BAC Sequence – LE_HBa0110L05

>C04HBa0110L05.1
AAGCTTAGCAAATGAACAGAGTGGAGGCAATTCACTCGTAATTTGTCCGTATCGGCACTTAGAATGACGTTTTAAGATTCTGTTAGTATATCAGTAATCC
TAGTAATTATACTTTAGATTAGTAGAAGTTACTAAAAAAATGAGGAAGCATTTTTCCCTCTTATTATGTATGTTCTCCTATTTGAATACATCTGCAAAAA
CTATTTAATCCCCATAACTTGAGGACATGAAACTAAAGAAGTATTGAAAAACACGTCCGAGAGAACATTTTGCTTTCACAGACATAAACTGCATAACTGG
TGTCAATAATGTATTTCTAACTGTGGAATAGGGCAATAATTTCTTGTTAACTTGACTAAGTAACAACAATGTATGTATTAGAGGTCGTCCTTTATATAAT
AGTTCTAGACTACGTACAGTATGGGAAGTATTCAAACCTCTATACTACTAACATAATTTAATCTATAAGATTTTTCTGATTTAAGTACGGCAAATCTAGA
TATGTATGCTTATAAATACAATTTTCTTTATATTCCAACGCTAATTTAACACATAACTACAACAGATTAGGAATATCCATACTGGCTAACACCATGGTTA
TAAATTTTTTTGTATTTGATCCTCAAATATATTTTGTAAGAATATCAAGTAACTAGTCACTAAAATTAAGCAAAACTAGTCAAAACACATATTTTTATTG
ATAACCGTTCCTGAAGGCTAATGATGCACAGTTCAAAACTCGGTGGATAGTGGGCTTACCCCTCTACCCTAGTCACAATACATTTGGATTCCATCTTTTA
TCTTATAAAAAGACAAATCCTTTTAGTATATTGATTCTTGGTAACATGAGTTTTTAAGCTACATGCAGCATCACTTGATTTTCAAATCAGTTGCATTTTT
CAATTTCTTCAACATATCAACTCTAATCGAACTAGCTTTAACCATATAAGCCACATATGACTAAATTACATGGTTCGATACTGTCTTCTGCGTTTAATCT
GGTCACCACATCTTATTATTCTAGTGTTTCAAAATATTATATTACCCGTTAAAATGCAATGCTTTGAGGCAGACGGTCTGGTGGAAGGAGATCATATCCA
GTTTCAATGAAATAATCCATAACCTGTGTGGGATGCAACTGAAACGTCTGATCATATCACTGTTAGATAATTGAACAACATATTAAACATCGATATTGAC
CTTGAACCTTTTAGAGTCTCCTTTTTAAAATCAGCCTTAACATTTAGTTTCGAATTAACTATCAAAATATACATCCTATTTATTAGTGATGATTTTTAGC
ATCTTTTAGCGTCTAGTAATACTCCCTAGAAGCTATATCTATTAAACTAGTTAAGGTCAATGTATTAATCCGCCTACTCAATTCTAGTTGGGCTCCTTCC
ATTTGACTAATTAATTTGTTTTTTCAGGACAAATTAGGAGTTTTGGGTTTCTCTAAATGTTACACCTAGCCTACACTGTCATTTAACCTCTAACCAAATT
TATCACACAGTTAAGATTAATGTATCAGTCCTCCTTCGCAATTCTATTTGGGCCACTTCCATTTGACTAAATAATTTAATTTTCAGGACAAATTTGGAGT
TCTCCAAAACTTAGGTTTCTCTAAATGTTACACCTAGGCTACACTGTCATATAACCTCTAACCAAATATATCAAACACTGCACGTAATGTAAGTGTCCAT
ATGACTAAACCTTAATTCGTGTAACAAGTTGGTATCACTTACACAAGTGCTTTGCTTCCATTAGGGTAGAAGGTAGGAGGTAGTAGAGCATTGGTTGGTT
TCCCTTACCAGTATTTTTATTATTACTCCCATATTTTCTTATTCTTCAATTTTATTATCAGATGTTGTTTCCTTTGTTTCGGTCATCGTATTTTTTGTTG
TTGCTACTGTTCTCTTCTCCGTTATGCTAGCATGACTACTTTACAACTGTATTTCCTGATACTTGATTTTATTTTGTGTCTTTCGAGCCAATGTTCTATT
GTAAACCACCTCTCTACTTTCACAAAGGTAGGGGTAAGGCTGTGAATATACCACCCTCCCCATACCCCATTTGTGGATACTGGTATTACATTGGCATATG
TTTTTGTAATTGTTGGTAGATGTACATGGCACGAATTGTTTCAGGAATCAAGCTTTAGATTATGGTGAAAGCATATTATTCCTGTTATTGTTCATTTTTC
CTAGATGCATTCAAGGTGTGGTCTGGATGTCAATGAAGTTTAAAGCACCATTGAACACTGAAGAGTGCACTACAATTATCATCTCATATTTAGAATCCTT
TTCGAACCAAGTCATTGAAGAAATGCACTGTACATTTTTGCATAAAAATCGAAATTTTTCCTCATTTACATGCAATGCACATGCTTACCAACTTGCAACC
TTTAAGAGGCTTTTAATCATTGAAAAGAATTTACCAAGTTAGGGAGTATTGATTAAGCTCTTTCTAAAATCCACTGTTTCTAGCCAACTTATTGAAGAAA
TACCTTGGAAGTGTTTTTGCATAAAAAATGACAATTTTTTCCTCATTTATTCCCATATGCATTCTTACAAAAATTACTTATCTTCTGCTTATTGACAATT
GTGGTCACTCTGTAGGGATTTCCTGAGTCTATTTTTTCTATTGGACTATTGCCTACTTTTTCTTGAGCTGCTGGGTCATATTATTTTTGTTCTCTGGGCA
GGCTATTTTGTCATATTGGAAGATGAAATTGATGGTGGTGGTAATTCTCCACATTGGCCCTGGCAGGACTTGATTTTTCTGTTGTGGCCGTTTTGAGTAT
TGCTCAATCTGAATGCTGAAGAATTCGCGGAGGTATACTGTTGTATTCTATTTTTTTTAAAAATTTTATGATCAACCCGCATTTTGCATTATCTTTTTGT
AAATATAGCTCTTCCACGCTCTGGGTATTGATCCTAGTGTTCAAGATGGCTTTCTGTGTTCATCATTTATTTACGTAGTTACTCAAATTTAGCCACTGAA
CAATTTTCTATGTGGTGTTTCTCTTCTTTCTTGATAAAGCATATCTCAAATATCACTACAAACTGTACAAGTAGTGTTCAGTATATAAAGCACATATTCT
TTGTGCATTTAATCTTATCTCTGAGTATAGTTTTACTCTGTAAATAGTACTCTTTTTCAGCTGCAAAGGCATTTATCACATCCTTATCGCAGAAGGTTGT
ATATAGTACTTTGTAATTGTGCTCTGTTAGATAAGGCTATAATCATATCATCATTGCTGCCAGCCATTTATAGATTGTTAGCTTTGACATGCAATAAAAA
CTATAATCAACACAGTATAGTAACAATGAATGTCTCAAGCATACGTAATGGCACCCTAAACTTGTGATTCCGTGGACTGACATCACCCACAGGGAAATAG
AACCAATTTGTGATATATAAAATAACCTGGCTTTTAGATGCCCGTTATCTATGAAGATGGAGGATACATACATGAAAACCAATCTGGATCATTATCAGGG
CCATCTTTTTCTGTAGCTCAAAACCAAATCTCTTGCACCAACTTTATTTCCTATGTACGTCAAAAGTGGTGTAGTTGAACTCAAAATCATTAACTCGTAA
GATTACAGAGAAAACTATCTCAGCACCCAGTCGCATGCTCAAAGATTTTCAGGATGTACAGAATGTTCCCTGCACGAGCAATGACTGAATAGGCAATTTG
ACAGCATACATATAAAACCTCGGGTCCAACTTATGTGCAATTAGTTCCTTAATGAAACTTTTTCATTTGAGCTGCCGATAGCATGGTGCAAAAAGATTAT
CCACTAACTCTGATGAGAACGAGTTTCGTGTCAGATGTTTCATCTTATTCTGCTGTAAACACAGCAGGACACAAGTTTGCATATCTTTAATGTCTGATAG
TCTATTTGCGATCTTTTGTCAACCATTCATGGTCATAGAGTCTGTGCCCATAGCTAATAATGCTGAAAAGAAGAAGTTGCAGCTAGGGATCCTTATTAGT
CATCAGGCTTTATTTTTTTACCAAAAATATCATGTTTTCGCAAGTTTACTTGCTTTGGTGATATATCCAGGTGCCCTGGAATCTCATGCAAGTTTGCACA
TGACGTTGGTGAATTCATTTTATAAAATTGTGGTTGGAGGCTAATAGTTCCGGCAGATTGAGCCCTTGATTAAGACATAATTAATCTTTCAATATGAAAT
TTGTGTGTATTGGAAGCTTGTCTGATAAGAAAAAGTTCCCTTTTCTAATATTCTCTCTTTCTTGTGTGCTTGGGAATAAATTCCTACTGTTGTTATTGCA
TTATCAGTATCTATAAAAGTTCTTCCCTCCAGTAATGCTTACATTTAATAAAGGTGATTGGTACGATTCATTCAAACAACATTGGAATTTTAGTCGTACA
ATAGCAAAATGCAATGCATTAGTAGACCTGAAGATATCTAGAATAACATCATTGTCTACTTAATGTGAAAGATTATGAAGTTTAATCACACATACATTGA
TATTTCCTTTTCGCATCGAAAGGAAGACCTGTCTGTAGATTGTGATTACAATGTGTGACTTTGGGGAATACTGGAAATGAGAAAAGATTAGCTACCATTC
TTTTTCTGTTTTTTTTTTTGGAGAAAAAGTGGAGAATTAGAATCAGTGAATTTGTTCTGTAGTGTACAGAGCTATCATTCTTGAGAAAAGGTTGCAACAT
ATTTAAGGTGTGACAACTCTTGGTGGAAGAGGACATGAACAATCGCTAAATAAAATTCTTTTGCTGTTCTAAAAGTCGACTTCGACGTACTAAACTTGGC
ATATATTACATGCTTAAAAGTTAATTTGGTGGGAAAATGTTGTAGAAGGAGAATAAAAACTTGGTGCAGATGAATTGGAAAAGCCGTACTTGTGAATCAG
ATCTAATTTTAGATTCTAACACTCTGTCAATTTTGGTTCATTACGATCTGATGGCATCAGCTCCATATGCATATTGCTGTAACTGTGGATCCCCACCTCC
CATCTGGGATATTGAGAAAAAATCACTTCCATATTATATTTTATTTTTAACCAGAACAGCGGTGGAAATACATTTTTTAAACAAGTCATGTTATTTTAGT
TACATTTTTTTGGTGGCTGTTTAAGTACTGAAGAGTGTATATTTTCTTTGAACTTTGGCTAGCCGTTCACTCACTCTCGATGTAGCAGAGCAAATAATGT
GCTTCAACGTAGACATGTTGATGGATAAGATCTAAATACTTTATTCAATTTATATTTACTGATGATAATATAAATGCTTGCATTATGAGTATTACGAGCA
AGGCTTTAAGCTGTTATATAACTCTCCTGCTTGTATCTGTCTTTGTGACGGGTAATGAAAGCAGGAGTTTAGCATGTAAGGGAAAAAACAGTGACCTGAC
ACAGTGATAATTTTTTTTTATTGTTTTGATTGAAAAATTAGTGTTGGATTCAAGTGGGGTGAGGAAGAAAGCTGCAGGTAACTCTGGGTGCTGGTTAAAG
TTGTTCTGTTTCTGTTTCTGTTTGTGTTGCTTTGCAGAAATTCAGAGAAAACGCACAAACAAGGCATTAAGGCCCCCCACTTGGAGACACATTGATCCCT
GTTGTGAAAATTGGATACAATAAAATTTTAAATGGCTGTAAATGCAGCACGTACTTTTTATTATTTTTATTTTTTCACAAGATTTTGTTTCAGTGTCCCC
TTTTTTTCCATCTGCCTCTTCTTCCTATGGCCATCTACTGCATACTGTTCTCTTCTGTCACACACCAATTAACCCTTCAGTGGTCCCTTCTTCTTTCTTT
TTTTCCCCTTCCCTTTCCAATTTTTTGCAATTTTGCATGATATGCTGTTTTCTTATATACGACCACCTTCCCACTCACCCAACAATTCCACAATTTTTAT
ATTTTTATTTTCTGTTTCTACCTCCCACAAACTGTGAGTATTCATTTCAGGATAACTTATTTAACTCCCAAGATCAAATATTATGTAAGAGAAAAGATCC
CCTCGATTTGACACTTTAAAAAAAAGTAAAAAATTAACCCCACCATTTTTGTTCCTATCCGAATTCCTTAAAAGAGAGGTTATTCCAATGGTAAGTACTT
TCTTGACTCCTATCTCAAGGTAAAAAAAAGAATTTAAACAAGTTTGTTGACACGGACATTCTCATTCTCAAGATGGTTTATATATCTTTCAAAATGCTGG
CAAAATTTAACCATTTCCTTAGGTTTAAACATGTACAATCTCATCTTTGATCGAGACAATTCGATGGATCTAATCCACTTGATAATTTCTATAGAAGTTG
TATCCTTTGAAGAAGAAAATAGGTTTGTTGTTGGCCACTCACATTACCAAAATTGAATGAAATAAAGTTCCCTTTTTAGGAGTAGTTATAAAAAGAAAAA
AAATACCCATACCAAATGGCCCACAAACAAAACCGACCATAACATTAGTGATTACATATCTAATATTAAAATTAAAAATCATATGATAAATGTCATATAA
GGAATCGTTCAGTTTTATTTATTTTTTTCTCTCTTCCCACTACTTGAAGAAAATGAAAATTCCGGCCACAACTTTTCCAGCTGCTTCTTCAAAAACAACA
CAACGTGTTGTCTTCACAAACGCATTATTATTATTATTATTATTTTTACAGTGGTGTTTGATATTATATTATAATGTGATATTATTATTATAAATAATGA
AGTGGAAAAAATAGTACATAAATTATATGTAAAGGCCAAAAAAAAGATGGGACCTTGAAAACAGAATTTTAGAAAAAACAGATGTGCACTCACAAAAAAG
TTGCAAGTAGCCAAAGACTTAAACGGTGTTTGAGGGGTTACAGACAACATAAGTCATGCTCGATACTCTGGTGCATCACATGGGCTGCGAGGGGAATGTA
ACATGCATGCAATTCTTTTGCCTTGCAACATGCCAACATTTCCTTAGCCACACTTCCCGATCTCGATCCATGATTTTAAGTTTATGAGTTCTTATAGCGA
CGTCAAGCTGAACTCACAATCAGATGAATTTGTTGGTACGAATACAATGAGTTCGTTCACGTGATCTAGACCCCCATGGCTCAAAGAAGAAAAGGGAAAA
CACTCCTTACCTTTGTTTGTGTATGAACATTTGTAGGCATCAAGAATAAGAAACTTATATGTGTATTGTCATATCAAAACAACTAGCTAAAAATTTGAAC
AAATATTTGTATTATATGGAAAATAAAATAGATAATCTTTTTATTCCCTTTTTGATGGGTGAGAACGAAAAAAGTTCTTTTTGTGTGTGTGTGTGGGGAG
GGGGTAGGAAATTCTTTTAAAGGGTTGCGGTTGGATAGGTGGTTAATTAATTGATTGAAACCTAACAAAAGGGATGTAATAAAAACTTATCCAAGACTTG
ATAAATTATAATAATGTGTTGAATTAACTATAGGGTATTATCCTTCAACATTTTAATATATTAATTGCCAATAGGGCATCGACACTTTGAACAAAACTTA
TAAATTAAACCATGCAGGTTTCATTAAGTGCAACCGTTTGGACGGTAAAACACTAATATGCTCCCATTAAAAAATTTATTCTATAATGCATCTTTTATTC
ATGGACCAACATCACCCTCTTTCTTAGGAATATTTATTATTATTATTATTATTATTACTATTTACTTTCTACTATTGCTTATATTACTAAGACAAGATGG
AAAAAGCTCCAATTCATAGCCTTTTGAAATGGACAAGGCCCTACCTTTTCATTAGGTAGAATCCACACGTCCATTCCAACTCATTTAAGTAAGAAAAAGA
ATCAAAGATAGAATTTTATTTTTATTGTAAGAAAAGAAAGTAGAATGACAAGATAGATAGACCCGGCTCCCACTGAACGCCAAAATCAGAATTTAAAGTT
TATAATACCCTTGTGAATTTATCACGAAATTCATTATTACAAATTTCATAATCATATATTTTTACATACTTCATTGCTTTTCTCATACAAATATATGATT
TATGAAAAAAAAAATACATGAAATTCATTTAAATTCGTACTTAATATTATAGCTCTGCTCAGCCCGTTCCACCCCACCCCCACCCCCACCCTAATCTCTC
TTCTCATCAAGAGCCGCATTTTATTGGCAAAAATGAGCATCATCATATAGCGACACGTCTATGTAGGGTCAAATTCTTGCATGTATATATATACTACACA
TCTTGGTTGCACCCTTACTTGCATTCAAAGCTCTAAAACAACAAAAACATATATACCTCATTAAAAGCCCCTCAAACAAAGGTTTCTCTCTCTAAAAAAA
AAATTATTTATTTATTTCTTTCTTTTTTTCTCCTTGTGTTGCCCACAAAACCATAATATTTATTATCTCTACTAGTCTACTATTTGCATCTTCAAGCTTA
CCAAAGCAAGAAAGAACTAGGATAGAAATATAGATAGAGAAAACTATGTGCAACCCTAAGCCTTCTTCTCCATCCTCCTTTGTCTCCAATGAAAAAGTCC
ATTTTGTGAACTCAAACAAACCAATTGATGTTCAAGTTGATGATGAAGAACAACTTCATAAATGGCCAACCCCATCTGAGGTAAATATATACACATAAAA
AAAAAATAAAAACAAAAAATCTTTTCCCCCTATACCCCAACTAAGCTACATTAGCACAAGGGTTCAGTTCGTTGAAAAATTACACCGTATATATATAAAT
TCAACAAACACAACTTTTCTTTTAACCCCTGCGACTCTAAAGAACCTTTTTGTTTAGTGGTAAAGCAAAATTAAGTACTTCTTAACTCACAATATTCTAC
TCTTATTTTTTGATTTCTTTTGCGAAAAATCTTTTCTTCCACCTCAACCAACCACCATACATATATAATATATATATATATATTATGCATGTAAAGTTTT
TTTCTTTTTTTTTTAATGTTACAGTCTCACATTGGTTAGAAAATAGACCGCGTGTTATATCTTCGCGCTTTCTTGTAACAATATAACTTATAACTTTTTT
