BAC Sequence – LE_HBa0163O04

>C07HBa0163O04.1
AAGCTTACCGCAGACAAAAGCCAAGTATTATAGTGGATAAGTAGACAAGCGGGCCAATCAAGAGATTTCTTGATTATAAGAAAAAGACATGCGAGATTCA
AACAGGTAAACTAACACACAATATATGCATTATCAAGCAAGCCTAACTAGCTTGTAAATGAATATCTTAAACTTATACTAACATATATATATATATATAT
CAATGTATGTGTTCATCGGTTATATAGCCTAGAAGGCCAGGGTTTTTCTCCCAAAAGCCAAAGGAGAAGACACCTTTTTCAGCCTCACTATAGGCTGCTC
AACTCAAAGGGAGTCCTAACTTTTCTTTTAGAATGTTCACTCAGTAAATCTTCACATCCTTGCCCAAATATTAATTTTCCTTAATATAATTACCCTGTAA
ATGTTCAAACGCTCCCCCCAATCCCACCCCTATTTCCTCTATGAGTTACCACTCTCCCGAAAGGCTGCCACACAAAAGAGGCACAATCAATCAATTAACT
ATACAAACTTGGGGTCGGTTATGTGAATCCTCCTCGACCATTTTACTCAATTCTTGACTCGAATCATTCCAAAACTACTTCGCATAAAAATATTTTACCA
TATAGAAAATGAAACCTTTACAAAAATCCAATCTTTTTAAGGAGTCCAAATTAAAAAAGAACACCCCTTTATAGTAAATCACAGTTATAACCCAAAAAAT
TCAAAGATACTAAACCACATGGTTTATTAAGCAATGAAATACCTCTAAGCATGGGTTTATAGAAACTAAGAGTGTCTTTCCACCTTCCTTCTTTAACACC
ATTAATGCTCTCAACACATTGAGATACTTCTGTCAGTATTTGACTGTTCACTGTTGTCCCTGCATTTGGTTGCCAGTGCAAAACCCTAGCAAAACAAAAA
TTGTACACTTAAAACTACTTAATCTAACACAGCAAAATCAACAAATAACGTTTAGTTTTTAGTGAAATTCAAAATCCTTACCATTTGATTGGCATTCTGT
TGATTGCAGAAACAGTTCCCTTTTTCCTCTCACCGGGAGATTCGCCGGAGAAAATTAAACCCCAAATTCCCTTTCCTCTTACCGGAAAGTTCGCCGGAGA
AAATTAAACCCCAAATTCCCTTTCCTCTTACCGGAAAGTTCGCCGGAGGAACTTACACCTGAAAATCCCTTCAGCTCTTCTCGGTGGAAAGAACTAAGGT
GATTCCTGAAAATACATATGAAAAAAGTAAAAAGGAAAAATAAATAGATTATATTAATTTAATATTTTAAAAGATATTATAAATTTCAATTTTTTTAATA
TACTAATATGATGGAAAAATACATGGTAAGATATTAGTTAAGATTATAGTCGTTCGACTCTGAAAAATAAAATATAACAATTAAAAATGAATTAAGATAA
TAACATCGAGAATTTTGCTTTATTAGTTATAAGTATTTTATTGTATATCACAAGGGTTTGAAATTGAACTTTTATCTAGCTCAACAAAAGTTCTATAAGA
ACTAAATTATGATTTTTACGAGAAATAATTTGTACTGAACTGAATTTTCACCTTATGATATGAAAATATAAATTTATGTTGAACAAAAATTATTTGTTAC
TTAGGTGTCCAAGATATTTCGATCACTTATTTTTTACTTTAAAATATTAAAAGTAAAAAAAAAAATTTGAGGGCAAATATTAAAAGAAATTTTTTTATAA
ATTGATACATTTTAATAAATAATTACTGATTTTATCGATACTTTTTATTTATTACTATTTATAGCAATATTATGTAAAATCTGTAATATGAATTAAAGCT
GAATTATGTATGCAATATATATGAATTATAATTGTTTGGTAAAAATTTGACAAATTGTATTATAAATATATTAAAATATGTGAAAAATGTATTATTCATC
ACTAAAACTTGTATCATATGTGAATAATATAAATTGTTCTTTGTAATATGCATTAAAATTGTATTATAAATGAATTAAAACTGATAAGTGAAAAATTTAT
TATTGTTATGAATGGTAAATATTTTTTTATTGTAGTATATTTATGTAAGTTTTTCATATTAAAAACCAATAATTTTGCACTAATTGTTAGTACCATATTA
GTCCAACAATCTATCATATAAACTCATAAAAATTACGATATGAGTAGTAATGGAGTCAAAATTTTCAATCTGAAGGGTTAATATACACATAAAAAAACAA
CAAAAGCAACAATAATTGAATGAGAAAATTTGAATGAGAAAATTAACACACTTTATTATCTGGGCTAATTCTTTGCCTCAAAACTAATATAGTGATAGAC
TTCTTAGATCTAGCAAGAAGAATAAGAAATATGTGCCATGAGCCTAAAAATTCTGGTTCCGCCTCTGCCTCCTTCCTTTGGTACTCTTGTGTAGCTGTGG
TCAACCAACTCTCCCTCGATTATTTCTTCAACATTTTCTAGGAGGTCGATAATTTGTTGGGAAATGTCAATATCAATCAATAACATGTCCTAAAAACGAA
ACACAGGATAAACCAAATGTATTATCGTCAAATGAAGATAAATTCTACTTCAATCGATTTACATGTCCCTATAAATCAAACACGAAATATATATAGAAAC
AAACAGGTAAGGTCTGCATACACTCTAGCCTCCCCGGACTCCACTTATGCGATAACACTGGGTTTGTTGTTGTAATTACGATGTCTTCAACATTACTGTA
CATTCAGTGTGTTCTCAAGATAGAACCTGATGATAGCATCCTATGTTACAGTAAAAGTAGAACTCGAGATAATCAAACTTACAGTACGAGCATCATTTGA
CAAAACATCCCCGTCAAAGACGACCCATTATGATGTACAATCTTGGCTGTACAACCCACAGTGATTGATCATATCTTCCATTTTATGAGCTATATACTTC
TTTCCTATATGCTCGTTAGAAACTCCTTGGTGAAATGTGGTATTGTGTCAACCAGACATCAACAAGGGGGCGAAAAGAGTCTATTTACCTTTACAATATT
TCACAATGTATTCATGGCTCTATCTATTCATTAAAAAAAGAAAAAAGAGTTCTACATCTCAGGTGAACAAATAGGCGTGGGGAAGAGTGAGGGGTGGGGT
GGGGGGGGCCTACGAGCCCTCTCTCGTTTGTTGTTCACTCTCTTGAACACTCAACCAATTGAGTTCAATATTATGCACCCAATGCTATTATACAGTTCTA
ACAAAACAGCGCGCTGCTACAATTTTTAACTAGTTCAGGACCATAATCTGGTAGACCACGTAAAGTTATAAAAACTCCGCTCCTAAGGTCTAAAAAGTGG
CAGCAAGTTCCCCTTCCAATTCCCAGAATGTTCTTGCTGATGATACGCACAGGTTCGGTAATAATGAAGTAATTTCAGTGAAAAATGACACAATCAACCA
AGTCGAAACAAACAACTAAATGGGATCAGTACTGTAGAAAGGAGACATTCAAGAGAAGTCCCTCGAGGTGTCTAAAACTCCATAAATGAAAATGTCAAGG
TGATTTATGTTTTCCTGTGCAGATGCATGGTTTACGTGCAAAGTAAGATGAGACAGCTCTATTGTGCAATCCTCATATCATAGTATTCAGATAAATAAAA
GACCACCGAATGATTTTGAAGGAAGATTGAGTGACACCCAAGTCCAACATGATTAGAAGGCATAAGCAGGGACGATACCAAGAATGGGCTGTGCTTATTG
GGAAAAGATGGCCTCCACTCTATCCAGTGACGCTTGTAGTCGTCCAGAATTCATATTGAACAACGGTTCACCAGTGCCTAAAGCCCTGAAAAAGAAGCCC
AAAATTTCATGTTAGGTAAAAGTGCCACCAAGTTTCGGTCAGTTTTATATCTTACAGTAAGATATCGTTAAGCAGGTGAGTTTCTTTAAAGTGAAGCGCA
AATGAGGATAAAGTAACTTGCCCAGTAACTTCTGGAAATACATAATCTGCTTTCCATCCAAAACGGAAATCCACACCAGGACATAATCCAAGCGATGTTT
TATTCCGGATGCTGGAGATACCATCTCCGCCGAAACAAGACGTGAGCTTCCATTTCCAACCTGTTGCCTGCAACTTAAAGCTATGGCCTACACCAACCTG
TATAAATTCAAACGGTTACCCTATAACTTTTATGCTGATAAGAAACGGAAATAGTATAGTGTAGGGAACAAAGTGAAAAAATTCAACCTGAAGATTTAGA
AATTTTGTCACCGGGATCTTCTTGGAAAGAAGGCGGACTTCATGATTCAAAGGCTCATATATGAACTTCCATCTCCGCTCAGGGGCTAAAGGTTTTAAGA
CCAACTTAGCCAGATATTCATTGTATGGGGCATTGTAAAACTAGTCAAAAGGCATCATAAAAGAAGAGTTAAAACTTAAAACCAGAAATACCCAACAGAG
ACACTAAGTTAAAATGCTTGCTCTCAATGTCCTTTCAGGTGATTTCAGCAACAACTACAGCGTTACAGCAGTAAATTTGCATACTACAATTCAGATTTCA
GAATTGTGCATTAACTTTTATACTAACGAATTGACTAGAATAAAGCAGATCGCATATCACCCAACAACCATCTCACAACAGATTATTTGTAAAGTATCCA
ATCATTAACGATAGCAAACTCTATATATTTGAGTTTGCTCATATTGCCAGTCTCAAACTTGCATGAAGAGTTGCGATTGGTTCATAGTCAACACAAAACA
AGTCAACTTTTGATAATTCCTCACAATATAAAACATTTTGGACATGCTCAAGCACTGAGATAAGCTTAGATCGAGTGACATGGCAAGTGAGGATTCATAT
AGCCAATCACAACCATTCAACACTTACTCTGTTTGCAAAAGCTTAAATCGAGTAATACAAGTGCGGATTCATATAGCCAATCGCAACTTTGGAGATAGTT
ATTGTTGAATAACTATGACATAAATACTTATTGTGTTTGCAAAAGTAAATTGCTCCATCTCCATCCAAGGAATAGATGATTGCTCATTCGTATTGACACA
TACTAACAAGTGTAATTTATCCGAGTTAAGCTCAAAGTAACCCAAAAACGACTTGAAACTTTTTTATACAATTGTCCCACTAAACTAATTTACAAAGGAA
GCATCAAGGAAGAATATAGATGGTCAGCGAGTACACTCTACCCTCTTACATTGGGTTTGTTGTTGATAACTTAATATAGATGGTTAGTGAGAAATCAGTA
CCTCCAAGTTAACACCAACTCGATAGCCCTCAATTTCTTTTCTGAACTTGAGAAAAATCTCCGAAGGCATCAGATTGACATTGTAAAGCTCATCCCATGA
TTTAGGTTCTTCTCCACTTTGACTCAAACCGCCCTCCTCCATTCTCGTACCCGAGAATCAATTCAAACTGCAAATGAATCAACAACCAACCACCTCAAAA
TCAAAGTGCTACACATCAAAAGATTGCTTTATATGTTAAATTTGTACTAGTTCAAAAACTTAATGCCAGTATTAAATCAAACTGCAACCAGGTCAGCATC
CAAATGCCACAAAATCAAATCTTTACACTTAAAAGTGATTTCTCTATACATCAATTCATACTTGCTTTAATTGAATCCATCCTCACAACCTATTCAACTA
CAAATGGGTCAAGACCCAAACACCTAAAAATCAAATCTTTACACAAAAAGATTATTCCCCCCCCCCCCCCAATATCAATTTCATACTTGTTCATCAAAAT
TTTTAGGCCAAGAATCAATCCAAAGTCCAAACTGCAAATGCCCCCCCACCCCACACACAAAAAAAAGAAAAATCAATCCAAAGACCAAACACCTCAAAAT
CATATTCCTACACATACAAATGATATTCTATACTCCTATTTAAACTTGTTCATCAAACTTTATATGTCAAGAATCAATTTAAACAGCCATAACTATCTGC
TACAACTCTTCACACATAAAAATGATTTCTTTATGTATTAATTCATACTTTTTCATCAAATCTTGATGCTAGGAGGAAAATATGACAGAAGGGTTACACA
GAAAAGGGGTTCTGCATATAGCAAGTAAATACCTTGAGGATAACTGCAACGGAGAGAGAAGAGAGTGAATTTGAACTTTAAGAATTATAAAAAAGGGTTT
AGTTTTAATTAATAATAAATATAGTTATTTTTTATTTACATAAAAATAACTAAAAAATATGCATTAACTATATATATATTATAATTTGTCAAAAATCAAA
AAATAAAAAAAAAATAAAAATATACACTATACAAATCAACAATACAATATAGTAGCTAAAACTGGCCCGGACTCTGGATCATTAACATCTTATTTGGATG
GTTTTGTTAGATAAATTATATTGTATCGTATCGTGTCGTTAAAGATTTATTTTATATATGAGAGTATCTATTAAAGAAAGGAATAAGTGGAGTATAAGGA
GGATGGTGTCTCCACAAACCTTATCAACGACAACTACTACGATCATTGACATCGATCATCACTATTACAATAATCACCAATACAACAATTAGATATTCTA
TAAAATTTCGCAAGTGAAATATACAAAGAATAATGTGTGCACAAACCTTATCATCATTACAAAATAGAAAGATTCCGATAGACCTTCAACTCAAATAAAA
ACATTACAAAAATAATTTGAAAATGAAGAAGGCAAGACAAAAATGCTAAACAAGTATGACAAACACACTATCTAACTAAATAAATAATAACAAGACCCTC
AAAGATAAACTATTAACTATTATTACAGACTAAGCAAAATAACTCACAACTACCTAACTAATTATCTATCTACCCATATGTGTTCTCCGTAATATTCTAT
CTAAGGTTGTTTCCTTAGTCAGCTAGAGTTGCGTCATGTCTTGTCTAATCACTTCTTTTGAGTATTTCTTCGATCAATCTCTACCTCTTGTGCAATAATT
CATAACCAATCTCTCACACCTCTCCACTAGTGCAACTCCTCTTCACATGTCAATCCGAACTGTTCCAACCTTGCTTCCAACATCTTGTCCTCCATTAAGG
TCACTCTAACGGAAGATTAAATCTTATCCATCGATTCGATGTCGGGTCGGTAGATAAGATCATGACACGTCTATGTCAGTTAATATAAAGGGTATATATG
TTCTAGTTTTTGGACGGCAGAGCCACCTATATCCCAAAAGTATGACGAAAGGTATCTGCAAAGAAAACCTTTTCAGCTGAAGGTGTATCTGTGTGTTGTT
TCAATGCCGATTAGCTATATGAACCATGGGGAAGTTGTCGATGGTCGATGAAGGTTGTCCATTCAGCACATTTTCTGATTTTTGTGAAAGATTTCTTACC
ATGCCTTGTGATCCTGAAGCTCCATTCTTCCACCTTTAAGGATAATATCTTGCTTGCCATCTGCGTGCCTTGTATATTATTCGTGATCGTGTTATATGCA
CAAACAGACACTTTAACTATCCAACTTTTAAATAAATAAACTCATGAATCCTAGGACACCACATTGGACAAAAAATGACATGTAGGATGACATGTGTGTC
TATTTGTTCAACTTTATACAAGTTTAAGTGTCTACTTGTGCACGCCCAAAGTTGAAGGACATAAATGTGATTCGAAGCCAAGTTAAAGGTCATGTTTATG
AAATATGCCGTTTATATATACTCAACAACTCAAGAAGCGTGAGTATTACCTCTCTACCCTACTGCTTAATTAATTTACAAACTAAACTAACTAACTCTAA
ACCTTTTTATGGCGCTCGCTGCTAAGTCATAAACCAAGCCAGGGTCCATGGCATGGTTTGACCATACGTGTCCTGATCCATAAGCAAACGATGCACCATG
GATCAGGACACATATGGCCATACTTTTTGTGATTGCAGGGCCAAAGAAGTGGTTTATATCTGCAACATCAAAACATGTTGAGGTGTTTGAAGATTAGTGC
AAAACAACATCTTAATAATATGTTCCCTTGACAATCTATTAGTTGTGTTTTCTTTGAGTTTCTTGTCAAAAAGCTAGCCAATAGAGTTATTACTGGCTAA
TGTTTTGTAATATATTCATCTAGGGTGATAAATAAAAAGTTTAGTTACCAAAAAAATATATATATATGTTTCTCATATTTTTATTTTATTTTTGATGCTA
TAAAAGTGTGGTTAAACATGTTTGTTGCATTTTTGCTCAAAATATATTTGATATCACATTTTAAAGGTGATTTTACTGGCAATAATAAATGCCGCTAGAA
GTATTTACCTTTAGCGGCAATAATAAATGATAAATAATTGTCGTTTAAGACTTTAGCGATATTAGATGTAATGACAATAGATTAAATGTCGGTAAATGTT
TTTGTCCGCAATATTTATTGCCACAAAATTAATTGCCACTAAAAGGAAAATTATAAGTATTTGCCTTTCTTATAACCTTTTCATGACCATGAGATTTGTG
ATTGAAATGTTCAATAGCTTAGTTGATTTGTTGGTAACTTAGTGCTTATGCTAATTTTTCTTCACATATTAGGTGGAAGGCTCCAAAAAATGGTGTTATC
GAAAGAAAAAAGTGTTATAAGTCTGAGATAAATAACTTCTCAATTTCATATTCTTTCTTAACTTTTAGATGGAATTCATGAGAATCAAATGATTAAGTAA
ATCAGATAATCATTTTCTTTTATAAGATAGCAAACTAGCTAATTACTGATCTCAACAAACTTAGCAAAAGTAAGATCAAGTCCATCGTTGACCAATAGAA
AGGTAATGACATTTTGAGTAGGTTTTCTAAATATTAATGTCATCTGCTTTGATCATATCACAAAAAATTCATGGACTACAACACATGAAAATCAGTAATA
TTTGTGTTTACCTGTTTTGAGGCTTGTTTGAACTTAAAATGTGTCAGTTTTTCCCGCGGGACGAATTGGGTCCATTGCTAAGGTCTTAACGGACGTCCAT
GAAAACAAAATTTCAGTCATTTTGTTTCGGAAATTTCAGATCACAGAAAATTCATGGGCAATAGCACAAGAAAATCAGTAAAATTTACGCTTACCTTCTT
TGAGGTTCGTTTGAACATTAAAATGCCTTCGTTTTCCCTACGAAACAAACTGGTCCATTGCTAAGGTCTTAATGGACGTCCATGAAAAATTTCGGCCATT
TTGTTTCGAAAAATTTCATAACACAGAATCCATGGATTATAACACATGAAAATCGACAAAATCTGCTTTTACCTACTTTGAAGCTCGTTTTGACTTTAAA
ATGCGTCTATTTCTCCCGCGGGACGAACTGGGTCCATTGCTAAAGTCGTAACGGACGTCCATGAAAAATTTCGGCCATTTTTGTTTCGAAATTTCACATC
ACAAAAAAATTCATGGAGTATAGCACATGAAAATCGATAAATTTTGCGTTTACCTGCTTTGGAGCTCGGTTGAACTTGAAAATGCATCTGTTTTCCCTTC
AGAACAAACTAGGTCCATTGTTAAGCTCTTAACAGACTTCCATGAAAAATTTCGTTCATTTTGTTTCAGGAATTCTATATTATAAAAAATCCATGGACTA
TAGCATATGAAAATCAACAAAATTCATTTATCTCCTTTGGAGCTCGTTTGAACTTTAAAATAAGTTTATTTTCCCTGCGGAACGAATCGCGTCCATTACT
AAGGTCTTTACGGACGTGCATGAAAACTTTTCGCCATTTTTTTTGGTATTCCAGATCACAAAATATCCATGGATTATATAGCACATGAAAATCGACAAAC
TCTGCTTTTACTAGCTTTAGGGCCCGTTTGAACTTTAAAATAAGCCCATTTTTCCCTCGGTATGAATTGTGTTCATTGCTAAAGTCTTAACGGACGTCTA
TGTTTTATCGAAAAATGGGTGATTTTCGAAAAGAGTTTGTTTTTCGACTTTTAGGAGTCGCCACTTAATTTTTAAGAAAAATCAAGAAAACTTTGCTTCT
AAACAACCTAAACAGAACAATTATTTTGAAACATTTTTTAAGGGTTCGGGATTCTTATTAGTGTCTTAGGAAGGTGTAAGGCACCTAAGATACTCCGTTA
AACACGGTTTTCCGGCGATTAACTTATTTGACTACTTTTTAACCTTTTGCGAATTTGAAGTTGAACCTTTATTAGAGCTTTATTTGGACAAATCTAAAAG
TTGAAATACTTATTGTTTTTGAGATTCTTTTAAAGTTAAACTTTTTAAATTTTAAACTCTAAACGAACTAGTGAATTTGAAACGTCCAATGTTTTAAGAC
TTAGTTTTAGCTTGATAAAATAGAAAGGCGTTTCGAAGGAGATTTGGATTTTTCTAGTCCTAACACTAACGATACTTTAAACAACGCACATAAGCAAGTA
ATAAGGAGAGAGAGAGAGATTTTTGGGTCCAAACTCGGGTACTGTTCGCCTTGACCGAGTTTTGGACCCACCTGTTTTTGGGTGTTTCGACCCATTTTGC
CACCTGTCCAAGTCTAAACATTACAAGATAAAATATAAGAGGAATAAGGAAAGGAAAATGACAAGGGCTTATGCCCATTACAAAATAAAATACGGAAACA
AAATAAAGAAACGTCTTCTAATCCACTTTGGATTCTCCTTCCAACTTCATGACTTGTACGCCTCTCTTAAGGTTGTCTTGCTTGGTAAAAGACTATGAGT
CTTTACGACTCTCTCGAGATACGGAGAAGGAGAGTTCGTGGTGAACTCAAACGGATTTTACATGCCACACAATAAACAAAAGGAATTAATATTCGATTCA
ACGGGCACATATACAAGAAAACAAACTAACTTAATAGAAAATGCATATCCATGGATAGTATCTAATCGGATCAATAGACACACGACAACATGTAACAAGA
AAGGTCGGACTAGCGCAACATGAAAGAGACGACAGAAGAGAAAAGTAATGACAAATGCGAGTCGACCCAAGGTAAATAACTATATTGAGGCGATTTTACT
TACCCAACCAAACAATGAACTTTCAATTTCACAGAACAAGGCATGTATATGGCAATCTTTGAATTTAAAATTTGACTTGTCGAACTAACAACAAAGAAAA
AGGACAAAACTCCAAAATAAGACATCACTATTATCATTCAATGCACTACTTCGCTTCTGTCGAACCCATCATCACATCAGTTTGACATCAAAGTGAAAGA
AAAACAAAAGAAGAAATAACAATAAAGATGATGACAGAAGAGTTTGAAGTGAAATTGGATTTCACTTCGACCAAACGGGTAACATCTACAACTCATTATA
AGCAGAATAACGAAGGATTCCCTTAGACTAATTCATGTACGAATACAAACAGGAGGAAGAAGTAGGAAACGAGCAGAAACAGACTCGGCGGATCGAAATA
CCCCAAACACACCGTTCGTTCCCTTTAAAACTTTATCAAATATAGGAAGTTGCGACAAAATCAAGCGAAGACAAGACAAAACCACGAATTTCAAACAACT
TCTGCAATACAACAAATTCACAGCAGCTAGGACCAACCTAAACACTAACGTACAAACAGCAAATACAACTAAGAGTCGAGGGTCAAGATGGGTGTTACCT
CTTTAAGTGCAGCGAAACAGGAACAGCGAGCAGGCGGAGCACCACTATCACGAACCCGAAATCACCCTCTGCTTCGCTCGTTCGAACAAGAACGTCGCAA
CGACACTCGACGAAACAGTTTCTTCTCGTCCAGAAATCTCCAACCTCAAATTGCTTCCAAAAGTTTCGACCAAAGATTCAGCCTTAATTTTGACCAAATG
TCCCACCCAAGTTCTACTTTTTCGAATTTTCGATGAAAAAATCCCCTTCCTTTTCGTAAAAAAAAAACCCCCTTTTTATGAAGATGGGAGGGGTTTATGT
AGGGTCGGTGATACGATTTTTCGCCCATTTTTTGAACTCAAAATCGAAATCCCTTTGGGTCAAAACCCACATGGCCATTGCGTGTTGGCGAGGGTGACAT
ACGACGTTTCGCAGACCTGCTCGACAGGGTATGGGTTTCTGCGGGGTTGTTGGCGAGTCGCGAAATGGAGGGGAAAGGAGAAGAACGTGGGGTTGTTGGC
GTTTGCAGGAAGTGACGTCTGTTTTTCTGGGTTCTGCCGAGAGGGAAAGGAGAGAGCGAGCGTGGGCGTGAGACGCGGGAGAGAGGGAAGGAGAGGAGAG
AGGACGAGAGTGCGAGAGCGTGGGGAGATGAGGGAGAGAGCGTGGGGGTCGCGTGGGTTCTGAATTTTTTTTTTTCGCGTCTGCACCTGTTCTGGGGAAA