TTGTTTGTTTAAAAATTTCAGGCTTTTGAAGAAATGAAAGAAATAGGTAAGATTGCCGGACCAACAGCAATAACAGGGCTGGTTCTTTATTCAAGATCGA
TGATCTCGATGCTATTTCTTGGATATTTAGGTGAACTTGAGCTAGCTGGAGGATCTCTTTCAATTGGTTTTGCTAATATAACTGGTTACTCTGTAATCTC
TGGTTTAGCTATGGGAATGGAACCAATTTGTGGACAAGCTTATGGTGCTAAACAAATGAAACTTCTTGGAATTACCCTTCAAAGAACAGTACTTCTTTTA
CTTTCAACTTCAATCCCTATCTCTTTCATGTGGCTAAACATGAAAACAATACTTTTATGGTGTGGTCAAGATGAAGATATTTCAAATATGGCCCATACTT
TCATTCTCTTTGCGATTCCTGATCTCTTTTTCCTATCTTTGCTCCATCCTCTTCGGATTTATCTTAGGACACAAAATATTACGTTGCCATTAACTTATTG
TTCTGCTATTTCTGTACTCCTACATGTCCCACTCAACTTCCTCCTCGTGCGATACTGCGATTTGGGTATTGCTGGTGTTGCTCTAGCCATGGTCTTAACT
AATTTGAACTTTTTTCTCTTGCTCTGCTCTTTTGTTTACTTTTCCGGTGTATATAAGGATTCATGGGTTGCCCCGAGCATGGATTGTGTTCGGGGATGGT
CCTCATTGCTGGCGTTGGCCATTCCAACGTGCGTTTCTGTTTGTCTAGAGTGGTGGTGGTATGAATTTATGATACTGTTATGTGGACTATTGCCTAATCC
TAAAGCTACAATTGCTTCTATGGGGATATTAATCCAAACTACTTCTTTAGTCTACGTCTTCCCATCTTCCCTAAGCCTTGGTGTTTCAACTCGAGTTGGA
AATGAGCTGGGTGCTAACCGGCCTGGTAGGGCCCGGGTATCGATGATCGTTTCCCTTGTTTGTGCAATGGCATTGGGACTAGGGGCAATGTTGTTTGCAA
CATTGATGAGGCATAAATGGGGTGGTCTTTTCACAAAGGATGTTGAGATACTTAAATTGACTTCAATTGCATTGCCAATTGTAGGGCTTTGTGAATTGGG
AAATTGTCCACAAACAACAGGTTGTGGTGTGTTGAGAGGAAGTGCAAGGCCTACAATTGGTGCGAATATTAATTTGGGCTCATTTTATTTAGTTGGAATG
CCAGTAGCTATACTTGTTGGATTTATATTGAAAAAGGGGTTTGGTGGATTATGGATTGGGTTACTTGCAGCACAGGCATCATGTGCAATACTAATGCTTT
ATGTATTGTGCAAAACTGATTGGAAAGTTCAAGTGGAAAGATCAAAACAGTTAACACAACCAACTTCCTTGCCAGTCACAATGCCTAATTTGGACAAGAA
AAAGATCAAGAAAAAAAACAATAATAATATTATTAGTAATAATCTTGAAGAGATTTTGTGCAATAAAGAGGAAGATGATTTGATGAAATCAGAAGATGCT
TCACTTGATACAGACCCTCTTATATCTTCAACTACTTAATTAATTCAGAGATTATTGTGCATTGATTGGATTAACTCTCTCCATTTCTATTTTTACTTTT
TTTTTTTTTGGGTCCCTCTTAATACCCTTGGATGGGTTGATGTGAAAAATTGTTCATTGGGATTTTATAGACTAATCATGTTAACATTTGATGATCAAAA
GAGTGTATTTGATGATCATGAGGATATATATATATATATATAAAACTACTAGCTAGCTTTGTTATATGTTTTTTCTTTTAATTTCCATCATGTATCTTGT
AATAATAATAATATTAATATGGAATAGAACATGTATCATCTTCTTATAGTTTATTTCTTACTGGTTGTTACTTCATACTTTAATTCTCATAAAAAACTAA
TCCTACTCGAGAATCCCTTTAAAGTTTGTGCATATAGTATTTTAGTTTCAACCTTGAAATTAACTCTCCACCTCGGAATTGCTATTCTTCAGATTTGTAT
TAAATAAATTCATTAGTGTAATAACTTATAAATCATATAAAAACGTAAACCACACTAAGTACGTCGGATGAGACAAACTCGACTGAGATGGCGTTGGCAG
GTGAAAGCGATCCCTAGCCTCCCTTATGGGATATCAGATTGTTGCACCGACTCAATCATTTACCCGTAATAACATGTTGGTTATCATTTTTTACCCTATT
ATCAAATGATACAAATGAGTCATGAATGAATTCACATTATAATGCCATCGAGTTATCTTTACCTATTAAAACAGATAACATACTTATTTTTTTAAGATTT
TAAATCATATATTTCAAAAAATAATTACATATACATATCATTTATATGACATGATAGTATAAATATAACATGATTATATAAATATTTTTGACGGTCGATA
AGCACTATTATATTGGTATTGAAAGAGGGGAAAAGTGTTGTCGGTTGTTTGAAGAAGTGGGAGCAAGAGAAATATATGTAGAATACACCTAGCTAACAAG
CTTTCTAATTGTTCCCTTATACCATATAAGGCCACACATTCATCAATACCTAATATGGAAAAGTTTTAATTAAGCATATCTCCATACATACACTATATAT
TATATTATATTATATTAATTAGTACTACTATACATTACTTAAACATCAAACTTCAACTCAACGCTAACAAAATACTATTATTTACACACTTTTCTTTTTC
TTTACATATCTAATAACAAGTATATATCTTTTCATTAATTTTGATGATGGAGGGGTTTCTTCATTTTCTTATAATTAAATTGCTTTACAACACATCCTTA
CTTCAAAAGTCACCTTTCTTATATGTTTATTTATATTCTCTACTTTAATTTTTTTTTCTTTTTTTGTTTTTGATTTAATGTTTAGCTAGAACACAACCAG
TACTACTTTCCAAAATTGGTATTATGAGATTATTTTTATTGACTTTTCTGATACCATCTCAATATCCTTTTTTGACTTTTCTGCCTAGCTTGCGTTTTTG
AAAATGGATCGAATCTTTTAAAAAGCTTTTGTGATTATTCTAAAGCTTTTTCGAAAAGTATATCAACAATAATAATATTTTTAGTACTACTCCTAGTAAA
CAATTTTAAACCATCTTGATTAATAAGTAATAAACTAATTAGTTAACCATCTAGCTTTGTACTTAGTTATAATTAGAATAATAAACCTCATGTCACAAAG
CAAATAATACACCTAAGAGATTTTCATTTTTTTTTTTACATGAGACGTAACTAATATAAGGAGAGAAAAAGAGAGTAGTGCATGTATGTATATATCCAAA
AACAAATTTATTTTGTTTATTCGTTTTTTTTAGTGTTCAGTATTCTTATTATGTAAGATCTATAATAGGATTTTTTTCATGCATACTCAATACCTAAATT
TGAATGATCTTATCTATCATATCACGATGTTCGATTATATCCAAACAAGTTAAGCATATAAAAGAGTGATAATATTGTGCAGTAGAGTGAGGGGGGGGGG
GGGGGGGGGCCCTGTTTGTAACTGAAGAAACAAAATCCAGCTATTATTGCCTGTGTCTACTTGTGGGATGACAAAATTTTGTGCAGTGCCTCTGCATAGC
AGTTTCCAGCCTCTTCTTCCCCACCATCTCAGTCTCCATTAATTTGTTTGTTTCTTTGCAAATGCACCACCACCAACAAACCACACTAAAAATGGATATT
TTCTTCAATCAAAAATTATAACACTTTACTATATAACTAATTACATATTTTACACAATCCTATAGATCATGGTCATGCACATGCACATGATTTAAAACAA
GTTTTGTGGGTCTAACCAAACTCATTATTGATTTATGATTACTGAGTCACGATTTTTCACTAAAGTATAACAAAAATCAAAGATATAGAAAGGTTTGAGA
CCTTAGTAAATTTGAATGAGAATTATAATATATTACAATTTGCAAATTATAATATGTAGTGGCCGGTGTTTGGAGGAATATAGCTATCATAGGACTATTA
TTTATCCTCTTAGTATAAATGTGGAAAATAATTATGAAAATATCGAAGATTTATTTATTTATTAGTCCCACAAAATTGTATGTAGGTAGTGGGAAGATTT
GCTGGCATTTGTGGTACACAGAGGAAGGACTTTGATTTGCATCATATAATATATCACAACTCACACGCCTAAAATAGGTCAATTTTCGAGCGCAGTACCA
TTCTTGTCCTCTTTGCATCATCTCTTATCTCTTATTTCGAAAAATGCGTCACACTTCTCTTCTCTTCTCTTTCTCTCTTATATTATGATTCAAATCAATT
TTAATTTAAAAGTATATTTGGTATGAATTTGAAAAAATAAAGTGATCTTTTAAATTTATTTCTTTGCATTTGGTAAGTACGTGGATAGAAAACATTATGG
TTGAGTTACTTTTTTTAAACTAGGCTGAGACGGTGAGTCAGGATGTTAGTGAAAAGGCACATCGATCGATGTTAGGGTGGGGAGTTTGGAGCGTAGGGAG
AAGATAATCAATGCGCAGTGTGCTTGTCCAATAGTTAAAGGACATTTTAAATTCGATTTTTTTTGTTAAAGAACAACTTAATTAGAAGTCCTTTTTTTCA
TTATATCAAGATGATCAATAGTATTTTCTTCGGCCTGACTCAAACTCTCAATCTTCTTATTGATAGTGATGATGTTCAACTACTTGAGCAAGCTACACTT
GTTACAACTTAGGTCCAATATGTGTAACAAGAGCAAATTTTAAATCATTTGCAATAATTAAGGAGCATTTCTCTTTTACCCTTTTTCTACATTTACTAAT
TTTATGATTTTACACTTGGAGCTAGAAGGAAAAATGAAATTCTTTTAATCTTACTTTTCACCTAGTGTTTGATATTCAACTAATTCTAATTTATATTAGA
TATAGCCCTATTTAAAGATAACGTTTCCGAAACATAGATTTTTTTAAAAAAATTTAAAGAGAAGGATATATATATATAGTAGAGTAGAAACAATAATGTC
AGACCGTACGTGACAACTATTGGAGTGAGAGTATAAATTGGAAATAATGTGGTACTACTAAACTTTACTCCTATTTACAATCCTCCAATTTCCCTTTTGG
ATAACATATATAATATATGCTTTTTTTTATTCTATTCTCTATTGGCTAAATGACAAATTCCTTCCCTTTTCCCATTTACTATATGCCCTGCCCTGTACCA
TTCTTGTACTCGAAATCTCCCCTAAACTTGAGTTTTAATCATCATAACCCTATTCTTCTATTCCAACAACAATGTCCAAATGTAAGAACAAACAACAATA
ATGGAGTAGTTTTAATAAGTGACAAAGTCCAGATTTTTATAAGTGGTGTTGATGTGTAATAGTAGTAATTATTAATCAAAATCTTTAGTTTAGTCGTAAA
ATAAATATATTCATATCGGTTGATTTTGACAACATTGTTATAAGGATGATGTAAAGATTCATTTTAAGGATTGCTCTGCTAGATTTAAGGATATATGACA
ATAGTTATTACTGTTGTAATAAGTGAGCTATTGGTAAGATTGTATAACTGTTGCTACATAAGCGTTGTGATAAGTCAAATTTCTAGTAATGAATTAAGTC
AATAATGTTTATGAAAGATGGACGAAATCGATAGAAAAACATAGAGAGAATGCCAAAAAACACAAATAAGGAGAGCTTACAAATAGGAGTGATTTGTCAA
GATTCCTAAGTAAATATGTGGTTGTTGATGGGATTTGGGATTTTTTTAATTAAGATTTATTTCATAATAAATTATGATAATTCGTCAAAATTTCTGATCA
AATTCAGACAAATTATCAAAATCCATTCAATATTTATAACGGATAATATTAAGAATATCATTTTCTCTTCTTTAAAACATTTTTCCAAGCTCAACAAAAC
CTAATAATAATATTTTCAATTTTCTACTATCAAATCAAATCAAATTTTATTAAAGATCGACGACATAAGCTCAACGCAATATTACCCATTCAATTCCAAC
CACACGTAAGTAATTAAATCTTTGACTTTTATACCACACATTTCAACATAATATAAGTGTCCCTATTTTTATTTATTTGAGTGTTCACATCAAGCTTTTG
TTTATCATTTAGAAAAACGCCGTAATAATTTTAGTCAAAGTTCAATTTTTATTTTTTTGCTCAATGAATAGGTAGCTATTTATAAAAATTAAAGTACAAG
TTGAACTACGTGGATGTGTCAATATAACAGAAAGGGATGGCTTATATATTAAAAATGGTAGGCCTATATATATTACATATGTATACATCTTTGTCATTAT
ATTCTTAAAACTCAATCACTCTATCCCATTTTATATATCTCATTTTTATTATTTGAACAATCAAACAAAAATTTTATTATTATTATTTCAGATATTTTTG
TAATACTTTAATTATCCATAGTTCAAAAAGAGTGTGTAAATTGTCTCAAGTGTATGTATGGGTTCTTCAAGTTGGTCACTTTTGGTGGACCTACATAACT
AGTTGTATATCTCTTTCCAGAAGCAATATTGGGTGTTTAATTAGGCATTTATTCATTTTTTTTTTACTCAAAATGATTCTTTTGTAGGAATTAAATAAGA
ATTCATCCATAAGGAATTTTAATAACAATTATTTTAATTTCTCTTGTAGATTTACCCATATAATGTATGATTGGAAAGAACATGATATGTCACATGACTC
TTTTTGTATCACATATTCATATTAGGGTTTTAACGGTGATATAAAAAGTTGCTTTCATATAACGTAATGCTTTTAATTTGAATTATTCATCGGATCGAAC
CAGGTCTCAAATGCTAATTTATTTATTTATATAAGGAAAATAATCAAAAATGTCTTTAAATTATTTAAAATTAATTTAGTTTATTCCGTTTTATTTTTTA
TAAAAAATATCCTCCAACCAACTAAGTAGTTCAAAAGTATCATTCGTACTAATTGTTACTCCATTACAAGGAAAAGGGTAAACTGAGCCTATTTCGAATA
GTTTAAGGTTAATTTTGGACCATTTTCCCTTGTTTATAATATCTTTATGTAATTCAGAATTATGTGAATTTTATTTGTCTACAAAAGTTAAAGAAATTAA
TATCTAAATTCACATGGAATACTATAATTATTTGTATTTCATTTTTTTTTTGTGGGGATAATGAAAATTACACTACCTCAAAAATATAATTAGCGATAAT
TAATTCTTAATTGCCGTTAAATATGTATCTTTAGCGGCAATTAACACTCTATGTATATGTCCCTAAAGCCTTTAGAGATATTGATTGTAATAGCCTTTAA
CTAATACTGGTAAACTTTAACCTTCTTTATTAATGTCAATATATATGCCGCTAAAAGTTATACTCCCCCCTGCGTATCAAATCCCTCATGAGCTGCATAT
AAAGAATGTGGCTTACAGAAAGAAAATTCTCCTTGTTATGGAATATATCTACCATGCACCCCTTTTTCTCCCCTTTTTTTTTTAAAAGAAAATTGTGCGG
TCGATACTCGCTTGGGATCTAAATTACATAGCACGTAAAAGTTAATCGAAAAGAGAAACACTTTCTATATCAGTTTTATTTTTACGATTCAAATTTAAAA
TAAGTAATAAAAAGATGGAAAGAATCTTATTTATTCTAGTGCAACACGCATTGATATTGTCTAGCACTTCATTCTAATTTCTAAACTATGGAATATCGAT
ATATAATTTGGTGCGATATGATATTCCCAAGAATTTCGATTCTTCTTACTCCTCTCTAGTGCTTGTCACAATTGTTGGAAATGCTTCCCTCATCTGTTAA
ATATATATTTTTTATTTTTCTCAAAGTTAGTAACGTGCTACATAAATTAAAAAGAAAAATTAAGATTCAAGACTTAATTAATTAAAGGGGAAAATTCTAT
AAAAGAACTAAAGTTTAAAGTAGAATTACCATTAATACTTATAGTTTTAGTATTTTCGTATTCCTTACAATGCATTCGTTCGAAAATTTGAACACTAAGT
AATTGTATACGTTCACTTAATTTTATTGTATCGAAACATCTAAACACGATAAATATATCATGCACTCACTCAAATTTAATGCATCAATAAATACAGTAAT
TATAGATTGTAATTTTGCCATTAATTAATTGTTTGTACTTTGTAGGCAGACCAATTGGGGAGTAAGTGGTAGGGTAATGCAACTATGGAACTTAGCAAAA
AGGTGGAAACATACACTGAAATTTTTGGGGAATCATACAATTATATATTTTTCAGATCCCTTCATTGGCATACCCTAAACTGCAATCAGCATTTGTGCTT
ATTTCCCATGTTATGTGCCTTTTTTTTTTTTTAAATTTAAAAATAAAACAAAATTTCTTCTTTGGAGAACCCCTTTTACTATTTTCATCTCTAATTTTAT
TCCTCTAGAAGATCTTATAAAATATATTTTTTTGTCATAATACTTTAGCTCTAAAGGTTTAAAGTTTGATGTATTTAAAACAAGCTTTATGTGACTATGA
ATAAAATTTTAAATTTTAAAATCTGATACATTTGATTGAACAAATTTTAAAAGTATTCTTTTTATTCACTTTTATTTGTCATTTGCTTTTTCTATAAAAT
AATAAAAAATTGTCTTTTCTTGATACGTTAAAGTTAATGAGTAAAACTGAAAACTTTTTTAGGATGGTGCAAAACATCACATGAGTTCGTTTACATTGTC
TATTCGAAGATTCAATTCAGAAACAACCTCTCTATTATATAAAAATAGGAATAAAGCCGTTGTGAACATTTTTCCCTCACTTGTAACTCTTTTATAGAAT
TACACGAATTCATAATTATTATTGAACAAATAAAAAAATGAATCGAGTGAATAAATAATATCATATAAATTTGAGAGGATAGTAATTTACCTAATCTTGT
ATACTGCCCTTTTTTGGATGTGTAAAAAGGTTAGGTTGATTAAATTAATGGTGTTTTAAGTGAATGTCTTTTCAAATGAAAATCCCACTAGATGAGATAA
ATAGCAAATAGTTTTATCCTTGCCCTAACCAAACACAAGATAAGGACAAAAAGTTTTAGCAATATTTCCAAGTGTGATTAAATAGTAGTAGCATTATGAT
TGTAAATGATTTACTACTACTCTTTTAACAAGTGTTAAAATTTACACAAAACAAAGACAACTTGTCTACAAACTGTTTGACTCCACCATTGCCGAAAGGC
ATCCTCTCATTCACACTAAAGCCTACAAAAAACACCATAAAAAGTAATATTTGTTTTAGTTTATATTTTTTCTTTGATCATAGTATTCAGATCAACTTAT
GCACGTCTCACGTGTGTGATTTCACACTATCATATGTATTGTATCGTTTTATTCACCAATTCTCATATATAAATGTTGTGCGGAATTTGAGATAATACGA
GAAAATATAAACGCGAAAAACAAAACAACAGATTTACGTGGTTCACCAATAAATTGGCTACGTCCATGGGAAGAGAGGGAGCAGTTTTATTATGGAGAGG
CAAAAACAGAATTACAGAATAGGGTTTGCCATAGCGTCTATATATATATAAAGTGCTAAGCTACGCCCTAACAGGCTTGGGCCCAACATACAGAATTGAC
AGAAAATTAAGGGCCCAATACAACAACATTGTATACCGTCGGGCCGGGGGCGTCTCCGGCCCCCCCCCCCCGGACCCCAGGCCAGGGGAGCGAGACCCCC
GTCCTTTCTGTTTGTAGCGGGTCCGATTCAAGGCATTCAACAATAAAATTTCACACTAACACATGTATTGTATAATTGTACGAAGAAAAGACGTAGTGTT
TTTTGCTTTCGCAAACGAAAAAGAAGTATAATTTGATCCACATTAATATATATATACTAGGCTAGCATGTGGCAAATTCCAAGAACACCTATCCCCTACA
TGACCAATAGTCTATAATGTTCGAAGAGAAGAATTATTGATTTAAAAAAGTACTATTACTATTGCATTGCACGGCTTAAATGCTTTTGCCGTATACATCT
CCAGAGTTTGCTGATATGTTTTTTTTTAAAATATGGAGGTTCATGAATCTTATTGTTTTACTATAGACTTATAGACAAACATTAAAAGTTGCATAATTGA
CAAAGTTATAACTTTTCCATATTATAATCGACTTTTCAAACCCAAAATAATTTAAAATATGTTTTCTTGTTCTTTGACAGAGTGTACCAAGGAGCGGAGC
CAGTCAGGGTCAAGATGTTCATTCTTTAAATGAAAAATTACATTATTTATCCATGACAAAAATTATTTTTCATATTATATTTTAATCGACTATGACTGAA
AATTCTGAATCTGTTACACGTAGATGAACGGACGGCAGAAAATGAGAGTTGGTCATGTCACGCTACTATTTTTGAGGATAATACAAGAGATAATAGTAAC
AAGAGTATACGGCTTTTACCATACCACGAAAAGAAAGATTGAAGGGAAAAAAACATGCGTGCTGACCAAATAGAGTGTGAAAAATGGCTATGACAAATTG
ACAAAGAAAGAAATAAGTAGGATTCTCATATTCAAATTTGGATCAGTTATTGTTGGGCCATTCAAAGATGCCAATCGTGTGGCATTCAGCTTTTTCTTTT
GTGTGTACCAAAGGACGACTGAACCACTGCCGTATTAGCTTTCCAAAGATAAAATGTTTCAAAAATTATACCAGTACGATCAAATCTTTCTATAACAGTC
ATTTTACTATGACGACGGTTATATAAGTATGTTGTAGTAACCAAAAGATATTCGTATAAACAGCATTGTTATTGTATTTTAATCTATTGTTGCATGTGAT
CGATCGCTTTTTTTAATCTTCCAAAATACTAACTCCGTTCAAGTTAATCTTCCACTTTATAATTGATCTTTATCGGATTGATTTGATAGTTTTGTTGCGT
TTATAACTCTTTCTCAATCAAGTTTGGACGGAATAGCATGATAAGTAAGTTTTTCTAGTCATTAGTATCTTTGCTTGCGGTAATTGTGACATCTCAGGAA
AATCGATGATTGTATCAATGATTTTATGCTAATATAGCTAAGACTTCTTAATTGACTCGTTATAAATAGTCTCAAGGGTATGGAACAAAGATATTTTTTT
AAAAATTTTTACCATGTTGTAAAGAATATGAGAAATCAAACACTTGTTTCTATTATATTATATATCAAAATAAAATAAAATTCATCATGTGGTGCAATTG
TGGGTAGTGGACCATTCTAAACTAGCACATGCAGACGACGACGACAACCACGATACCGTCTCTCACTTATTATTATTATTTTTTTTTATTATAAGTGTCA
CCTAGTGTGGACTTTTGGGGCACCACTAAAGGAGTATTTGTTGTTATTTGTAAGACACAACAATTGTTGCTTTTAGAGCTCTTAGCAATAATATAGTTTG
ACAAAACTTAGGGTAAAACTTGTCTCCTTTAGAAAACTCACATTCTTTATCAAAGAAGTCTACCTCCAATTGGGAACCTCTAAATTATTAAATCACAAGA
TAAGAAAACAAAATAATAATAATAATAATAATATCATAAACATATCTCTTTAGTATTGGTCCCACATTGTGTTCTCTCACTCACCCAAACATGTATGTTT
CATTGTGGCTTCATTCCAAATCAATGATAAACTTAACAAAGACTATTAAAGATGAACCAAATACCTTTTAGGCCACTACAAGCTGAGATAGAAAGGAACA
AAAGATTAGTTTATTGGGAAAAAAAAGGACGAGATAACAAGGCTAATTGCAAACACGTGTAGGATTAAGCTTAAGAAGATGTGGTTTATTAATCTCACAA
GTACTTTAATTGCACGTAGCTTTGCTTGAAAAAGAAAAAGAAGCAATTGTGAAGCTTAGTGCGTTTGACATTTCTATGTTATTGAAAGCTAAGAATTTTG
ACTCATTTTTCCTCTTTAGTTTTAGACTAAAAAGGATTGGTCGGTTTTCAGCTGGGGCTTTAATGATAATGCCTTATAGACTATAGTATAAAATTAGAAA
GATAACAAATTAGAGGTGGAGAAAGACAAAGCAGAAAGGGGCAAAAAAGGAGTCCAACAACACATGAGTACAAGGTAAAAAGAGAAAAGATACTAAACTT
GTATACAAACCAGAGTCTTTAATGATTTAGTGGGTTTTATAGAGGTCTAACATCTAGAATTTTAAAGTTGCAAATTGGACAGGAAAAAATGATGATGAAT
TGATAACTAGATATGAGTCATAATACTTGTTAGTAGTTGTTCTCATGAGATATTACTACATCTGAAAAGTTCACATTGATGTATCTAAGCACTAAGCATA
ATAGTCAAGTCTTACCATTTAAGATATCCCTGTCTTTGTTCAAAACACGCAGCATAATTAGCTAGACAGCTTAGGATAAAAGAAGATAAGTGTTTCTGCT
TAACGACGTGCAGTACCTGCAACTAAGTTGGAGAGTTGTTGACTATGAGATCAATCATCATCCATGACATAATCCTTAAATTACTAAGCAGTAAATATTA
GCTGGTAGGGGACGTGCCATTTGTTAGGAGCATCGGGCACATTCTGCAATTATGGAGCATTTCATACGGTAAAAACTCTAGAGAGGAAGTTGAATAAATT
ATTGGAGCTAATTCTAGGTGAGCCAAAGCATCGCGTCACTTCAGTATTGAAAAGACTTTTGTCCCGACTTACTTGATCAACTAAAGTAAAAGACTTGTGT
CCTGAATCCAAGACTTTTCACCTTCCACATGCCTAGCTATAATTTCACAAATGAGGCTATAGATTTTTCAGCAAAGACAGGTATACAGACAAATTATTGG
AAGCGCAAATGTAGAAGTAAAAAGTTTCATAATGATCATGCTTACTGGAAATGATATATGCTACTCTGGAATCCATTGGATAAGCCAGCAGCAGAGTCAA
AGTTAAACAGATGAATTGACCTTGGTCTCTTTGGTGGCAGAATATTCAATCCATATAAGTCCCCTGCAACAAAAATTGGTGGTTGGTTACTCATGATTTC
GTTGAAATGTGTTATTTCCTAGGCAAATAAATTGGGATGGTACCTTTATGTTTGTCCATAAAACAAACTAGTCATGAAGATTGTCAGGGCAAATGTACAA
AAAAGTCGTAGCGTGAAACAAGTGTAGGGAAAAATCAACTTTTCTTCACCTAAATGAATTATTGACGACCTTATCGACCCCCCAAAAAAGACCACTCAAT
GTTAATGGATAGCTGATTCCACTACTCTTGAAGACACCATATCATGTCAGGCCACTTTGAAATACAGGAGCACAACCTTGGCAAACTATAACAGGAAAAA
ATGCAGTACAACAATGACTTTCGAGAGAAATTGCTGCATCCCATGAAAAGTATGTAAATACAGTAGCTACTATAAACAATTGATAACGTTGTGTTTTAAA
TTAAAAAGTAAAAGTAATAGTGAGGTTTTACTGATTCCGCTAAAACGTCACTAAAACTAAATAACTGCAGATTCCAACAACATTTATTCACCATTTACTA
TAGGTTTAAGGTTAGGGAGCTGAGATCAAACAAAGAGCTGGTAAGTTAATGAAGCCTCGTAATATTTAGTTGAAAGGAGAGGTAGAGCACATGGATTACA
TTTCCCACTTTGCAAGATTTACTTCCTTTCATTCTGATATAAAAGGGTATCAATTGCAAGGTGACAATCTTTATACTTTTGACAGAAAAAGAAATTGAAT
GAAGCAACTTTCTACTTTTTTTAATGACTGAATCAGAAATTAAGCAACTTCCCATATTACTTTTGCTTCCTTTCACCTGATATTCTCAGTGTTCTGAACA
TTAGATAGATATCATTGGTATTGGACTGTCCACAGCCCAAATGCAAGTAAAAGATCCAATCAAGTATTAGAAGCCCAATGCAGTTGCAATCAAACTATAA
ATGCATAGAATTGGACAAGGCAACTTGCCATGCTAAATTAATGAGATAACACTCAACTACCTATTCTTTTACGTAGAGATCCCTCTCCAAACTTGCATGT
TCATTTAATTTCCCCGAAGTGTTGTGCTTGAGAGTAAAGGAACACGATCCCTGTGTTACAGTCTTTTCATTTGCTGACTAATTTACTATAATCATTTTCA
GTGACAATGATGCCTCAGTGCAAACAACTGTCCTCAAATTTTCACCTTTCTGCCCACCCTTTGCAAACTTCAACCACTAAAAATGAAACAGTTGTAAAAA
AGTTAAAAAATTTACTATTGAATTCCTGATGTCAGAATTGTTAAGAATCATTTTTGGAGGAACAAAGGTCAAGAATCACGGGAAAGGAGACACAGATTCG
AATGTCAATAATCTCATATGAAGCAAAGCCAACCCATAAAAACTGCAGTCTTCATCTGTCATAATAACAGCACATTTATAGCATCAACTTTCCATATAAA
TTTTAATTTGTTACATTGGAACAAATCATGAATGTTAATTAAAAATAGAAATTGCAAAAAGCATTACCGAAAGATGAGATTTACATTAACTCATTCTAAG
TTTCTGCAGATCAACCTCTTTCAGTTCCTCAATATCATCTGCACTGTCTGTGGGAATATCTCCACCACAATAAAGAGTCTGCAAATGCATCAGCTCGGAA
AAGATCAACAATGTAAGAAAGTGAACTACAGTTTAGCTAAAATAAAAGAATAGGAATCAAAGATTAGAACAAATTGTGACCATTGTAGTTTAAGTGGTAT
TTTCATGTTGAGGTTTTCAGCATGTTCCTTGGACCACAAAAGGGAAATCTAAGCCATTATTGAGGAACTCTAGAAATAAAGTTTTACTTGCACTTAACAC
GGTAAATAATTGAACAATTGTCTCAAGGCTATAGCTGATAATCAGCCATGTTATTTCTTATTACTCTCCTTGTGTTATAACGATAACCTCATAACGATAA
CAGCTTCTAACATAAACTAATCACCTTCTTTCTTTAATGAATAACTCAAGACAGTTTCCCGGCAAAAGAAGGTGTTTAATCTAGCACTAGTAGAATCCAT
GCCCAACAGACGATACGGGCAGTAGTTTTATTTATGCTTTTAGATAAGTTTAGCAGTTTTCCTCAACGAAATTATATATACCAACTGATACTGATACATA
CTGTTAGGAGAAATTAACATGTACTAATGCAGTCCTTTGCATGCTATTTCATCTTCAACTTCAATGAACCTTTATCTTAATATATAACCCAAAATAGTTT
CTACATTTGTTTCAATCTGCGCAAGAGATGATTTTTGGAAGCTCTTTAATAAAATTATAAGACTTCTCATTTTACTTTAGTTTAAGTGTAACTGATTAGA
TTCAGTAATATATTAATTCATATAATATCTTCTATCGTGCCAAGTGTAGCTCATTAGATTCATTAATATACTAATTCATATAATATTTTCTATGGTGCCA
ATTTTACATTAAGTTGAAAGCTTATGCTACTGCACAAATTGACAGTACTCGATAAACTATGCTCAAGTAGATATATTATGTGCATTTAGAACCTCTTGCA
ACAATCTGAAGGGACAAATGAATAGACTGAAGAAGGTTGTCAAAAGGGTATAGAGAAAAAAATGAGCAGCAAAAGCTGACTTAATTGGAAATCGACCTTG
GGACCTAACTCTTAATGCAAAAACAATTATACAAGGCTCAATGAGGGATAATAATGAGCAAGTAATGAAGGATAAATTGTCTAACATGAAGTAAGAAATG
AGGGACAGTTAGAGGAACTACTAGGAAGAGACAAGGGACTCGTGTCCCTTGTTACTGAATTTCTTAGCAATGATAGGACAGACATCATCAGCATCAGCCA
GCGTCACTAGAAATGGAAGTTCTGAAGTAAGTGCAGAGTCTGATGGGGGTCATCACACCAACTCTTGATCATAGGAATTCCATTATTCACTTGCAATCTG
AAAACCTGAAATCAAGAAAGAAAGATGCTTTCAGGTGCAAAAACAAAATGCCTGGATTTCAATGAAAAATAGATACTTCTCTAGGGACATTTTATGATTA
ACTAAGAAGACCATGTGTTCACACATTTCTGGTTCAAGGGAAAACGACATCCTTCTGAAATGTTATAATTTTAACAAATAATGTGAATATGCTTGTCAAC
ATACAAATAAGTTGCATGACACTCTAAGATACCACATAGAATCTCTATTTCCGTCCCCCCTCCCCCTGAAATCACATGAGCAGATTAGTCAGGTACTTAA
TCTCCCATCCCCCAGTCCAACATCCAAGAAAACAAGGAAATCCTAAAACAAATGGATGCTTCTACAAGGATTATTAAAATCATTAAGATATATGCCTAAA
TGATCAGCACCTAATATTGTCAAATCTTTAGTGTAACTACCACCTGAGAATATGCATAATTCATGATAAGAGTTGAAATTAGCTTTCCATCTGGATCCAG
TATATCCGACAGTAGACTCACGTAGATGCTATAACTGGCAGTAAAAATCACGATTTCAAACATATCTGCAACTTTCTCCATGAATGTCTTGAGATGAGGC
CTCTGCTTCATATACACAACGTGTTCTTTCATGCTGAAGGAGACAGGAAGTGCAAAGTATGCATCATCACTGTGCTCCAAAGTAGAATAGACAAGTGTTT
CTAGAAACATGAAACCAATATGCAAGACGAGAGTTTACTTATTGGAGTCAATATGTGCCTCCAGTGAGACATTCTCATTTTTTTCCTAAGCGGCGGTTCA
CACAATCACTTTGACATATTTGAATCAATCTTTGGTGGGTCTTTTGGTGGTAAGAATTCTCTCTCAGATACGTTCTTCCAAGTGAATTTTGTACTTCTTC
TTGCCAAAAATAAAAACTATGATTGTTTTTTATGTGTTAAATAGAAATACAAATGCCACATTTAATTAGGCTGCAAGTGTGACTTGTATATGAGTTCAAC
TATGACACTTGCAAATGTGTCTAACAACTGACCTAGATACCTTAATATTTTTCACTCCACAACGTGACACTGTTTCTAACTTTCTGGTTTTTGTTTTGTG
GTGCTAAATAGTATTCTTTAAAAAAAAACACCTTCTAGTTTTTTGTTCTGCTTGTAGAATATTTACTTTACTTTGCTTTCTATTTCAGTCCTTCCCAAGA
ATAAGACCTCCTTCCTGGAATGACCAAAGAACAACTTGCAAAGGAGAGGTTATTCACTGTGCAGCAAATGTTATTTATGTAATTCTGAGCAGGAAACAGT
TGATCAGGTATTCTTCCATAGCAGCTTCTCAAGACAATGCTGGGAACTTTTCTTTAACATCATGGGCATATATTTGGTATTACCACAGAAGATCAGCAGC
CCTTTGGAAGTTTGGCAGTTTAAAAAGTTAAAGGGGGCTTGAAGCTGATATGCAAGATTATTCAAAATTGCATACTGAAGACAACATGGTTGAAAAGGAA
CTAGGCATGTTTTGAGTGGAAGAGACTGCAGATACATAGACTCAAAAACAAATGTATCAATCTTATAGTAGTTTTCTTGGTAGGATGGATAAGTATGGGA
ATTTTGCACTTATTAGGGGAAAATATGTAGTGCGTTTGGAGTTAGAGCTGTAGTTAGGTCCTGTAAAATGGTTGTAAGAACAACAACATTATATGGCAAC
AAATGTTGGGTCTCCAAAAATAACATATCCACATTGTCTAGACTCAAGACTCATATGAATGCGAATAAGATGGATATGCATTCATATCCTAAGATTATAA
ATTATCACATCCCATAAGAGGTGCAGCAGCATGCAGAGTTTAAAATGATGACGTCATATGAGATGGTATGGTCATGTCCACGAAGAATTTTTATATGCTC
ATATGAGATGATATAGTCATTTTAATAAAAACGGAAAAGTTAGACCCAAAATCATATAAAAGTTATCTCAAAAGGACTTTTTGTTTTAGCTTAATGGAAG
CAAAGCATACATATATGCCACACCACTAGTTGGATTAAGACTTAGTTGTTCCTTTTAACATTTACGATAGATCCAATATTTCATGGGCTTTTTTATCCTT
GTTAAAGGCTTGTTGTGATGTAGTCCACGTGCAGGAGTAAGAGTACGATTTAGAGAACATCCACTCGTAGAGAAACCATCATCTTTCTTAAAGACAAATT