GGGGCGTGAGGAAGGGGGGAAGAGGGAAGGGGAGCTGGGTCGGAGCGGGTCAAGAGATTTGGGGCTGGGTCGGGTAGGAAATTAGGGGGTTTGGGTTGGG
TTAAAATTAAAGGGAGATGGGCCTGAGGTGTAATTGGGTTGGGAATAAGAGTGGGCTGATGGTAACAAAAGGAAATGGGTTGGGATTAAAGGGTTTGGGC
CATTAAGAATAAGAGGAAAGAGGCCCAAACGTTTTAGATGTGCTTGAAGGGGCAATGAGTTGGATTAAATAAAAATGATAAACTCGTTAAGCATTAAATA
AACGAATTTGTATTAATTAATTAACGAGCCTATTTATTTAGCAACATAACTACTTAGATTATAAAATAAAGATTCAAAATATAGTTGTGATTTAAAGTAA
ACTAGTTTAATAGAATACTTTCCAAACTTAAGATATACATACATACATACATATACATATACATATATATGTATATATATATATATATATACATATTTTT
TTTTTATATATTTTTTTTTAATTTTCGCAAGACTTATAAAACTAATTAACTTAAATAATTTAAAAACTCATGAAGCTCGATAATTAATTTATACCAACGC
GGGTCAAAAATTGGGTGTCAACAACTGTCCCTCATTTTACTTGGGTTGATGCAAGCAACTCGAGGAAAATGAAGTTGACCGAACCAATTTTGACCAACTC
CATTCGTTTTTAAACAGAAGGATTTGACAAAGAGTTTAGGAATTATGGCCGAACCCTTGCAAACGGGTCTCCTACATATCTCAGGCTATATGGGAATTCA
GGCCACTCGTAGTTCGATAAGCTTGATTTACCGCACGATTTCAAAGAATCAAAAGCCACCTCGACACCGAATTATGAAGGTATCGAAATGCTCGAGAATA
GAATTCGAGAGCGAATGTTGGAATACAGCCGAGTTTTCAACATTGAATCCGCCTACATACCCTTAAACCTTCGGAATCAGGCTGTGTGTAGTTCGACTAG
ATCGTTGGAAAAGGAAAACTATTATGCTAGCTAACCTTCGGTTTTGGACGAGTGACACATTAAACGAGTATGAAAAAGAGGCTTGTAACCTCTTAGCCAT
GAATGTGGAGCTCTTCACATCCATAGGTAAGAACTTACACGGACATAATTTCCAAAGCTCCTGGCGCATTGTCACTCAGATTGGAAACTCGCCCCCGATA
AAACAAAACTTCCGGACGCAAGACGGAAACTGACAGAACTAGAGAAAACCCGTATGCCTCGAGAGGGGTGGTTCGATCGTGGTGGAAGTCGCTCCTCTGC
TCGCGTCCTAAGAGTTTGACATTCCTCTTTGGACTATGTCCCAGTTCGCTGCTAAGAAAAGTTCCACGTTGTGCTGCATCCTTTTTGATGTCGTCCGCAC
CTGTGGTTTTTGGAGAATTCATCCTTTTGGATGCTCTCGACAAAGACTGAGATAAAACTCGTCAGCTTAAAAAATGCAATTAGGATGGGAGACAGTGTCT
TTTACCATGTCGACACTTCATTGTTCTCTTCCATGTTCGACGTCGACTCGATCGGTCTGACGTCCAGCAAATAAAGTTTATGCCTTGTGTTTTGCAATAT
CATCTTCAATGTATTCCATACTTGATGTCGAAATAAATAAATAAATGCTGATGCGATATTGATGTTTCTTTTGTTGTCATCTTCGATGCTCTCCATGATG
TTTATTTTTATAAGAAATAACATAATGCAGTCGAGGCCAATGGATAAGTATTGCTCTTTCTTTATCCAAGTACGTCTTCTTGCGGGTCATGAATATCTTC
CCGCGATACGTAAATTCCTGCGAGATATGAATCTTCTCGCGATGCATAACTTTCAGCGAAGAATAAAATCTTCTTGCGATGTGCAAATTTTGACGAGGCA
TGAATTCTTCTCGTCGTGCATAAATTTTGACGAGGCATGAAATCTTCTCGTCGTGCATAATTATTGACTCGCGATGCATGATTTCCGCGATGCATGAATT
CCAGCGAGGCATAAATTCTTCTCGCGATGTATAAATTTCGACGAGGCATGAAATCTTCTCGTCATGCATGATTATTGACTCGCGATGCATGATTTCCGCG
ATGCATGATTTCCGCGATGCATGATTCCGCGATGCATGATTTCCAGCGAGGCATAAATTCTTCTCGCGATGTATAAATTTTGACGAGGCATGAAATCTTC
TCGTCATGCATGATTATTGACTCGCGATGCATGATTCTGCGATGCATGAATTCCAGCGAGGCATAAATTCTTCTCGCGATGTATAAATTTTGACGAGGCA
TGAAATCTTCTCGTCATGCATGATTATTGACTCGCGATGCATGATTTCCGCGATGCATGATTCCGCGATGCATGATTTCCAGCGAGGCATAAATTCTTCT
CGCGATGTATAAATTTCGACGAGGCATGAAATCTTCTCGTCATGCATGATTATTGACTCGCGATGCATGATTCCGCGATGCATGAATTCCAGCGAGGCAT
AAATTCTTCTCGCGATGTATAAATTTTGACGAGGCATGAAATCTTCTCGTCATGCATGATTATTGACTCGCGATGCATGATTTCCGCGATGCATGATTTC
CGCGATGCATGATTTCCAGCGAGGCATAAATTCTTCTCGCGATGTATAAATTTTGACGAGGCATGAAATCTTCTCGTCATGCATAATTATTTATATTGCC
CCCGTGAATAGTAACGGCAAGACGACCTCCAAATAATATATCGACTTGATCGATAATGATAAAAATAATAACTGCATAGCTGTCTCTTCTGAGGTAATGC
ATTGTCTTGATCGACAATAATCATCTTGCTTTGATAACGCAATGCAAATAGCGTCTTCTATAGAAATCGTGAAATCTTTGCTGAGATTCCCTTTTGATCC
ACCTTTGAATCTGGCCAGGCACTTTGTAAATTTCATGTATTGGGGAATGGCTTGAAATAAACAAACACATTCACAAACATCTTGGCATAAAGATATGAAA
TGCTTCTTGCTTTCAATAAAATCACCGGCTTTGGAGATAGTCTTCTCCTTCTCCGTATTCATCAGTCGGAAGAATTCGGCCGATTTCAAAGTGAAGCTAT
AAACCTGCATCCACAGAAAAATTGTCAATTTTAAACATACTGATCTGTGTCGATTGTTTGCTCCTTGTCTTGACGTCCTCGGTTGATTTCCCGATTTTCC
GACTCTTGATGGATAAGAAAATATCTTATACCAAAACAGATGAAATATAAAAGGGAAATTTTTAAGAGAAGCAAGAAATTTTTTAAGAAATAGCATCTCG
AAAAAGTCAATGCCAAGTCATGTCATGTCAGGCTTAACGAGCTTCTTTGAGTCCGACGCTTGTCGAATGAATTTCAGAGGCATTCCGGACTTGTGGGGAA
GTCCCATGACGAAATTTCGAGGCCATCCTCAAAATTTCTGTCCCAGTTTAGTATCTTGCTCATCTTTCCATTGTAACCGAACAAATCTCGGAATTTTGAG
ATCTTCTCAAAAATTCTGTCCCAGTCGCAAACTCGAAATGTCTTTAGTTTGATCCGCTGAGGAGAAGGTTCCTTTTGGAGAATTTTTGAGTCCCTCTCAA
AAATTCTGTCCCAGTTTCTATTGTAGAAGGGGGAAATAGAAATCTTACGAGAGATATGACCGAGCCCTTGTGGCGCCTATGTATCCCGTTGAGGCAGGAA
TCAGGTCAAACGTAGTTCCCCTTAAAGGTTAACAAGAATAAAATTTACAAAGAAACCGACCGAAGCCGACAAAGGCCGCCTACGTATCTCATTCTTGAGA
ATTCAGGTCGAACATAGTTCAGGTCGTAGAATTTGGTCTTCTGTTTTGACTTGTTAAAGAAGTCCAACTTCAAATGAATTTTTGAGATCCTCTCAAAAAT
TCTGTCCCAGTTTCCATTATGGAGAGAAATGGAAATCTTCTGAGTATATGACCGAGCCGTTGTGGCGCCTACGTATCCCGTTGAGGCAGGAATTAGGTCA
AACGTAGTTCCAACACAAGGAATAATCAAAGGGAATAAATGGGGTGACCGAAGCCGACATAGGCCGCCTACGTATCTCGTTCTCGAGAATTCAGGTCAGA
CGTAGTTCATTACAAGAGGGATAAGAATTCAAATTCGAACAAATACAAGCAAACAGAAGATTACAAATAAATGATGGGAAATGCAAAACGAACTTCACGC
GTAATATCTCTTGACAGCATCTGAGTTGATAGGTTTGGTCCACACAGCGCCATCCATCTCTGACAAGACTAAAGCACCTCCAGATAGTACTTTGCGGACC
ATGTAAGGACCTTGCCAGTTTGGTGCGAACTTTCCTTTGTACTCGTCTTGATGAGGAAAAATACGCTTAAGAACCAACTGACCAACTTCAAAATTTCTGG
CTCTTACTCTTTTGTGAAAAGCGCGAGTCATTCTTTGTCTATACAACTGGCCATGACAAACAGCAACCATCCTCTTTTCATCAATCAAGGCTAGTTGATC
AATCCGTTTGCTAACCCACTCAGCGTTACTTAGCTCAGCTTCTTGGATGATCCTCAGTGACGGTATCTCGACTTCAACAGGTACGACTGCTTCTGTTCCG
TATACTAGCAAGTATGGAGTAGCCCCAGTTGATGTTCTGACCGTCGTTCGATAACCCAGTAGAGCATATGGCAACATTTCATGCCAACCCCGCTGCTTGT
CAATCATTTTCCTCAGAATCTTCTTGATGTTCTTGTTGGCGGCCTCTACAGCTCCGTTCATTTGAGGGCGATAAGCAGTTGACCTTCGGTGAATAATCTT
AAATTGTTCTCATATCTCTTTCATCATATGACTGTTGAGATTTGCACCGTTATCAGTGATGATGGATTTTGGAACTCCAAATCGGCAGATCAGATTGTTG
CGGACAAAGTCGGCCACCACTTTCTTGGTTATCGATTTGTAAGAGGCTGCTTCCACCCATTTGGTGAAATAACCGATGGCAACCAAAATAAATCTGTGTC
CATTGGAAGCGGCCGGTTCTATAGGGCCGATGACATCCATTCCCCAAGCTACAAATGGCCAAGGTGAGCTCATAGCATTGAGTTCGTGAGGTGGCACCCT
TATCAGATCACCGTGCACTTGACATTTATGGCATTTTTGCACGAATTTGCAACAGTCGTTCTCCATAGTCATCCAGAAGTAACCGGCTCGAAGGACTTTT
CTTGCCAAGGTAAGCCCGTTCATATGTGTGCCACAGACTCCAGCATGTATCTGTTCAATAAGCCTCACGGCTTCAGCAGCATCCACGCATCTCAAAAGAC
CCAAATCTGGAGTCCTCCTGTAAAGGACTTCTCCATTCAAAAAGAAATTGAGAGCCATACGACGTATCGACTTCTTTGGATTAGATGTGGCGTCTTCTGG
ATATGTCCCAGACTCCAAGTACCTCTTTATGTCTAAATACCAAGGCAAACCATCTGGTTCTGATTCCACCTGTGAACAATGGACTGGATACTCCTTCAAA
TCTATATCCAGCGGGTCGATGTAATCAATATCCGGATGTTTGATCATTGAAGCGATGGTGGCAAGAGCATCAGCTAATTCATTCTGTATTCGGGGAGTAT
GTCTGAACTCGATCTTGCGAAACCTTTTACACAGGTTTTGCACATATTGTACATAAGGTACAATCTTTGGGTTCTTCACAGCCCATTCTCCTTGAACTTG
ATGGATCAAGAGGTCTGAATCTCCAATAACCAGTAACTCGTAAACATTCATGTCAACGGCCATTTTCAAACCGAGAATGCACGCTTCATACTCAGCCATG
TTGTTTGTGCAGTTGAACCGTAGCTTAGCCGCCATAGGATAGTGCTGACCAGATTCTGATACCAAGACTGCTCCAACACCTTTACCCTGGTGATTCACCG
CTCCATCAAAGAATAATCTCCAACCTGGATAAACTTCAGAGATATCTTCACCCACAAATGACACTTCTTCATCGTGAAAATATGTCTTGAGAGGTTCATA
CTCTTCATCAACGGGATTTTCCGCAAGATGATCAGCCAAAGCTTGTGCTTTTATTGCCTTCTGAGTCACGTACACGATGTCAAACTCGCTCAACAACATT
TGCCATTTAGCCAGCTTCCCGGTCGGCATCGCTTTCTGGAAAATATACTTCAATGGATCCATTCTGGAGATAAGATATGTAGTATACGATGACAAATAGT
GCCTCAGCTTCTGGGCAAGCCACGTCAGAGCACAGCATGTTCTTTCCAGCAAAGTGTAACGAGACTCGTACGGAGTAAATTTCTTGCTGATGTAGTAGAT
AGCCTTTTCCTTCTTCCCTGTCTCGTCGTGTTGACCAAGTACGCATCCAAAGGCGTTATCTGAGACAGATAAATACAGCAATAAAGGACTCCTTTCTCGC
GGGGGAACCAATACTGGTGGGTTAGACAAGTAGCTCTTGATAGCGTCGAAAGCGGTCTGGCACTCCTCAGTCCACTTAGTTGGGGCATCTTTCTTCAGCA
ACTTGAAGATGGGCTCACATACCACCGTCGATTGTGCTATAAACCGGCTGATATAGTTTAACCTCCCTAAGAAACTCATCACCTCTTTTCTCGTCTTCGG
CGGAGGTAACTCCTGAATTGCTTTGATCTTGGAAGGGTCGAGCTCAATACCTCTTCTGCTGACTATAAACCCTAACAATTTCCCAGCTGGGACTCCAAAA
GCACACTTGGCGGGATTTAGCTTCAAGTTGTACCTACGCAAACGTTCAAAGAATTTTCGCAGGTGTGTCAAATGATCCGAACTCTCGCGGGATTTAATTA
TGACGTCGTCCACGTACACTTCAATTTCCTTGTGAATCATGTCGTGGAAGATAGTCGTCATGGCTCTCATGTAAGTGGCACCGGCGTTTTTGAGCCCAAA
CAGCATCACCCTGTAGTGATATACCCCCCAAGGTGTGATGAAGGCCGTTTTCTCCGCGTCTTCTCCATCCATCAGAATCTGGTGATAACCCGCGTAACAA
TCCACAAATGACTGCATTTCATGTTTGGCACATTTATCAATCAGAATATGGATATTTGGCAACGGGAAATTATCCTTTGGACTAGCCTTGTTGAGATCTC
TGTAATCAACGCAAATCCTGATTTTTCCATCTTTCTTGGCGACCGGAACGACATTCGCCAACCAGGTGGGATATTGCGTTACTTCTACCAACCGGGACTC
TATCTGCTTGGTGATTTCCTCCTTAATCTTCAAACTCAACTCAGGCTTGAATTTCCGAGTCTTTTGCTTCACTGGCTCGAACCCTGGGTTGATAGGCAGC
TTATGAGATACGACATCGGTACTCAGCCCCTGCATGTCACTGACCTTCCAAACAAACACATCGCTGTATTCGGCAAGCAAATGAATCAGGCTCTCCTTCT
GAGTTTCATTCAGGTGAGTGCTGATCTTAACCTCTTTGACACATTCTGAATCTCCCAAATTTACCGTCTCTGTTTCCTCCAGATTCGGTTTATGTTGATT
CTCGAACTGTCGAAACTCTTCTACTACATAGTCTGGTTCCCCACTTTCTTCGTCGTAGTCGTCAGCCACATCGTCATTTACCTCATTTTGTTCGTTTAGC
TCATGACATGACATGACGTTGGCAGGTTTGTAACTTACGTTACTGAAATCATAAACAGACAAAATTAGAAAAGTAAAATATAACAAGCAATCGAATAAAC
AAAGTCAAAATAAGGAGGCCTTCATTTAAATTGAATCAAGATGCAAAGTTGGGTCATGGCACAAGGCCACGTCGCCCTTTAAACAATCATAACAAAATTC
AAAATCAAGAAAATGCAGAAATGGTGGGTCTCGGGCCTCTTCCGAACGACCACCGATTTTGGCATGCACAAAATAAATCCTTTCTACCCAAAAGTCCGGG
ACATCAGGATTGGTGTGGACGTCCAATTCTTCAGCATCTCCCCCGGTTCAGCATCGCGAAAGCCAGCTGGCTCGGCCTCTTCCTCTATGACGGCATTGAT
CTCCTTGAACAGGTCACAGATTCCTTCCCCGTCGTCTTCAGGCTCGGCATGCTCCCGAATTGGAAAGGAGTGATAGAGATGCGGGATCGGCTTAGTCAAC
TCTTGATCCCTTCTCCTCTTCATCTTCATATCATCATCTGTGGGGATGTACCCCAAACCATACTTTGATCCCTGAGCAAGGACCGGAACAGGCTCAATAA
TTCCTTGGGAATCTCTTCCCAATCCGAAACCTGGCTCGAACCCATTTTGCAGCATCACCGTGGCTATCATTTTGTACACGGTTGGAATGGAGTTGAGGGC
CAAATCTTCGTTGGCGGCATTCACCAGCTCCACCGTGTAAAAGTCTGCGCCTTGCGGCATCTCATCAATGACCGACACCTGCTTGCCCGAGCGACTTCCC
TCGCCGTGAATCACTAACTCTTCATTTTTCCACACAAGTTTCATCATCTGATGGAGAGTAGAGGGGACGGCTCCAGCCACGTGGATAAACGGCCTTCCCA
AAAGAAGGTTGTAGCTAGTGTCTATGTCCAATACTTGGAATTGCGCACTGAACTCTGTGGGGCCCATTTGAAGGGTCAAAGTCACAGCCCCTAAGGTGTC
TCTTTGCACACCATCAAATGCCCTTACATTGACCTGATTCTGCTCCAGTTTCCCAAGGTCAAAATTTAGTTGCCTCAATGTCGTCAATGGGCAAATATTC
AAACCGGACCCATCATCTACCAAAACACAGTTGACAACCTTTCCACGACATATCACGGTAATGTGTAGCGCTTTGTTGTGGGATCTTCCTTCGACTGGCA
ACTCATCGTCACAAAAGCTGATCCGGTGCCCCCGAATGACTTGATGATTCATAGCAGCCACGTTATCACTACTTGTACCTGAGGGTACGTATGTATCATC
AAGAGCTTTCATTAAGGCCTGCCTGTGGGACTGAGAGCTCATCAGCAGGGCCCACACGGAGATCTGAGCCGGAGTCTTCTCTAAATGTTTGACGATGGAA
TAGTCCTTCGGTTGCATCCTTCTCCAGAATTCTTCTGCTTCCCCCTCGCTTATCGGCCTCTTAGCATGGTCCTTCTTCTGTCCTCCGAGAGCAAGCTCAT
CAGGAGTGTAGCACCTTCCGGACCTGGTCATGCCTTGGGCCACGGCAGTTTCAATGACAAATTTGGGCTTAACGAGGGTTTTCGAAGGCACCAAGGCAAC
AGCCTTTGCAGGTGTCAGAATAACAAACTTCCTCCTTTCTTTGACGCTTAAAGAAGCGACAGCCCTTTCCAAGTCCTCATGCATAATAGGGGTAATCATC
TTTGTTCCACACCCGTCTTCATCCGTTTCAATCATATTAAGGTTGTCACCTCCATGATTCGGCAACGGATTTGTGTTGACGTTTGGCACCGCCGATTGAA
GAGAAACTACCTCTTGATCGATCAGGTCTTGGATTTTGTGCTTGAGGTTGATGCAATCTTCCGTGTCATGTCCAACACTGTTGGAATGATAAGCACACCT
TTGATCTGGCCTGTAGAACTTTGAGTTGACATCCCCGGGTTTGGGCCCCACAGGGTGGATGTATCCATCTGCGGCTAGCCTCTCAAATAGTTTGGTCCGG
CTTTCAGCAAGTGTGGTAAAGTTCCTTGAAGGCCTTTTTTCAGGTCTCGGACGGGAAGTATCATAATTGCTTTGCCGAGGGGGAGGCACCCGCTGATAAT
TTTTGGTATTTGTACGAGGAGCTTGGCCCCGGGGATAAGGGCTTGCCTGGAAATTTGGCATTGTAGCTTGGTAATTCGGGAGGGGGTCCTGGTATAATGG
AGCTTGGACTTGATAAGTGGACGGAGGTGGTCGGTAGCTCGACTGTACGTTGGCACAGTTGGGAGCAATATTCTGATAAGGGGATGGGATCTGGTATGGT
TGAGGGTAATTTGGGTATATGGGAGAAAAATTTTGGAGATTAGAGGGTGGACTTTGGTACGACGAAATTTGAGCACTCTGATAGGTGGGGACAGTATTGT
GGTTATTAGGATGATTGGATTGTGGGTAGTTGGATCGGTGGGACTTTGGGGAAGGCCTGAAACGATCTTGGGAATGTGACGGGTTTCTAGGGGTTTTTCT
TCCCCCATACGAGACAGCGGCAACTTCCTCTCTTCTCTTTCTTATCAATCCTGAAGACCCAGGCGACGCAGATACACGGGCTATCTTCCCCGATTTTAGA
CCATCTTCGATAGTCTCACCAACTTTGACTATCTCAGCGAATTTAGCTCCGACTAGCAATATGATCCGATCATAGTACTCAGGCTCCTGTACCCGCACGA
ATACTTCCACAATCTCTTTCTCGGTCATGGGTGGTCTTACCCTCGCCGCTTCTTTCCTCCACCTATAGGCAAATTCCCTATAGCTTTCAGTTGGTTTCTG
CTTCATCTTCTCTAAAGAATACCGATCGGGCACTATTTCAACATTGTAGGCGAATCGGTCAATGAAGTCCTTAGCCAATGCATTCCAACTGGGCCACTGC
CTGGTTTCATGTGAAGTAAACCACTCGAGGGCCTCTCCACACAGACTTCGGCTGAAAAGCCGCATCAACAAGGCCTCATCCCTGCCAACTCCCACGAGCT
GGTCACAATACGCTCTCAAATGCGCCATAGGATTGCCCACTCCTCCGAAGGTGTCAAACTTCGGAATTTTAAAACCTTCGGGAAGGTTCAAATCTGGATG
GATGCACAATTCTGCGTAGCTAAGTCCGACGGCGTCTGGGATGCACTGCAGCTCTTTCATAGCCCTTTTGATTTCTTCCTTTATATCGATCTTCACTTCT
TCTTTCGCCTTCCATTCTCTTTCCTGTTCTTCATAGTGTTCCAACTCAGAACCGTGCACCTCGTGCTCGGCAGGAGCGGGAACTTGGAAGGTGGCTCTTT
TTGGTAGGGGTGGAGCTATAGAGGGACTTGGAACGTTTTGGGTGGTCTGGTAGTTTTGTGGGTAGACCTGAGGATTGGTGTTCTGGCTCAAATGCGGATG
AAATGCTTGGGTATTGAAGGCAGTTTGAGTTTGGTTTTGATTTTGTGGCGGTGGGGCAGTTTGAGTATTCTGAGGATAGGGTGGTATTTGAGGGTGGTTA
TTTGGAAGAGGTGAAGGAGTTTGGTAAGATGCAGAAGCGTATTGAGGGTTTTGGGTTGTGAGGTCAATCACAGACGGATTATGCACAGGTGTAGAAGGCT
GGTTCTGAGTTGGATCTATGTTTGATGAAGGGAAGTAGACCGGAGGTCTTGCATCAGCAGTATTAGTACCAAATCCAGGTGGAGGCGCATCCTGTCTCCG
TTGCATTTCAACTTTCATTTCAGCAATTTGTTGCATCAGCTGCATGATCAATTCGTTCTGTTCCACTACAGTGGGCTGAGCCACCACAACGTCAGTAAGA
CGCCCTTCGTCATTGTTGTCTCCCATAACTGTTTTTTCCTTTGTCTGAATTTGATCGAGGGAAGGAATCTGTAGGACCTTTTGACTTGGTGAAGTAAGGA
TGATCTGCCAGCTTTATCGACACAGATCAGTAAAAGGTACCTGAGAGGTAAAAACAACTCAAAGGCAAATTTGTTAGTACATATCCAGAGTACAAAATGC
ATAATATCGCACATAAAACAGATAAACACACAAGTCGTTTTGTTTGAGGATATCTTAACCCACGAATAAGGACGGATATATATTTTGAACAAACAGGAAT
TTGTTTGTTTGGCGCTATCTTGGGAAATCTGAATCACGTTGAGCTATGGTCTTCTTGCAGCTGCTTTGCGACGTCCGTTGATCTTATCTTCGTATCTCCG
AAACATGGAGGAGAATGAAAATTTTCTGTGATAGGGGCCGGGCCGGGAAGGCTGCCTACGTATCTCACGGGAGAATTCAGGCCCAACGTAGTTCGGATTT
TAGGATGAAAATTTTCCATTCATTCTTTCGTTGTGATTACAAGGGAATTGAAAAACAACATTGAGATTTCTGGAAGACCACATTTGGAGATTTCTTGCCT
TGTGGCTGCGTCATTCCTTTCCTTTCAGACAGTCGAAAATGGAGGCTTGTAGACGATTTCTTCTTCATCATCCTCCTCAATCACTTCATGGTCGGGGCCA
CTGTTGCCTGTTCCCTGATCACGGGCGAGGTATTTTCCGCCCTTTGGGTCGCTATAGGTTGCCAATTCCTCGTCGAGCGCCACGCTTCTGTCCAATAACA
CAGCAGTCTCGATATCTATCTTCGCCTCTCTTGCCTTTCCTTCGTGTATCTCCAAACGAAGCAAGTTCAACCTTTTCCTTAGGCTTTCGGTTTCCCTCTC
AACCTCCTTCTTTCTCTTTATCTGTGACGCCAGATCTTCATCCAAGGTTGTGACCGCAGCCTTGTAGATTGCCGTGGTCACGTCTACTTTGAGTCCTTCC
TCCTTAACCTTCTGAATCTCTCGAGTGACTCGCTCGATCTTTCTTCGCAATTCCTCCTCAGTGAGCTCCGTCTGGACGTTCTTGCCTTTGTCCATAGCGG
TGATTCAACTTTCCTGAGATGATAGAGTGGTATTTAGGATTTATGGTATGGATTTTGTGTGAGAAACTTGAGACTCGGGAATTTTGGTCGGACAATTGTA
ATGTTGGCTTCTGTATACTCTTTAGGATTTTGGCTAGGAGTGGGTTTACGATATCCTCAATCAAAGCAACATAACACATAAACATTTAAACAAATATATC
GTTTCCTAAACATGCATGTGACCCTTTTGTGCCAAGGGTAGGCCTAGCGATCTGAAGGATGTATTGCCCATTTAAATAAGTAATTGTACCCCCGAAACAA
ATTTCACTAGATGTCATAGCGTTCATTACACAATCAAAATTAAACGGGATATATCTTGGGAAGGGGATGTAGTGCAAATACACATATAAAATCAATCCCA
CCCAGGGGAGTTAAAAGGTCGATGATCCAGCTCCTCTTCTGGCCTTCTCCACTTCTTCTCGGATAATGCATTTGCTGGTGAACACGTATGGCTCAGCGAA
CGCAGCTTTGGAAGATGTTGGTATGGCTTGTAAGGTGTTCATCTGCTCGTCCAAAATAGTGTCCAAACGCATTAGGCAAGTCCTTGTGTCAGCTAATTCT
TGTGACATTACGGCTAAAACTCTCTGATTTTCTAATTCCCGGAGTTGGTACGCTTGCTCCCTTTGTTGAAATTCCTGTTCTTTCTTATAGAATTCCTGCT
CCCTCCGGTCCCACTCTTGCTAAAAATGGTACGCGTGAATCTGAAGCCTTGTCTCCACGTCTTCGATTTTCCGACTCGTGTGTGGTGTCGGATCCACTAC
ACCATGCAAATTATTATGCAACCATGTCTTATATTCGTCGACATACCCAGCTCCATACCTATCTTCGGTGACCTCCCACTTCATGTTGACACGTCCGGCC
CATTCCTGGAGGATAATTTTAGCGAAAGGTATTTTGTCCTTCCCGTTGTAATCAACAATGAAAGAGCTGGCATCTCCTTGGGCGGGTATGATTTGGACTT
TCCCAAATTGCCGCATTACTCGTGTCGGGTTGTAAGGACGCAATCCTCTGATGCCGGGAAGGACTAAAAATGGCAATTTGGCCCCTTGGGCTGCTATCAT
CTGAGACCTGAAGCTCGGTAATACCCATTGTATGTCTCCTTCTTTCAAATTGTAAAACACCTTTGCCCACGCATCCCTGGTGGTGTGAATTGGAAATTTA
CGGATACTCAAGTAGAACTCGTAATTATTGAGAGGACTTGTTTGACTTGGTTCGGCCAAACCATGTAGCTGGGGGTTGTCTCTTTTGCATAGATGCTCCG
TCAACCACCATTGAAGTAAGATGTTGCAACCTTGGAAAAACGGAAAACCATTCTTGCACAGGCTCAAAGATCGGTAAATGTCGGACAGGATGACTGGGGC
CAAACAGCAATATTTCTTTTCTTCAGATTTTCTACCGACTCCTCTGAACATGGCATTCACTACCATTATTACCCGGGTGTCGATCTCTTTACCTTCGTCT
TTAGGGAACACCATAGTTCCCAAGAGGCATGCGGAGAAAGCGATAGCTTGGGTTTGCCTCCAAGTACTGTGATCATGAAATTCGTCCGGGAACAATCTAA
AATAATTGTCGTGCCCCCACCTCTCGAAAAACCTCATCAGCGGAATGTTGTTGGTCTCTAACCAATCTGCATTCACTAGGAATAGCATATCCCTCAATTC
GTTCTTGGTTGGCCTATCTGGTAAGAGAATGTGATGATCGGGACGCTTTTTCCTTTTGCCACACGTCCCAATCGAGTCAAGGCAATCTTTGATCTCTTCT
AGTGTGGGCGCTATTTCGACATCTCCAAATCGAAAGACCATTTTATCATCGTCCCAAAATCGGGTGATGACCTCGATGAATGTGGGCCATACCTTGAAGT
CCATTATCGAAGGTAGGTGACCCAAGTAAATCGAGATTTCTCTCTTTTGACACTCCTTAAGATTGCTCCACCATACTCGAAGAATGTCGGGTGCCTGGGT
GACCATTTTGAAGTGAAGGAACTGACTTGACATCTACAAAAATATACAACTAGTTAATTTTCAATCCCCCCGATACAACAACTAGTTAAACACGCAATAC
ATCCTTCAAATTTAAACAACAAACATGAGCGTCCTATCGAGCCGCAGGCTCTTTGGACTCAAGGTGGACTTTTTAATGGGCCCGACACTCCCTGGGTGTC
GGGTCATCCTAGGCCAATGCACTATTTTCGGGATTTGGTTTCGCTCTATCCTAGTTTGACTAAGAGTGGGTTGTATTTAGAGTGGATTGGGTAACCCAAG
CGGACTACTTGGGCTGGGACAATTAACGATCGTTGACTATCAAGTAGTCAACTACACTCGTCAGGGTGCCCCGAGAAGATTTTGGTTAACGAACGACTGC
GAACCCGCATAATCGTCCTTTAGTGGAAATGTAAAAAAGTGTCGTTTGACGGAAGTATGTATGCTATGTATGCAACAGCTTAAAAAATCTAATTAATTTA
AACACTTAAACAGTTAATCACAAATAATCAAATACGTTAATCTTAAGGTTAGAATCCTCCAAGTCCCCAGCAGAGTCGCCATTTCTGTTTTATCGAAAAA
TGGGTGATTTTCGAAAAGAGTTTGTTTTTCGACTTTTAGGAGTCGCCACTTAATTTTTAAGAAAAATCAAGAAAACTTTGCTTCTAAACAACCTAAACAG
AACAATTGTTTTGAAACATTTTTTAAGGGTTCGGGATTCTTATTAGTGTCTTAGGAAGGTGTAAGGCACCTAAGATACTCCGTTAAACACGGTTTTCCGG
CGATTAACTTATTTGACTACTTTTTAACCTTTTGCGAATTTGAAGTTGAACCTTTATTAGAGCTTTATTTGGACAAATCTAAAAGTTGAAATACTTATTG
TTTTTGAGATTCTTTTAAAGTTAAACTTTTTAAATTTTAAACTCTAAACGAACTAGTGAATTTGAAACGTCCAATGTTTTAAGACTTAGTTTTAGCTTGA
TAAAATAGAAAGGCGTTTCGAAGGAGATTTGGATTTTTCTAGTCCTAACACTAACGATACTTTAAACAACGCACATAAGCAAGTAATAAGGAGAGAGAGA
GAGATTTTTGGGTCCAAACTCGGGTACTGTTCGCCTTGACCGAGTTTTGGACCCACCTGTTTTTGGGTGTTTCGACCCATTTTGCCACCTGTCCAAGTCT
AAACATTACAAGATAAAATATAAGAGGAATAAGGAAAGGAAAATGACAAGGGCTTATGCCCATTACAAAATAAAATACGGAAACAAAATAAAGAAACGTC
TTCTAATCCACTTTGGATTCTCCTTCCAACTTCATGACTTGTACGCCTCTCTTAAGGTTGTCTTGCTTGGTAAAAGACTATGAGTCTTTACGACTCTCTC
GAGATACGGAGAAGGAGAGTTCGTGGTGAACTCAAACGGATTTTACATGCCACACAATAAACAAAAGGAATTAATATTCGATTCAACGGGCACATATACA
AGAAAACAAACTAACTTAATAGAAAATGCATATCCATGGATAGTATCTAATCGGATCAATAGACACACGACAACATGTAACAAGAAAGGTCGGACTAGCG
CAACATGAAAGAGACGACAGAAGAGAAAAGTAATGACAAATGCGAGTCGACCCAAGGTAAATAACTATATTGAGGCGATTTTACTTACCCAACCAAACAA
TGAACTTTCAATTTCACAGAACAAGGCATGTATATGGCAATCTTTGAATTTAAAATTTGACTTGTCGAACTAACAACAAAGAAAAAGGACAAAACTCCAA
AATAAGACATCACTATTATCATTCAATGCACTACTTCGCTTCTGTCGAACCCATCATCACATCAGTTTGACATCAAAGTGAAAGAAAAACAAAAGAAGAA
ATAACAATAAAGATGATGACAGAAGAGTTTGAAGTGAAATTGGATTTCACTTCGACCAAACGGGTAACATCTACAACTCATTATAAGCAGAATAACGAAG
GATTCCCTTAGACTAATTCATGTACGAATACAAACAGGAGGAAGAAGTAGGAAACGAGCAGAAACAGACTCGGCGGATCGAAATACCCCAAACACACCGT
TCGTTCCCTTTAAAACTTTATCAAATATAGGAAGTTGCGACAAAATCAAGCGAAGACAAGACAAAACCACGAATTTCAAACAACTTCTGCAATACAACAA
ATTCACAGCAGCTAGGACCAACCTAAACACTAACGTACAAACAGCAAATACAACTAAGAGTCGAGGGTCAAGATGGGTGTTACCTCTTTAAGTGCAGCGA
AACAGGAACAGCGAGCAGGCGGAGCACCACTATCACGAACCCGAAATCACCCTCTGCTTCGCTCGTTCGAACAAGAACGTCGCAACGACACTCGACGAAA
CAGTTTCTTCTCGTCCAGAAATCTCCAACCTCAAATTGCTTCCAAAAGTTTCGACCAAAGATTCAGCCTTAATTTTGACCAAATGTCCCACCCAAGTTCT
ACTTTTTCGAATTTTCGATGAAAAAATCCCCTTCCTTTTCGTAAAAAAAAAACCCCCTTTTTATGAAGATGGGAGGGGTTTATGTAGGGTCGGTGATACG
ATTTTTCGCCCATTTTTTGAACTCAAAATCGAAATCCCTTTGGGTCAAAACCCACATGGCCATTGCGTGTTGGCGAGGGTGACATACGACGTTTCGCAGA
CCTGCTCGACAGGGTATGGGTTTCTGCGGGGTTGTTGGCGAGTCGCGAAATGGAGGGGAAAGGAGAAGAACGTGGGGTTGTTGGCGTTTGCAGGAAGTGA
CGTCTGTTTTTCTGGGTTCTGCCGAGAGGGAAAGGAGAGAGCGAGCGTGGGCGTGAGACGCGGGAGAGAGGGAAGGAGAGGAGAGAGGACGAGAGTGCGA
GAGCGTGGGGAGATGAGGGAGAGAGCGTGGGGGTCGCGTGGGTTCTGAATTTTTTTTTTTCGCGTCTGCACCTGTTCTGGGGAAAGGGGCGTGAGGAAGG
GGGGAAGAGGGAAGGGGAGCTGGGTCGGAGCGGGTCAAGAGATTTGGGGCTGGGTCGGGTAGGAAATTAGGGGGTTTGGGTTGGGTTAAAATTAAAGGGA
GATGGGCCTGAGGTGTAATTGGGTTGGGAATAAGAGTGGGCTGATGGTAACAAAAGGAAATGGGTTGGGATTAAAGGGTTTGGGCCATTAAGAATAAGAG
GAAAGAGGCCCAAACGTTTTAGATGTGCTTGAAGGGGCAATGAGTTGGATTAAATAAAAATGATAAACTCGTTAAGCATTAAATAAACGAATTTGTATTA
ATTAATTAACGAGCCTATTTATTTAGCAACATAACTACTTAGATTATAAAATAAAGATTCAAAATATAGTTGTGATTTAAAGTAAACTAGTTTAATAGAA
TACTTTCCAAACTTAAGATATACATACATACATACATATACATATACATATATATGTATATATATATATATATATACATATTTTTTTTTTATATATTTTT
TTTTAATTTTCGCAAGACTTATAAAACTAATTAACTTAAATAATTTAAAAACTCATGAAGCTCGATAATTAATTTATACCAACGCGGGTCAAAAATTGGG
TGTCAACAACTGTCCCTCATTTTACTTGGGTTGATGCAAGCAACTCGAGGAAAATGAAGTTGACCGAACCAATTTTGACCAACTCCATTCGTTTTTAAAC
AGAAGGATTTGACAAAGAGTTTAGGAATTATGGCCGAACCCTTGCAAACGGGTCTCCTACATATCTCAGGCTATATGGGAATTCAGGCCACTCGTAGTTC
GATAAGCTTGATTTACCGCACGATTTCAAAGAATCAAAAGCCACCTCGACACCGAATTATGAAGGTATCGAAATGCTCGAGAATAGAATTCGAGAGCGAA
TGTTGGAATACAGCCGAGTTTTCAACATTGAATCCGCCTACATACCCTTAAACCTTCGGAATCAGGCTGTGTGTAGTTCGACTAGATCGTTGGAAAAGGA
AAACTATTATGCTAGCTAACCTTCGGTTTTGGACGAGTGACACATTAAACGAGTATGAAAAAGAGGCTTGTAACCTCTTAGCCATGAATGTGGAGCTCTT
CACATCCATAGGTAAGAACTTACACGGACATAATTTCCAAAGCTCCTGGCGCATTGTCACTCAGATTGGAAACTCGCCCCCGATAAAACAAAACTTCCGG
ACGCAAGACGGAAACTGACAGAACTAGAGAAAACCCGTATGCCTCGAGAGGGGTGGTTCGATCGTGGTGGAAGTCGCTCCTCTGCTCGCGTCCTAAGAGT
TTGACATTCCTCTTTGGACTATGTCCCAGTTCGCAAGACTTATAAAACTAATTAACTTAAATAATTTGAAAACTCATGAAGCTCGATAATTAATTTATAC
CAACGCAGGTCAAAAATTGGGTGTCAACGTCTATGAAAAATTTTGGTCATTTTGTTTTGAGAATTCTAGATCACAAAAAATCCATAAACTATAGCACATG
AAAATGATAAAATCTGTGTTAACTAGCTTTGGAGCTCGTTTGAAATTGAAAATGCGCCTATTTTTTCTGTAGAACGAATTAGGTCCATTGCTAAGGTATT
AAAGGACGTCCATGAAATGTTTTGGCTATTTTGTTTTGGAAATTTCAAATCACAAAAAATCCAAGGATTATAGCACACTAAAATTGGCAAAATCTATGTT
TACCAGCTATGGAGCTCGTTTGAACTTGAAAATGCATTTGTTTTCCCCGCAGGACGAATTGGGTCCATTGCTAGGGTCTTAACGGACGTCCATGAAAAAA
TTCAATCATTTTGTTTCAGAAATTCCCAATCACAAAGAAATCCATGTAACTATAGCACACGTAAATCGACAAAATTTGTGTTTACCTGCTTTGGGGCTTG
TTTGAACTTGAAAATGCGCACGTTTTCCACGCGGAATGAACTAGGTCCATTTCTAGTGTCTTAACGAACGTCAATGAAAAATTTTGTTCATTTTTTTCGA
GAATACCAGATCACAACAAAATCCATTGACTATAGCACATGAAAATTGACAAAATCTTTGTATACGTACTTTGGCGCTTGTTTGAACTTTAAATTATTTC
CGTTTTTTCCGTAGGACGAACTGGGTCCATTGCTAAAGTCTTAACAGACATCCTTAAAAAATTTTGGTCACTTTTTTTGGGAATTCCAAATCACAAAAAA
TCCATGGACTATAGCACATTAAAATCGATAAAATTAGCGTTTACCTGCTTAGTGACTTGTTTGAACTTGAAAATGCCGTCGTTTTTCCTGCGAAATGAAC
TGAGTCAATTGTTGAGGTCTTAACGGATGTCTATGAAAATTTTTGACCATTTTGTTTTGGAAATTCTACATCACAAAAAATTCATGGCATATAGCACACG
AAAATTGGTAAGATATGCGGTTACCTTTTTTGGGGGTTGTTTGAAATTGAAAATGTGTATATTCTCACCGAAGGATGAACTAGGTGCATTTATAATGTCT
TAACGAATGTCCATAATTTTTTTTTGATCATTTTGTTTAAGGAATTACATATCACAAAATTTTCATGAACTATAGCACACGAAAATTGATAAAATCGTCA
TTACCTACTTTGGGCTTGTTTGAACTTGAAAATGCATCCAGTTTCCCTGTGGGACGAATTGATTCATTGCTAAAGTTTAATGGACGTCCATGAAATATTT
AAGTCATTTTTGTTTTGAAAATGCCAGATAACAAAAAATTCATGGACTAAAGTGCACGAAAAATCGGCAAAATTTTTTGTTTACCTGATTTGGGCTTGTT
TGAACTTGATAATGCACCCGTTTTCCCCGCGGGACGAATAGGGTCCATTGCTAAGGTCTTAAGGGACATCCATGAGAAATTTTGGTCATTTTATTTTGAA
ATTTCTGATCACAAAAGTCCATGGACTATAGCATATGAAAATCGATAAAATTTGTGTTTTCCTATTTTAGGGTTTGTTTAAACTTTAAAAAGTGCTCGTT
TTCCCTGCGGAACGAACTGGGTCTATTTCTTAGGTCTTAACAGATGTCCTTGAAAAATTTCTGTCATTTTATTTCAGTAGTTCCATATCAAGAAAAATAC
ATGGACTATAGCACACGAAGATCGGCAACATGTGTATTTATCTACTTTAGAGCTCGTTTGAACAGTAAAATTGCTCGTTTTCCGTGCAAGACAAACTGGA
TCCGTTTGTAAGGTTTTAACGTACGTCTATGAAAAAATTTCAGTTATTTTGTTATGAAAATCAAGATCACAAAAAATCCATAAACTATAACACACAAAAA
TGGTAAAAATCTGTCTTTACCTACTTTGGGCTTGTTTGAAGTTTAAAACGTACCTGTTTTTTTCATGGGATAAACTGGATCCATTGCAAAGGTCTTAACG
GAAGTCTATGAAGAATTTTGACAATTTTTTTCCAGATATTTTAAATCACAAAAATTCATGGACTATAGAACACAAAAATCGATAAAATCTGCATTTACCT
TTTTTAAGGCTCGTTTGAACTTGAAAAAACACTCATTTTCCCCATTGGACGAACTGAGTCTATAGCAAAGGTCTTAACAGACGTCTTTGAGAAATTTTGG
TCATTTTGTTTTTGCAATTCCTGATTAAAAAAAATCATGGACTATAACACATGAAAATTTGTAAAATTTTTGTTTACCTATTTTGGAGCTCGTTTGAACT
TCAAAATGCGTCTATTTTCCATGCGGGATGAATTAGGTCCAGTGCTAAGGTCTTAAAAGACGTTTTGAAAAGTTTCGAAAATCGGCGAAATCTGCGTTTA
CCTGCTTTAATGCTCGTTTGAACTTGAAAATGCGCTCGTTTTCCATGCAGGATGAACTAGGTCCATTTCTAATGTCTTAACGAACGTCTATGAAAAATTT
TCATTATTTTGTTTTGAGAATTCCCATATCACAAAAAATACATGGACTATAGCACAAGAAAATTGACAAAATCTTCGTTTTCCTGCTTTGGGGCTTGTAT
GAATTTAAAAATGCGTTCGTTTTCCCCGCAGGACGAACTGAGTCCATTGCTAAGGTCTTAACGTACATCCATAAAAAATTTGGCCATTTTATTTCCGAAA
TTCCATATCACAAAAAATTCATGGACTATCAACAAAATTAGCGTTAACCTGCTTTGGAACTTGTTTGAACTTGAAAATGCCGTTGTTTTTCCTGTGGGAT
AAAATGAGTCCATTATTGAGGTCCTAACGGATGTTTATGAAAAATTTTGGCCTTTTTGTTTTGAAAATTCTAGATCACAAAAAATCCATGGACTATAGCA
CATGAAAATCACTAAAATTTGTGGGTACTTGCTTTGGGGCTCGTTTAAACTTGAAAATGCGTCTGTTTTTATGAAGGATGAACTAGGTGTATTTATAATG
TCTTAATAAACGTCTATGAATATTTTGATCATTTTGTTTAAGTAACTACAAATCAAAAAAAATTCATGGACTATAGCACATGAAAATTGGTAAAATCGTC
ATGTATTTACTTAAGGGCTCGTTCGAACTTGAATATGCGCTCTTTTTCCTCGTGGGACAAACTGGATACATTTCAACGTCTTAACGGACGTACATGAAAA
TTTTTAGCTTTTTCATTTCAGGAATTTCGATTCACATAAATTCCATGGACTATAGCACATGAAAATTTGCAAATCTATGTTTACCTACTTTGGGGTTTGT
TTGAACTTGAAATAAGCCTATTTTCCCCGCGGTACGAACTAGGTATATTGACAACGTCTTTTCATGATAAATTTCAGCCATTCCATTTTGAAAATTCCAG
ATCACAAAAATTCCATGGACTCTAGCATACAAAAATCGATAAAATTTGATTTACCTGCTTTGATGCTCGTTTAAACTTAAAAAATGCGTCTGTTTTCCCC
ATGGAACGAACTGGATACATTGCCAACGTCTTTACAAATATTCATGAAAATTTTTTACCATTTCGTTTTGAAAATTCCGGGTCACAAAAATACTATGAAC
TATAGCATAGAAAAATTGATAAAACATGTGTTACCTCCTCGGGGATCATTTTAACTTTAAAACGCGTTTTCCCGCGGAACGAACTGGATACATTGTCAAC
GTCTTAACAAACATCTATAAAAAAAATTGTCCATTTCATTTCAAAAATTCTGGATCACAAAATTACATAGACTATAGCAGACGAAAATCGATAAAATTTG
TGTTTACCTACTTTGGGACTTGTTTGTACTTGAAAAGGCACTCACTTTCTCCGCCAGATGAACTCGATACATTGTGAACGTCTTAATGGACGTCAATGAA
AAATTCGGTCATTTCATTTCAGAAATTTTGTATCACAAAAATTTCATGGATTATAGCACAAAAAATTGGCAAATTACGCATTTACCTGCTTTGAGGCTTA
TTTGAATTTGAAAATGGTTCCATTTTTCATGCAGGACGAATTAGATACATTGCTAATGTTTTAACGGACGTCCTTAAAAAAATTCTTCCATCTCATTTTG
AAAATTCTACATCACAAAAATTTCATGGAATATAGCACACGAAAATTGATAAAATCTGTGTTTACCTGCTTTGGGCTCGTTTGAACTAGAAAATGCGCTC
ATTTTCCCCGCGGGACGAACTAGATACATTGCCAATGTATTAACGGACGTACATGAAAATTTTAATCCATTTCGTTTAAGAAATTCTGGATCACAAAAAT
TTCATGTAATATAACACACGAAAATAAAAAAAATATGTGTTTACCTACTTTGGGACTCGTTTGAACTTGAAAAAGAAATCATTTTCGCGAGACGAACTGG
TTACATTGCTTACGTCTTAAGAGACATCCATAAAAAAATTTGGCCATTTCGTTTCAGAAATTCTGAATTGCGAAAATTCCTTGCACTATAGCATATGAAA
ATTGGAAAAATTAGCATTTACCTACTTTGGAGCTTGTTTGAGTTTGAAAATGTGCTTGTCTTCCCCGCGAGATGAACTTGATACATTGCCAAAGTGTTAA
AAGATGTTCATTAAAATTTCGTCCATTTCGATTCAAAAATTTCATATCACAAAAATTTCATGGACTATAACACACGAAAATCTGAAAAATTTGCATTTAC
CTACTTAAAGACTCGTTTGAACTTGAAAATGTGTGTTTTCCTCACTGAATGAATTGATACATTGTCAATGTCTTAACGGACGTCCATGAAAAATTCAACC
ATTTCATTTCGGGAATTTTGAATTTCAAGAATTACATGGACTATACTGTGTTTACTTGCTTTGGGACTTGTTTGAATTTGATTTTGCATCTGTTTTCCCC
GTGGGACAAACTAGATACATTGTTAACGTCTTAACGAACATCTAATTTTGGTCATTTCATATCATGAATTCCGAATCACAAAATTTTTTTGGACAATAGC
ACATGAAAATCGACAAAATCTGCGTTTACCTGCTTTTGGGATCGATTAAACTTAAAAATGCGCTCTTTTTCCCGCGGGACGAACTGGATACATATGCCAA
CGTCTTCATGGACATCCATGAAAAACTTTAGTCATTTCATTTCGGGAATTTTGGATTACAAAAATTCTATGGAGTATAACACAAAAATTGACATAAATAG
TGTTTACCTACTTTGGACTCGTTTAAACTTGAAAATGCACACATTTTTCCCGCGGGACGAACTGGATACATAACCAACGTCTTAACAGACATCCATGAAA
AATTTTGATCATTTCGTTTCGAGATTTCAAAGCACAAAAATTTCATGGTTTATAGTAAACAAAAATCAGAAAAATATACGTTACCTTCTTTGAGGCTCGT
TTTAACTACATCCGATTTTCCCGCCGAACGACCTGTATATATTGTCAACGACTTAATGGACGTCCATGAAATTTTTTATCTATTTGATTTCAAAAAATTG
AATCACAAAAATTTCATGTACTATAGCACATTCAAATCGATAAAATTAGCGTTTACCTACTTTGGGACTCGTTTGAACTTAAAATTGCGCCTGTTTTCTC