ATTATGTATTACAATAAAATGGACCTGAATGGATCAACATGAAAACAAGAAATTCATATACTAAACTCAACAATTTAGCATTGAGCAATAGTTGTCTGAG
TGATTGAAAATAATGTCCTGATTCAGAAATGACTTTTTTTGAAAAGATAGCATTCTATCATAGATTAGTAAACAATTAGTCCTTTACTTTATATTCCCAT
ATGTTAACATTTGAAGCAATTCAGTGAGTAAATAAAAAGAAATAAATGAATCTGTTCGACAAACAATAAAGCACAACGAATACACCAGCACCACTAAAAA
GGATCAATCAACTCATCCAAGATCATTGCAATGTGTTTTTCCCACATCTTCATTTTTGTTACCATTGTCAACACTCATCACTCAAAAAACAGTCAAGAAT
TATCAAACAAACAACTCTGGAATTAGTTAACTGCTAAATATAGAGATCGGACTGATTAATAACTTAAACAAGTTCAAGTGCAGCAGATTTTCTTAACAAG
CCAAATGTGACCAGCCAATTAGGTTACAACGATGAACAGATTTTAGGAAGACTGACACATCAGACCCCAGCCAAAGAAAATTAGAAGCTGAGGTCCACCA
ACAACAAATATTTAATAACCTATAGATCAACAGACTGATAGTGATAGAGAAATAGAATGTAAACAACCAAAGTTAGGTATCTATGCAACATTGAGAACAG
ATATAATACATAAAAATCAACTCACAGCTCCCCAATGTAATTGGATGCATCATGGTTTCCTCCAATGAATAAAGTTGGAAAGGCTGGCAACTGCAACTTC
TTCTCCTGAGAAATACTTCCACGAAGAATTCACGATCCCATATGAGGTGACACATTTAAACGTATTCAGATCCTTCTCATTCATAACAACCTGCTTGCAC
GATGAAAAAGGCTCAACTTATATCAATCCAGAAGACAATATAAGAACATAAGATGCATAATTATTGTTACTGATGAGACCAAACGACAGTCCGGTGCACT
ACACTCCCAAAACTTCAAAGCCAAATTAACTATTTGAGTATAACTGAGCAGTATATATGATCAAAATGATACGAATCACAAATTTGCTAGAGAACTCATT
GAGAAATATCTATTACGGAGAATCAAATGGAAAATTGTAAGACGCATTCGAATCCTCCTTACTAGCGAAAAGGAAAAGGAAAGGCCATCATTAAAAAATG
ATACATTTACATATAAATACAGATGGATTGCAACGAGAGAATTTTGATGAGAGAAAAATTGCTCCTTACGGCGGCGCTAGTCGAATTCTCACTTCTGCTA
GTAGTTCCGCTTTGTCACCGGGCAGGCAATTGTGGTGCGCGACGGAATAGAGTCGTCGACTAGTTGTCCGGCAGCAGATGGCGGGCACGTCTGGACCTGA
GACTTATCACAATTCACATCATTACGTGGGATTAGGATATTTAGTTTATCAAAATATAATTAACAATAATTAGTTATTGTAAATTTTAGAATTATTCATT
ATAAATTTTACTATAATTTTTTCTTCGTTTTTAAACAAAAAAGGAAGAAAAAAAAAACACAACAATTTAGGATTTTTTGGACAACTTGCAAAAGTATCAT
ATATAGGATCCAACAAATTAAACATTTAAGATATTCTAATCGTCCTTTCATTAAAAAAAAATAAAGTGGTAACTCTCAAAAGATGAACTAAAAGTTATAT
GGTTGTCATATGTGTCATTTCATCATATGTTATATTGCATTCGCAGGCATATTCAAAATTTCGAGAATATGATTGCACTATTATTAAAAAACTAATCTAA
ATATAAATTTGATAGATTTGATATTTAAGTCTTTTAAAATGTCAAAAATCTTATAAATAACTATTTAAAAAGGTGTTATCTAATCTCATTAAATAAAAAT
AAGATAAATTTAAAATTTAAAATTCTAACGTCAGATAGAAAGAAGCATCGAATAATCATCACATTATAATACTCCTAGTGTTTGTTCACTCATCCATATG
CTTATTAATTTTTAAAAATAATATAACACTGGTATATATAAGATCTTGAGAAGAAAGTGAGAATTCACGTAAAAATAATGTTCAAATAAATAATATATTT
GAGCTAGTGCGGCCACAGGCAACCACAATGTGTCCTTTGAAGGAGATCAAAATTCAAATGACTAAAAAGTAAAGTGTTGGTACAAATGTAGTGGTCTTTA
GTAAAATTTTGTTGCCAGTTTATGTGAGCTCCACAGTTGAGAAAACACACACATCACCAGTGACTTTAAATCCAATGGACAATTCACTAAACTCAAAACA
TTTTCACAACCCTTCATTATAAATCCGAAAAGAGTACTTATATTATAGATAATTCAAAACATCACAACAAAATTAAGATCTATCGATCGATCTCCAACAC
TAGGTGCAACAAAAGATATTAATTCTTACTACAAAATAACCAAATGATAACTGCCAAAACAAGTACTGACTATACTATTATGCATTTCCAATTCAATCAC
TCAAGCAAAAGCTTGTGACCAATCTTATAAGAAGCATAAGCATCAAGGCACGCATACTCAACTCCCTTGCCTCCCAATTACTCATACACACATGCTTAGG
CTTCTTCATATTTAAACCAGCAACTTCCAAAGCTAAATCTTTCAGCCCTGGTCTACGAAACCTCCCAGGCCATCGCGCGAATATCAGCGCTCTTAGCACA
ATTCAATCCATACTCGTTCTTCAACTTTTTAACATCATCCGCAACTTCAATTCCCACAAATGTAAACTTTGAACTATTGAGAAAATCCTTTAGAGATTCA
GGAACTTCATCAAGGTAGAGAAGTTGAAGGATGAGACATTTTTCATCGATGCATAATTGTAACGTTGCGGATTTGTTGCTCATCCAACTTTCATGGGGTC
TCCATTCAATGTCTAGGCCAACAACAACCATGGGAGTGTTGCCATGTACGGAAAGAATGTTACGTACTCATTCATCTGCGACGGTGCCTTTGTCGGTGAC
GGTTGTTTCAATTGTTTTTCCGGCGAAGGTGACTGAGTGTTTGGAAGTAGTTGGGTTGTAAGTTATACCATTACGATTAGTGAAGGAATACATCTTTACT
TTTTTGTTTTCTGTATATGTCTTTATCTCATGAGAGTTGGAATTTATAGGGAGTACGTATGTTTGTTCAGACGTTTGAAATCCATCACTGTCAAAGAATG
ACAAAAGTCCCACATCGTTGATTAATGAGATGGGTGGACGCCTTAGGTAATCCTCCTCCCTTTGAGCTAGCTTTTGGTGTGTAAGTTAGGTCTAAGACCT
AATTTCACATGGTATCATAGCAGGCCCCGTCTCATCCGATGTTGGGATCCCCAAAATTAAAATTGTCCACGCACCAGATGCTAAGCACTGGACGTGAGAT
GGAATGTCAAAGAATGACAAAAGGGTGGACTCTTTATAAGGCTTAGGCAATTCTCCTCTCTTTGAGCTAGGAATTTGTAAAGTTAAAGTTGCATAAATAC
AAAAACGAGAAAAGATGAAACATAGAAACTTGAAAATTAGTTTGGAAACGTGTAATACACGTATGAGAATCTGAAGAAGTTAACTCTTTGAAAATAGAAA
TTAACTTGATATATACACCACAATAAATAGTTAATTATTCCCAAGGCGACCGTTAATATTCCATAAAAAACTTTGAGTTTACAGTTTTGTTCAATAAGTC
AATTATGTCACCAAATAAAAAATAGAAAAATTTTGGCCATAAAATTTAATTAGAATTTATCAGAATAATAAAATAACATATTTTATCATTTTAATTTTAA
TACATTTTAGTTAAAAATAGAAAAAAATAATTTATTTCAAAATAAAAAATATTATAAATTTTTTAAATTTCTGACAAAATACGGACAAAATATTCTGATC
ATATAGCATTACCTAATATCAATGTTTTACTTGGCTATTCATGATTAATTTTTTAAGGAAAATTCTTTTTGGCCAAAAAATGTGGCCAGAATTTGGCGAA
TGATATTTTACCTATATTATTTTATCCTTTTAAATATTTTTATCATTTTAATTTTAATATCTATTTAACTAAAAATGGAAAAAAAGATTAATTTATTTTA
AAATTAAAAAAATATCACAGATTTTAAGTTTTCTGGCCAACTTCTCTGGTCATTTAGCACTATCTATATTTATAATATTATATTATTAACGTGCAATAAA
TTTTAATAAAACTACTCAGGAACTTAATAAAATAAAGGATATTTTATAGTACTTCAATGCATGTATAAGTTCTCATGTTTCCGGTAAAATACTTTATCTG
TCCCTAATAATTATTAGTCCACTTTTAAATTGACATATTTATTAAGAAAATAACGATTGACATAATAAAATTATTATTTTAGCCATATTATTGATAAAAT
GTATAAATTAAGATACAAGTAAAAGTGAAATAGTGAAATTTCCCTCCTAATCAATATCAATATTTTGTTAAGGGGTATGTAAAATGAAAAACATAACTCG
CATTTTAAGATTGAGGAACTAGGGAGTAATACTTTCTATAATTAATTTATTGTAAGACTTGCACTTATATTGTGTATATATACAAAATAAAATAATTATA
AAGACCATAGTACACAAAACTTTTAAAAAATAATTTTAGGAGGAAAATCAAACTGATCAATCATAAACCGAATAATGCTACACAATATGCCTAAAACAAT
CGTGATTTTATAGGTCAAAGTTATTATAAGATTATTATGTCATTCTATCCAATTCAATTAATACGTATTTAATGATGTTAGGATTGTTTACATCATCGCG
ACTATTCTTTGTCCCAAGCAAACGTCACATTTTATTAAGGATGTTTTAATTTATTCATCGATGATAAATTGACATAAATAGTCAAGCAAATTATGCAAGT
CTTTTGTGATTTTCACAACGAGAAAGAGGTCAATGTAGTTAACTTTATGCATTTAACTATCAGGATTTAATTCATCGAGCCGTGTGGACCTCTACATGTT
AACACCTAAATAGGAGAATCATTATATCCTAATTACAATTAAAATTATGCAGACAATTAAGAAAACGGAAGAATAAAGGAATTTCATGCAATATTTTTAT
AAACAAGAGCTTTAAAAACAACTGCAATTAAGATTTATAAAGTAATTAACATTCTCACGGATCTATTCTAAACAAGTATAAGAGCTATTATGATTGCAAA
GTATGAAATGCAATAACAAGGACACAACTCCCACCATGCAGAAGGAAAAATAGAAATTGATAGAGATTTACTTCGTTTTCATCTAATGAAACACCACCAA
CCTGCACTTAGACTATGCCAAAAAAGCATAGCAACAGTAGTATCAGTACAAAATCACACATACTAGCAAAAACATGCAGATAACCACTCGCTTCTCCATC
TTTACCATCTCTCGAATATCTCATAATTACATTAGGGCCCTTACTACTAACCACCTTCTCAGTCAACCTACTCACTAGGTTCTTGATCATAGTCTAACCA
TTGTAACGCATAGAAGAGCCCATGAATACAACTACAAACATTCTAACTAACCACTCACGAATGCCTTTCTCCAAGTGAAATCTAGCTAAGTATATATCAC
GTACGCTATCTTCACTTCTCGCTATTGCAACACATGAACAACCCTTTTCTCTCAAATATTACAACCCTTGATCGACGCTTGATACATACTGCACCACATT
CCAATTTAGGCTTGTTCTTTCTGATTGTTTCAACAACGAGATACCAAATCAGTTTACTCAACATGGTAGAACAATCAAATATAGGTCATCATAATCATTT
AACAATTCTGAGGAAAACAATATTAACCGTCATTTACAAATAAGGTGCAGTTTCACATTTTTTAGCTACAGAGTTACGACAAGTCAATTGTCCTCTCATG
AAACTCAAACTCAAACTATTAACATACCGGAATGTGGTACTCAATCCCATATTTAGTGTGTCGGAACGCATGCAACATCCGATCCATTCAACAAGTCACA
ATCACAATTTTCAAGTATTTTCACATAATCATACAATCAAGTCATGATTCATGGCATACCCCATTCAATTATTCTTATATATGATTAGTGTGATCCATAA
CACAACATTTACATACATACATTATAATGAAGTAATTACTAGCATACATCACATTAATATGAAATCGCAATCATCACAATGAAGTATTCATTCGAAATAT
ATTACTTAAACAATAACTCGACCATTCTTAGCACTAGTTCATCATCTAAGACTTCTTCCTATGATTTAGTCATCTTTTATTCGTGCATGAAGGCCTACAC
ATAAATCTTACCATTGATTATCATTATACTACGCATTGGACACAGATTCGTAACTAATCAATTTATAAAACCTAGCCTACCTGGGCGCCAAGCAGCTACA
CATAATTTTTAGCTTTGATTCTTGTTTTTGAACTTCGTGACGGCTTGATTGGAAATCCGCTATCCACCCCGCTCCTTACGCTAGAAATCTCCTTCTCTTT
CTTTTCTAAGCTTAAAAGTAGCTCTTTTTTTTTTTGGGGGGGGGGGGGGGGGGGGATGGTTTACGTCTAAATTAGATATTTTAGGAAGAAAGAGGAAAAT
AAGATTTTACATTATTTACATTCTGTCTCGCCTATTCCACTCCGGCGTCAATTTACCCCACCATGACGTCGCCATCTTAGCGGCATCTGGTTAGTAATTT
CTTGAAGTTTTTTTTTCTTTCTAAATAACAAATGTTCGGATCATTATATTATTATATGCGTATATAATATGTATACATATTTAAAAATACTTATGTTCAG
ATTTTTGTGCTTGTTAATTCAAATTTCTTACTCGTTTCCAATAGTAACAATTCACTATTCATGTACCACATCACATTATATAAGAATTCTCTTAAATCTT
CCCAGTTCCATGTACGTATGTATCACATTATAAATATTTAAACTATGATTAGCTTTACCAAACGGTCCAAAACAATGTGTTAAAAGTCCTAATCACAATG
ATTAATTGGGAGTGAATTAAATTTCTGTCCGACAATAATAACCAAGCTGCCTCCCCACGAAACAACAAGCCACGCGTCAGTTTCCTATACGGGCCCACCA
ACCTGGCGCGCGTTAGTCGTAACCAACGCCCAGCTCAGATTATCTGGCGCGCATCCCACTTGATGCGCACAACGCCCCCCTTTGTGCCTCCTCTACGGCC
GCCACTGAGGACTCATTTTAGACTTCCATTTACAGCCGACACTCAAATATCTCAAATTCTACCGGGAAATTTAGCCGCCGTTGTACCGGAATTATGAACA
GTTCCGTTGAATATTCTTGAATCTGATATCTGGAGTTGCTGAAGTTTTTTTGCTGAAACCGGGTTCAGCAGAGATTTCATTCTATTTTTTTTTTACCAAA
TCGGGCAGATTTGATTCGGAGAATTAGGTTCTTTTCGTATATCTAGGGTTTCAGTGTAATCAATTGTGATTCGGCGAAGTTTCGGTTTAAACTGAATCGT
CTGAGCTGGTATGATCTTCTGCACATTTGTTCTACTGTAGACTCTAGTTGAATATTCGTGCATTTCGTGCCTTTTGTTGATTCGTTGATTCATTGTGTGT
AAAAGCGTGGAACTTGCGTATCTGTTGATGTAATTGGGCAGTTTGGTTAATCGATGGCGTCGATCCGGAGAACTCTATCACCGAGTAACGAACGGCATTA
TCAGAACGGAAACCAATATTCAGTTCAATCGCCATCTCATAAGCTCGTTCTCAATGGCAAAAGCTCGCTACTGAATTCTCGAAAAAATTATATATCCAGG
AAGAAGTTGTTCTATAGGTGTCTGGTATTTTTCGTGCTAGGGTTTGTATTAGGTATGGCACCATTTGGTGGTTTTGATGATGCGAAGAACAGTGATTTTT
CGTTTGAGATCAAACCACCGGTGGTGAATGTTAAGGAGGAGATGAAAGATGTGGTAATTCCCAGACCTGACAATGTCGTGGTAAACTCAGTTAAATTACC
AGGTTTGGGGGAGGAGGAAGTGCACGGGAAGTTTGATTATGTATCCAGGAAACTGTTGATTGTGGTTACTCCGACTTATAATAGGGCACTTCAAGCTTAC
TATCTTCTTAGATTAAGCGAGGTGTTGAAGCTTGTAAAATCACCTCTGTTGTGGGTTGTGGTTGAGATGAATGTGGCGTCTGCAGAGACTGCAGACATTT
TGAGGAAGACAGGAGTTATGTATCGCCATCTGGTGTGCTCCAAGAACATGACAGATATAAAAGACCGCGGGGTGCACCAGAGAAATGTTGCATTGGAGCA
TATTGAACATCATAGGCTCAATGGAATTGTTTACTTTGCAGATGATGATAATATCTACTCACTTGAGTTGTTTGAGAGCATTAGATCGATCAAGTAAGTT
GAGATTCATCAGTCTTGTTTACATGACTTGTCTTTGTTTTGTCCTGCTGTGAGCATGTTCAGGATGATGTTATGTGCTTTATGTAGATGTTCAAGTCGAT
AATAGTGAATAGTCTAGAGCTATTTCACATATATTACAACTTCACTAACAAATTCTTTTCCTGGTGTCCTCGGTTCATCACTCTTCATAGTTATAAGAAT
AACAGTTGTAGATTAGACCACTGGTCGTGTGATTTTTGGACTTAATTATTATCTCAATTCTTCCTCAAAATAGCAGTCCTTAGATTAGAAGCTGAGGAAT
GACCACCTTGTTAGTGTATAATGGAATCGCCTTCTTCTGGTAAAATATAAATTTTGTGAATTTTATTAGTGGACAAAAAGAGTTACATGATTTGGATGAC
CGACTTTTATGAAGGGCTATAACTCTGACATGCCCACCAGATGTAACATCTTCATCATTAGTGTGATCATGTGTTTGTTCATTCTTAATTGATGTCAAAG
AAAAAGCTTGGCTTGACAGAGATGTACTTCAACCACTTGGTTGGACAGATGTGCTTCAATCTTTTCAGTAGAAATCTTGACTTCTTTCAATCCAAATAAG
AGAACAGAGTAACCACTCAATGTGGAAGTTGGATATAGAAGTATTAGTAAGAACTAGCCATAGACTTGTTACACCTGTTCTTTTGTCGATGCCTAGAATT