CACAAGACGATTTAGATACATTGTCAATGTCTTAAAAGACGTTCATTAAGAATTTCAGCTAATTTGTTTCAAAATTTCTAGATCACAAAACTTTCATGAA
TTATAGCACACGAAAATTGGTGAAATCTGCGTTTACCTTCTTTAGGACTCGTTCAAACTGGAAAAACGTTTGTTTTCCCCGCGGGACGAACTTGATACAT
TAATAACGACTTAATGAACGTCTATGAAAAGTTTTGACCATTTTGTTTCGTGAATTCTGGATCACAGAAATTTCATGGACTATATTACACGAAAATCAGC
AAAATATATGTTTACCTACTTTTGCGCTCATTTAAATTGGAAAATGCATTTTCTTTTCCCGCTGGACGAAATAGATACATTGACAACGTTTTAACGGACG
TCTATGAAAAATTTTGGTCATTTCATTTTGTGAATTGCGAATCACATAAAAATCCAAAATCAGCATAATTTTTGTTTACCCTTTTAGGGCCCGTTTGAAC
TTTAAAATGCGCATGGTTTCTCCTGCGGGATGAAATGAATATATTGTCAATGTCTTAACGAACGTTTGTCTAAAATAAATTTCATTTCGTTTCAAAATTC
ATATCATAAAAGTTCCAAGGACTATAGCATACGAATATCGGTAAAATCAACATTAACCTGCTTCGAGGCTCGTTTGAATTTGAAAATATGCCTGTTTTCT
ATGGGGGGGGGACTTATTGGTTAGATTGTCAACGTCTTAACGGACGTCCATGAAGAAGATTGACCACTTCTTTTTGGAAATTTTGAATCACAAAAATTTC
ATCAAAGTATCTTTTTTGGAGCTTGTTTGAACAAGAAAATGCGCTCGTTTCCCCGCGGGACGAATTAGATACATTGTCAACGTCTTAACAGACGTCCATG
AAGAATTTTGGTAATTTTCTTTTTAGAATTCCGGATCACAAAATTTTCATGGACTATATAGCACATGAAAATTGAAAAAAAATTGTGTTTACCTGCTATA
AGACTCGTTTGAATTTGAAAACGCGCTCGTTTTCCTTGCGGGAGGGACTGAATATATTGCCAACGTATTAAAGGACATGCATGAAAAATTTTAGTCATTT
CCTTCAGGAATCTAGATCACATAATTTTCATGGACTATATCACATAAAAATTAGAAAATTTTATTTTTACCTAGCTTTGGGGCTCGTTTGAACTTGAAAA
TTCATCTGTTTTCCTGCAGGATGAACTAGATACATTGTCAACGTCATAAAAGATGTCTATGAAAAAAAATGGTCATTTTGTTTTGAGAATTCTGAATCAC
AAAAATTTCATGGACTTACTTCAGGGATTGTTTGAACTTGAAAATGCGCATGCTTTCCTCCACCGAATGAGATAGATACATTGGCAACATCTTAACGGAT
GCCCATGATAAATTTTGGTCATTTTATTTCAAAAATATGGATAACAAAAGTTGCATGCATTATAACATACGAAAATCTGCATTTACTTGTTTTGGTGCTC
GTTTGAGCTTGAAAACGCACCAGTTTTCTCTGCGGGACGAACTAGATATATTGCCAACGTCTTAACGTATGTCCATGAAAAAATTTGATCATTTCACTTC
AGTTATTCATAATCACAAAAATTTCATTGGATATAGCACATGGAAATCGACACAATCTGCGTCTACTAGCTTTTGAGCCCGTTTGATCTTGAAAATGTGT
TCGTTTTCTCCGCGGGTTGAACTGGATACATTTTCAACGTATTAATGGACGTCCATGAAAATTTTCAGCCATTTCACTATGGAAATCTAGATTACAAAAA
TTCTATGGACTATAATACACAAAAATCGATAAAATATGTATTTACTTACTTTGGGCTTGTTTGAACTTGAAAATGCACTTGTTTTCCTTGCGGAAGGAAC
TAGATACATTACCAACATTTTAACGAACGTCCGTGAAAAAAATTTGACCATTTCATTTTAGGAATTCTAGATTACAAAAATTCCATGAATTATAGCACAT
GAAAATCAACAAAATTTATGTTTACCTGCTTTCGGGCTTGTTTGAACGTTAAAATGCGTTTGCTTTTCCTGTTGGACGAACTGGATATATTGCCAACGTC
TTAACTAATGTTCATGAAAATTTTTTATCTATTTGATTTCGGGATTCCAGATCACAAAAAATTCATGGACTATAGCTCATGAAAATTGACAAAATATGCA
TTTACGTTGGAACTCGTTTGAACTTGAAATTACATATATTTTTCCCGCAAAATGAACTGGATACATTGCCAATGTCTTAACGGATATCCATGAAAAATTT
TAACCATTTCATTTCGGGTATTCCGAATCACAAAATTTCCACGAATTATAACACGCGAAAATTAACAAAATCCGCCTATACCTATTTTGAGCCTCATTTG
AACTTAAAAATGCGCTTGTTTTCCCCGAGAGACAAACTGGATATAATGCTAATGTCTTAATGGATGTCCATTAAAAAATTTGGTCATTACGTTTCAGAAA
TTATGAATCAAAAAAATTTCAGGGACAATAGCAAACGAAAAATTAGAAAAATTTGCATTTACGTGCTTTGAGACTCGTTAGAACTTTAAAATGGGACTGT
TTTCCCCATGAGATAAACAGGGTAGATCGTTAAAGTCTTCACGGACGTCAATGAAAAATTTAGGCCATTCCGTTTTGGCAATTTCATATCACAAAAATTC
AATGGACTATAGCACACAAAAGTCAATAAAATTTGTGTTTACTTCCTCAGGGATCATTTGAACTTGAAAATGCGTCTGTTTTTCCTGCAGGACGAATTGG
ATACATCGTCAACGTCTTAACGGGTATTCATAAAAAATTTGACCATTTTATTTCAAAAATTCCGGATCACCAAAAATCTGTAAATTATAGTAAATGAAAA
TCGATAAAATCTATGTTTACCTACTTTGGGGCTCGTTTTTAACTTGAAAATGCGTCTGTTTTCCTTGTAGAAAAACTGGATACATTGCCAACGTTTTAAC
AGACGTCCATGAAAAATTTCAGTATTTTCATTTTGAAAATTTTGAATCACAAAATATTTATGGATAATAGCGCATGAAAATTGGCAAAAATTGTGATTGC
ATATTTTGAGCTTCTTTGAACTTGAAAATGCGCACGTTTTTCCCTCAGAACGAACTAGACACATTGTTAACGTCTTAATGAACGTCTATGAAAAAACTTT
GCCATTTCATTTCAGGAATTTCAGATTACAAAATTCTATGGACTGTAGCCCATGAAAATCGGCAAAGTCAGCGTGNACCTACTTTGGGGCTCCTTTAAAC
TACAAAATGCATTCGTTTTTTTCCCGAGATGAATTGAATACAATTCCAACGTCATAAAGACGTCCATAAATAATTTTGGTCATTTATTTTCAGGAATTCT
AGATTACAAAAATTCTATAGATTATAATGCACAAAAATCGATAAAATCTGCGTTTTTGCTTGCTTTGGGGCTCGTTTGAACTTGAAAATACACTCGTTTT
TCCTGCGGAACAAACTACATACAATGTTTGTCTTAACGGACATCCATGGAAAAATTTCAGTCATTTCATTTCAGAACTCTGGATAACAAATATTTCATTG
ATTATAGTACATGAAAATTGAAAAAAAATTGTGTTTACCTACTTTGGGGCTCGTTTAGAATTGAAACCGTGTTCGTTTTCCCTACCAATCAAACTAGATA
CATTGTCAATAGAATTTTTGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGACAAATTTTTTCGTGGACGTTCGTCAAG
ACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCGATTTGGAAAGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTC
GTGTGCTATAGCACACCATTTTTTGGATGGTCCGGATTCCGACGTCAAAAATGCTAAATTTTTTCGTGGACGTCTGTCAAGACCTTGCCTATGTATACGG
TTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACAAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCAT
TTTTTGGGTGATCCGGATTCCGACGTCAAAAATACAAATTTTTTTTGTGGACCTCCATCAAGACCTTGTCCATGCATACGGTTGGCCATCACGGCTTGTC
CGATCCATTTGGAAGGTCAAATGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATT
CCGACGTCAAAAATACAAATTTTTTTTGTGGACCTCCATCAAGACCTTGTCCATGCATACGGTTGGCCATCACGGCTTGTCCGATCCATTTGGAAGGTCA
AATGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCAGATTCCGACGTCAAAAATGTCAA
ATTTTTTCGTGGACGTCCGTCAAGACCTTTTCTATGCATACGGTTGGCCATCACGGCTTGTTCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGC
ATACCCCTCATTTCGACGATTTTAACGTGCTATAGCACACCATTTTTTGGTGATCCGAATTCCGAAGTAAGAAATGCCAAATTTTTCGTGGACGTCCGTC
AAGACCTTGTCTATGCATACGGTTGGTCATCAAGGCTTGTCCGACTTATTTGGAAGGTCAAACGAGCCCTGAAGTGAGCATACCTCTAATTTCAATGATT
TTCGTGTGCTATAGCACACGATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCCGACAAGACCATGTCTATGCATA
CGGTTGGCCATCACGGCTTTTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTTATTTCGACGATTTTCGTTTGCTATAGCACAC
CATTTTTTGGATGATCCAGATTCCGACGTCAAAAATGCAAAAAAATTTGGTGGACGTGTGTAAAGACCTTTTCTACGCATACAGTTGGCCATCACGGCTT
GTCCGACCCATTTGGAAGTTCAAATGAGCCCCGAAGCGAGCATACCCCTTATTTCGACGTTGGGTGATCCGGATTCCGACGTCAAAAATGCTAAATTTTT
CGTGGACGTCCATAAAGACCTTGTCTATGCATACGGTTTGCAATCACAGCTTGTTCGACCCATTTGGAAGATCAAACGAGCTCCGAAGCGAGCATACCCC
TCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATACCAAATTTTTGCGTGGACGTCCGTCAAGAC
CTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTTATTTCGATGATTTTCGT
GCGCTATAGCACATCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATTTCAAATTTTTTCGTGGACGTCTTTCAAGACCTTGTCTATGCATACGGTT
GGCTATCACGGCTTGTCTGACCCATTTGGAAGGTCAAACGAGCCCCGAAGTGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTT
TTTGGGTGATCCGGATTCCGACGTCAAAAATTTCAAATTTTTTCGTGGACGTCTGTCAAGACCTTGTCTATGCATACGGTTGGCTATCACGGCTTATCCG
ACCCATTTGGAAGGTCAAACGATCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAACGCACCTTTTTTGGGTGATCAGGATTCCG
ACGTCAAAAATGTCAAATTTTTTTGTGGACGTCCATCAAGACCTAGTCTATGTATACGGTTGGCCATCACAGCTTGTCCGACCCATTTAGAAGGTCAAAC
GAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACAAATTTTTGGGTGATCCGAATTCTGACGTCAAAAAGCCAAATTT
TTTCTTGGACGTCCGTCAAGACCTTGTCTATGCATACGATTGGCCATCACGGCCTCTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGTGAGCATAC
CCCTCTTTTCGATGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCTGGATGCCAAATTTTTTCGTGGACGTCCATCAAGACCTTTTCTATGCA
TACGGTTGGCCATCACGGCTTGTCCTACCCATTTGGAGGGTCAAACGATCCCCGAAGCGAGCATACCCCTCATTTCAATGATTTTCGTTAGCTATAGAAC
ACCATTTTTGTGTGATCCGGATTTCGACGTCAAAAATGTCAAATTTTTTTGTGAACGTCCGTCAAGACCTTGTTTATACATACGGTTGGCCATCACGGCT
TTTCCGACCCATTTTGAAGGTCAAACGAGCCCTGCAGAGAGCATACCCCTCATTTCGATAATTTTCGTGTGCTATAGCACACCATTATTTGGATGATCCG
GATTCCGACGTCAAAAATGTCAAATTTTTTCGTGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATAACAGCTTGTCCGACCCAGTGGGAAG
GTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTTCTATAGCACACCATTTTTTGGGTGATCCGGATTTCGACGTCAAAAATG
CCAAATTTTTTAGTGGACGTCCTTCAAGACCTTGTCTATGCATAAGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTAAAACGAGCCCCGAAGC
GAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGAATTCCGAAGTCAAAAAAGCCAAATTTTTTTGTGGACG
TCCGTCAAGACTTTGTCTACGCATACGGTTGGACATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCG
ATGATTTTCGTGTGCCACCTCTTTTTGGGTGATCCGAATTCCGACTTCAAAAATGCCAAATTTTTTCGTAGACGTCCGTCAAGACCTTGTCTATGCATAC
GGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACGATCCCCGAAGCTAGCATACCCCTCATTTTGACGATTTTCGTGTGCTATAGCACACC
ATTTTTTGGGTTATCCGGATTCCGACGTCAAAAAAGCTAAATTTTTTCGTAGACGTCCGTCAAGACCTAATCTATGCATACGAGCCCCGAAGTGTGCATA
CCCCTCAATTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCAGATTCCGACGTCAAAATGCCAAATTTTTTCGTGGACGTCCGTCAA
GACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTAAAACGAGCCCCGATGCGAGCATACCCCTCATTTCGACGATTTT
CATGTGCTATAGCACACCATTTTTTGGGTGATCCAGATTCTGACGTCAAAAATGCGAAATTTTTTCGTGGACGTCCGTCAAGTCCTTGTCTATGCATACG
ATTGACCATCACGGCATGTCCGACCCATTTGGAAGGTCAAACGAGTCTCAAAGCGAGCATACCCCTCATTTTTACGGATTTTCTTGTGCTATAACACACC
ATTTTTTAGGTAATCCGGATTTCGACATCAAAAATGCCAAATTTTTTTGTGGACGTCCGTCAAGACCTTTTCTATGCATACGGTTGGCCATCACGGCTTT
TCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATGCCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTATGTGACCCGAA
TTTCGACGTCAAAAATGCCAAATTTTTTGGTGGAGTCCGTCAAGACCTTTTCTATGCATACGGTTGGCCATCACGGCTTTTTTGACCCATTTGGATGATC
AAACGAGCCCCGAAGCGAGCATACCCTTCATTTCGACGATTTTCGTGTGCTATAGCACACCATATTTTGGGTGATCCGGATTCCGACGTCAAAAATGCCA
AATTTTTTCGTGGACGTCCGTCAAGACCTTTTCTATGCATACGGTTGGCCATCACGGCTTGTTCGACCCATTTGGAAGGTCAAACAAGCCCCAAAGCGAG
CATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATGCCAAATTTTTTCGTGGACGTCTGTCAAGACCTTGTCT
ATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGTAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTAT
AGCAAAACATTTTTGGGTGATCTGGAAATCCGACGTAAAAAATGTCAAATTTTTTCGTGGACGTCCGTCAAGACCTTGTCTATGTATACGGTTGGCCATC
ACGTCTTGTCTGACCCATTTGGAAGGTCAAACAAGCCCCGAAGCGAGCATAACCCTTATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGAGT
GATCCGGATTTCGACGTTAAAAATGCTAATTTTTTTGTGGACGTCCGTCTAGACATTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTT
GGAAGGTAAAACGATCCCCGAAGTGAGCATACCCCTCATTTCGACGATTTTCGTGTGTTAAGCACACCATTTTTTGGGAGATCCAGATTTCGACGTCAAA
ATGCCAAGTTTTTTCGTGGACGTACATCAAGACCTTGTCTATGCATACGGTTGGCCATCACGTCTTTTCCGATCCATTTGGAAGGTCAAACGAGCCTCAA
AGCGAGCATGTCCCTCATTTCGACGATTTTCATGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGCCAAATTTTTTCGTGG
ACGTCTGTAAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTCGAAGGTCAAACGAGCTCCGAAGCGAGCATGCCCCTCATT
TCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTTACCCGAATTTCGACGTCAAAAATGCCAAATTTTTTCGTGGACTCCGTCAAGACCTTTTA
TATGCATACGGTTGGCCATCACGGCTTTTTCAACCCATTTGGATGATCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTA
TAGCACACCATATTTTGGGTGATCCAGATTCCGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCCGTCAAGACCTTTTCTATGCATACGGTTGGCCAT
CACGGCTTGTCCGACCCATTTGGAAGGTCAAACAAACCCCAAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGG
TGATTCGGATGCCAAATTTTTTTGTGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTTTCCGACCCATTTGGTAGGTCAAACG
AGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGTTATAGCACACCATTTTTTGGTGATCCGAATTCCGACGTCAAAAATGCCAAATTTT
TTTTGGACGTCCGTCAAGACCTTGTCTACGCATACGGTTGGCCATCACGGCCTATCCGATCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCC
CTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCTGGATTGTGACGTCAAAAATGCCAAATTTTTCATGGACTTCCGTCAACAC
CTTGTCTATGTATACGGTTGGACATCACAGCTTGTACGACCCATTTGGAAGGTCAAACGAGCCCCAAAGCGAGCATACCCCTCATTTCGACGATTTTCGT
GTACTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGCCAAATGTTTTCGTGGACGTCCGTCAAGACCTTGTCTATGCATACGGTT
GGCCATCACGACCTATCCGACCCATTTGGAAGGTCAAACGAGCCCCCGAACGAGCATACCCCTCATTTCGACGATTTCCGTGTGCTATAGCACACCATTT
TTGGGGTGATCTGGATGCCAAATTTTTTCGTGGACGTCCTTCAAGACCATTTCTATGCATACGGTTGGCCATCACGGCTTCTCTGACCCATTTGGAAGGT
CAAACGAGCCTCAAAGCGAGCATACCCCTTATTTCGACGATTTTCGTGTGCTATATCACATCATTTTTTCGTGATCCGGATTCCGACGTCAAAAATGCCA
AATTTTTTCGTGGGCGTCCTTCAAGGCCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAG
CATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACATCATTTTTTGGGTGATCTGGATTCCGACGTCAAAATGCCAAATTTTTTTGTGGACGTCCT
TTAACACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACACTTTATTTCAACGA
TTTTCGTGTGCTATAGCACATCATTTTTTGGGTGATCCAGATTCCGACGTCAAAAATGCCAAAATTTTTCGTGGACATCCGTCAAGACCTTGTCTATGCA
TACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAATGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGGACGTCCGTCA
AGACCATTCCATGAAATTTTTTGACCATTTCATTCTTGAATTTCGGATCACAAAAATTCTATTGACTATAGCACAGGAAAATCAGCGAATTCTGCATTTA
CAAGCTTTGGGCTCGTTTAAACAGGAAAATGCGCCCTTTTTTCCTGCGGCATGAACAAAATACATTGTCAATGTCTTAACAAACATCCATGAAAATTCTT
GGCCATTTTGTTTTGAAAATTATGTATCACAAAAATAATATAGATTTATAGCACATAAAAATTGATAAAATTTGTGTTTTCCTCTTCTGGGACTCATTTG
AACTTGAAATGAGCTTGTTATTCTTGCGGGACGAACTGGATACATTGTCAACGTCTTAATGGACGTCCATGAATTTTTTTGTATATTTTAATTCAGGATA
TTCTAGATTAAAAAAAATCAATGTACTCAAAATATGGATTTATCTTCTTTAGAGTTTGTTTGAACTTGAAAATGCATTTGTTTCCCAGCGGGATGAACTG
GATACATAGCCAACAACTTAACGGAACACCATGAAAACTTTTCGGCCATTGTGTTTTGAGAATTTCAGATCACAAAAAATTCATAGACTATAGCATAGGA
AAATTGGTAATTTTTTCGTTTACCTGCTTGGGGCTCGTTTAAACTTGAAAATGTGCTCGTTTTTCTCGCATGATGAACTGAATAAATTGCCAACGTGTTA
AAGGACATCCATTAAAAATTTCAGTCATTTCATTTTGTGAATTTCGAATAATAAAAATTTCATCGACAATAACAAACGAAAATTGAAAAAAAATATTTTT
ACCTACTTTGGGGCTCGTTTAAACTTGAAAACGCGCATTTTACACTGCGGAACAATTGGATACATTGACAACGCCTTAAAGAACATCCATGAAAAATTCT
ATCCATATCTTTTTTAGAATTCTGAATCACAAAAATTTCATGGACAATAGCACACAAAAATCAGCAAAATCTATGTTGACTTGTTTTAGGGATTGCTTGA
AGTTGACAATGCACCTGTTATCTCTGAGAAACGAACTGGATACATTGCAAAAATCTTAACAGACGTCCATAAAAAATTTCAACCATTTCATTTCAAAAAT
TTTGGATAACAAAAATTTCATGGATTATAACACACAGAAATCTGCATAATCTGCGTTTATCTGTTTTGGGGCTCGTTTGAACTTGAAAATGTGCTCGTTC
TTCCCGCATGACGAACTAGATATATTTCCAAAGCCTTAATGAACGTCCATGAAAAATTTCAACCATTTTATTTTGATTATTTCGGATCACAAAAATTCCA
TGAATTATAGCACATGAAAATCGACAAAACGTGCGTTTACCAGCTTTGGGCCTATTTGAAATTGAAAATGCGTGTGTTTTCCCCGCGGAACGAACTGGAA
ACATTACCAACGTTTTAACGGGCATGCATGAAAAAATTTGTCCATTTCTTTCGGGAATTCTAAATTACAAAAATTTCATTGACTATAACACACAAAATCG
ATAAAATCTTGAAAAAATTTCGGGACTCGTTTAAACTTGAAAATGTGCTTGTTATCCTCGCGGGACAAACTGGATACATTGTCAATGTCTTAACAGATTT
CCATAAAAAAACTTAGACATTTTATTTCAAAAGTTCTTGAATACAAAAATGTGATGGATTATAACACACAAAAATCTGAAAAATCTGCATTTACCTTCTT
TTGGGCTCATTTGAACTTGAAAATGAGCTCGCTTTCCCACAACATAAGCAAAATACATTACCAATCTCTTTACGAACGTCAATGAAAAATTTTGGTCATT
TCATTTCAGAAATTCTGAATGACAAAAAATCAATGGACAAGTAAGACACGAAAATCGGATTAATATCCGTTTACCTGCTTTGGAGATTGTTCGAACTCTA
AAATGTGTCCATTTTCCCCAAGAGACAAATTGGATACATTGCTAGCGTCTTAACGAACATTTTGAAAAATTTTGATCATTTCATTTCGGAAATTTGGATC
ACAAAAAAATCATGGACTATAACACATGAAAATTAGAAAAATATGTGTTTACCTCCTTTAGGGCTCGTTGTAACTTGGAAATACGTTAATTTTCTTCGCG
GAATGAACTAGATACATTGCCAACGTCTAAAAGTATGTCTATGAAAAATTTTGGTCATTTTATTTTAGAAATTTCAAATTATAAATATTTCATGGACTAT
AGTAGCACATGAAAATCGATAAAATATGTGTTTACTTGCTTTGGGGCTCGTTTGAACTTGAAATGTGTCTGTTTTTCACTGGGGGACGAACTAGATACAT
TTTCAACATCTTAATAGACCTCCATGAAAAATTTCGGTCACTTTATTTTGGGAATTTTGGATTACAAAAGTTCCATGGAAAATAACACACAAAAATTGGT
AAAATCTGTGTTTACCTACTTTTGGGCTCCTTTCAACATGAAAATGCAGTCATTTTTCCTGCGGGACGAACTGGATACATTACCAACGTCTTAACAAACT
TTCATGAAATAATTTTGGCCAATTCGTTTTGGGAATTTTGGATCACAAAAATTTCATATACTATAGCACAAGAAAATAGGCAAAATATGTGTTTACTTGC
TTAGGGGCTCGTTTGAACTTTAAAATGCACCTATTTTCCCTGCGGAACGAACAGGTCCATATCTAAGGTCATGACGAATGTCCATGAAAAATCTTGTCCA
TTTCGTTTCGAAAGTTCTTGATCACAAAAAATTCATGGATTATAGCACAAGAAAATTGACAAAATCAACATTTACCTGCTTCGGAGCTCGTTTGAACTTG
AAAATGTTTTCGTTATTTCCATGGGACAAATTGAATCCATTTCTAAGGTCTTAACGGACGTCTATGAAAATATTGGTCATTTCGTTTGGGAATTCCCGAT
CACAAAAAGTCCATGGAATATAGAACACGAAAGTCGATAAAATTCATATTTACCTACTTTGGGACTCGTTTGAACTTGAAAATGCCCTCTTTTTTCTCGC
AGGACGAACTGGGTCCATTGATAAGGTCTTATTGGACGTCCATGAAAATTTTAGTCCTTTTGTTTCGGTAATTTCATATCACAAAAAATCCATGGACTAT
AATAAATGTAAATCGGTAAAATCCGTGTTTACCACTTTACCTAATTTGGGGCTCGTTTGAACTTGAAAATGTGTCAGTTTTCCCACAGGACGAACTAGTC
CATTGCTAAGGTCTTAATGAACGTTCATGAAAAATTTTGGTCATTTTGTTTAGGGACTATAACACACGAAAATCAGAAAAATTTATGTTTTTATGTGCTT
TGGGGTTTGTTTGAACCTGAAAATGTGTCTGCTTTCTCCGCGGGACGAATTGGATCCATTGCTAATGTCTTAATGGACGCCCATGAAAAATTTTGATCAT
TTTATTTTGGGAATTCAAGATCACAAAAATTCATGGAGTGTATAGCACACGAAAATTGACGAAATCTGCGTTATCTGTTTTAGTGCTCGTTTGAACTTGA
AAAATCGCATGTTTCCCCCACGAGATGAATTGAGTCCATTGTTAAGGTATTAACGGACGTCCATGAAAATTTTGGCCATTTTATTTTAAAATTTTCATAT
CACAAAAAATTCACGGATCATAACACACGAAATTAGAGTAATTTAGGTAATTCTTAAAAAATGGTCTGTAAATGTGAGAATGGACGTGAAAAAATGGTGT
GAGTATATATGGTGGTTCCCAACTCATTGTGGAGGTTCGTATAAAATTTTTTGAGAAAACAATGTGGGTGCTCTAGAGCTTCAAATATATGGGCTATGAC
ATAAGAGAAATCAAGGAATTTTGGTATATCCTAAAAAGGGGCCTGTAAATGCAAAAATTGGCGTAAAAAATGTGTAAGTATACGTGGTGGTAACCTAACA
CATTACGTAAGTCCTCATAAAATTTTTTGAGAAAGAATTAAGGTGCTCCGAGGCGCTAGATCCATTGACTAATGCACACAAAAAATAAAAAACTTATGTA
ATTCTTAAAGATTAGCTTGTAAATGTGAAAATATGACTTATCATACGGTGGTAATATGCATATATTTCCCAATTCATTTATGGAGGTCATCATAAAGATT
TTTCCAAAATAAAATTGAATGCTCATAGTTACCAGATCCATGGGCTAATATACACAAAAAAACAAGAAAGCTTCTAAATTCCTAAAAATTGGCTTATAAA
CGTGAAAATATGCCTAAAACAGTGGGACTGTACATAGTGCTTGCTTCCTTGATTCATTACGGAGGTCCTCATAAAATTTTTTTAAAAAAAAATTAAGGTG
CTCCGAAGTTTCATATCCATGAGCTAATACACAAAAAAAACCAATAAAGTCTCGTAATTCCTAAAAGTTAGCTTGTAAATGTTAAAATATGCTTAAAACG
GTAAGACTGTATGTAACGTTTCCCCAGCTCATGATGGAGGTTGTAATAAAGTTTTTTCAAAAGAAAAATTGGATGCTCCGAGGCTTCAGATCCATGGGCT
AATACACAAAATAAAAACAAGAAAGCCACATAATTCCTAAAAGTTTTTTTGTAAATTCCAAAATATGCCTGAAATTAATGGTGGGACTATACGCAATATT
TCTCAACTCATTATGGAGGTCCTAATAAATATCTTTAAGAAATAAATTGTGAGTGCTTAATGCGCTAGATCCATGGGCTAATAATACACACGAAAAACTA
AAAATATCGCATAATTTCTAAAAGTGACTTGTAAATGTGAAAATATATCGAAAAAATAGTGGGACTGTACGTACCGCTTCCCCAACTCACTACAGAGGTT
ATAATAAAGTTTTTCCTAAAAAAAATTGATTCTCCGAAGCGCCAGATTCATGGTTCAAAAAGGAAAACGTCGATATTTTGAAGTTCAAAACGAAGTCTGA
AACACTAATAGGGATCTTTGAATTTTTTGTGTGTTATAGTCTACAAATTTTGGGTGACATGTGCGCCAACTATTTTTGTTTAAAATTTTTTGTGGACATC
TGTGACTATCTATTTAATGGTGTGCATTGGTTCACAGGGCAAACATCGGCATTTTCAAGTTCAAACAAGGAATGAAATGAGAAATAAAGTTTTTTCCATT
CTTCATGTGTAATGGTTTATGAATTTTGGGTGATATGTGAGCCCACCGATTTTTTGGCTGAAATGTTTTGTAGATATCATGATGAGCTTTTTAATGGCGT
GCATTGGTTCGAAGGGGCAAACGTCGACATTTTCTAGTTCAAACGAGGCATGGCACTGGAAATAATTTTTTTTCATTTTCATGTGTTATAATCCATGGAG
TTTAGGTGACATGTGCGCCTGGTGCTTTTTTTAATCAAAATCCACAAACGAATAAGAAAATCATTTGATTTTTGTTATGTAGTCCCTAAATGCTAAAAAT
AAGGGGTAGATCATGATGAAGCTATAGGTATAATTCTCCTAGGTAGTTATGAAGGATCATGTAAAAAAAATTCCAAAAATAAGATCTGAAATTTATATCA
CCAAAAATTTCATATACTAACACAAAAGAAAAATTAGAAAATCGTCTAATTCCTGTTGAGTGCCCTAAATGCTAAGGTAAGGAATACAACAAAATATCAT
ATACATACACTTAAAAGTGCACAAATTTTAACCAACTTACCTCCTCTTTTAACTCAACATATATAAAATGTTTCTCTATAAGTCTTATGCATTGCAAATC
TAAATTAAACACAGAGTAAATCATTTCGCACCAATTTACTATTCTCTCTGTTCATTTTTATTTGTCATGTTGTGTTTTTCGAAAGTCAATTTGACTAATT
TTTAAAGTTAAATTAAATTACATTAATTCGATATTTTCTACAAGAAATTTCGATATTAAAAAGTTGTATGAAAAGTACCATAAATTGCAACTTTTTCCAT
ATAAATATGATGAAAAAATACATCTTAAAATATTAGCCAAAGTTTTTACAGTTTGACTTTAAGAATAGAAACCATCACAATTAAACATGGATGGAGGTAG
TAGAACATTATCACAACTTTACTACTCCCTCCTTTTCAAAAAAGAGTGACATCCTTACCTTTTTGGTATGTTCCAAAAAAGAATGATCTCTTTCTCTTTT
TGGTAAAATTTTAATTTCAGCTTTCCACGTAGCATATTTAAGGCCACAAGATCAAAAGACAATTTTGTACATTTGATCTAACTTTAATTTAGGACCACAA
TATTCAAAAGTCTTCTTTATACTCTTAAACTCCGTGCCAAGTCAAACCAGGTAATTCTTTGTGAAACGGAGGGAGTATTTCAAATATCAAATGAATAAAC
ATAAAAGTAAGTTAAAAAGGAATTAATTGCCATGTAAACATACACAAATCATATTAGATACAATTAAAGGAAGTCACAAATTTAACCTCTCTTAACAGGA
TCAAAGTTGGAGACACCAATAATAACACCAATAATAGCACCAAGCACAACTCCACCAGACACAATGCTAAGCAAGAAGTTCTTAAGTGATGGTGACAAAC
CCTCAGCAGCTTGTGCTACATCAGGTACAACCATTGATGCTGTGAGTACACCTGTTGTCAACCCTACCATTGCTTTTTCCTTAATTGAAGATGCCTTGAT
GACTGCAAACTTTTTTGTAGTTGTAATTTGTTTTGAAGGCTTAATTGGCAATGGCTTGAAAAAAGCTTCAACAATTGGTTGTTTGTTTTGAGTTGTGTAA
GTTAGTGGCATTGCCATTGAAACTATTGAAGAAGTGGTCATTTCTTTTGCCTTTTTGCTATCAAGAATTATAAAAAACAAAGGTTGAAGAAGTGTGGTAT
TGTTATTATGATGTGATTTTGTTTTGAGAGGATAAAAAGAGAGTTTTTAATGAGAGGTGGAAAATTGAAATGTGGAGTTGGCATATTTTTTGTTTTGTTC
TATGTGGCTGATTTTTATTGGTTATATTGGATATGGTTATCTTATTAGAAGGTTGTCACAACTTTATATGTGTCCACATAGGCTGACAAAAGATGCATGG
TGTAGTCCAAGTGTTCATTTGGTCATTAATATTTTTTTAAGTTTAAGTAAATATGACCCCCCCCCCCCCTCCACCTCCTTCCTCCCCTCTTTTTTTTTTA
AAAAAAAATTCAATTGTATACGATAAATGATTAATTTTCATTAGAATTTTGCTCGTTTTGATGTACATTAATGATTAGTGATAGTTGTAGTTGGTGAAGA
TGATTGGCAGTAATGGTTGGTGGAGGTATAGTCGAAGTCTAATAGAATGAAATCTAATAGAATGGTTGTATAGTTATGAGCGACAATAAAAGTTATTAGA
ACATAAATAGAGTAATTGCACAATTATACTTGCTAATCAACAAGAGTCCTTATAGTAATTATTGTCTTTAACGACTTAAACTTTATATGATTATTTATTA
TATATTTAAGACTCACGAGAAGAGTGTTATGTGTAAAAAAATTACTTTAAACAAAAGTGATTGGTAATAATGGTTAATAGTTTTAATTATATAATAGAAG
TTTGGCGATAAAATTGATTGATAATCTAAGTGGTCAATTATGGTGATGGCCCAATTAAGATTGGTGTTTGGTGATTGGGCAATCTTAGTGAACGAAATTC
TAAGAAAGGGTATTTCTTAATTAAGTAAGAACATCTTCACAAATTTGTAATTATATAAAAGTACAAATATTTTAAAAAAAAAAAAAAAACTCATTCTATG
TGTCTCGTTTTCTTTGTGAATTTATTTTTAAAATGAATTTAAAATGCATTTTTTATAGTTAATGGGTTTCTAATCCTACTTTTTGCTTTAGCCTTAATGA
CACTCTTATAGAATTATATGTTTAAGATCACAAATTTCAAAATATTTGATATGCTAAGAGAGATAGAAGTGGTAGTGACCCTTTGTGACAGACAAGATGA
GAGAGATAAAGTTGAGATGGTCGAATATATTTCGAGAAGTAGAGGAGGTGTGAAAGGTCGACTATGATAGGTGTGAGGAGAAGTAGAGGTAGGTTGAAGA
ACTTTTGGGAAGAGGTGATCAAGCATGACATGGCACACTAGCAGCTCACCGAGGAGAGGCTCTAAATAACAGGATATGGAGGTCAAGTACTAGAGTAGAA
GGTTAATAGATACGAGTATTAGAGTAGAAGGTTAGTAGATAGTTGACCGATGTCTAATCTCCCTTGCCAGTTTTGGTATTATTATACTTATATCTTATCG
TCTGATTTTTATTATCAAACGTTGATTCATTTGCTTCAATTATCAATCATTTTACTTTTTGTTGCTAGTGTTATTCTCTTCTACATGACTTCTCCATTAC
TATATTTCTTTTTTCAGGCTTGAATTTGATATGTATAGTTGAGCTGAGAGATTGATTAGAAATAACGTCTCTACCAGCATGAAGTAGAGTAATTTTTGTG
TATATACCACCCTCCTCAATTATCATGGTAGATATTATTGTTTAAGAGCATCGAATTCAAAAGTATTTTACATTCTTAAACTTTATCCTAAGTTAAACTA
TACATAAATTCAAGATCTTTTTTTTAATTAAGATTTAACATTACACCACAACTTTCATTAAACCACCATTGAACACACAGGAAAAAAATGTTAAGAATTT
CTAGATTTATGGTGAAGTAAGAAGGAAAGAAAAAGAATTTTGCAAAACACTACATATTTACATAATGTATTTTGGCTTATCCAAACTCGAAAGCATTCAT
GAGTCGCTAGTCCTCAAAGAGAGAGTCGAGAAGTACTATGCATAGTTGACCCGTCCTTTCTTTCTATCAATCTTACCAAGCAAGATGTAACACAACTAAA
AAATGATACGATATTTTCACCTTCATTGTAGTTTGACTTGTTTTCTAGATAAGTAACACGCACGTATAATTACATCTTAAATGATTTGATAGCGTAAAAT
TTTTTTACATTAGTGTACCCAAACTAAAATAAAGGCATTTATATATTTATGGAAAAACTAAAACTAAGATTTAATCACTACCAAGGAGTGTAGTAAGATT
GGACTAGATTCTCCACCTTTAACTAATATACAAGTATTATGTTTAAAGTATTATAAGTGGAGAAATATATAATATGGATCACTTCTTTTAACGAGCCATA
TACATTGCAAATCTAAAACTATTTCACGCGATTTTAAGAGAGCTTAGAGCGTTATTATGAGCATTTTCTATTTCGAATACTAGATGAATAAATCGAAAAA
TAAGCTAGGGAATTAAATTGGACATGTTAACATAGACAAACAAAACAATACTTGAAACCCAAACAATATATGATATAGATACAATTAATTAAAGAAAAAG
GCAAAAAAAATTAACCCCTCTTAACAGGATCAAAGTTGGAGACACCAATTATAGCACCAATAATAGCACCAAGCACAACTCCACCAGACACAATGCTGAG
TAAGAAGTTCTTAAGTGATGGTGACAAACCCTCAGCAGCTTGTGCTACATCAGGTACAACCATTGATGCTGTGAGTACACCTGTTGTCAACCCTACAATT
GCCTTTTCCTTAATTGAAGATGCCTTGATGACTACAAACTTTTTTGAATTTGCAATTTGTTTTGAAGGCCTAATTGGCAATGGCTTGAAAAAACCTTCAA
CAATTGTTGGTTGTTTCTTTTGGCTTTTGCAAGTTAGTGGCATTGCCATTGAAACTATTGAAGAAGTAGCCATTTCTTTTGCCTTTTTTGCTCTCAAGAA
TTACAAAAAACAAAAGTTGAAGAAGTGTGGTATTGTTAATATGATGTGATTTTGTATTGAGATGATAAAGAGAGGATTTTTAGTGAGAGGTGGAAAATTA
AAGCATATTTTGCTTAGTCCTATGTGGGTGGTTCTTATTGGCTATTGACTATGTGGTGGATAAGGTTATCTTAATGTAAGGTTGACATAATTTTGATGTT
GAGAAAACACCTATGGTACATCAAAATTTTGGGACTCCAAAACTTCCTAGTTGAAGCATATGAGAATGTAATATTTACTTTTTTGTAATTATATTGTGCA
TTTCTTAGTATTTTAAATGATTTCAAAATTTAAGCTTTTGTATTATAATTTATCTTTATTTAAAATTAAAATAAATAAATATACATTTTAAACATAATTA
ATTAAATATTATAATCACTTTTCATGTAGTAAAGTGATATTAATGCAGATGGTAGATAGTGATGATTATACAATAATGATTAGTCGGTGATTGACATTGG
TGGATCGAGTGCAGTAGTAAGTGGTCATGGTTGGTGGAGATGATTGGTAAACTATAAGGTAATATTATCAGATGATGACTATTAGTAAAGAGTAATTGGT
AGTGATGATTCTGTCATTTGATTGTGTGGCGGAAGCTAACAATGGTGGTTGTCAATAGAATTGATTGATCATGTCAGGGTCGATATCGGTCTTTGTCCTC
TAAATGTTGATAACTCTGATATGATATTAATTTGATCTCTATTCATAAATAAAATTTTTTAACTTAGAGCTTGAAAGTATCGAATTCAGATAATTTTATC
TGAAGTTTGACATGACAATCTCGAAAATTTAACTTTGACATAGTGTTTCACTCATAGTACCTTTATTTTACTTCATTCATTATACGGTCAAAAGAAAAAT
TAAAATTAGGTACAACTTATTCCTTTTCACTCATGCAATATATTATTTTTGTCTTATAATAGACATGTATAATGAATACATTAAATTTTTTAGCAAAAGA
GGTATCATATAAACCCCTTGCTTCAATATAGCTCCGCCTAAGTGCATGTGTACTCCCAAATTAAAATATAAACATTCATATATTTCAAGGAAAATTACGA
ATTACCGCCAAGTTATGTGTTAAGATGGACGAGAATCACGTATCTCTAGTAAAATTGACATACATATGTTAGGTTTGAGCTATATTAATGAAAAAAATCA
TGACACGAACCGCTTCTTTTAGTGATGAATACTANACATTCCAAATATAAATTAACCGTATAGTAAACTCTTTCACACTATCTTAGCGTTTACTATTTCG
AATNACAAAAAATAATCCANAATTGAATTAAACATACACAAAATCATACTTGAAAACCAAACAATTATCATTTATATNNNAAGAAAAAACACACAAAATT
AACCCCTCTTAACAGGATCAAAATTGGAGACACCAATAATAGCACCAATAATAGCACCAAGCACAACTCCACCAGACACAATGCTAAGCAAGAAGTTCTT
GAGTGATGGTGACAAACCCTCAGCAGCTTGTGCTACATCAGGTACAACCATTGATGCTGTGAGTACACCTGTTGTCAACCCTACAATTGCCTTTTCCTTA
ATTGAAGTGGCCTTGATGACTACAAACTTTTTTGAAGTTGTAAATTGTTTTGAAGGTTTAATTGGCAATGGCTTGAAAAAAGCTTCAACAACTGGTTGTT
TGTTTTGAGTTGTGTAAGTTAGTGGCATTGCCATTGAAACTATTGAAGAAGAAGAAGCCATTATTATTATTATTATTATTATTATTATTTTGCCTTAATT
CTTCTTCTTTTGAGTTGTTCTATGTCTCTATATTCTTGTGTTTGTTCGTTTGAGAGGTGTATGTTGTGCTTTTGAGAGCCATTAAAGATATGAGAGGTGG
AAAATAGGGCAATTGGTTTTGCACATCTCTTCTTTATGTCCTACGTGGGGATTCTTCACTTGTCTATGGTGGATAACCTTATCTCATTGCAATCCCTATC
ATAAATTTAACCTTGTATACTAGGTGTAGCAGAGGCGGAGTCAGAATTTAAAGTTTATGAATTTAAAATTCTAGTCCATTTGTTACCTTCTCGTAAGAGC
TACCTTTTTTGCTCCCTTGATGACTGACCACAATCATGGGGTTGAAGGTAAAAAGTGTTAACCATCTAAGCAAAGCGCTCTTTGCTATACATATTGAATG
AGTTTGTTATGTCAAATACAAGATTTCAAACAAAGTTGCTAGGTTTGATTTAAATTGTATATCGAAACTAGTTAGTTATATCCATGTTCATTAGTGTAGT
GAAAACCTTCAAAAATGTGAAGTCTTTAATCTTGTATATTTGTCCTTCGATTATTGATAAACTATATTTTGGTTAAATTGAAGTGTATACGTGTAATCCA
TCTACCCCATGAATCTTCATATTGAACCAAAGATCATATAGCAACAATAATCTAAATACGAAAAAGGGGTCCAAAAAAAAATATCCCTAATGTATTAAAA
ATGACACCACAAAGTTGAGTCCGAAGCCTAAAGGGTAAAAAATGTTAATAAAAATTCTAAAACGGTATATGAAATTTCTTTTAAATCAAAAGGGCAAAAT
CGCTCGCGAAGTAGCGATTTTGTCCATTGGAAAAAACAAAATCGCTCCCAAGGGAGCGATTTTCAATTTTCAAATTTTTTTATACCTTTTTAAGTAAGTC
GCTGCTTATGCAGCGACATTACCTTAATTTTTTAATTTTTTTTTGCTTTTTTTATTTAAAAAAGTTTAAATGAAAAAAATATTTTTTTTAAATTACATTG
CTGCAATTTTTAATTATTTCTTTTTTAATTTTTAAAAATTAAATCACTAAAAAAAATTTGATTTAAAATCGCTGCCTTGGCAGCGATTTATTTATTTATT
TATTTAAAAAAATTAATTAAAAATCATTGCCTTGGCAGCTATTTGATTTAAAAAATTGATTTAAACTTTTTTTATAAAAAAAAACAAAAAATATTAATTA
AAAAAAATTATACACAAGTCGCTGCCTAAGCAGCGACATATCAAAAAAATATTAAAAAAAAGATTTTTATTTTGAAAATCGCTCCCGAGGGAGCGATTTT
GTTATAATTTTTTTTTAAAAAAAAAAAGCAAATTTAACAAATCGCTGCTATAGCAGCGATTTTGCTTTTTTCAGTGGACAAAATCGCTACTTCGCGAGCG
ATTTTGCCCTTTTGGTTAAAAAGAAATTTCATATACCGTTTTGGAATTTTTGTTAACATTTTTTACCCTTTAGGCTCCGGACTCCCACAAAGTTGCCCTT
CTTCCAATTATTAGGCACAAATTGTCCTTAACGTTAGTTAAATCTCGACATATATCATCTTATAATTTCATTAAAAAGATGAAAAGTTTAAGTGAACATC
ATGAAACTCATACCTTTTTCAAGAAGGGTATGGATTAAAGATGTGAAAGATATATTAGTTGAAGCTTTTTTCAAGAACTTTTCATTTAAGAACTTCGCGA
ACAATATATTGATCTGAATAAAGAGTCGTAATGAATTGAAAAGTGACTTTTTTCACTTTAGGAGCCACCGTCATCGTCGCAATGGAGAACACTATTAAAC