GATACATTAATTTCACTTGTCATCTTCTTTCTTTGTAGAATTCTTTGTGATGCCTCTATCCACTTCTTTTTGTCATTCACCTGCTTCATAGAAAATCCTT
GTGATGCCTTCATCCACTTTATCTTCTTTTCAAGGGGTTTTAAAGAAACATCTAGTCTTCCCATCTTTATTATGAGAGTCAGGACTACATTCATTACTAA
TAATTTTCCACTTTTTTCTTGTTATTTGGAATTGTAAATGTCATACTACGTTTTATTACTATAATTAGTACGGCATGCTTGCTATCATAGTCAACAATTA
GAACCCTTAATAAAATGTACTGTATTTATAACTATAAGAGTCCTCTTTTATAGCATAGGTGAAATTAACTTATTTGTCTCTTCGACTTCTAACAAATAGA
ACTTATTCATGTCTCTGCTTAGTCAAAAGCTGTCTGATGTTTACATAAAAATGACTTTACTGGTATCGTTCCATAAATTGGTAGATTGACCCTCGCAATA
GTGAATTTGAGTGTCCTATGGGCTGCTCCGTGAAGAGTAGCTGCTACTTATCTTCCTTGATGTCTACCTCACACAAGTAAAGCTTAAAAGAACTGCCACT
ACAAAACTTTAAACTTGGTCAAGATGTCTTGATACTTGTCACCAAGGAATTCAGTCTATAATATTCCTTCGTAAATTTCTTATTGTTTAATATGTAGAAA
ATAAGTCTCACTGAGGATTAGAAGCAGTGAGCTCCGAATTTGCCTGCAGAGAGAAGTATTGCGACTTCTTTATGCAGCAAAACAAGCCTCAATGGACTGC
TTTTACTGGAAGTTAAATCTCAACCAAGAGAGGTGCAAATAATATGTCAGAGAGATGAGCTTCCCTGCTGCAACTGAATGAATTGTATTTAAAAGATATG
GTTTCTACGATGTAAGACTATCTATATATAGTTACTCGAAACCCGATCCATATCCTAGAAAACTAGTAATATTCCAAGTAGTTAATGCAAAAGAAATGAA
TCCTGAACCATCTATGGGAATTAAATCCAAATACAGTTTGAGCTCAAATAACAACATAGACTCGACAAGTTAGTATTGATCAAAAAACACACTAGACAAG
TCAGTAACTACTTGTGATGCTCCTGGAAAATATTTTGTTCTTTTCTTGATAATGGTAATGTATTCCTCAGAATCAAGGATATGTTGGAGACCTCCAAAAA
GTTGTGGATTAGTCAACAAAGACTAATCAATTACAATGATCCTAAGTCCTAACAGATCTGTTAATTGTTCAGCTTCCTCTACCCTTTCTTCTTTACCCCA
AACATAAAAGGTAACAATACAATTCCATTTGATCTTATGAGGGGGACTAAGACTACCTTCAGAGCATCTTTTGTTTCTTTCTTTGCATGTTGTCCACCAT
ATACAAGATGGGATGATTCTCAACCATTTCTTGTGACTCTTGCTGCCTCCTCTCCTGATCCAGCAACTGAGAAGATCTGTTGTGTGCTCGAGCATTATCC
ACTTGCTTTGAGAGAGACTAAGGAATAGGGCCCAAATTTGTGAGGTCACTTTACAATGCTCCTGGGAAATAGTATATTCATGTCAAACATGGGTCAGAAA
TGTATATGCTAGACTGTTGTCTTCTTCACTGAAAGAGGCAATGTATTTTCTTGGAATGTCAGTTGATTTGTGAAGAACGCTCAGTAGGTGACCTTGTGAC
TCCAAAAATAGAAGCTGCATATCTTTGTCCACTATCTATTCAAGATAGAATCTATTAAGTGTTGCAGTATTCCGATTCTTTTCTGTTCTTCCTGCATCAG
CTCCTTCATGGAAATTCTTGGATCTCCTGATAGTAATTGTTTGAACTCTTCATACATGTTCGGATCCAATTTCTAGAGTTCTACCTCTGAGATCAATTGA
TTTGCATAATGAGGAAAAGATGATAGAAATTGCTGCCTCAAGAATGAACTTCTTTACAGAGCCTTGTCTCTAAGGTTCTAGGTTATTGCTCATCCCATTC
TGATCTTGTAGCTGTTCTCAGATATCATTGGATTAAATTCATTTACTCGGTAATTTAAAAATTGGACTATTTTGCAGACCTTTAGGCAAATTCCAGGGCA
TTAGCATTTGATATGATCTTTGTTAATGCTTTAACATGGACCAATTTTCTTCCACCTAAAAGTTATGAAAAGATCCCTTAGGAAATCTTACCTTCTAGTA
GTTGAAAACTTGGTTTGCAACAGCAATTTACTTTGAGCAACATTATCACCTCTGCTGCATCCTCGTTTTCTTATTGCTTGCCTCTTTTGCTACACCATAC
TTCATTTTGGATCTTTGAAGTGAACTTCGTTCCAGTCTTCTAATGTGCTTGACGTTTGCCGTCCTTATTAATTTACGCAGTCTCAGCCTTGAGAAAAAAT
TGACCATTCTTTGTGTGATCACCTACCGTGTTATAAAATAGGTTACAAATACTTCCAAGCAACACCTCCCTTTTGGCTATAGGAATTGTGTTAGAAATAG
ATCAGTTTAGCTCCCAACTTTTCCCGCAAAGTAATCCAATGAGGCAATGACTCTTAAATGGTCGAGACGAAGGTCATAAATATGACTCTTAAATGGTAAC
ATATACCATATTGAATATATCTCACAGGTGGATGTTTTAAAAAGAATCTCACAGATGGCTGTGATTCATGCCGAATAGCTCATGAAATTTCTCCCGACAA
CATAATTTTCAGAGGATACAAAGGTTGGTTTTTTTGCCACAATTGACAAATGTAACGGGTAGTAAATTGTGGTTTCCAATTTTTATTGCTTCCTCAAATC
CTTGTTTGACGACAATCAATTAATCTTCTTAGGCTTTTGAATATTTGTGGATTTAATCTCACCAATTTAAAAATAATAATAAATAAATTGTGTTCCTCTT
CCATAGAATGCGAAGTTAATGATCATTACTGTGTTTCCCCCAGAAATTCGTCCTCTGATCCTTGGCTCCCTCTAACTTAAGCATTATATTGTCCAAAGAA
AAATTAATCTTTCTGCTTGCTCTGGCTGCAATCCATGATCTTCGCTTATGATAGGAGTTCATAGCAACTTATGAATTGAAGGAAATAATTAAATTTTTTT
TGATATACTGTATTATGAGCAGTGAGAGGTTGAACTGTAATTCTTTTGCCCCTGTTCTTTCATTACTTTTGCTGTTCGATAAACCTTGGGAAATTTGCGC
ATATGGTGGACCATATGGAAGGAAAGGAACGAGAGAATTTTCCAAGGAAGATCAAAGGGAAATGCATTTCTACTTTATGTTTTTGGTGTAAAGAGCAATG
AATAGTAAATGAAATACAGATAATGGATTTCCTAGGCTTATTGTAATTAGCTATCTCTGCAAGCACACTTTTGGAGGTGGCCAGAAGAATACATGTAACC
AATTTCAAAAAAAAAAAAAAACACCTTCGGGAATTTCCTCAGCAATAGACAACAAATACTTCTTGTCCATGCTTTAGTCATATTCATATGATTCCTTCTT
TGTGAGGACCAGCGAGTGCTGCTCGCAAGGTATAATAAGAGCCAATGCATGTAAGATATCTTTGTTGTATTTTGCTCTATAGTTTTATTTTTTTTCTTGG
ACTTGGTAACTTAGTTTTAGCATTTACTTGAATAAAATCATCTAACAGGGTTGCTGCAAGGTTTGAGCTTTCACTATGACAGATTACCATGCTTAGAGTT
CTGCATGAATTCAGTAATATGTAACCTGACTTGAGATTCTGCCTGAGTGTCGAAGTAACTGATCTATTTTTTTGTTCCCAGATCCCAGCTACTTCCCTTA
AAGAAAGTAGGCTCTTCCATGCTATTGAAATTTGTTGTGGAAAGATGTTGCAACTCTTCTTCTTTTTCTTTTTAATACTAAAATAAGCACAACTATTCAA
TAAAACAAACTTATATCCTCTTCTGGGACACACTTCTGGTGAAATTCTTTCTTATCTAGGAAGTATGGTAAAGTAAAATGGTTGAGCTAGGACATAAGTA
ACTATTTATATTATTGTTGGTATGAGAGGTAATATGTATGTTGTTACTTGCGAATATGACTGTTTTTAGATTCTATAAGTTGAAGGAGAGCACATTGTTT
TAGCAGATTTGACGTCATTGTTGGAATATTCTCCTTTTGTCTTTATTTTTTCTTATCTGCTTATATTTTCTTGTGATCTCCACTTTGTAGTCGTTTTGGC
ACTTGGCCTGTTGCTATGCTAGCACAAAGCAAAAGTAAAGCAATACTGGAGGGCCCTGTGTGCAATGGAAGTCAAGTTATTGGGTGGCACACCAATGAGA
AGAGTAAGCAACTTAGAAGATTTCATGTCGATATGTCTGGTTTTGCCTTCAATAGCACTATATTATGGGATCCAAAGAAATGGCATCGACCAACTTCAGA
TCCCATACGACAGTTGGACAATGTGAAGGAGGGTTTCCAAGTATGCTTCATATTCCGCCTCCTTTAAAAAAATTTATTTCTTTACTTTGGGGATAGAAGC
CTGCCTGAACAGGTTGAAGTTGGAAATTTGCTCACAATGATTACTTGCAGGAGACCACTTTCATAGAACAAATTGTTGAAGACGAAAGCCAAATGGAGGC
TGTCCCTCCTGGTTGCTCAAGGGTATTGAATTGGCACCTTCATTTGGAAGCTCACGGAGCTGTCTATCCAGGAGGCTGGCTGCTTCAAAAGAACCTTGAT
GCCATTATCTCTACCACATGAGAAACACAAGCAAGGTGCAGGAACTCTAAATGGTGTCCATGAAGGTCAGTGCTTCTTATAATCACTAAACCCACAACTT
CCCTTGTCTTGAAAAGGGAATGGTCAAACGCGAAATAAGTGAACTAGGGGTTGGTGGGGTGTGAGGAGTAGCTTCTCTTAATTAACATCATTTTATTCCC
AAAATGAAGATTCATTCTCCCCCCGCTCTCCCTTTTGTTGCTAATATCCAGAGACCTTTTTGGCATTATTGTTGGTTCTGCTGCCGTGTCCAATGTCCAT
ATTTAGTTTGACTGAGCAAGGAAAAAGGAAAGCACTCAGCTGCAATTCTTTTTGACAGGCCAGTGCTAATCCCAGTAGGAAGCTATCATTTTCAAGCTGA
TCAGGGAATTACTAGATTGCCAAAGTTGAAGCAGCAAGCATGCCTTCAATGTCAAGCTAGCTATAAAGAAAGGAGTGATTCATTTTATTTTTGACTTTCT
CGACATTATTCTTTGACAGCATCAGAACTCGTTTTGTTGTGGAGTTTTGCTACTTTTTCCCAAGGAGAGGGATGTGGTTTCTTCAATTTCCATTGCAAAA
TTGATTGCTACTGCCATCACAGAAGGCGGAATGTGTGCATGTTGTAGAATGGAATGGTTGTGATTATTATCCTCGGAAGCAGGAAGCAAGTGATGCTTAG
TTCAAGTTGTAGTCTTTTACTATTGTGTTACTGATGGAATAGTTATCATACAAAATTTGCAGTTTTTTTTTACCTTCTTGATGTGCAAAGGTGGTTATCC
CAGAGGTTAACTTTTGCCAATTAAATTAAGCTGTTTTGAATTTTACTTGTGCAGATTTTTTACTTTCTACGTTGAATTCACTTTTACCAACTTATTTTTT
TTCTTTGGAGTTAAGGAGTGTTATAATATACGTTTCTTTGAGTACTATAATAGGAGAGACCTGGCTAATACCTAATGTTTTTGAGATGTTCAATAGTACC
TAATCTCATCCTAAATTTGACGAATTCGCTCGCCAACATATCTTCGGAAGAGATCACGTCTCAACGCTAAGACATGTGATGATAAAAGATTGCCCAAAAA
ATCATGATTAGTCACTTGGTCCAATACAGTATTCTACAAAAGGGTTGCTATTGAAAGTATTTGGGTAAGTATCATTCGATGCCCATTAAAAGGACGAAAC
AGAAAGTATTTGTGTTAACAATAAAGGACGACTAAGGCACAGTTTGTGTTAGGTATTAGCGGGACTAAGTTGCCACAAAAGGACCGACACGGAAAGTATT
ATGTGATTATCAGCGACGACAAAGTCGACACTGAAAGTATTTATGTGATATAATATAACAATTAGCGGCGACTGAAAGTAGTTATGTGATTATTAGCGAC
GACCAAGTTGCCACTGAGTATTACCGAAGGTATTTCTGTGATTATTGGCGACGATATTGTCGCCACTGAAAAAATTTATATGATTATTAGGACGACAATG
TCGCCACTATAAGTATTTATACAATTCTTAGCGACGACTTTATTTGATTATTACCGATGAGAAGTCGCAACTAAAAGTATTTTTGTGACTATTAGCGACG
ACAATGTCGCACAGAAAATATTTATATGATCATTAGCGACGACATTTATGCGATTATTAGCAACGCCACTTAAAGTGTTTACATGATTATTAGCGACGAC
AAAGTCGCCTCTGAAAGTCTGTTTATGTGATTATTAGCAAAGTTGCCACGGAATGTATTTGTACCTAGTATTATTTGTGTTGCAGTGACTACTAAGTTGC
CACTAAATTGCGTACCATGTATTAGCCATGACACACGAACCATGTATTAGCCACGACACCAAGTATTACTGATGACAATGATGTCACAAAAGGGTCGCAA
CTGAAAACATATATACCATGTATTAGCGAAGACTATGTCAACATAAAAGGCCGCCAGTTAAAGTATTTATATCAAGTATAGTGACTGCATTGGAAGTGTA
TATAACTTGTATTAGCAACCACTACATCGCCACTTGAAGTTTGTGTGCGTTTTTACTTTTTGAAGCATTCGTTTTAATTATTAATGACAACTCAATAGCT
CACTGAAAGTATTTATTATAAGTTTTAGCAACCACTTAGTCACCACAAAAGAAACAATGTACTTGCAAGGTATTTTTAGTTACCACAAAAAATATGTGCT
ATGTTCTAGTTAGTACCAACACATTCTAAAAGAAAGTCCAATTCGAGAAAAGCATTTGAAGATGATGCAACTAAGGGCAAAAAGCTCTCAGCGACTTCTT
AGTAAAAACTTACTACTTTTCGATAAAGCTAGAATAACTAACCATCGAATAAAGTGTATAATTCAAATCACCTGACCAAATCTACCATTCTTTCACAAAT
AAACTCTCGTTTTCATTTTAATAAGTTTTGTTCTGAGAGCTTTTCGAAGAAACTAGAGAAGTGTTCTTTTTTTTCCTTTACTCTGTAATCTCTAATTGAA
CCCATTTACTCTGACCACAAGTGAGGCAAGTGGGGGAGGGGTAAGGGGAAGTGGGATGGGGCTATAAAACTACAGTACAATTACACACTTCCAGCTGCCT
CCCTCTCATACAAAAGGTTCTAAATAACCTATCCTACCAGCTATTCTACTCCCCACAGCACCAATTGGTTGCCTAGACACCTCAACTGATGCCTGTAGGC
AGAAAAATTACACAAATATAATGAATTACAAACATATAGCTGGTAAGGAACTGCGAGGGAAATTGATGTCTTATGGTACATTCTCCAAAGGGAGATTTCT
CCTCAAAACTTTTGGACACTGCCATCGCATGAGCCGTCTTGTCGCCAGCAGATTGAGCCGAACTTCCAAGGGGCGCAGATACTAGCCACAATTTACAGAC
TCTGGAGATTTATAGCAGATTGTTGCAATAAGGAGCTGCAGTAACACTGGTGCCCACGCCGTGTATTACTACACTGCATTCCTTTAAGAAAGTGCACTGT
CATGTTAGAGTTGTTCCATGAACAGAAGCACTAGTCTCTGAGGCATGCACAGTAGATGAGAGATGTGATTGCTGCAAACTCTCATTAAAAAGACCAAGTT
GTACCAAGGTTGATCTGCATCAATGCCAAACAACTTTAGTAAGCACAAAGACTAGTTAATTTGTAATAAGCATGACCAAGGTCTTTTTTTTTTTGGATAA
GTAAATCATGAAGAAACTTTTTGAGCATAATGGATCATGCAATTAGCTCTTATTCTAGGATCACATGAAGACACAATCTGATTTTCTACTTTTAGAATAA
TGTCTCAAAAATTAGATGCAGCATGTACCATGAGAACTTGAGATAATTCCAGTTGACATAATGCAGAAAAAGATGGGAAATTACTAAACGGTTGATCAGA
TACAAAATATACCTAGGGAGTGAAGTTTTAATATTTGGCTGATTAACAAAGGTAAGCAATGGACTTCGGAGATTAACATATTTGTTTAGAGCACTCTCAA
GCTGCGCTGGTGGCAACTGCAAACAAGATCAAACACATTTTAAGACAAAATACAGATAAGGTCGCCTCCATGCACAATATAGTAATATTATAAATCACCA
AACAATACCTGTAGTAGTACAGGAAAAGAATGTGGTTGTGTTTGTGAGACACATTTTAGGAATCCCACCCACAATTTTGGCATCCTCCATACCTGCATCC
AATATGCAATAGGATGACAATTCATTTGTACAGCAATAACGATAGTTTGTGATTAGGGGGAAATCTAAGCTTAAATACCTGTCTAACCACAAGTTTGGAG
AGTATCTCCATCACAAAATCAACCTAAACATAAAAAATAAGAAGATAGTGTCAAACACATTGACTACATTCCTTCCACATCAAACAAATATATGCTCAGT
AAGAAGCACTGTCAAAATTCTAGTGCTGCCCAGCTGCATCAACATGTAGATGAAATACTCCAGCAGTACTCTATCAGAGCTAGTTCATAAACATCCAGGA
ATCCAACCCTCCAACCATCAAATGGAAAGAAGGAAAGAGACAAGACGGATTACATATCTTGGATTGCGTAGTTTTCAAAATCCAAGACCAATAATCACAT
CCATATGGTGTTTAACTGTGTGACCCTCTCATCTAAGAGCTTGAATTATTCAAGAAACAGCTTTTATTCGCTTATGTCTTCAACATTGCCCCTTTGTGCT
TAATATGGCAGGCCAAAGGAATGCAAACTAAGAGACATGGAAGAATAACTTTATCCAAAAATAAATCAAGATACTAAGATGTGTCAACTCATGAGTATCA
AGGACATGATTGTCAGGTATTCAGATGCTAATTTAGCATGGTAATATCCTGATAGACACTCTATCTCTGGACATTGTGTTCTCATTGGAGTAGGGATGGC