ATCCACACAAAAAAAAAACTAAAAATGGATAAACTTATTGAAATAGGAAGGGTGAATGCTAATAGTGGAGTTGACTGACTATCTAAACTTTCATGATTCC
TCACTCGTAACCTCTTACCCATTCCCCGACTTCCAATTATTTTATTTCATTTAAAAAAAAAGAAAAGTGAAATAAGAAGGGAGTATATTACATCAAGATG
GGACAGAGAGAATTATTATAATATATTTACCTAAAATACACAACAACCTACCTACCAAAAGATAAGCTTCACAAAGTCAATTAAAATCAAATTATCCATC
AAACTTCCTATTAAAAATGACAAAATAGGAGCTATAAAATCGACTTTGCTTGAAAAGTGACAGCAAATTTTAGATGTCAATTTATTTGTATTCTTCATTT
GATTTCATATTTCATCACAGTTTATTTATTTAAATAACCAGCCAATATTCCTTCTTTATAGTCCTTTGATTCCACGGCTTCATAATTAATAGTAATTCAC
AATTTTTAAAACATCAAACAAATAAAATCAAGAATTTAAGTTATATACATTAACAATGTGTTAAAATATTTACACAATCATATCACTTATAATTATATAG
ATAAATCCTTTATGCACATTAACTAACAGGTAATCTAGTAAGGATGGTACGTAACCTATTAGTATTCCCTAGACTCTGATCGAAATCTCATAAACACACT
TTAACTAAATCAAGGTCCTATTATCGCCTGAACTAATTCATTTTTGTAACTTAATACACCTTTTGTCTTACATGGGTGTCTCCACGAAATTGAGGCATGT
GAAAGATATTTAGATGTCACGTAAGCCAAAAAGGTGCAGAAAAGAACAAAAGAAAATGGGTTTGGGAGATAATAGAACCTTAGTTTAGTTGAGGTGTGTT
TTTGAAATTTCGGTCACAATCTATGGAGATACTTTTACCTTTTACCTTAATATTATCCATGTAAATAACACTCCCTCTATGCAAATACAAATATCTATGA
CTTGTTTTAGACGACAAGTACTAAAAATACACGAGGGGTAACAGAATTTAACTTCCTATACTATAAGATCACTTGAAAAAATATCTAAAACTGCCCATAA
GAAGTAGAGAACTTCTAAGCTGATAATGACAGGTTAAAATGCACATATAGTACTTTTTTTTTCTACCTCTTGTGTAATATAAGTTAAATTTGTAGTAATA
TTATACTACTTTACTTGGTTATATATATCACTAAGTGGTGAATCAAATCTATCTCCTCATAATATTTGCTTCTCAAACAAAAAGCTTCAACTAATCAACT
ATGCCAGAAGCTCCTATGCCTTATATCCCTTCATATTCACCTCCAAAACAGTTGAACTTACCGAGTCTGTATTGCGCTCTTATCATTGTAGGAACAGCAG
TTTTCCTGCTTGGAATCTACAATTTCATCATAACTCGATGGTGCAACGAAAATAACAACACGAATCAGTCTCTTGAACAAAACACTGTCCAGGTTCCTAA
TAACCTTAACGCGAACATAGTGTCCAGTTTCAGGTACACGAAAGGAGAAGTTGGAGGAAATCAACAGGAGAAGAATGGTGATTATGAGTGTGCTGTGTGT
TTATCAGTTTTTGAAGAAGGGGAGGAAGTGAAGCAACTTCCAATATGTAGACATTATTTTCATGCTTCTTGCATTGATATGTGGCTTTGTTCTCATTTGG
ATTGCCCTTTGTGTCGTTCTCCGGTGGAGCCACTAGTGCTTCACCGGAATAGTTTCACAAGGCAAGAGGAAAGTTCTCGAGATGGTTGATAGTTCGTTCA
GTTTAGTTCATTCTCTTTCATTTCGTTTTGAATTTTTTTTCATAGAGGTATTGTCTTTCATTTCATTTTTGTGTTATGATAGTTTTTGTTTCTAGAAAAT
ATTTGGTTTTGCATGAAGATGTTCCTTGATGAAGAGATCTCGGTGAGTGTGGTAATAGAGGAAGATATAGTTGCAATCTTGATCTATCCTTAATCAGAGA
TTTCTCTATGAAAAATATGAATCGAAATTTCCATGAATCATTCATACATTCTAAGGCAATAATTACTGGATCCTATTTTCAAAAAGTTGAATTTAAGTCC
AGTGGTTGTGAAAGACAATATTGGCGAGAGGCAAGGCGACCCTTCCTCGCTTATTAGCTTAGTGGCGAGGCAATCTTCAAAGGCAAAAGGCGAAAAAAGT
GTCGCATTTTTTGTGTTTGTTAAAAAAAAAAAAAACCAATTTAGGAATTAAAAGTTAAAAGGTAATATTATGAATTTTCTTTTCAAATTTAAACAGTTGG
ACTATTAGCCAATGACTTCGGCTCCAACCACTCGACTCAACTAGACTTCTTCGACAAATCCAAAGTCCAACCAATACGTATTTCTTCTTCTTTACTTCTT
CATCTGTTTCTTTTTCTTTCTTCTGCAGACATGAGAGTAACTTCAACCTCTCTTTTTTCCTCACTTCTTTGACTTCTATTTTGTTTTTTTTTCTCGTTCA
AGTTCTTAACTTTTATTTTGTTTTTTCCTCATTCAAGTTCTTTTAATTTTTAGAATGTACTATCTACTTCCAGTATTTGAATTGAATTTGCTAATATTTA
TTTCAGATTTTAATTTTTATATATGTAATTTAATTTATTAACTTTTTAATTAATTGACACTGCACTTCAAAAAGTGAGTGCCTTGCCACTCACCCCGAAC
CCATGTTGCCTTTTGTCATCCAAAACACTGCACCCATCGTGACTTGATAGTCAATGAAGTGAGTTAAAAATAATGAGATTTCAAGTTCAAATTCCCAAAG
ACAAAAACTTAAAGCAATTCCTTTCAATCTATCCAATCATAGGTAGATAAGAGTTATATTAATACCAAGTGGGAGATATCACTTAGCTGATGGAATTAGT
CTCTCTTTCTTTTTTTTTTAACACGTGGAATTAGTCAAGATGTGCCTAAATTGATCCAGCCCAAACACCAGGTTATAGAAAAAGATGATAGTTACAGGAA
ATGCTTGTATTCTATGATGTGAAAAAATGATTACCTGTAACAAATTGTGGCAGGTTTGATTTTTTGGAATATAATACAAGTATGTTACCTTCTCAAAAAA
AAAAAGGAATAAAATAGAAAGCATATGCTATGTTTTGCAAATTGCAATGACAGACACAATGTCTGATCATGAACTCCAGAATTTTCACAAATATTACAAG
AACATATAAAGTTTCCAATTCATTCTACAAACAAATTTACATTTTCCTCAAATTGTCTAACCTTGCTTGCAGATCACTGTCTATCCCACCATCATCATTG
TCAGTTGCCTCAGCTTGTGCAACCTTGCCTTTCGCTGCTGGAGCAGCCACCGCGGAAGAAGGAGCATTGACAAGCTGCCATTAATATTCAAGGATAATAA
GTAATTAGAGCATTGCAAACATATCATATACATACAAATAGGCCGTAACGGAAGAGTGGTAAAAATACCTCATTGTTGATATTAATTCCAATCTCATCAA
GGACCTGGCTCACCAACTCTTCAGTTTCTTCTTCTTCCTCATCCCCTTCCAAAGCATCATCAATGGCATCTCCCATCACCTCACTCACCATTTCCATCTT
TTCATTTTGCATCTCAAATTCTTGCATTATTCTCTGCAATGCCGGCAAATTCATCTGCCTGTTCATCTGTCCCATTGCCTTTGTAACGCCTTTCATTGCT
TCACCCATTGCTTGTGTTGATTTCAAAGTCTGATACCAATGATAATATTTGGGTATTTGGAAAGAAAAGAAAAGAGTTAGGAAACAATTGATTTTTCAAG
ACAACCAAATATATGCAATTAAAAAAAATCAACAATATTAGGAACTCTTAATCAATCATTCACACAGCATAAATATTTTTGTCAACCAGTTTGCATATGC
CTAAACAGTTTGAATGTGAAGGGAATGAATCATTATCAGAATATGTTAGTAGTTCCCTTGCAGCACCAAAAACAGAAGTAGATCCAGGACTTAACCCTTA
TGTGTTCAATCCTTTAAGATTCTTAGGATTGAACACATTGTATTTTTAAATTATGAGTTCATACGTACTATTTATTGCAATTTTAAACTACTTCTGCACA
AAAACTTCTGCTCTACGTCGAAAATAATGAGTTCAGATGAACCCAGTGCCGCTATTTGTCTCTGCAACTGATGGAAAAGCTTCCCAATTTTCCATTAGCT
GGTGATGGGAACTTACTTTTAAGATTGCAGAGTTTATTCCAGAGGAGGGAAGGAATAAATCAAGGATACTGCTTTGCAAATATTAAGCTTTGTAAACAAC
AGTCAGATGTACAACAGCAGTTTTATCCTCAATAATGATAACACTTCTCAAAAGCAAAACAGTAGCAATAGCAACAACAGCAAGAAAAAACAACGATAAT
GATGTCCATAACTACCTGAATTCTGAGGGAGACACCTTGAAGTTGGGACTTAAGCTTGTAAAATTTTTCAATCTGATGCCTTGTTCTAATAAGATCTTTC
GCCATCACCTTCACAGCTCCCTAGAATCAAAAAAATTCAAATCACAAACGGGCTTAAGAATTGTTGTTAATACAATATATTTCCTTGCACTATCTACAGA
ATAATACATTACTGAATTCAAGAAACAAAAGTGCCGAAGCAGACAGTGCTTTTTTCCGAGACTCAATGAAGTTGCACTAACTGCATAATGGATTTTCTGT
TCAACTAATTGAACCAAAGTAAAGCTTAACTAGAAAACATAAAAGCTGGTGCTTTTTGGGTTCAACTCTGTGCAATGTGAGATTAACATTAACTACAGTA
CAGGCCTTCTTCACCACTTTGTTACGAACAGCTAATTTTTAGTAGTAATTCAAGCAACTAAAATACTAATAACTGAAGTGCATGATAGGCTCCACCATCA
TAGAATAACCTACCTTTTAGAAAATCACAGCATGTGTACCGTTAATTTGAAAAAGTAGAGAGGCAAATAAAAAAGATGAAGAAGAATTACTCTTTACGAA
GTGGGGTTTATATCCAGATAGAAGACATACCATCTGTCCTTGCTTTGCACTTTTCTTTATCTCTGCAATTAGTTTCTTCTCTTGTGTTTGTAAGCCCTGT
CTCTCCCTTTCTATTTCTCGGATAGATTTATCAAGCATACGCTTGTTTTCACGCAGGAGTTCTGCAAATGAAAATAGAACATGAGAAACCAATGCAAGGA
AATCCTTCAGAAAAGACTAACAATGATCACATCCCATTAAATTACAAGGGAACAACATAGAACAGTCGTGCATTGTATATAAGAAACAATAAATGGGGAA
ATTAGGAAGTAAAATTCATACAACTGAGAATTAGCAAGAAAAGCTGTAATAGCTCGATTTACCAAGCAAAAGCTGTATTCTAGAGATTCCAAAACTAGTT
CTCTATAAAAGAGAAGTGTCATATGAATTTAACAAATATATAAAAAAATAAGTTGTAACATTACATGCAGAGACTATCAAAAATTTAGGAAAGGTGCATA
GATAAATTTAATTTTCACAAAGAGAATTAAAAGTTCTCAAATCGCTCCTAAACAGATTGAGTTAATGGTAGTTTTTCCAACAATGATGAACTTCTCACTC
GCAGTGTACTAAAATTTTGAGAAGTGATGGATAGAGATAAGGCCTAAGAGATACAAATACCCTGGTAATGTTTCAGCATCAAAAGCAATTGGAAATCAAA
TTCTTCCTTAACCCCAAGTCCCAATAAAATGAGATTTTGTTTAGACTTGCAGAAAACAAGTGAGGCATAATAACAATAGGTTCAGACAAGGATGGGCAAA
AGAAGGTATTTGTAATTTGTAAAGATAATTTTGAGATCTAAAATCACTCAAGGTAAGAAAAATGTGGAGCTTGCTCTGATAGGTAAGCAGGTAAACCAGA
CACAAAAAAATAACGCCGAACTAGGCATTAAGGCAATTTCATTAGTAGGAGGTGACTTCCAAGAGCATGAGCGCGCGCACACACAGACAGAACATGCAAT
AGAAAAGCACCTGCACTTATCTGTATCAAGTTGGTATTCATTTTCTTTTTCTTTTCTTTTTTTGGGTGTCAACATAGTCTATCATGTGCAGTTGAACAAG
ACCAAGCCCAACACAAAATTTCCATTTAAGTGTTTGAGGTTTAGCAGTAATAAGTATAAACCAGAGGTTTCAAGCTTTGAGCCTTCTTGGCCTTTCAGCT
AAGATCAAGTCTAGTATATGTCGTTGTCAGTTTAGTATGAGATATATGGGACAACACGCATGATGTCCACTCAATCTTTTACAGAAAACTTCCAACATTA
AATTTGAGTAAGCACATGCTCACAATCAGAAAAATAAAAGAACTCCGACCATTATACAATCTAGACAATGGAATACGCATAACCAGGAATCATTTGGAGC
ACAACAATTTCTTCCTCAAATACCATCTGAAGAATGCCAAACTTAAAAAGACAGGACATTAAGGAGACCAGACGGCCAGACCGAACCTCTTGCCATCACT
CTGGCAAAATATAAACTTAATACATTCAAAATAAGAAATTTCATCACCCAAAATGCATCATTTGTTTTCATCTAAACTCACTAAACAAAAGCATCAAACC
GGATAACTAATACTCACATCAGATAAGAGATTTTACAAAATTATGAGCCAACAGCGTAAAGTCAAAAAACTCATCGATTTTACTATACTTCCCAACAATT
CGAGGTGATCATGTGCCAATTCACATACATCAGGAAACAGGAATTTTTCAAAAAGCAATAACTTCATTGAATAAATTAAAACAGGACACTAAAGCAACCA
CAGCCAAACTTATACCATCACTAGCAAAATTTAAACTTTAAACATTCTAAAGAAAAATTCATTATCCTAAACATCATTTTCTTTCCCTAAGCTCACTAAT
CAAAAAGCATCCAAACCGGCTATACCTAGTTTCTCATCAAATATAAGATTCTGCAATTAATATCCAGCAGTTCAAAGCCACACTTATCAATTTTACAATA
CATACAAACAATTCCAGGTGATCACGTCTCAATTCACAAAGGTTGCTACAGCCAAACTTTTGCCATCACTCCAGCAAAATTAAACATTTAAACACTCTAA
AGTTTTATTAAAAAATCATTATCCTAAGTCCACTTATGCATCATTTCCTTTCCCCTAAACTCACTAAACAAAATCATCACAACCTTATATACCTAATTAA
TCATCAAATAAGAGAATTACAAAGTCAAAACTCATCAATTTCACCATACTTTCCAACAATTCGATGTGATCACATCTCAAATTCACATAGATCGCGAAAA
CATGAATTTTCAAACCGCAATAAATTCATCAAAATAGCAGTAAACAAAACATCAATTCGATCAATATCAAAAACAGAAATCTCCTGATAAAAAACCGAAC
CTGCCGGAGTTTTTCTCTTGCCGAATAGAAAATTCATCGTAATTAATCGATCGGCGATTGAATTTTCCTCCTCCTACTGAAAAATTGGATTTATCGACGG
AAGAAAAAGGGGAAAGTGTGGGGGTTTTGGGTTAACGAATAGTCTTTTATGCACTACGCGGCAATAGTGGTTACCGAATCCTTTCTACAACACGGCGAAG
TTAGTGCGCGAATCCCAAAAAGAAGTTTCCGGTCAGAGATGGGCTTTGGCTAATGGGCCGTGTTATTGGACTCTTAACTTTGCAATGAATGGGCTTACGC
CCATTATGAACTTCACAATATTCCATTTTGGATGTATCATTCCAATTTTTTATAGGGTAACTTTTACATATAGTAAACATAAAAGTCATACTTATATGTT
ATAGTTATACTTTGCATAATTATACTTCATAGAAAACATAAATATATATATTTCTCTATACATATATAAAAAAAAACAATTGTATAATTTGTTATACATA
TACAAAGAAATCAGTTGTATAATTCGTTATTTATATACAAAAGATTAATTGTATAATTTGTGTAGGTATAAAACAAGAAAGAGAAAAATATAAAAGAAAA
TTGGGCAGAAATTTTTTTTGTATTGTATAATTATAAATGTATGTATAAGAATGAAGATATATGTATTTGCATGTGTATATACAATTTTCTCTCGCTTTAT
ATAAACAGAAACACAATTTATACATTTCGTTTGTGTTGAAATGAGCGAGAGATGTGAGATGGCGAGCGAGATTTGAGAGAGGGGAGAGAGAGGACCGAAA
ATATATGTATTATATACAATTTTCTCTCACTTTATACCTACAAACACATTTTATACATTTGTGTTTGTATAAAAGCAAGAGAGGCGAGCAAGAATTTGAG
AGAGAGAGACGACTGGCAAACAATTTGCTACAGAGCACAATTAAATCAAAGTATGATTTTAGCATTTAATTTGATTTATTAGATTGCCCCTATAGCGTAT
ATATGGATAGGTGAGCATATAAACGAGATAAGATTAGGAATGAAATTATTTGAGATAAGGCAAAGTGACTCTCGTGAATGTTAAGATGTGGGATCCAAGT
GAGACTATTTTGGACACGTGTGAATAAGAGATTTACAAAATCCCCATTTTTGGTGTGACAGAATGACCGCATTGGTAGAGTTGAGGAGTATTGGAGTGGG
GTGATTAAATAAGAGATGAAGCAACTTTAGGTTACTAAGGTCATTCCTTGACTAGAGATTGTAGAGGTCGAGGATTATATTAGATAATTAGACGTAACTT
ATTCTCTTACTTAGCGTATCACACTTTGTTTGGATAGTTGTTAGGTACAGTTTATAATTGTTTACTCCATCCGTTTAAAAAAGAATGAAATTATTTTATT
TTTAGTCGATTTAAAAGAGAATTACTCTTTTTTTTTTTTGACAACGCTTTAACTTTAACTTTTTACGTGACATGTTTAAAACCATAAAATTAAAAATTAT
TTTAATACATTTAACATAACTTTAATTTAAATCACAAAATTAAAAACTTTTTTTTTTTTAAAACTCGATTTTAAGTCAAACGGAAAGTATGATGGAGGGA
AAAAAAGAACACCCACTACTTCACAAATTTGGGAAACAGACAAAAAAATGAAGCATTTGGATAATAATTTTGTCGTTTTCCTTACCGTCGTTTTGTGTCC
AAAAGCCGCCAAAGCCCACCGGGTTAACGTCGCCCCAAATGCGCCACGTGTCTTCCTAAAATGATTCCTCCGCGTGGTGACAACTAACTTACTACACTTT
ATTATTATTATTAGTATTATTATTCATGCTCGATACTTGATTTAAATTTATATTGTATAAAATTTATTTTATAGAGAAATATTTTTTAATTTTAAAAAGT
TCATACATAGTCGAATCTATAATCTCCTTGATGTATCATATTTATATCATAATTTGATCAATTTTAATTTATTATGGTATAAGATTTATTTAAGAAAAAA
AGTGTTTTCTAATGTATATCTTATTTAGATGGTTGTTGTCAATTGTATGGTTAGTTTAAATATAATATTTATCTCAATTTTTACTTAATTTCTATGGTAT
TAAATTATTTAAATTCATCGTTAGATAACAATAAAAAAATTCATTTTATGTAATGATTAATTTTGTGTGATTGCTTAATTATGTATCTTAATATTTTCTT
CTTATTTTGTTTTTATTTATTATTTAATAATCATATATCATCTTATTATGTTATAATAGACAATCCATATCTCTTGAAAACCGTATAAATTGAAAGCTCT
CTTTGTATTCGACTTTTTATATCATCATTTAAAATATAAATGTATGACATTATATAATGACGAAAAATAATTCCAATCTATCTAAACGCTATATTACAAT
ATATTAATACATATGAAATAATACGCAAAAACAATATAAAAAAATTAAAAGTATTTTATATCCATTTTGAGATTCTTGCTAATTTAAGTTCTAATCGTAT
AAGATTTATTTTATTTTTTTTTAAAAAAAGAGTTTTTTTTTTCATTAATTGCCTCAGCCATTTGGAACATACTTAATTCTACACTATCGAACCCACTCCA
TAATGTAGCGCGTCTTCCTCACGTACCAAAATGGAATAAGTAAATTAAGTACTTATTATGTTTAAGAATAATATTTTTGTAAAATAAGTTATTTTAAAAC
TTTAAAACTAAAGTTTTAAATTGGATAGTCCTCTAGAGAAGATATATTTTATTATTTTATTATTTAATTATATTCTCAGCTTGATTATATAGAAATTATT
TTTTACATGAGTCATAATGAGATCTAATTTTAGAAATTCTACTTAATTTGACATTTCATTAAAGCGCATAATTATTTTATTTAAAAATTAAACTATCAAA
GAAAAAAAATGCATACTTCATTATTTAAATATTTTTTTATTATTTAAATATATTCTGATGATTATCTCAAGTTCTTCGCTTTCTCTCAAAATTTGGAAGG
ACATAAATTTTTAAAATATTTTATTTTAATTTAATTATCTCTCGTAGATTTAGAATGTAAATTTATATTAAAAAAATATTTTATTTTTCTTTTAAATCAT
CTCCCGTAAATTTAGAACAATAAATTTGTAGAAAATTTTTTCTATAGGGATTCAAACTTGAGCACTATATAAATTTTGAACACATATTTACCATTACGTT
ATAAATCTCCACCTATTTTTAAAGATATTCAAAATACTATATATATCAATATAAACTAAAACTCCAATAATCAACTAAACACACTCACATATAACTCTTC
CCCACAAATGGATGTGAAAAGTCATTTTGACTACCTCAATCTCAATGAAGTTCAAGAAATAACTTTTCTCAAACAATTAAATTTTATTCGTTAAATTATC
CTGATTATATTACTTTTTCCGTTTCACAAAAAATGACATAGTTTGATTTAACACAGAGTTTAAAAGTATAAAGAAGATTTTTAAATCTTGTGGTCCTAAA
TTAAAATTATGTCAAATGTACAAAATTATCTTTTGATCTTGTGACCTTAAAATACCACGTGGAAAGTTGTTATCAAAAAAAGAAAGAGATCATTCTTTTT
GAAACATACTAATAAGTAAAGGAGGTTATTCTTTTTGAAACAGCGAGAGTATTAATTATTATTATTGTTGTTGGTGAGGTAAAAGTTTAGTAGTGAAACT
AAAGTTATTAATAAGGAGTTTAAATTTTTTAAACATTAAATCTATAGACAAATAAAAAAAAATATTTATTATATAAGTAAAAATATAATATAACTAATAT
TAATATTTTTTATCAAAGGGTTCGAATAGGGAGCTATTTTACTAGAGTTACAGCGGAGTGTACAGAGTTGATGATGACAGCCAAAGTAAATTAATTTTTG
TTTTATTCAAGTGGGACCCAATCAAGAAGAAGAAGAACCATTGAATGATGATAAAGTACTAAAGACAAAATTTATAAAAAAAATTTTTACTATATTAAAA
TAGTTTGAATATTGATGTTGGTGATGCCATTGATGGAGGTTTTAACGAAACTAAGCTATTATATAAAGTCATTTATCAAAATAATATGTTTTTTTAAAAT
TTTACAAAACTAGTATAAACGTATTTCACAGTAATGTTTTAGGATATATTTCGTTTTTTAAAAGTTGATGGCGTCAGATTGATATACGTTACTCACAATA
ACGTTTTAGGAGTAAAACGTTATTGAAAATAACGTTTTAAAAGTAAAACGTTACTTACAGTAACGTATATCAACCTAATGCAGTTAGTTTTTAAAAAATA
AAATATACCCTAAAACGTTACCATGAAATACATTTATACTAGTTTTGTAAAATTTTAGAAAAATATATTACTTTGGTAAATTGTTTTATATAATGACTTA
GTTTGGTTAAAAATTCCCATTAATGTGTTCACTTAATTTTTTTAATATTAATTTTTATTATAATTCAGATTTTTTCTATAATATACTCCCTTAAATTCAA
TTTCTTTCCTTATTTTTTCAATGACAAGTATTTTTTTAATTGCAATAAAAAAATTATTACAAAACTTCTCATATCCTTTTCGTAGTTTGATTTGTTTTTA
GGTTATCGTTGATCTGTTTTGCGAGATCATTTTATCACGAGGCAAAAGCAATCTTAAAGGCTACGGTAATTGTTGATTGATGTAGTTTTATCGTCTATTT
TGATACAAATAAGATACAGAACAATAGCACCTAAGCTTCCGATCTAGGGCTCAAAAAATGACCAAAAATTGAATTTAAATTTTAAGAATAAAATCATCTC
TAGTAAAAAGGACTTACATTTAATTTTTAATTTTTCAATAACATTAATAATAGTACTATATTTAATATAGTATACAAATGAGGTTCGTGAAGAGAAATCT