AATGGGGTGGGGCAGGGGGGGGGGGGGGGGTTGCAGGTTCCCTCCCTCCACATTTTGGAACAAAACAGTTTGACGGATCAATGATCTTCACAGTTTTATA
ACTTAATAAATTTTGTTCATAAACTTGAAATCAAATTTTCTTTTCATTCATTATTTATGTAACTCACAAGGTCAAGATGATACTAATATTAGTAGAAATC
AACAAACAATTTTTCCACCCTTCCCAATTGTTATTCTTTATAAAAGACAACAAGAAAAATTCAAGATACTTGATACTTTTTAGTTCCTTGTTTCTTCCTG
TTAAGCTGTAACAGAGAACAGGAATGAATTTTTTTCTAGGTTCATTATATAAGCACCCTTTAACTTATACAAGTCATAAAAATATTCTTAGTATAAATGT
TAAAGCAGTAAACTGATCAGAGAATTTGACAAGCAAAAAAGAAAGATATATGACTAAATAAAAAAGAGAAAAAAATCGCAATGTAATACTACATCGTGAT
GATGAAAAATAATTACGTATAGCCGATTTATACAGGGAGGGGTGGGTTAAAAAAATATATTTTGTCGTGTGGGTCAGGGCAGGGCAGGGCGGGGAGGGGA
GGGTTGGAGTGTTCACGGGTTTATGCGGGTTTGCCCCGCAACTGCCCTGCCCCGCCCCGCCCCTTTTAACATCCCTACATTGGAGGCAATTTGATCTCCT
GAATGAGTAAGAACCAATTCTGGTGCAAGACCTATGTAGCAGCTGAATATCGAATCATGGGAGTTGCTACATGTGAACTCATCTGGATCAAACGACTGTG
GAAAGAATTGAAATTTGAAGAATCACTCTGATGGAACTTGTTTGTAATAATCAAACTACGCTGCATATTGCTTCAATTCCAGGTTCTGGGAGAAGACCGA
ACACAGAGAGATTCACGGTCACTTTGTCAGAGAAAAAATATTCTCTGAAATATTTAACAAGATCTGTGAAGTCCAATACCAAATTTATCACAAGTACTCA
ACTAACTGCATACGTACACCATGCTCGACACATCCAATGTATATGCTTGAGGGGTGGGTGTTAGATAGCTAGAACAGTGTTGTCCATGTTGTTGTCCCAC
ATTGAACAAACATAAAAATGATGAAGCCTAAGACGTTAAGTCACACCCATAAACTCACATATTCTAATTGTTGAAATTTGTTTTTAGTTACTACAATAAT
TTTTGGCATAATAAATTAGTAGTTTTAGAATAATTTGAACTTTAAATTTCTATCAAGTTTCGATTAATTTGTTGAGATATTTTAGTTTTTTTGAATTTCA
AATTATGCAAATCTTTTGTTTTAAACTGACTATTTAAAGACCTCCTATGCTTAATAAAATAGCTGAGAGACTTCCAATCAATACTTCAGCCCTTTTGGTT
GCATCCTCTTCTAAAAACCAGCGGTGGCATCAAGAGCTTCCACTGATATAAATGGATCTTTGCGTTCATCGAGGAAATATAATTTTAAATCATTTTTAAC
CCATATCAATTTTCAACCGATTTTCAACTCATGCTTATTTTTAAAGCACGGGCAACATCTTAAACCCTTGCTTATTTCTAACACTTGGGCACCAATACCA
ATTTTCAAAATTTTAGCTTATGCTTATATTAACACACAACTATTTTCAACCAATACATATTTTAACTATACAAATTTTTATCCATATATATTTTTAACCA
TGACAAGCATCTATCTTTTGATTTCCCTCGGACCTTCATTGATGAAAATCATTTATTTTGGTCGGTGAAGATGAAGTCAGATTTTTTTTTATTTATAACA
CGCAGGTCAAATTCTCTTCCATTTGACAAGAGAAATTACACAATCACTCTCCATCAACAAAATAAAGAAATTGTAAATGGAAAATGCTTGAAGCATATGA
TAGAAAAAGAAAAGGAAATTGAGTTAGATGAGATTATATAACAAAAATTGCAAGTTCAAAAGCACTTAAAAAGAATTCAACACCAACCGCGAAGGAAAAA
AGTAGGAGCACTCTTTTAAAATTGCAGCAACTAAAGCAAAGGAGGAGTGTTGAAATTTGTTTAAGTTACTGCAGTAAATTTTTAGCATAATAAGTAGCTA
GTTTTAGGATGATTTGAATTTTAAATTTCTACTAGATTTTGGTTAGTTTGTTGAGATATCTTAGTTTTTCTATTTCAAATTATGCAGGCTTTTGTTTCAA
GTTGACTTAAATAAAATTGCGGAGAGACATTTTCAATAAATACTTTCAGCCCTTTTTGTTGCACCATCTTATAAAAAACCAACACTACTCACGATTACTA
ATTTTCAAAAATAAAAATAAAAACTGCTTCTCAAAAGTCCTTGTCCAATACAAATAAGGCATTCAACAGCATCACGTTCTCTTCATAATTGACAATCCCA
CTCTATAAATACTCACCTAATCCATACTTCGTTTGGCAGAATATATGAATGTATCAAGGTGTGAGACTTGCAGGCTGTAGCACTGTTGCAGATTGTGCAA
ATGATAACCCAAAAAAAAAAATCCAATAGCAGACCAATATGTTTGGAGTGTGTGATCATCTCATCTAAAAGTTTAAGCTTTTAGAGAGAGCACGCTTTTA
TTAAACGAATTGTATTCTCAACCAGGGACGGACCCATGTGGTCTCTAGGGGGTTCACCAGAACCCCCACAGCAAAAAATTACACTATAATTATAAGGTAA
ATTTTCTGAGCTTATGTAGATATAGTAATTTAACCCCCTCATGAACAGGAAGTCGTAGTCTAGTGGTAGATTTCCTTTTAGATTGGCCCTCATGTCCAAG
GTCCGAATCTCATTGTGGTCGTTTTATTTTTTAACCTTCTCTTCATTTTGTTTCAGAACCAATCTTTCATAATTTTTGTTTTTCTTTTTTAAAAAGAGTA
TATTTAAACCCAAAAAAATCCAACCGTGCTAAAAGGTCTAAGCTAATGGAACTAACTTTTTGTACTTATAAACTATATACTAGTACTTCCTTGGAATTGT
ATTTTGTTGGCTTATTCACACATTTATATTATAATTTTTCGAACCCCCTGAATATATATCTTGGATCCGCCACTGTTCTCAAAACGTCCCCTCACACTCG
GGCCTGATTTTTTTATGGGCCAAGCACATGGAAGTTCTTTTTGATACTTTACTTGTTCCAATACCATGTAGAAGTGTGTAACCGTCTCATCTAAAAGCTT
AATCTGTTAGAGAGAGCACACTTTTATTAGTTACGTGCACCCAAACTAACAGAGAGAGCACACTTTTACTGGTTGGTTGTATTCTCAACAGTGTAAAAAG
GCTGGAACATAGTTATGCGCACCCAACTGATTAATATACAATATAAAACAGGAGCAGTGATTTACCAGAGTAGGAAACGCGTCAATGGCCTGAATCACTG
TTCTCATGAAGAGCAGCGGGAGAGGAGTCTGATCAACCTGATCAAATGAGTATTACAGAGATCAGAAAATAATCCATACCGTCTCTATCTACTATATGCA
TTTGTTCCATACCATCTGTCTCAAGGCTTTTGCCAGGACCTGTTGCGTGAAAACAGTCCGCTGTTCGAAACAAGCTGAGCAAGCATCTGTTATCTGAAAG
TGAATAGCATCAAAGTGTCACCAAATTGGTATGTAAGGCACTTTCACTATGTCCTGAATCTGTAGTAAGGAACAGGGAGAAGAAACAGAATTCAACAGGA
AACAAGGGAATCATGCAATTGAGGATATACATAGCAAAGAACTTGAGGGCAAGATAACAATAGATTTTCTAGTTCCACATGCTGCAATAAGTTCACATGC
AACAACCATCAAGCCAAAGACTAGTGGAAGTGGAAGATCGCATACCTTTTTTAGCGGAAGGCCATCCCTGTCGGGATTTATATCATGTATAGCGACCAGC
ACTTCTGCTGGGCTCAGTGCTGGACCAGTATGGGCGGAACCCTGCCATGAATCAAGTAAAGGACCTTTTATCTTCTCTATCTCCAAGGCAAATGTACAAT
GCTCATCAGATTACAACAAGTAATATGGAATTCTTTACTAGCAGAGGGGCATCAGGTGATGATTTTTTGTCAACTGATTATTAAACAATAAAGTGACTAG
TGGACTTCGATTAAAGAACCACATAATCACTGACCTAAGAAAAATAATGATAAACTCAAAACATAATATAATCTGAATGAGCATGATATTCAGAAGAAAG
AGTTGAACACGGCAATGAAGATGAGAAGGCTACCATGGTTAAATGGAATGAACATAACAGTCATTATCACAGAAATTAGAAGGTACCTAAAAATTAGGAG
AGGTAAAACATCTATAGAATGTAAAACCCAATCAAACCTGTAATATCCGAGCTAGGGCAAGCTGAAACTTATCCAGTGGGAGAGCAACAAGATTTGGGAA
AATAGGTAGAACCTAATACAAAAACAAAAGAATCATCATAAGTCAAGTCTTTCCGAATTAAGTGCAGTAGTTGAAAGGAAAAAATATAAAGTACTTTACT
ATCACATCAGGAGGAAACCAAGGAGGAAAGCTATTAAGCCAATCATTCAATAAAAGAAGAAGTTGATTTGTGTTGTTCAAGAATTCTTGTTTAGGATGAC
CCTGATGCTCTTTATAAAATCCTTTACTAAAAAAACAAAAAAACAAGATCTCTTGTTTAGGCAAGTTCGTAACATCTGCGCATCGTTTTTTGATCTAAGA
TTTCAATGCTTCCGTCTTTCATCTCAATGTATAGTTTTTTTATCTAAGATTTTAATGCTTCCGTTTTGATCGAATATTCCTCTATCTAACTGAATTCAAT
CAGTAAGAAAAGAAAAATGGAACAAAGAAGTGAAATTCTATATAATTGGAGATGTGATTGTCCCAGGGGAAATGTCCTACCTTTGAGTGCAGTTTGGAAT
CAACCCGAGCCACCAATCAGGGAAGTCATAAAGGGACATTAAACGTAATTCTAGAAGGGCCTTCCCGTCCCAAAAAAAACAAGTCTTGCCAGTTCAAGGG
AGTTTTTTGGACTAGCCCCACTATATGGCGAGGAAACTAACTTCTGTGAGAGTGGCTTTCACCTTAGTAATTACCCAACGAGAGAGAGCTAACGCAAAAG
TAATTCTTTTACGCAAGGAAATACCAGAGACCTCGGCTAACTACTCCCTCCGTTTCGATTTGTTTGTCTGGTTTGGACTTGTCAAGGAGTTTAGTAAAGA
GAACTTTTGAATCTTGTGAGCTTAAACTAAAGATATTCTCAAGAAAGTTGAATTCAAGAGTTGTCAAGAAAGGGCGGAGGCATTCTCTTTAAAATTGACG
AAAAAGTAAAGCAAGACAAACAAATTGAAACGGACTAGTACGTTTTATATAGTTATATATATTGAAGATATTTTTTTAAGAAAAAATTATAGATTTGCTC
AAAAAACTACGAATATTTATTTAAGAAAGGATAATTCATAACCAAGATATGAACAAAGCCCAAAAGCATGCCAAGTTAACCAGGCACTCCCTTTGATCCA
GCAAATTAAAATGGACATAGTGTGATATATTATCAGTTAAAAGGATATCAACCAGAGAATAAAAAAGAACAGATATGTCATTCAGGGTTAGTGAGGGAGA
TATAACACATATCATTATTTAGTAACAAAAGAAAACTGGAAATGTGTGTAGAATAAAAATGCAATAATCTGAAGAATACCTCACTCTTAGAATATGAAGA
GAGCACTGGAATAAGAATAGTTGCATCCTACAAAACAATTTAGGGTATCATTGGTGAAACTGCGAAGTTTCTGATTGAGAAAGCTATCAAAAAAACAAAA
AGAAAGATGCTAAACCTTCAGTTTAGTTTCATACAACCGCTTGACAACTGCAACTAAGTCAGGCGGAGGGGTTGTCCCTTCAGAGAGAATATGAAGCACC
TTGCAGTGAACAAAACAATGGCATCATGATAAGGAAGAGAGTTCAAGATGAAAAGCAATAATTAAAATGCGAGGTGTAGTAATCTACCTGTGTCAAAAGA
TTTTCACAGCCTTGAGGTGGATCAGATATTATACGAAGCAGTTCAGAACATGAAGAGCCTATAGCCCTAATAAGAATAGGCATATGACGGTGAACAGCCT
GTACCAGATCAAAAATTAATAGAAGGAATGTCAGCCAACTGAAATGAGTAGGACAACAAGAGCAATACAAGAAGTTCAGCACAAGTTAATAGGGATTGTT
AATAGTGCTCCAGAAGAGCAATGTAGATCCTCATTAAAGCTCATCTTGAAAAAAAATAAATTGGGAGTAGATCATCAAAATGCTAGTTTTACTTCTTTTT
TTGGGTTTCTGAGGCCTAACGAATCCAGATCATTTTGATAAAATGACAGTCAAATTATTGCGGGCCTATTCATGGTTCGATCGGGGTGAATGATTAATTC
ATCTCACACAAACCATTATTAAGTCGGCTATTAGGATTTAAGAGAGGAGCACAATAGAAAAACAGACCTGCTTAACTGCCTTAGGAGCACGTGCATAAGT
ATCAAATACAAGGTGGAGAAGACTGAATTTCTGCAGGAAAAGCTACCCGGTCAGCATCATCATAAATGCACATTCAACATACATCCTTGCACTTGTAAAA
TTGTCCAAACCTTAGTGCATAGAGCAAAAAATAATGAGATAAGCCGCTGAGCTTGAGCTAAAGACAACTCTGAATCACTTTGAGAATCAGTTGCTGCAGT
CTTAACAAAATCATTTTCAAAGAATCCTGGCCCTGAAATCTGAGAACCACTAACTGACGCTTCCTGATTTCCTGTCTGATAATCATATTCTTTTCTTAGG
ATAACATTCAAATTCAAGGAAAATTATAATTTTTTAGGTTAAGAAGAATTTATCAACATAGAAGGAGAAATGGTACAGCAAAGATAGTTTAAGCAAGCAA
TTTCAGAAGGCAGGTGCACCTCAACTTATTGGAGTCCAGAAATAGAAAATCTCTTCCTTCAATCCATATATTGGACTTCACTAACCTAGTTACTAAGTCA
TGCAGCAACATAAAAGCTAATTTATCATTTCAGGAATTTGATACACATCTAAAACATCCAAGATTTGAAAATTGACTCTGGACAGAGTCATGTATAACAA
GTTCCACTATAGAAGATAATCTCAACAACAAAGCCTTTAAGCAGGTCATAATTTTTGTCCCATCAATGGATAAAAATATTAGCTCAGATGTGTCATATAT
TTTGGGGTTCTTGAATAAAACAAGAATAATAAGATTGCTTTCCCAAAACCATTTTGAGCAACTGTTAGGGTGTATTTGATATGGAGGAAATGTTTTCCAA
TTTTCTAATGTTCGGTTGGTCACAAATTTTAGAAAGCATTTTCTCTAGGAAAACAGGTTCCTTAACAATGAGGAAAATGATTTCCCTAATGGAAGTAAGA
AAATCAAGTGGAATTCCATATTGATAGAGTCCTCCACCATCCAACACACCTCATCTTCACTCCCACCCCCACAACCACACCCACAATATTTGCCTAGATT
ATATACAAATTTTTTTAAGAGGTAATATTTTTTGCTTATGTACCGAACACAAGAAAATAAGTAAGAAAACCACTAATTTTTCAAGATTACCTTTTCCTTC
GTACTAAAAAGAATTAACTATTGAACGACGTGCATTTTAACAGAAAAAAAATTTAGAATAAACTTTCCTCCTCATAGTGAAAACGAGAAGTTCTAATCTT
TTAAGTCCTTAGCAACTACTGCTACTTCCAGATGAAATAACTAGTCTAAATACTCTGAATATAATTCTTTGAAATAGAATCACAAATTTTAGTACACTTG
CAAACTAATAGCCTGTTCAGTCAAGATTATATAAAAAAAATATCTTAGTTGTGCAAGGATAAAGGTGAACCTTGAAAAATAATTTTCACTTTTTCAAAAT
TGCACGTCTTATTTCATGTTTCGCTAGTGAAACTTCATTTTTTGACCACAACCTAGCAGACGAGCTTTACATGTTCCTACAATGCAAGAATTCTCATCTT
CTAGTACATCTATTCAATTATCAAATTTGTTTACGGGAATCACATCCCAACTCATATTCAAATATTATTTATTTTAAAAAAAATTCCAAGTCGCTGCAAT
CTGGTCAAGCTGACGTGAAATAACCAAAAAAGAGACTCAAACGTGAACACGAGGCTCCACCCACAAACAATTTCCATAAAGGAACCACCAGAGCCCTCTA
AAATCAATCAGTCCTCAAGCAACAACTTCAAGACCAAATACTAAAGGAACAAATGCAAACAGAACAAAAAGAAAAGAGGAAGCAAGATCAGAAACCCAAT
TTTGTTATATATATACTCACACAGACATTCGACAAAGCCAAAATCAGAGAGAATTTTTTATTGGCAAACACAAAAATAAGAACACACCTCTCCTGTCCTC
TGAACCAAAGTTCCAGACTGGGAATATTCTGCATCTGTGACATGCTGGTTTACAGCTGACAAGAACATATTCTTAGCATACTGCTCGATATTATCTGAAA
TGTCACCAACCACGTAAAGTTTGTTTGACACCTATCAAGAGTTACAACATTTTAGCGATTCAGATACAATAATCCATAGATAAGAATCGTAAAGAATGGC
TACCAGCAGGTGAAAACGCACAGCTGGCAACACAAAACAGTCACAAGTAGCATACCAGGCGAATAGCTTTTGCTCGGACCTCGTCCTGGGGGTGAATAGC
ACACTGCATGAAAGCATGAACTTAAATGACTGCACCATAATCTCATTCTGCCAAAGGCAAGCATTACTTTTGTTTTTTTATTTGCAGAATTGTAGGACAG
TTAAAGAGTTGTGTATTTTTGGTATAATGGAACTCAACAGATAAACAATTTTGAACACGTGTCTGCTACAGGGATTCTTTTCTTGTCCAGTACAAAATTG
AATATAAGAAAATGCTTTCCAGAAAAAACAAGAACAATTACAATAAGATGTCACTCAATCACTAAAGAAATAAACATCAAAATAGATACTAAAACCCGAG
ATTGAAGTTGCAACTCCACCCTGCAAGTCAAATCTAATGAGGGCCTTAGATCTTCATCCTCCTAATTGCCTCCATATACAGACCTCACCACCACCACACA
CAAAAATAAATTAAAAAATTTACAAGAATAGATACTAAAACCCCAACCAATACTACAGGGTTTATTATTAATCCCGAAGAAGATGATTCCATTTACATGA
TAGGTAGACACACCATCAAAAAACTCAACGCAAGGAAAATTTGACAAATAACAAAGCCACATTTTACAAAATGATATATGACACACACAGACATCAATAT
TAATTAAACCAAATACTATATACGGCACAACATTATAACAAAATGAAATGCAGCCATCTCATGACAGTAATAATCCTTCAAATACACAGAGAACCTTATG
AGAGAATAAAGACTCTAGATACATACTTGAATCCAATACTTATACTGGATCCAGCACTTCTCCAGTTACAAGAGTTTACTCAAGGTCACAAACACGTAAA
AAAAGTAACTTCGAAGTAGTTCTTTTGCTTCAATTAAACTGTCTGCTTATTAACTCTTTCTTCCAAAACTCTATTTACTCCTAAAAGTGATGCTTTAGCA
CTCCTTAGGCAACTAATACCTGCAATTACGTAAAGTGAATGCAAAACATCAGCACCGAATATTTGATGGTCATATACCTTCAAAGCTATATCCATGCATG
CTTGACGATTAGGGGGGCGACCCAAGATTAAACTCCAAACTGCACCAAGGCCCTGAGTAACACGGTCACCATCACGACCATCGTTCCCAAGATAATTGTC
AGAGCATAAATCAACTAGCAGTCTCATCACAGATTCAGGCAGATATGGAACTTCACCAAGGAGCCTACTAAATGACTTGTCGTTTGCTGGTAAAGAATCC
AGCAATGATTTCGCCTACAAACAAAGAACTTACTAAAGAAACTTTGCGAATGATGTAGATAAGGATAATAAATGACTCTATTTACCGCACTGAGGAGGAA
TTTCTCATATAGAGCAGCAGCAGATGAAATATTTTCAGCCGAACCCGATAGCATGAGATAATGCAAATGATAAAGCACATGCATTGCAAGCTCATGTACC
TGAGGGTCAAATCAACATTGTTAGCTTGCAACCACAATTTCCACTAAAAGTTCATTTGCAGAAGATATACAGCAGAACAAAAGCCATAAAAAGGGTTTTG
TGGTTAATAAACTGTATCAGATTAAACCCCTTTGGATATCCAAGTACAAAAGATTTAGAAGATTACCCAAACTAAAAAACAAAACAGTAAAGGGGGATCA
AGACAACAAGAAGCAGCGGAAGATCAAAGCTGTGTCCGTTATTTGTGATTTGTTGCAGTGTGTAAATACTGTAAATAGTGTCGTTGTAATAAGTAATTGA
GCGATCAAAGGTTTGAGCAACCACAGATGTTACAATGAACCAATTTTCATCCGAAAGATGAAAAATCGGTGAGCTCTTTATCTTTGTCTTAATTCTATAT
GCAGCAACTACATGACACTTTGGAGAGACTCACTCCAAGAAGATTTTGGATGGCAGCATTTAAGCCATATAAACTAGCAGAATATACACTTCACTAACTG
AAATAATGATTCTAAAACACTTCACCTAATAAAAACAAGCTTACCAACACAAAAGGAGAAAGTAATCATAGTTGATTGATTACACAACTTGAACGATGAC
ACTAGCATAAGATACTCTGAGTGTAAGAGAGAAAGTAGATACCTTCTCATGTTGGTTGCCTGAGAAAATATGCCTTTGGATCATCAGAACTACATGAGCA
TCAGCATCAGCACCAATCTGCAGGGTCAAACAAAAATACTGAACTATCCCATTCACATGCTCGGACTAGTTTTTCCAAAATATAAGAACAAAATACCCCA
TATGGTCCCACAAGTGGGGTCTAGGGAGGGTGGGGGTAAGGTCGTGGGGTAAAGATGGCCAAAGTAAAGAAACAACAGTAGTAATAAAATTGAAGAATTA
GATAGCCAAACTATGAGATCAAGTAAAGTAAACAAAACTTGCAAAGGTACTTAAATAATTTGACGTATTCATTATATATCAGCTTATAAACAGAATTAAG
CACATAAGATCAACAAAGGAGACATCAGTATTTACACTTCTAGTTATACAAATATGGTTAGCAATACCAGATTGCTTGATCAACATGCTGAGTTACCTAA
TAACTTTCTGGCTTATGTCCAAGGGAAGTTCGTTATTTCATTAGTACCTCCATCAGCACCCCTACTTTTCATCATAAATAATGTCTTAACATTCTTTGCT
AGGATGCCTCACTTCACCTACTATATCCCAAAAAGAATAACATCTTTCTCTTTTGGACTAATCTGCATCCATTGCTATCAAGATGTTACTCCAAAAACTC
AATGATTGCAGATCATCTCAGAAGGAAAATTGGCATGACTGCAGAACCTATTATCAGCTATGTGAAGCAAGTCAGGCAGTCATGGTCAATTTAAACTTAG
ACTTTAGGATGGTCATCCAGACAATTGCGTAACAGACTCAAGAGGCCAAGGAAGTATTTCTCAAATTTCTCCATTGTTCAGGTTAATATCCCAACATTAC
TCAAACCATGCATCAGCTTAATTCCTACACTGAACCAAAGTTTGTATTAACTTGGACTTCATAAATAAATCTAAGTCTCATCTCTACCTAAATTACTTTT
CACAATGACAGATATTTTTGGTGGGATAAGTCTGACTGTGTGTCAGTTATCTATATCCATATATAATCATAATTCTACAAGTACAACACTAGAATTAGCA
TAATTTGTTTGTCCTCTCTGACTTGGTGCACGAGAAAAGTCACTAAGAGTTGCTGAACTCTAGAAATATCAGAAAGATGAATTGGATCACAAGTGACTTT
CAACACCAAACTAGAAAGGGAAGGACCAACTACCCAAGTTATAAAGATTTCTTGGGAAAAACTCAAATGTCTTCCAAAGCATGATTATTATATCATACTG
GAAGAAACAAGTAATGTTTCAAGGAGAGAGCTAGAATGATGAAGTGGTATACCAACAGAGGTATGACACAAATAAGAGTCTCAGATAGGAAGTCTACAAG
GGCGACGAAGTGGCGAACCACTTTATTCAAGCATAGTTTGCTGCCCCTCAAAGAAGAACATTATTTACACCAATCAAGACAGAATGGGTAGATTATCTTA
GTTCTAAATTTTTCATGAACCAACATCTGGTAACTTAAGATAACAAAGTAGCCCCAATAAAACCAAAAACTAATAGTTAAAAATCAACAAGTTTGACCCC
ACCTGGGCAACCAACCGAGAAAGTAATGCCATTCCTGTATGCTTACTGTCTGTCTCTTTTAATTTCTTGTATGAGTCAATTATCTGTTCAACAGCCAGCG
TTCCCATATTTCTTTGCTGCTCATCAGTCAGTTCGATGAATGGCGGAAGTGCAGGCAAGTCCTCACATGCATCTTCAGGAGTTGCAGCAGTTGATATAGG
GGGAGAAAGTTGATCTGTTTCTAACAAAGGAGAGTAAATTTCATTAGTTACTCCAACTTCAGATGGAATTTCTGGCACCAATTCCGGTTCTACTTTGCCA
GGAGATAATAGTGGAACATGTATTGTGGGATCCGACTTGCGATCAGGAATAGCTTCATTCAGGTCTTCCTCATGACCTTCCTCTTTGGGAGCTAACAAAC
CGACTACTGGTCCTGGTGAACTTTCACCAGTGATAGAGTTAGTTTCCATCTTCAGATAAGTCATTGGCATACATTCAGAACTTGACATCAAGGGTACTGC
AATATCAATATTAGATGAACTGGAAGGATTTATGTCAGATTGCAGAATTGCAGATTGCGTAGCACTTATATTATGTTCTGCAACAAACGGTGGTGATACT
TCAACAGCGACAGCTGTTCGCCTTGGGTCAAGGCGCCGTGGATCCTGTGAAGCATCATGATGTAGTAAACAGTTTGTTATTGGACTGTCACTAGTGAGAG
AAACATTAAGTACAAACAGAAGAGAATAAACTTGAAATAATTTAGTTTTGCTCACCCTTCTGGGATCACGTTTTGAATCTAAAGGGAGACTTGCAGAAGT
AGGCATTTCTGGAAATGTACTGCATGTGGCAGTTGATAAAGAGATGGGTGTCTGGGATACAGGAACCCAGGACTGTTGGCCTAATGAGGAATCAATTGGT
GCCATAATTTGGGATAGATTAGTAGAATCACTCGCCCGAGGTAATGAAAAGGTTCCAACCGGTGCAAAAGGAGGGGGATTGTTTTTAGGCAAGTGCTTCA
TATTAGTTATGACTATATCAGCCAATACATCAGGATGAAGCTCGGATATTAGGAGATCAAGAGAGTTGACACCCCTTTCTCCTTCTGCTAGAAGAGCACC
AATCATGTTAATTATTTGTGCAACCGTTGGGTCCACCCCGTTGACATATTCTTTCCCAGAATCATTTCTCTCAACTGGAGCTGTGTGACTGTGATTATTT
GGACCATAATAAACCCTTTTTGTAGTTAGATCATAATTATTAGATGGATCTTCATTATCTAACGGAGTCGACCTCTTCTTGGTTGGATCACCTGAAATGG
GCTCATCCTGAAAAAGAAAGTAGAAAGTTCTGAGAACAGCTTCTGAACTATATATTTCACAGCTTGAAGTCCTGACACTTTGGTCTTCAATAACAAATAA
AGAAACTCAGTTACTGAGTAAATTACTTTATTCAATCTAGAATCACGTGAAGCTCGCTCATTGTTTCTGATCATTTTATCGAGTTGCCGAAGAACTTGAT
CAGCAGCATCACCAGCATTCATGGCTCGCAACGATTTCATCAATCTTTCTCTTGACTGAATAAAAAAAAAACACTTAACTAGTTATTCAATTTATAATAA
AGATAATCATAAGCAAATCTCTATAGTCCTAGAGTTGAAAGATATTGATCGCACTTCTCATACAGTATAGAGCACAAAGATCTTTTGAATCTATCCAACT
TGAACTTGCATTACACTTAACAGAAATCAGACCATGTTTTAATGTAGTCCTCCTATCGCATCTTTGAGCTTCAACTAAATATGGCTCTTTCCAAGTATAA
GAACGTGAAATAACCACCGACAGCTGAAGTTTAAGGAAAACAAAATACCTTTTGGTTTAAAGTTATCTATTATAAGAATTAAGAATTAGCATATGCAAGA
GTAGTCATCAACAACAATGACAACACCCCTCAGTCCCAAACACATTGGAAATCCTCATTTGTGCATTTAAGCCATATAATATCATCACCATACTAAATAG
AATATAAGTGAAAGACAACATTAATAAGTGTCTGTACATATATATATACACATGTTTTAGATTTAGCAAGAAAATTATCAACAAGAGCATTAACTAGCTT
GCATGTAAATTATATACCAAAAGCAAAAAGTAGAAAATCTTACAAAAAATACATGATTTTCTAATAAAGCCACCCCAATCATCTATAAAAGGAACTTATG
GGTGCACCAAACGAAGATGCTACCCGGCAATGTAAGAGTAGGTGATCTACATCTTCCCCTGATCCTTTGCACATGAAGCACTAACTAAGACAATTGATCT
CTCTCTTCCTCAAGTTATCCGTTGTCAAGATCACCCCATCCCTGTGGCTAACCATTTGAAGAAGCACACCTTACTTGGTACTCTAGGGATCCATATCGCG
GTATGTGGGAAAACAATCTCCTCTCTCACCAAAAGATTCACATAACAGGACTTAACGAAAAAGACTCCATTTTCCCCACTGCCCATTTCTAAACATACAC
AACCCATAGTAACTTTGTTGGTGGAGGAATGTCCTAAATTGTTTTGTTAAGTTGGTAAAGGAGGAACTTCCTAAATTGTTTCAAATTGTAAGATACTCAG
AACCAAAAATCATACCATATAGGGAAGGCAACTCATGGAACATCATATTTATGAAGAAAAAAAAATTGTCCATTCCTTGAATTATATAAGAGAGCAAATT
TCCTTTTTGCACTCTGTGCATCCACTTGATGGCCTATCAGTGATATATTGACTTTACCCCTTAAAAGAACAAAAAGGATTCTTGTTACATAAATGGACTT
TGACCATAATTCAACCCTAAAACCTATCTCACGAGTTAAGTATCACGCAAGGATGTATAAGAATACTACAACACGTTTCCCCAACCAATGTGGGGATATT
CTAACACTCTCCGCTTGTCCAATTTTGGACAATGGGAGTGGATAAACATAAAAGGGGGCCCAGCACTGGATAACCAAAGAACAGGTATAGGTCTACCTCT
AATACCAGGATAAGAAAATGGACCTTGAACCTACTAAACCTCAAAAGCCAGTTCATGATGTGAGGGGATTGTACAATACCCTACAAAGAACTACAGCTCA
TTCTCTCAATCAATAAGCAAGAAACATCTCTGTTTGATTAATCAAGAAAAATAGTTAGAAAGGAAGATGCAGCAGTCGACACCCTGAAAAGAAACAGAAA
TTGGAAGACAGAGAAATCCATAGATAAAGAACTATGAAGCTCTAATATGACATGTCAAGTATACCTCCAAAATGGAAGGATGTGTACACCTCAGGAATCC
TAGAAAGGCCGTTCTCAGAGAATACTGAATGCTGGCAGCATGTCCACCCTTTGTCATCTCAAAGTTTGGATCAAAATCAAGCAATGCTGATAAAATGTAG
TTATAATGGATAGGTCGCCTCCTTGCTATAACTGCCAAACTGGAAACAATAGTAAGAGTTATCAGATCAAGTATGAAGCAAGACAAATAAATAATACAAG
TCAAAGATGAAACGATTAATTATGAACACATATTCAAGGAGAGAGCAAATAGAAAAGAAAACATACTGACATTATGAAGCAAGATTACAACTTCACCTCA
ATAATCTACCACAGATGAACTAGTATTCGAACATAGAGAACTACCAATTTATTTTAATTGTCCACCTTTAATTACAAAACTAACAAATGCACCACTGTGG
TTTATCATAAGCAGGCAGCAGGCAAAGTAACCCCATAAGTTACAAAACAAAATTTACCATGATACCTAACCCAAAAGATATTTTTAGGGTTACCGCAACC
CAGAAATAAGCACAGATAAGCCCTACTAGTCTAGTGGCACACCAAAGTAGCTTTTTCTTAGGACAAAGTATCCTCAGACCAGCATACAAGTTCATTATTC
AACTCCTTACCATCTTTAAATTTTACATCTCATAATGTTGGATCTTAGAGAAAACAGCTGGCTTCTCTACTAGTCTACTTGATGCCTGCTGTTGCAGTAT
TTGCATAGAGAACAATTGCAGAAGATCAGAAATCAAGGGAAATTGCAAAAAAATCCAAGCAGAAGATATCAGTAATAACTCTAGCCAAGGAAATCCTCGA
ATTGTTAAAGGCAGTATGGGAAGATGGAGGTATAGGCAAAAGAGAAATTGAGACATAATTGGAAGTTCAGTTAACAAATAATTTGAATAGGAAAAATTAA
CTTTTAGCTTGGGATGCACTTGTAAGCTATACTCTATTATTTTCTATCCTTCTACTAGCACACACATTTTTCTCAAGCAAAAACTACCTGAGCAATATCC
ATGTCCATATCTTCTTGAGACAAGTAACACAACATCAAAGAGACGTTTTTACACACGATCAAGTACGAATTACTGCTATCTGACCAATTTGAAAGGCCAA
CCACAACACAGTTTTGCTATTCCTTATACCCTAAATGCCTTAGGAAAGAACCACGTAGTAAGATGTTGAGTTGGGAGAGAAGATGTTAAAGAAGAGAATA
GGATTGTTATATTGCGCACATCATAAACAACAAAAACACCCAGTGAAATCCCATAGGTGGGGTCCGGGGAGGTAGAGTGTACACAGATCTTAACCCTACC
TCATGGATGTAAAGTGTACGCAGACCTTACCCCTACCACATCGAGGTAGAAGTGTTGTTTCGAAGACTATCGGCTCAAGTATCGCATATCAAAGAAAGTA
AGGTAAACAAACATACAGATACTGCACACATCATACGAGACAAAAATGTGTCCATCATACTCTATTACAAAATAACGTCTTGGACACATTGCATGCTAAT
TATGCCATTACACATTAAGGAGTCTTATATGCATACCTCTAAACAAGGATACATTATTCACTAGGAAGTAGGAACAAGAACCCCTTTGTTTTTTCAACAG
ATCTATACTCAACCACAACCACTAGATTTGTCTATTCTTTTACAAGTACATCTTTTTATGACATATTACTATAAAGCATCAGGAGACATCAAACACAAAC
CCATATAAGTAATTCCGCATCTTCAGATATTATACAGCAGGATGGCCCCTCTATTAAAACATTAGAGTTGAGAGGTTCACCGGAAAAACTAGATCTGTTA
CAACTATGGTCAAGTAACATTCAGTGACCACGAACAATCACAATAGAAGTTCAACTTCAAACCAGGCATACCAGAACCAAAATTTGGCTCGCTACTGCAA
ACGAAATCACAATATACACTGACCAGTGTTGGCATATAGACTAAATCATGTCACCATTTTCGCTATCCTATTTGCAGGTGGTCAAAAGATCCACCCACTA
GAATCAGTTGTAAGAAACCAAACAGCTTGATTATTGTAACAAATATTGTAGTATCAAACAAATATCTGAAATATGGAGAAAGATGAAGCTCAACTCTATA
AGAATTTCAGCTAACTCTTCTGTTGAAAATTGGGAAAGAAAACTAAATGGCATGATCAACATTTTACTCGCTGAAGCACTTTGTACAAGAGAATGTACAT
CAAACTTTAGCTCAAAGAAATTTCACATGTTTTTGCTTTTGAATATACAAGCATTGTTTCTTGATCCAAGATACTTTCACAAGATCAGCACTAATGCACT
CTACAATGTACATCAAACTTTAGCTCAAAGAAATTTCACATGTTTTTGCTTTTGAATATACAAGCATTGTTTCTTGATCCAAGATACTTTCACAAGATCA
GCACTAATGCACTCTCTTAGACAAATTCCGAGCATGCAGTTAAAAAACATATATACCCCACCAAAGACAATCTGCTGCAAGAGAGAAAGCAGTCCATGAA