TTAAAGTATGATAATATTTTACATTATATTTTATCTTTTTAAATATAGAATATGAAGTTATTCTTAATTCTATTTTTTTCAAATATAAAATATTTCACTT
AATAAAGATTTAACATTTCAACTTTATATATGTTAATATTATATGTTTGTTAAAAAAATAAGATTCCTGAAGAATAAAAAGGAAGTTGAAAAGCCCCAAA
GAAGTTTGTTTTAATTTTTTTTTTTAAAATTCAGTTTGGTTTAAATTAAATGCAGATAGAGAACAAAAGTAAATTGTTGTCAAAAGTTTGAAGTCCCAAA
GTAGAAAAAGTAAAATTAAATTAAAGTAGAAAAAAAAATTAATTGTTAATTAATCATCTAACTGTACAGTGTGTACATCATAGCCAGCAAGAAGATGCAC
AGAGATTCTTATGCCATTTCTTACAAGGCAAAAAAAAAAAAAAGATTTCTTTTTAGAGAGAGAAAAGAGAAGAGAGAGAGAGAGTTTCAAGGAAGGAGAC
ATGCTTGATTTCATACCAACAAGCAACACTTGTGTTTATTTCTTTTCTTAACTTTAGTGGATTCCACAGGTCCTTCTCTAAATCCATTCACTTTTTTTTT
TCTTTCATTTTTTTTTTTTATGTTTTTTCATGTTTTAAGTATGGGATTTATTTATGTGTTTTTGCCCAATAGTTTTTTTCTTCTTCTTTTTTTTGTTTGG
TTGTTTTATTTTGGTTTTGATTTCTAAATTTCTCTTTTTTGGGTATTGTGTATTGGTTAAGATAAAGAATGTTCTACATAGTGAAAATCTTGAAATGCAT
GTGGACTTTAAAGTCAAAGATGTGTTTTTAAGATGGTTTTGTATGTGAATAAGAGGAATAATGAGTAAAGTTGCAATCTTTATTGGTTTTCTTCTTGTAA
TAGTTTCATTTTGCTATTGATCTCTAAATTTCCCTTTTTGATGTGTATGTACTGGTTTGGTTAGATAAAGAATGTTCTACATAGTGAAAATCTTGAAATG
CATGTGGAATTTAAAGTCAAAGATGTGTTTTTAAGATAAATTTTGTATGTGAATAAGCGGAATAATGAGTAAAGTTGCAATCTTTATTGGTTTTCTTCTT
GTAATAGTTTCATTTTACTATTGATCTCTAAATTTCCCTTTTTGGATGTTGTGTATGTACTGGTTTGGTTAGATAAAGAATGTTCTACATAGTGAAAATC
TTGAATGCATGTGGACTTTTAAAGTCAAAGATGTGTTTTTAAGATGGTTTTGTATATTGATAAAGTGGAATAGTGAGTAAAGTTGTAACCTTTATTGGTT
TTCTTCTTCTAATAGTTACATTTTGCTATTGATCTCTAAATTTCCTTTTTTGGGTGTTGTGTGTATACTGGTTTGGTTGCATAAAGAATGTTCTACATAG
CGAAAATCTTGAATGCATGTGGACTTTAAAGTCAAATATGTGTTTTTTAGATGGTTTTGCATATGAATAAGGGGAATAATGAGTAAAGTTGCAATCTTTA
TTGGTTTTCTTCTTTTAATAGTTTCGTTTTAGTATTGATCTCTAAATTTCCTTTTTGGGTATATTTACTGTTTTGGTTAGATAAAGAATGTTCTACATAC
AGTGAAATTCTTGAATGCATGTGGACTTTTAAGTCAAAGATATGTCTATTTAAAATGTTTTTGCATATTGATTTGGGAAAAATGAGTGAAGTTGCAATCT
TTATTGCTTTTCTGTATATTTTCTGTTTATGGGTTGTGATAGGAAACTGGGTTTTTTTATTGTTATATCTATGGATATTCTGTTGGTGATAGTAACATTT
GCAGAGTGGGGTTCTTGATGTAATAAAGATCAGCATAATTGGTTGATTCTTTCTTGATCTTTTGTTCTATATATTTAGCATTATTGGTAAATTTGTTGCG
ATGTGACTTGAAGGTCACGGTTTTGAGCTGTGAAAACAACCTCTGTAGAACTGCATGTAAGGCTGTGTCCAATATGCTCTTATGTTCTGGTCCTTCCCGG
ACCCTACATATAGCAGGAGCTTAGTGCACTGGGTGGATTTTTTATGTGCATGCCCAATAGTTTTCTTCTTAAAGTTTCATTTTGCCTCTAAATTTCCCTT
TTGGGGTATAAGAATATTCTACAGAGTGAGTCTTGAGTGCATGTGGGGTTTAAAGTAAAAAAATATGTCTTTTTAAGATGGTTATGCATATTTATAAGGG
GAATAATGAGTAAAGTTCATATCTTTATGGGTTTTCTGCATATTTTTTGTTTATGGGTTGTCATAGGAGAATGTGTTTTTTCTTCTAATATCCATGGAAG
TTCTTTTGATGATAGTAATATTTGGAGAGTGGTGTTTTTGATGTAATAAACATTTAAATATTTGGTTGAATGTTTCTTGATCTTGTGTTCTAGGTTCTGA
TCTAGTGTTTTTCGCCTTATCTTTTTGAAGAGTTTGCTGGCTATGTTGCTCGGACTCTTCAAAATATAGACGGGGTGCATGTGGGATACTCCTAAAATAG
TGTATTTTTGGAGAATCCGAGCCACATGGTTTTCTCGTGATATATGACTTGGTATGTTGATCAAGTAATCTTTGGGATATAAGATTCTCATGATGTTAGA
GCAAGATGCATGTGGTTTTTTGTTTTAATTTTCCCATTGGTAATTTTTTTTTTGTTCATTTCATTTTAGGTGTTCATTTTGCTATGTCTGATCAAATCCT
TTCTACTATGGTTTTTTATAGTCATATATATGAGTCGAGTATATCGGGTAGGTTAATGGTCTTGTATTATGTATTGATGAACTGCTAGTTACTAGTTACT
GCATGTAAACATCAGTCACAGAATGCTTACCCACAATTCTGCTTCGGAAACTTCTCTTTTGAGGCAAGGTCTATCGAGAACAGCCTCTCTATCCCACAAA
GGTAGGGGTAATGTGTGCATACATCGTACTCTTCCCAAATTCCACTAGTGGAACTACATTGGGTATGTTGTTGTTGTTGTTACCGCATAACCCTGTCTGT
CCTTGTGTATTTTATCACCTTATGGGAGTTCGTGTTGCAGGTTTGATGACTAAGATTTTGTTGATGTTGTTTCATTTTTCATATATGCTATGTGATTCTT
CCTCTAGTGGTTGTAATATTTCTTTATTTCTGTATGTTCTTTGATATAAATTACCGAGCCGGGGATCTTTCGAAGACAACCTTCCTATCTCCGTTAGGTA
GGGGTAAGGTCTGTGTACAACACTCTATCCCTCCCTAGACCCCACCTTGTCGGACTACGTTGGGTATGTTGTTGTTTGCTTTGAATAGCTAATCATGGTG
AGTTCCAATGAACAAGAAACTTCACATTATAATCGGAAAATTGGTCTCAGAAGTGGAATTTCCATCTCCTTGCTGCCAGGAGATATGAAGTCTTTGGATC
CTGACTTACAAGGCGAGACATTGCGGTTGACACATACAACTCTTAACTCTCAAGACGAAATGACTGCCTCAGGGAAAACAAATTCTCAAGATCAATGTGC
TTCCTCAGAATATGGTACAGATACTTTATAGTTTTCTTCTGTCCATTCGGCTAGTTTTTTTTTTCCCGATACATAAATAGATTATCTATCTCAACAAGCT
TTAGTTTTTTTACTTGATGAAGTTCTTTTGCTGATAATGATTGATCATCTTACATCTTACTTATGATTTTCCAGCTCATGATGAAAGATATGGAAGAGAT
ATGCAGGTTCAAATAAAGCCTGCTCTTTTTTCTTTGCAAAATGAAGTGGCCAATTCAACTGTATGTTGTCTCCTTTTTAGAGATTTTTGCCTTAGCTTTT
GGCGTAATCTTATTTATTGTTTTCTCACGTTGCAGGGTTTATCTGCTTTTGGCTACTCTGATCCCTATATCAGTGGCTTATATACTGCTTATGGACCTCA
GCCTTATGTGAGTAATCTGCTTTGGTTTTTGTCTCTTGTATGTACTCCATTCGTCCTAAAATAAGTGTCACTTTAGCTCATTTCATGTCTGTTAAGAAAA
ATAATGGGTAGTTTGCTAAAGTGACACTTACTTTGGGACGGAGAGAATACTTGATTGCAAACAATGAGCAGAATTCTGTCATTCTAGTTGTAGCTGCTGT
AAGTTTGCAAAGGAGATGTATAATGGTATCACATACCGACTCCTAATTATCTCGTAAATGTTCTAAGTTTGATATTTGGTCAATGCAGCCTCAAATGATG
GGCATAGCACCTACCCGTGTCCCACTCCCCGTTGATATGGCAGAGGATGGACCAATCTATGTTAATGCAAAACAGTACCATGGGATCCTAAGGCGGAGAC
AGATACGTGCAAAGCTTGAGGCTCAGAACAAACTTGTCAAAAATAGAAAGGTAATTTGGGTACTTATTGCTCTTCTGCACCTTTATTGTATTTAGGAATA
ATCGATACATGATCAGGCATTATTCCGTTAAGTGCTCAGTGTTACTGTATAAGTCATGATTCCCTAAGTCTAGTTACTGTGGTTCTTCGTTAATGTTGTA
CTACATTTGTCATCGTTGTCTTGACTAATGAAACTTGTCGTATTCCTGCTTCATTCTTTAGAGAATAGCATCTACTCTAGTATTCTGGTATGAAAATTTT
CATCGTAATGATCAATATGGCAGAAGAAACATGGAAGTAGGTTGGTTATAGAGATCTAGTGGCTTTGCATTTCCGAGTTTTGGGGCTAACATTATGTGCT
ATTCGAGCTGGTCTGTAACGCCAGTAATAGGACCATGTGCACAGAAGCAAATCAATTAGGAGGACTACTAATAGAAAGTCTAGGGTTGTGTACTTACACT
TTTATCATTCTTCAAGATGAATTTTGAGCTTATTCGTCTGGTCAACTTTTTGCGTGCAGCCATATCTTCATGAGTCACGACATCTTCATGCAGTGAACAG
AGTTAGAGGGTCGGGTGGACGTTTCCTCAGCTCAAAGAAAGTTCATCAATCTGATCCAAATAGTTATCCTACTAACTCAACTTCTTCTCTAGACTCAGTT
GAGCATGAAGGTTCAACTTCTGCTTTCTCAAGTGTCCGTCAAGATGTCGTCCACAATGGCATCAACTTCCAGCAGCAGCAGCCTGATCACATGGCCTTCA
GTGTATCCTCTCATATGGTTATTACCATGCAAGGCAATGGGACTCAGCAACACGCTCCAGTTGTCCGGTGATTACAAGTTCTTAACTGTCTTACGACAGT
CACCGGCAGGCAATTCATCCTTGGCTTTTACTCTTTTCCCATTATGTCTCTGATTTTTGCAAGTGCCAACTTGTTTCTACTGTTATAATGGTGAATTTGG
TCTCCTAGATTTATCAAACCTAGATTGAAGAAAAGAACGTCTTTCGTTCTGTATTAGTTGTTATCTGTTCTGTTGCATGTCTGCACCTAACATGGAATGG
TTGTGCAGTGAAGTTGTTAATGATAAACTGAAAAGAAAATGGAACTGGTTTTATGTTGAATGATTCAAGAGGTTCATGTAATGCTAATATGTTTAGTGGT
CTTGAATTGAATACATCTGTTGTTGTGTTTTCGAACTAGTTAAAGAGCACATGAACGATTTCCATGGACGCCTTTTGACTTCTTTCGTGTGTTTATATCA
TCATGTTTTCTAACACCTGTAATGAAAATTTTGACTCCGAGACTGAATGTGACAAGCATATAAGAGAACAGCAATGTGATAAAGGAGACCTTAGCATAGT
TGCTTAAAATGTAGTACAACAAGAAAAATAAGATTGTGAGATTTCACTTCACAAGCAAAACTGCTTCTGTCAATCAATACTGAGATGATAATTCAGTTAC
TGATACAAGTTCATAAGTTCATCCTTGAATTTCGCCTTTAGGGGTTCGCGCTTCAGTTTGAGAGCTGGAGTGACTAATCCGGACTCAGGCGTCCATGGCT
CGGGTATCAACTTGATCTTTGCAGGAATCTCAAACTTGTCCAATCTTGCAGCTTTGCCTACCTGCATTTCAGCATAACACTCTTCAATTATGTCTCCTAG
GATGTCCTCTCTTACGATAGTTTTGAGTTATCTAGATTGACCTAGCTAGCACCGAGCTGTCATAGGCCAATATAATCTCAGAAGTGGGGTCGGAGAGAGA
TAGAGGGGAGGATGTACGCAGACCTTACCTATACCTTTGTGGGGATAGAAAGAATGTTTCTGTAGACCCTTGTAACTGATAGGCGGATGTACAAAATAAG
TGTAAACAAATACTAATACACATCGGGAAAAAGGGGACTACGTGATACCTAAATCATACTACTAGAAGTACAACAACACTCGACTACCAATAGCTACCAA
CCTCATATAACGTCCTATCTAAGGTCATTTCCTGCTCAATAGGGGTCGTGATTGATGATAATTCGGATGAAAAGGAGACGAACCTTTGAGAGTGATTGCT
GGACCTCATTGACTGCTTCAACTTTGTTGCACAGATCAGAAAAAGCTCTATGCTCGATGCCATTTTCTTGTGCCCATTTCTCAAGCACCTTTTGTGAAGG
AACAACTAGTGCAACACAGTAACTGTGGAAGGGGTCTGCATAGGCCATGATGTTATCCACATAATTGCTTGAGGAAAGTGCAGCCTCAACCTGCAACGAG
CATCAACTTGTCATTATAATTGCCATAAATCAAAACTCCGAGTAAAGAAAATTCTTGAATCTTGTGATCTTAAAATGAAGATACGTAGAATGCACCTTTC
CGAGTGAGATATACTCCCCGTGCTGAAGTTTAACAATATCTTTCTTTCTATCAATGATTTCGAGGCATCCATCAGGATGAAACCTTCCAATATCACCAGT
GTAGAACCAGCGCATCCCTCTCTCATCAACCTGCATTTAAGATATAAACAACATGAACAGGCTCGCGATATGACCAAATTCAGTCCATTTACAAGCAGTA
GCTCAGAAGTACCTTGTATTCCTCATTAGTTTTATCACCATTGTTGAAGTAACCAGCAGTAACACTGTTCCCACCAACAACTACTTCTCCCCGAGGCATC
GGCTTATCAGCAACTGTGTAACCTCCTTCTTCCCAAGAAATAAGCTGTATTGTTCAACACATTACATATTAATAACCAAACACCAGCACTGTCATAAATA
AGCAGAAAATTCCTAAACTTATCGAGTTAATAAAGTTTGAAAGGAAGGAACAAAGGGCAACGATTTCTTTAGTTTCTGGACTAACTAGCTTTTTTCTATT
TGTCTATACCTTTATATAGCAACAAGGAACAGGTGGACCAACGCGACCAACAGAAGGATCATCTGACTCGGAAAAGGCTGCTCCTGCAGATGTCTCTGTC
AAGCCATATCCTTGACCAATAGGCGCTCTGCAGCAACAACAACAACTAAGCCTCAGTTCCAAACAAGTTGATTATAGAACTCGTAACAATAAACAGTCCA
TCCAGAGTGAAGTGTCGAAAAAAGTGTAGAGCATATTCGGAACAGTTTTCTGATATTTACCCCATACAAATGTTGATAAATCTTTGTGTATCTCCTGATA
GAGGAGCACCACCACAAAGCATGAAACGTATATCTCCTCCGAGTACTGATCGTATCTTTTTAAATATCATCACCTCCCATAGTATTTTCTCTAGACCCCA
TGCTCCAAACCAGCTACCTTCTATAGCAGTCAATCGACGTTTAAAGGCAATATCAAAAAGTTTCTTTGCAGATCCTCCCCTCTCCTCCACCTAGATTAAG
AAAAACAGAATCAAGTGATCAGTACTTCATTTGAGGCAGGCCTTATAATCATCCCAACCTAAATATGCACTTAAAGCTCAGAAGGTCCAGTTTAAACCTT
CTTTATAACGCCGTCCTTAACACGATCTAGAATGGCTGGAACTGCTGCCATTAAAGTAGGCTTTAAAGCTGAGGCATCTCCTTTAGTCCCTTTCATGATT
TTATTAGATGTATCTGTCAATGTCAGACCCGAGCCATAACCGATTGAAGCACCAGCAGTCAACATAACAGTCTGCAAAACCAGAATCACTCAGAACTACT
TCATTGCTAGATGAAGAAGACAAATAGTCTGTTTGGTCGAACTTCTAAAATCAACTTTACTTTGAAAAGTGCTGTTTGAGCAGCAATTAGTGTGTGGACA
AGTTTTATAAAAGTGCTTCGAATTCACTAGGAGCACTAATTTTCTCCGAAAAACTTGGCCAAGCAGATTATAACAGAAACAAACGATGTATGAACTCTGA
AGATTACCTCAGCCGCTAACTCAAAAACATGAGCCAAAGGTAGATACCCCAAATAGACATCGTTGCTGCCAAGTTTTGGAATGACAGTCGTAACTGCAGC
AGCCGTGGCTACAATGTTTCCATGAGTTATCATGACACCCTAAAACATAACAATAGAGCTCAATCGAGAATCATTCAGCTCTAAGGTAAATATCATATCA
GAAAGGAAAATTAAAAGCAAGCTGCATTTTACCTTAGGCATGCCTGTGCTACCACTTGTATACATGATCACCGCGATATCTTTCTTTATAGGCAGTATTG
GTTGAATAGGATTACTCTTACCAAGTTTTTCAACTTCGGAGAAAGATGTAACCCTCCAGCTATCAATATCCGTAGAAGTGCTTGAATCTATTGAAGTCTC
ATCATCTTCAAAATATATGACATTCGAGATGGTTTTCAGGTTAGAACCGATTGCAGCCAATTTTTTAAGTTGCTTGGCGTCACAAATCAATGTGGATGCT
TGAGTCTGTGAATGAACACAAGTGAATTCAATTCATTGCATATCAACTAGCACCTCGCGTAATCTAGAAGAAAACATATTTAAATCTCCCACCTCGTTTA
ACGAGTGTATAAGGGCATCATCTCCCAAAGAAGCATAAATAGTAACGACAGTTATATTCTGGCGGAAGCATCCCTGAGAACAATAATTTCAACTATAAAA
TGTTGTATTCCTGTAGTAATCAGATAACAAACAAATACAGAACTACTCCCTCCGTTTTAATTTGCTGTCTGGTTTTGACTTTACACGGAGTTTAGGAAAG
TGAAGAACATGTCACATGGAAAGTTTAGAATTGAAAAGTTGCCAAAAGAGGTTAGAGACTGAAAGTAAAGAAAGCAAATTGAAACGGAGGGAGTAAAGAA
CTCTCGAATACCTGAAATGCAATGATCCACTCTGCACGAGTTTCAGAGAATATAGCAGCGCGAGTCTCCACATCATGACCTAAATTAACAAGTCCAGATG
CAAAGTTGCAAGCCCGATCAAACGTTTGCCCGTAACTCTCCCAGTGATACTCACTCAAGTGAAGTTTCTCAAACTTCCTTCCATCCTTTGCTGTTACAAA
GTCCCTACTAACTAGTTTTCTTGTTCCAAGACAACGTTTACTCGAATGTTTCCTACAAGACCTTTCGAATAAAGCTGCCATAGTCGTAGCCCCTTCCCAT
GGAACTTCAATCAACTTGGCTGACTTAGCATTCCGCATTGTAAGACCTGCCTCACCACCAGCTTTAACCGAAACTCCTCTCTGTTTCGCCTTTTTCTTCC
TCATAAGCACAACGGAGAGGAATAAAGGTACTATAATCGCAACTACAACTGCAGCAACAACCCCAAATGATTCCTGGTCTTTGAAGAAGGAGACATAACA
ACTACTGTCCATTCTCTCAACGACATTCGTATTCGGATCACTTCCTTCAGAACCTTCCATTTTATATGATGTATGGATGGTTCTATGCTCACACAAAACT
CTTCAAAAGAACAAAGAGATACCTAAGACATAAAACATAATTCAGTACCATAGACAGGGCGGAGCTACCTTGTACGAAGGAGGGGTTCATCCAAACCCCC
TTCAGCGGAAAATTATATTATATGTGCATGGTTAAAATAAGTTTATAGGTATACCTAGTAGATGTTGAACCCCTTTCGGCTATGTATTTCTACAGATTTT
GAACCTTCTTATTGAAAATCCTAGCTCCGCCTCTGACCATATATATGCAAGGTCAAATTTTTTCATATGTAAATATAGTAAATGTTGAACCCCGTTAGTG
AAAATCTAGCCTCTACCACCGGATGGAACGTAAAAAGAATAAAAGAGAATCAAACTTTAATATGAATATTATGTAATTTAAAACTCAAGCAAAATTTGAA
ACCGGAGTTCTCCCAAACAATGGCAGATCCAGAGTAGTGTGTGCGGGTTCACGAGAACCGAATAGCTTTTTTCTCGATATATATATTAAAATATTTGACC
ATAAACCCAATTATTATCGTATACTATTAACTTGAAGATATTGCAAAAACCCATAAAACTTCAAATTTTGGATCCGTCTTTGCTCCCAAACCTCTTCATT
AATCATTTTCCTCGAAATTTTTACTATTTCGAAAATCACCTAATTCCCTTAAAACTATAACATATGCTTGATATAAAGAAATCGCTAGGTGATTTCTTAC
TATCTGTCTAAACCTTATCGAACATAGTAATCGAAACATATCTTAAGTGCCCCGCAAAATAGTCATGACACAAAAACAAATCGAACACTACCAAACAAAA
CATACTCAATGTAACCCGATAAAGGAAAGTGTAGGGAGAATAATGTATACGCAGACCTTACCCGTTACATAAAAAAAAAAAAAAAACTACACTAAGTTAG
CATCCACTTAATTAACTTCACAACTATAAGTTCAAAACTTATGGATCTACTTTGAACATAATAACCATACAAATGATAATAATCAATATAAAATTACAAA
ATTCACTTAAATATTAAAAAAAAAAATTACCTTGAAAAGTTGAGCAATAAGTTATTTTTGTTGGTTTTTGAAGTTTCATTCATGCAATGATATGCTAAAT
GAGGAAAGTTGATGAAAAACTTTTTTCAGTTTCCAGAAGAATTTATAGGGGTAGATTTGTCACAAAACTTTGTATATTTGCATTTCAATACCAATAGTTT
TGGGGTTTTGCAAATTCACTCCCAAACTTTTTAAGTGTCTTATAATTAGAATGTTTTTTTATTAGGAAGACGTCCTTTAAAAAATGTGATATAGATAATC
TATCATGATTTAAATATAAGTGATTATTTTTATGATTTGATGAGAACAATTTTATCGTTATTCCAAGGTGAAGGATAACAATGAAATAAGTGAAATTTAT
CTATTTTTAATTAAAAATTTTGTGTCAAAATTACGTATATCGAGTATAGGAAAACACTTATTTATCTATAATGTTTTTATTTTTTAAAAAATAAATTTAT
CTTTTTTCTTTTTTTTTCATAAAAGGTATTAAAGCTAAAATGATAAAAATATTTTTAAAAAATAAAATTACATAGAAAAAATTTCATTATCAAATTAAGA
GATAATGCCTTTATTTTTTTGTGTTTATTTTTACTTTTGCTATTTATTGTCCAATACATTTTTCGAAGCATTAAATATGATACTCCCTCGTTCACTTTTA
CTTGTCATTTGTTTTTAAAATAAATTTTAGTTTTACTTGTCATTTTTACAAATCAAGAAAAAATAATTATTTGTTTTTCATATTTTTACCTTATCATTAG
ATACTTATTTTCCAAATCATTTCAAGATCTAATACTAAAAAACATTTAATAGGAATAGTTTGATAAAATACATACATCAGTAATTATTTTTTTAATGACT
ATGTCAAATCACATAATGACAAGTAAAATAAAGGAAGAGAATATACTCAAAAATAATATATTAATATTGCTTTTATACTTATTATTTTTCAAAATATATG
TCAAATTCATTCGTGAACAACTATTATTGAACGACTAAAATATTCATACAAGGCCCACCTTCCAAGGTTCAAAATCTTTTAGGTATTGGTAAAACATAGA
AAGAACAATTGAAATTTAGCTGGAAATATTAATGGAGCTTCTTTTTTTTTTCGAAATTCAATGAGTATTAAAAGCTACCATTTCCCAATTCAATTGTTTA
ATAAATGCAGATGAGAATTACTTGTAATAAATTCATAGTGATATAAATTTTATTTTCCCAAAATAATTATTAGATTGTCTTACATTCTACTTCTAGAAGC
GTATTAACGTAGTTTATGTTGAATTATGAAGATTGTGAAGTAAATGCGAATAATTTTTTTTTAATATAGATTTGTGGACTTTTAACGTTGATTTTAAATT
ATTAATATATTATGACATAATTTATCAATAGTCCTCTAAATTTGATATAATATTCACTTAGATATCTTAACTAGACAATGTTCATTTAAAATGTATTTTT