GTGAAGGATGTCAAAATACTAGGTTGATACTTGATAATGATAGTTCATTAAATTTTCTTCAAACATTAATTTCATTGTATATTAGGAAATATGGTAAAAC
AGGAAACTGGAGGTGCAGTCTCTCTCTCTCTCTCTCTCTCTGTGTATGTGTGTATATACACAGAGAGAGTCAATCAGTTATTATGTCTCCATGGAAATAA
AACGTCCTAAGCAAAAGAAGATTATCAGCAGAAATCCTAAATCTACAAGAACACAAAACAAGGGCACTCTAAAACCATACTATGTAGTCAATTGGCTATG
TCAACCAACTAGCACCCACAAAAGCCATTTTCTTCGTCCCCTGAACTCATGTCATCCTTTAAAACAAAGCAAGCATGAATTCTAAGCTTGCTATGAACTT
GATTTTAGAAATTGTGAGTCACACCATTAGTAATTTGATCAGACCAATCACCCAAAATAAATTCAACGTGCATCAAAGAGTACACCATATAATTTATGTT
ACCTAGGAGAAGATAAGCCACAAAAACAATCACAAAAGGTCAACAAAGGGACAGCTGGGTGATTGCGGCATAGTAGTAAGAAACCGAGACCAGAGGATCC
TAATCCAACTACAACACTCAGAGTAAGCCCATCACCTTCAATCTAGGTGGGCAGGATTAACTAGGTACTAGACTTGTGAGCTGTAGCAAATAGCTCGGAG
GATCTACTTCAACCCCACTAGATTCGGATTCAGCTGACCATATATTATCTTCTATTGATTACGACAACTAGGCTCGTGTTTTTCTGGGCACAACCATCAT
AATTAAGAAAAGATGCATTCAAGTAAACACAGTGGTCAAATGCTAAAACGATACTTTATACAACCTTTAGAGTACCTGACACTTACAAATGGCAAGTAGC
CAGCAAAACCAGAACAAAAGATGAGAAAAACAGAATAATCTATGTACAAACATGCAACATTTTTTCAAATGTCTTCTGCGTAATGCTAAGCGTCTGGAAA
ACAATTATCTGGAACATTGTCCTAGCACAAATTAACGAGATCTTGTTCCATATTTCATGCATCAAGTAAACATGCTCAATCAACCAGCTAAAACTTAATA
CATTTAAAACATGAATTTTGAGCAATTTTTTCATCTGAAACTATAATGAGAACAACTTCTTAGAATTGGTAGTTACAGCCTTACCAAATAAGCGCAAAAA
GCTTCAGTTGATCATCCTCAGTTTATTTTCTAATTTAATGTGTTGCCATAATGAAAGCCATCAAGTTCATCATTTAAATGTTTAAAGTCAAGCTACTTGT
TACATGCATGATGTTAAGACAATATTGTGCAACCTACTATCCAAACTAAATGGAAGTACGGTGTTTAATCTTTGAAAGCAGCTAGATAAAACATTTCTAA
TGGTAAGAGAACAGGCTTTAATGTTTAAACAAGTTCAACATCACAACATGTCAGAATTTGACATTCCAAAGAAAAAGGAGACCAGAACAGAATGTCCTGA
TGTTGATGAATGTGCTCATCCTGACGGAAAGAGTTGCCCTGCTAAACTTGGTTAACATTCCTTCACAGATAATAGCAACCAAGACACTGAAGCAATATAA
AGATGTGCTCATAAAAGCAGGGAATTCCAACAGAACATAACAATCTACATGCAGCCTTCCCCAGAGTATTGGATTTCTCATTCAAGAACCAGTTAGCTTT
TCACCTGTTTCTGATTTCAAAATTCATAAGTAGAAAAGTTTTAATGAACACTTTGCTTATACCATTAATAATCATGTAGTTTTATTTGAAACAATGCAAA
GAGACAACATATTTGCTGGATATGCTCATGCTACAGCAGCTCCAGTATATACATATCACATGGTAATACACAATCATGATTGGGAGGAATTTAAATATTT
GACAAGATGAAGAAAAAGTGATCATACCACAGAAACAGTATCACCAATTTCTAAGTTCAAAATCAATGTGAAACACAGCATGTCATCCAGTAAAATTGAC
GACGTAACAGCAGCAAAAAGAAAACAGAAGTAAGAACAGAAGGTTTATCCAGGGGGAAAACCCTGTTGAAAATTAGATTATCTGGGTAATAAGAAGTGTG
TCAATGTTACAAAAAATAGCAATACATTATCAAACAATACTTGGAAGTGTCAGACACTACAAGGTTATGATGCCGTATGTACAATTTAAGAGATCAAAAT
TTGCTAAACTTTAATGTTGTCTTCGAAATGTACAGTGCTTGGTTAATAACTTGTCCAAACAGTTCTTATCCCAAATGGCGTGACAAATTTATCCACCGCT
TAATCTACCATCTGTCAATCTTGTGGAAATCAGCTAACTTTTACATCTGTTATCTGAACCATCAGTTCAGCATTCCAAGCAAAATGCCATTTTAACTCCA
CGTTAAAAAGCTGGGCTCATGCTGCAATAACAGCAAAAATAAGCAGTTGAACTTGAACTACAGCCATTACCAAGCATCTGTCAACTCTCCATAAATTCAA
AGTAATAAATCAAACAGCAGTCACTGCCAAAATTTTGGAGTCAGAAGTCTTATTTGGCTGGGCAATATGGGATTTACTGAGAGGTTATGACAAAGGATCA
TCAGAGTAATTTTTTCTGGCAAACTTAAAAAATACTTTTGGCAGGGATCACTGCCATAATTGCCAGTTACTGACAGAAAATAATAACAAAACTACATCAG
CTACCGTAATAATCCCAAATAGACAAATTATCTATTTGTCACATAACAGACACTTAAGTAAGTATGTCTTGTCGATGAAAGCAACCAGTAACACATCTCA
AACAACTATAGCAGGAAAATATCAACACACCAATTACTCATGTACAAGGCTGTTGTTAGTCTAACATAAACAATGACTAGAACCCTACAACATGATCTCG
CTTAATCATATTTGTTCACTTAGTTTGACTTTACATGAATGATAATAGTAGAGTTAAAATTAAATAATAGGATAAGAAAAACTTACCATAAAATAGAGTT
AAAACTTAGCCTCCCAAAGATTGTTGAGATTATTTAGAGATGACATGTGACACTTAACAAAGATAGATAATAAAGTAGCAGGCATATAAAGTACATAACT
GAATAAGATCACTAGAAATTTGACAATTTTAAGATGGACAAAAGGGAAGTCGTATGATTTCTTTGAGATAAGGGAGAAACATGGTATTTTAATGTCATCT
TAAGCAGGTGAGTTCTTCTTCTTCTTTTGGATGAAGTGAGGTGCTCCATTAATTTTTTTGGGTGAAGTTGTTAAAATGCATTAGAAAGGCATCATGGAAA
TGCTTAAGTAACAGCTAAACAGTAAGGTGCTCCATTAATAGGCATCCAAAAGATGCAAAAGTACGTGATTTTCTACTCATTTGTCTAAGGTTTTGTTGAT
ACAGTTACCCGGTACCTATACTGATGGGAGCTAATAGAAGTGAAGGTGCGCAAGCTGATACAGACACCACTCCACTGATATCAAAAAATATACACTTCAA
GTATCATGAAATCAAAATCGATAAACATGTTCTTCCTTTATTTCCACTAATGTATTTTAGATCAGTAATGTATCCATTTTTCTTGACTTGAAAAGTGTTT
TTATATAAAGATGAAATCAGCATCAGTATCAGCATCATAAAAATAATAAGATGACATCTTTTCCAGAAAAAAATCAAAGAAAGACAGATAAAAATACATG
AACCATAGTAAGTCCATCTAGGCAAATTACATAGAAATAAATGATAAGCATCTTGATGCCTTGCACCAGTTTGAGCCTATCCAACAAAACATACACAGGT
TCTGGTGCCAAATGTATTTGACTTAAAGATAACCTAACTTCACATACATAATATAAAAGATTAACAAAAGAAAGCTTTCAATGTATTACCATCTTATCAG
AAACCAAAAGAAAAACATTTTTATTACAAGAAGATCACAACGATATTGACGACACACCCACCTTTAAGATCAAAAATTTTCGCAAGGAAAAAACAGCCCA
TGTGTATGCAATTCTTAGTAGAGAACTCTACAAAAACAAGGTGATAATAACAGTACGAACAATGGACCTGCTCAACTGGTAAAGCATAAACATGCAGTAA
ACCATTCTAGGAAATTACTACAAGATTGACCCTGCACTGTAGTTTCAACTTGGCTACGTGCTTTAACAGCCATTTAAATTTCTTCTAATGTTTTTCGCAA
AGGTTAACAAAAAGAAAGCTTTCGAGTGTATTACCATCCTATCAGAAACCAAAAGAAAACAATTTTATTACACGATCACAACGATATTGAGGACACACCC
ACCTTTAAGATCAAAAAATTTCGTAAGGAAAAATAACAGCTTATGTATGCAATTCTTAGTAGAAAACTCTACACAAACAAGGTGATAATAACAGTATGAA
CAATGGGCATGCTCAACTGGTAAAGCATAAACATGCAGTATACCATTCTAGGAAACTACTAAAAGATCGACCCTGCACTGTAGTTTCAACTTGGCTACAT
GTTTTAACACCGATTTAAATTTCTGTTTTTCGCGAAGGTCCTAAAACATTAAACAGGGACCTACATTCACACTGTTGGATATACTGGTATGCATTCTTAT
TTTCTTAGTGACCTTATTCACTCCCTCAGCTCACTTCTTTCACAATACAACAGCACTTTATTTACAGATGTGAGTTAAGATTAATGATCTGGCATAAATT
TAAAATCTACCCTGACTAATATAAGCAGTTGCTTCCATAAAAGTTTTTGTTCTCTTTTGAGTTGCTTCCATTACCGCAACAACATTTTAAGTTTGAATGA
CAAAAGAGGAATACAAGAAATTTACAATGTAGTTAGACAATCACAGATGAAACACAGGCAAGTTGGCACCAATATCAAAATGAATTTTGCCTATCACCCT
GAAGTACAAAATAATTCACACATTCCGAAAAATTCAAAATAGGGAGGAGATAGAAGCTGAGGAAGGATGATTATTTACTAATAATGATGCTAATAAACAA
TATAAAAGAAAAACTTTTCCCTAGGAAGAAATATAATAATTCAACTATCTTCGTTAGACATGCCTTGTTCTTAAGGAGTCTTATCTTTCAAAGCATTTTT
TCATGATAAATCAAATATCATTTTGATGACACGCCAATTTGGTGTCAAAATCTATCTACTCAAGAAATGTCGAACCAAACCTTGTACCAACACTAGTTTT
GTCGAGTCTATTTTCTCAATCTCTATATTTATTCGCAAGAAAGACTCCTCTCCCTTACAGAAAAGGACGAATCATGCGCAAAAAGCTTTCAACTAGCTAA
AGCCTAGATGAACTTAGAATCATCCTGGAGATCAAACATAGCACTTATCCATGTGAATAATACACATTTTTGTGCAAAACAGATAAAAGCTCACCTATTA
ATGACGGATATGGTTAGTAAACCAGGGAGAGAACTAGCTGAGTGCAATAAATCCAATAGAACGCCAACTTTATTTTTTGCATCCGATGCAAGTGAAGCTG
GATCAAGAACAGGGTGATGACCAACTACCCATGAAATATTAAAAGTCCATCCATGTTTAGCTGCAGATGTGAAGAAAAGATAAATCCAAAGCACACACAA
TAACCACTAAGCAAACAGAAAAAATGGAAGGAAAATTGATGAATATAAAAATCTCATAGTGAATATTTTCTGATAAGTTACTATATATACTAGTTAATCG
TGAAAGATCTCCTGTACTCAGAATCTTCCGGCCTTGAAATCCTGTAAATGATTACCTTGTGCTCCAGATTTTTCTGAATCACTTGATGTGAAAAGTAGAA
TATATGTTTCAAGGAACTTCGACGCCAGCAATTTTGTACCAATAGGGACTGCCTGTAAAAGAATATCCAAGAAAAGCATGTCATTTGCATATGCCAAACA
ATTAGCAGAGAGACATCCCTAAAACATATCAGCAAGGCCTGAAAATGAATTTATTTATTCTTCTATTTCCTTTGCTATACCCTCCTGCGCCCAGATATTG
ACAGAGTAGAAGACAAGAAATATAAGTCTGGATTAGGAGAGCATTTGAATACATATTTCACAAAGACATCTCATTGTTACTAAAATGTAGCTACTTCCAA
AACTGGCTATTAAATGAGATTTAAGATATTCTTTGTCCATAAAGAGAGGGAGAGTGTGACACATGTATGTCCATAACAGTCCTGTTTTGTGCCCAAGCTT
CATTAAGAGGAAACAAACCAGAGAGCTGAGCTAAGCAAGTAACAGGACATTATCTTGCTTACTCTTCCTTCTTTAAAGAGACGGCTACTCCTGTAGTAGC
CCAGTAAGTAGTTACATATGGTAAAGAAGATTGTATCTACTGCACCACCCCAAACCAACATAAATAAATCGATGGAGATCAAGGCATCTAAAAAGGGAAT
TACCCTCTCAACAGAATATAATGTTATTGACTGGCTGTAACTAGAAGATATTAGGGCTGATGTAAGTATAATTTTTTGGTGGGGAACTACACTTTGATGT
AGTATACCTGTGGATATATAGAAGTAAATGTTACCTTTCTCAAAAAAAAGTATATACATATCCGACGGCTGGAAATTCTTGCATAATGTTGAATAACATT
CACAAAATATTATTTTTACTCTTTGTATGTTCACAATATATCATGATCGTCTTTTATAGAGTACAAAATACCATGATCTATTTATGTCCAATATAAAGTT
TAGTGGAACCACTAACAAGGAAAAACAGAAAAAAGTTCACCAAAGGAGAAGAAAAGGGCAAGTATTAGCAAAACAAATTCCACGTTGCTGTGAAGATGAG
TTCAAAAAAATGAGTGATAGCCGAATTGATTACCATAGTTAAGTTCACTAGCCAACAAGTACCCACTACATGAGCAGAACAAGATACCTCAAAAATAATT
CCAACGACAGTATCCTTGAATTTGACCATCCAAGTCCAGAGCTCTTCAAGCCACCTTTCAACTATACCGTGCCGGTGAAACTATAATTTATAAAAGAAGC
ATTTAGATCTTTGAACTTATTAGGGAAGAAGATAATTGTTGTGAAAGAAGGATAAATTAAACATGTTATAGATGGTATGTCGGAAAATGCACAGGGACAG
GGAGGATAAAACTTAACGAATCAACACTAGTAAATCAATGCATTTTGACACATACTGAACAATTAAGAGAAGGGTTTACTCAGATTGAACTTCTCATGCC
AAAGTTCCAGCTTTTGTATCAGTATAAGAAAAATCACTGGTCAGTCATCCACACCAATACAATATCACTAGCATATGTATGGTACTATAGTATATGTTAA
CCACCATCACCCATCTAGCCAAGACCTGTGCATAGCGGCCCAATGGGTTTATGCAGTCCCTGTCAGGCTCAACCCTATGCTATTGCTACCACATTATGCT
CGCGAGTATTATTTTGAACTTCTTTGGGATATTAATTCCAAGTTCCAAACTACTCATCCTGATCCAAGAAAAAAAATCTGAACTACTCAAAGTGAACACG
TTTGTATTCTCCTCTAACAACCACAAGTAGCCCACATGAACGTCAAAATTCAGACCACTCATTTGTCCCTTGGAACTCCTCCCACAAAGAAATGACGGCA
GCGGAACAGTCAACTCATCCGATGGGTACTTTCACCGTCCTAGAGTGAGTGAGTGACATTACACAAAATACAGCTGGTAACCCCCATAAACATCCAAAAT
ATTTCTATCTTACCCTTCTATTCAGATTAATACAAATATAGTTCGAACACATAGCCTAATACCAATTATGACAGAGATGTGATAGAAAAACTGAAGTACC
AAATACGGAACCTTGCTCTAAATCAATTGGGCTCCAAAAAAAGTCAAAGCCATCGAGTTCACTGAACCACATAACTGTACAAACTCAAATTCATTGGAGA
CTGAAAATTTCGACTTCTATAGAAAATCAGCCCCAGAAAAACAGTCTCGCACACCCAAACTACATTGTGGATGATAAAAAATATAGTTCGAAGACACAGC
CAAATCCAACAATGACAGAGGTGCTATGAAAGAAAATTTTTGAAGTACCAACAAACAGAACCTCGCTCGACAATAAGATTTGATGGAACTTGTCATACAA
AGTTATTGAAATAATAACCCGGCAGAAACTCAAGTTCGTTGAACTTTTTTCCACATAATTAATGAGAGATAGCATCAATTGAGTTCACTGAACTTTTTTC
CACATAACTGTACAAACTGAAGTTCATCGGAGACTGAAGGGTTGAACTTCTATAGAAAATCAATTATGCAATCATGGCCTCAAATTACTAAGAAGTCTAG
AACTTTAAACATAACATCATTAATTAAAAAAAAAAGTGACCTAGTGCGCAAGCCTTGCACAGAAGAGACAGGACTTTTTTTGGGATACGAGCTGAAAGTG
ACCAAAGATCCCCTCAAAAGAATCACAACCATGATTATAATGAAACAAGCCTATGTTGGATACGGGCTCAGTCAACAAGCTACAGAAAGAACAAAATCAT
GAACAAGTGTGTAACCTGAGATGATAATTCCTCCAATACACCACAAAAGATTTTCATGCCAGATATAACTGATTGCTTTGCCACCATAGAATTCATATCT
TTTAAGCATGCAAATAATACGGGCATTAATACCAACAAATGTTCCTTTGCTTTCATCCCAACCGCCTCAATTACCCTGACACACGTACAGAATAAAGTTA
GAATGATGAACACAACATGGAAAAGAAACAATTACACATAAAATCAGAATACCAAAAGCATGCAAGCACGTCCTTTTTCAACCATCTTCTGGAATCAGCT
AGTTCCAACATATTAACTACTGATTGCAACAGCAAGTAATCCTTTTTTTATGTTTTTACTTTGGTATACCGAACTCCCAAACTCTTGGTTAGAAGTAGAT
GGCTCAAACAGTAGATCAACCTTCTCATGTCAAGGGGGTAATCAAATTATAGCAGGACTTACCTTTATATATGGAAAAGAAAGTGTCAAGCTGTAACTTT
CAATCCTTGTCTATCACAAAATGCAACACCTTCCAAACACATATTTAGTCCTAAATAAGCTT