TCATCATATTAATATGCAAAATATTGTAATTAATAGTACTTTTCATGTCATTTTAGAATTTCTAATTTTTTGGTTTAAAATATTGAATCAATGTGATTTA
ATTAGCCTTTATAAATTAGTCAAATTGACTTTCGATAAGCACAACATGAAATAACTTTTTATATCATAACTTTTCAAATTCTTCTATTAGTAGATTTATA
ATTTACGATTAAAAACAATATGAATGTACTCATTTATCAAGAAAATGATAATTTAATTATTAAAGGGCTTAAGAACTTCAAATTCTATCATGAAAATATT
TATATTAAATCAAATTCGAAAATAAGTCAAATATTTTCTTGAGACATCATACCAACATACAAAGCATGCAATGGCTGCAACTGTTAAGAGTACTGATAGA
ATGATAAACTCTTGTCATCAGACACACTTGCAAGCATACAGGACCTAACATCAGTCCTTGATGTTGGTCCAAAAGCCACAGCCCAAACCTGATCTGTATG
GTTGGTTAAAGTTTGCGTAGCCGCTCTCATCTTAAGATCCCATAGCCTAACCGTCTTGTCACTTGACCCCGTTGCAATTGCTGCCCCGTCTGGAGAGATA
TCAACACTCAGAACCCAACTTGCATGACCCGATAAAGACGTGAGCAATGTTTTCCCCTCAGCATCATACATATGCACATGACCGTCATCTGATGCTGAGA
AGAGTATTCTTGAGTCGTGAAGTGAAGGTGAAAACACGAGAGAACGAACAGGCATGGTATGGCCATCTAAGAAGTGAAGGAACTTGGCGCGAGCTACATC
AAAAACAGAGATAGTCCCATCAACTGATCCACAAGCAAGAAGACTACCATCAGGACTCCATGCAACTGAAAGGACAAATTTCTTGTTGGTGCTTTTATCA
GATGGTTGTGGGGCTCCTTGACGAGGAATGGACATCGTGGTAACAAGTTCCCACCGATTAGTATCCCACACCTTGACTGATGAACTACCACCTCCAGCTG
CTGCCAGATTGCTACCCTGGAAAATGTTTGAGAATCATAAGACGACTGCCTAAAGCATCCTATAAAGATGTGCATCGAAAAGTTAAATCATAAAAAGGAG
ACATTGCTCTTCCGCAAACATTGAATACCAGAAGACAATAGATCAAGTAACATACATACTGGTATGATGAGAGAGATTTCAAAGTAAACCATCAAGATGT
ATGTGGAAGTGACAAGTATACATACCAACACCCTTTTAACTTGTCATAAAGGAAATGAATCCCAATGTTTAAAGACTATAGAAAATAACAATTTTCTTGT
TATTTTTCTTCTTTTTGATAGGTAAATTGAGTCCAAATAACTTGGGAGACTGAGATGTAGATGATTGATTTGACAGTTTAGTCAAACAAAAGTTCTCATC
TCTGTCACAATCCATAATATAAGCAGATCATAGCTATTTTAAGATAAAGTAGATTACCCACTTATCTATTGCCAATTTGCCACTGCAGTTCCAACAACAT
TTCTTATCCAATAACATGAACGTTTATAAAGATGAACAGCAAGAAATAATGGCTAATACAGAGTCCACTAAAAATCCTAGCGCTTTATCAAATTCGTGTT
TGTTTTCATCCAGATCTAAGAACTAGATCAGCATTACTCTTCACAGTCAGTACCAGTCAGAAAGTTTTTTTTTTTTTTTATGGCTGAGAAATCAGTGTGG
CGCAAATCCTTAGAACCAACAACTGGTCTTTGAAACTCGGGGATGATGGGTTAGTACCTCTACCCTTCTCTAATTAAATACCAGGCTTAGTTCACATGGC
ACACCTAGAACCTGCGACCTAAGTCATTGGTCTCTCAACCTTTGCACTTGAACAAAGTTCTGGGGGCAAACAATTTGGGTCACCAATGCTTCTACTTAGG
AAGGGCCTTCTAACAAGACATTTTAAAGAGACATTTTTCAGAAAACTGTTTTGAGTTCCAGCCTGTAATTTGTTGTTCATAAGGTATTTGCATTAAAAAA
ATATCTAGAGGAATCTTGGCACCACCACAACTACTAAACAAGTAAAGCCACCTATTCACTCGATCCCTTTCGGAAACATTAAAGTAAGGGCAACCCATAT
TGTTACACCGACTTTAAGTAATTTTTGAAGGAACAGGGCAAAAAGATAGAGGTACCAAGGAGGATATTTCCGTTGAGCTCGTACCAAGGAGGATATTTCC
ATTGAGCTCGTAATCAGGATTTTGTATAGGAATGGAAGAGATATGAATATTCCCTTAGGCCTTAACCTCAAGATCAACTTCTAGTACAACCATTAACAGT
TTGACTAGCACTAGAAGAACAACTAATATTTACCAACAGCCAATAAAAAAGGATAGGGAAAAAGAGAAACCACTAGACGATAGACTAACAGAGACAACCA
AGTTAACCAATCATATTTGAAGCCTCAATTCCAAACTAGCTGGGATCATTGATATCCATTTTGCTCGGTACATGACCAGACCATATCATTTAAAAGCTGG
TGAATAATCTGTCTCTTAAAAAAAACATTATATCTCTCATGAAACTAAAGCTTCTCACAGCACTAGCATACAAGCCTCTCAAGTCTTAAACAAACCAATT
CTAACCAAACAGAGACTGTAACTTTATGCATAAAGAATCATACAAAATGAAAAACAATACAAATTTCCAAACCTATATATTTCACCACATTATCAATCAT
AAAAAAGGATGAAGCAATTCCAATGCAACTTCATACTAAAGCTAAATTTTAACAGAACTAACAAGCAATCCAAACAAAAACGCATGCCGGTACACTAAGC
TCCCACTAGCATACAAGCCTCTCAAGTCTCAACCAAACCAATTCTAACCAAACAAAGACTGTAACTTTATGCATAAAAAATCATACAAAATGAAAAACAA
TACAAATTTCCAACCTATATATTTCACCACATTATCAATCATAAAAAAGGTTGAAGCAATTCCAATGCAACTTCGCATGCTGGTGCACTAAGCTCTCACT
AAGCACAGGTCTGGGGAAGGCCTGACCACAAGTATCTATTGTACGCAGCCTTGCCCTGCATTTCTGCAAGAGGCTGTTTCCAATGCATCTTCAAACTAAA
GCTAAATGTTAACATCAATAACAGGCAATCCAAAAAGGGCAATTTGGCGCACTAAGCTCCCGCTACGCTTGTGACCCGGGAAACAGCCAAGTCACAAGGA
TTTAATGCATGCAGCCTTAGCGACTATTTCAAATCTCGAAATTGTCACTTCCTAATCTATTGTAAGCAACCTTATCCTACATTTCAGCATGACAACAACT
TTACAGTGCAATCAAAATTTCATTTTCCTTTACTTACACTTGGACTAAATTGCAATTGCCAGACTTCAGAAGGAGGAGCTTCGAGAGTAGCAATAGTGTT
ATTAGTATCAACCTCAAAAACTCTAATAAAGCTATCTATAGAAGCAGATGCAGCAATTCTACGAGTAGGATGTGTAGCAACAGATACAACGCCGAGACAA
TGACCGGTGAAAGTTTGAACACAAGCGAAGTTACTCGGGTCCCATAACCTCACAGTTTCGTCAAGACCTCCGGTGAGAAGCAACGCTGGATATTCCTCCG
TCGACCGGACCCACGCCGCCGACCAAATGGAATCGTCGTGAGCATTTGTCACACTGTCAAGTGAAGCTAGTTTCATGGCGATTTTTGGATTGGGTAGAGA
ATTGAACCCTAATGAAAATTGAAGGACTGAGAAGGAGACGGTAGAAGTTTAGTTATATATTTTGCAGTTAAGTCCTTCATGTTTTGATATTGTCATTATA
CACCCTTAAAAAATTTAAATTAACTTATTTATTATGTAAAGAATTTAAAAACATGTGATGAATGTTATGAAATAATAAATAAAAATACAAAATATTTTAT
TTTCTCTTCAAATTGGTGAACAATATAAATTAATTTCAATTTCTCTAGCACTCTTTTATTTAGATAATAAAGAAAGAAAAAACTCAAGATATTTAATAAA
TTACAAGATAAAGTTACGTATAATAAATTTGAACAGTTTAGTTCTTACTTGACTTCACGCATGGAAACAATTTAACGTATCAAAATATTATCTTTATTAA
AAATATACTACTTGCGAATTGCGTAAATTACTTGCTTATTGCAAGTTTTCTTGGTGAAAATATTATATAAACCTTTTCCAAAGGAGTTGTTTAGAGGTTG
TAATCATCACTAGTTGCTTGAGCAAATTGCAATTAGTACTTATTTGATTGAAAGTTTTTTTAAAAAAATAGAAATAACAAAAGAATATCTATAGCTTAAA
TTATTCATAATAATCCCCAATATAATGTTAAATCACATATTATTGATTAACAGATAGAATTATAAATTATTTGAATTGAAGGTCTATCAGAAATATTTTC
TTTATTTTTGACCTATAAATAAAATTTGTGTACACTTTACTTTTTTGCAATCCTACTTTATAAAACTATACTGATTGTTATTGTAACAATAAATCAATGA
TATAAATTACATTCGTCTAACAATAATGAAAAAGTGAAATATTATGACCAAAATAATTAACTCTCTCAAATTTCAAGAACCATAAATAACTTTATTTTAG
CTATTTAAAACTCTCAAATCTCATTAAATTAGAAGTTAAGGAGACATTCACCATTACATTATTTGATCCCTTGCTTGTATATGTAACAATAATTGACAAA
TGATATGGAAATGTGAATTAGTTTCTTAAAACAAGTTAACTCAAATAATAAATTATTGATCTTTATTTTTATAATTTGAAATGTTGCGTATGATATATCA
TATATTTTAAAAAATAATGTAAACTACAAATTTTTGTGTTCAGACATACAAATAGACTTTTAAGAAAAAAGAAAATCTTAGAAAATTCAACTTTATCAAA
TTGGTTATAATTATGCCAAATTGTCAATTTTTCTTTATATTTTGTTGTCAATGGAGAAATCAATTTACCTAAAAAAAAAGACCTTTGAAGTCAATTGATT
TAGTTGGTATGAAGAGTCAATTTGTGATACTTTTACCGCAATAGCCGGCATGTGGTGTCTTGATTTGAATTTTTTTTAAAAAGAAATTTTGATCCTATAA
TCTATTTTAAGTTCGTTGTTTTAATTTATTTTTTTTTATAATTTTTCTTTTTTTATGTATATTCACTTTAAGTTTCATGTGATTGATATAGAATCATTTT
AGTTTGATTTCAATTATCGAATTGAAGTTCATACATATACGACTCAATTTTAAATAATTGAATTTTGATAAAAATTATTGAACTTCTGTTATATATGACT
AAAATTTAAATAAAAATAACCTAAGCAACACAAAAATAACGAAACTGTAATAACATATAAATGAGATTCAGCTATATAGATGTATGAAGTTAGAAGAAAC
ACATGCAAATTAAAAAAAATAGTATGAATTAAATAACAAAGCAAATAGAACATCTATTTAATTATTGGCAAGCTGCTTCATAGTATAAATTTAATTATGA
ATAGATCAAATGTTTACACTAAACTATGCAGTTAGTAAATGAAAGTGATATTTATGCATTAGTTAACTATAGTTAATTGACAATAATATATTTTAAAAGA
TTATGTTATATATTTATTAACTTAGATATAAATATCAATTCATAAGCTTTTTCCTTTTTTTAGCTAACATGACATGACCCTTTTTGACAAGCAACTAAAG
AAGATGCAAGTGTTCTATTTTAGTGAAAATAGTATCACTCCTTAATCAAAAGTGTTTGAAGTCCATTATTTCAACATACATTTTACCTCTCAAATATAAA
ATTTCTTCGGTAATTTTCACGTATAACAAATATAAAAATCATATTTATATACTATAATTATAGTTTGTATAATTATGTTTCATAACAAACATAAATATAT
TTCGCGATATATTTATAATTTGCTATACATATACAAAGAAAATAATTGTATAATTCGCAAAAAAAAGCAGTTGTATACAAAAGATCAATTGTATAATCCA
TGTATGTATAGAACGAGAAAGAGAGAAAGACAAAAAAAAAATTGGGCAGAGGAATATTTGTATTGCATAATTATAAGTGTATAGGACGAGTTTTATGTAT
TTGTAGCTGTATATACATTTTTCTCTCGTTTTAAACAATTTTAAACACAATCTATTTCGTTTCTATTTGTATAAGCGAGAGAAACGAGGGTCGGAAGTGA
GATCTGGGAGAGGGAAGAGAGAGGAACGAAAATATGTGTATATATGCAATTTCCTCTCGCTTTATACAAACACAAACACATTTTATACATTTTTGTGTTT
GTATAAGAACGAGAGAGGCGAGCGAGACTACCATCAAAACAAGAGTGGCGGGCGAGATTTCACCAGGGATAGAGGCAAAAATAGCAATAGTTTACTATAG
GATACAATTTAATCAGACTATAATTATAACATTTAATTTGAATTAATAATTTTCTAGTATATACAATTTTACTTTTTCTTTTAATACAAATTTAAATTAA
ATCAAATTTTAATATAAATATCAAATACGAGACATAAAAAGAAAACAACTATCACAACATTTATAAACTAATTATCTAAAAGGTTTTATGGTTTGTTTTT
CTAGAAAATGCTCTTAGGAGCAAATTTCTAAAGAATATTTCACTTAAAAAAGAAAGTTCAAACTTCAAAAAGAATACCTATAAATAAAGTAAAAAGAAAA
AAAAACAAAGGAAAAAGGAAAGAAAGAACTATAAATAAATAAATAAAACATGAAAAAAGAAAAAAGAAAGGTCCACATAAAACAACAGAAGAAAAGTCAG
CAAGTGTAATCCTTTTGATTCACAAAGTGTTTTTATCATCTTTCCCACTTATTTCCCCACTCATAACACAAAAATGATGGAGGAAAATGATAATAAATAA
AAAATACTTAATATTTTTTTTTATAAGTTGAAAAATAGTCAAATATTGCCTCATTTACTTATGGAAAAGACATCATAATAATTTTGAACACCCCTATTTG
TTCCTTCTTATATATGTGAAAAATTGAACAAAAATGAATTAAACTATTTACAATAAAAATATTTTTGGATCAAATTATTAATTTGAAATATTTTTATTCA
ATTTTATATAATCTAAAAGGGCATTTATTTCTTTTTCTATTATTATTATTATTATTAATCTCATATAATTTTATTATTTGATATTACTGTAATTATTGTT
TATCATTTTTCATCAATTATTTTTAGTATAATCCGTTTAAAATTATATTTCCTTTTTAAATATGGATCAAAATGCTTTATTTGAACTAAAAATCTATCGA
AAATAATTTCTCTATCTTCGTAAAAATCAAGATAGAAATAAAATTAATGTATACTCTTCGCATCACACTCAACCCCATTTATGGAATTACATATGTTATT
GTTGTACTTTTTAAAATTTTCAAGCTTTTCTTAATTTGCATCAAGCCTACTTTTTCCTTCTATTCAATTCACCATTACCATTTGTCTTCTCTATATATGT
ATAATTTTTTGATTCATAGTCTAGCTTAATAGTTGCAACAACCACATAATTTCTGCTATTATTTGCAAGACTTCTACATAGAGTCTTTCAGTTGACCCAG
CTAAGCAGAAATGCCCCTAAGCTCCCCAATTTTTTCCAACATATATTTTTTTTTTCAAAAAAAATAATCATATAGGAGTGAACTTTTAACTAGAATACAA
AAAACTCAGTTGCCTGGAAGCAATTTCATCTTTGATCTTTCAAGATTTCTATAAAAGAGTGAACTTTAAGCAGAATTAGCAAAACCCCATTTGCCTGAAA
GCAACTTTCATTTTGGGTGTTCAAGATTTCAATAAAAAAAAAGTGATTTTTAAGAAGAATTCAAGATTTCAATAAAAAAGTGATTTTTAAGAAGAATTCA
AGAACCCAAGTTTCCCAAGAAGCAATTTTTACTGTGATTTTACAAGATTTAGCTATGAAGAAAGGATCTTTTGCACCTAATCTTAAACTCTCTCTTCCTC
CTCCTGATGAAGTTGCTCTCTCCAAATTCCTGTACTTACTTTATCCCTCTCTCTTATGTCACATTTATGCTAAATTCATCTGTACTTTGTGTCAACTGAC
TTGAACTGTTGGATCCACTTCTTGTATCTCTTATTTCTGTGTTTCTCTAGCTATGGTTATGTATTTTGATGAGATGTTTTTGGTATTTTGTTGTATAGGA
CTGAATCAGGAACATTTAAGGATGGAGATCTTCTGGTGAATAGAGATGGAGTTCGAATTGTTTCGCAGAGTGAAGTTGCAGCTGTACACTTTCTCTTTTG
AATTACTTATGTTGTATTTGATTAAAGGAAATGTTGGTTTGATTTGTTTGAATTGCTTTTATAGTTCTGTAGTCTTGCTTGGATTGGGTAGTAGGATGAT
CCTTTGCTTAGTTTACATGGGATTAAGAGTAGACTATTCTCTAATTTGCCTTTGGAAGTTTGAAGTTTGAATTGGAATGTTTAGCTGACCTGAGATAGGA
GGGTATGGATGTTGCGGATTAGGGTAGAAGGTAAGTAGGTAATTGAGCTTTGACTCATTTTTCGACGGGTTTAAGATTGGTGGGTGTCGGGGAACACTGT
GTCTGTTGTAGTATTAGTCTCATACATGTATTTTCTTGCCTTTGATATCTGGTGTTCATTGTGTTTCAGTTACCACATTCTTTTCTTTGAATGCTTTGTA
CTGCTTTCCTTAGTAATTGACATGTTTTCAACACTGGTCTATTCCCTTTTCCGTAAATACTTTGATTTGCTGCATTGAGCCGAGGGTTTTTCGAAAACAA
GTTCTCTACATCCATTAGGTAAGGGTAAGGTCGGGGTACACTCAACCTTCCCCATACTCCACTTGTAAAATTACACAGGATATGGCTAGAAAATCTAAAT
GCATAAAGAATTGAAATTTTTGAATGCTTACTCCCAGCCAGCTTATAAAGAATTTGAAATGGAAGAAAAATTGAAGATCTAGATCTAAAAGCTGATTTTC
TGAATCAGGATATTAAAGCTGTGATTAGGGACTCATCTTATATGAAGGGTCCAAATAACAATTTACGTATTTGAATCTAGAGATAGACATATTTTTATAT
AACTGATACTAATTAGCGGGAATGACTCTTTGTTATATTAGTACGTTTACTTTAGGTCCAGAATTTGGTAGGAGCCTCTTAGTCTTGTTAGAAATTTATA
TACGGAAATGTAGAGAACCTCTGGTTCTAGAGGAACTACTGTTTTAAATTTATCGGACTAAGACGGACTTTAATGGAGCGATAAGAGCAGTGGGGATTCA
CTTACCTGATGCCAACTTGCTAGGAGTTGAGGTGCAGTCGTCGTTTTAGTCCATACCTGGACATTTTGTGTTCTTCATCTTCCTTTATATCCATTTTCGC
AATCCGTTGCAACTATAATGGCGTATTTATTCTGGCATTTGCAATTTTTTTTCAGCCTTCAGTTATACAGCCATCAGACAACCAGTTATGCTTAGCTGAT
TTTGAAGCAGTAAAAGTTATTGGAAAGGGAAATGGTGGTATAGTGCGGCTGGTTCAGCATAAATGGACAGGGCAATTTTTCGCTCTCAAGGTATATTTCA
GCTTCCATCTCTATTCTGCTTATCCTGGTTGTTTGCTATTCCCCTGAGTAGCAGCAGACTGTTTACATATCCGTTTGATATATTTCATTAATTTGGTGCG
ATATTCCTTCTTAAAAAATGATAGAAGACAAATTGACGATTGGGACGCGAATTCTTTCATAGAGATGTTTCCTCCCTATTGTTCCATTTCTTGTCTTATA
ACTTGTACTATTTTTGGTAGCAATATGTTAACTATGTTGCGTGGACTCTTCAAAAATGTCATCGGGTGCGTGTCGAATCTTTCATAAGTAGTGCATTTTT
TGGAGGATCCGACACGGGTGCATCGACATTTTTGGAGAGTCCCTCACCAAAGCCTGAAGAGTTGACAGTATGACTATCTCAATCAGTTTCTGAATATTGA
GATTGCTATTTTACCCAATACTAGGGTGCTTTCAAGTCTCACCATTTTATTACACAAAGATCATATTGACTTGTTCTTTGCAAATTCAGTGGAAGCCATA
ATTTTCAATAGGGGGTTCTAAATATGAATGATAATACACAAAGAAGCCAAATGGGGTTCACGATCTACTATATCTACATAAAAAATAATTTTAACCTGTG
TAGTGTAATTTTCCGCCCAAGGGGGTTAAGATGAATCCCCTTGGTCCTACCTGGCTCCAAACCTGTTCGCAATGCTGATGGAGGGGTTTGTTTATTGGAC
AATCTGTTAGCTTATGTTGACGTATGCTTTAATTTGTTCCTTTACTGACGAACAGTTTTATATCATTCAGGTTATTCAGATGAATATTGATGAGTCTATG
CGCAAACATATTGCTCAAGAACTGAGAATTAATCAGTCATCCCAGTGTCCATATGTTGTCATATGCTATCAGTCGTTCTTCGACAATGGTGCTATATCCT
TGATTTTGGAGTATATGGATGGTGGTTCCTTAGCAGATTTTCTGAAAAAGGTCAAAACAATACCTGAACGATTTCTTGCTGTTATCTGCAAACAGGTAGC
CAGTGAACAATTTAAATACCACAGGAGAAGAATTTGTTCAAGTACTAATGTTTCAACCGTATTCCTTCACCAATTAGGTTCTCAAAGGCTTGTGGTATCT
TCATCATGAGAAGCATATTATTCACAGGGATTTGAAACCTTCGAATTTGCTAATCAATCACAGAGGTGATGTCAAAATCACAGACTTTGGTGTGAGTGCA
GTACTAGCAAGCACATCTGGACTGGCCAATACCTTTGTCGGCACATACAACTATATGTCTGTGAGTATCTGTGACCTGATTTTTGTAGAAGCGAATATAG
AACTGCGCTGCTAGGTAATTTTCACTCATAAATATCACAGAGAAATATTTTCCTAGCATATTTTTCTGGAACTTAATCACTTCCTCCGTTTCAATTTGTT
TGTTTAGTCCGTTGAAAAAAGAATGCCTCTTTCCTTTTTTGGCAATTTCTTAATTCCAACTTTTCATGCAACATATCTAAGACCACAAAATTAAACGACA
TTTTGGTACATTTGACATATCTTTAATTTAAGACCATGAGGTTCAAAAGTTTTCTTTACTTAATTTCCGTGCCAAGTCAAAACTAGACAAACAAATTGAA
ATAGAGGGAGCATTACAATCTGCCTATGCTAAAAACCTCCAAGTTGCTGCTGATGTTCTGTTGTTTGCTATAGCCAGAGAGAATTTCAGGAGGTGCCTAT
GATTACAAAAGCGACATTTGGAGCTTGGGTTTAGTCTTGCTCGAGTGTGCAACAGGTCATTTCCCATATAAACCACCCGAGGGAGATGAAGGATGGGTCA
ATGTCTATGAACTTATGGAAACCATAGTTGACCAACCAGAACCTTGTGCACCTCCTGACCAATTTTCTCCACAATTCTGCTCATTCATATCTGCATGGTA
AGCGCTATAGTTATGTACCATCTGAAACTTCTAATCTAATTGTCCTATGAGTGTCTGGTAGATGTGTTTTCTAGTTCGGAAGCTCACTACACAATAACTT
GTTTCAGTGTCCAGAAGCACCAGAAGGACAGACTGTCGGCAAATGATCTCATGGTAGTGATAATCACTTTTTTTTGCCTTTCTCGAAGTTGCTTATAGAT
CAATTACTAATGTAGTGGCTATTTGGGATTCATGTAATACAGAGTCACCCTTTCATCACCATGTACGATGACCAGGATATCGATCTTGGATCTTACTTCA
CTTCCGCAGGACCTCCATTGGCAACACTTACTGAGCTATAATAGGTATGCTTGCTTAAGTCTTTGTTAAATGTACTCCTTTTGTAGCTTTTAGAAAGAAC
TAATTTTAGATCTTGTGTGTCTATTTTTATTAAGTATATATTGGAGTGTGTTTGCACAAATTATCTTCTTCATCATCTTGGATCGGATCCAGTAGCATTA
TGTAATTGTCTGCGGCTCTTTTCTTTTGCCTCAGATATCCAAGGGTTATATGGTCACATAGACCTTGCCTCTCGTTGGGACTCAACCCTCTAGCTAGTTC
CATTGACCAGTTAAGGTCTCGTAAGATAGAGTGACCCGCGCACAGCGGTCTTGTATGAGCAAAGCTTGTATTCACTTCTATTTGCGTACACATTTGCTTA
TAGCGAAGGTTGAAGAATATTTATCTTACTGATATCACTTTACTAATATCTGTGTTCTGGGTAGTTTCAAATTGTTAATAGCTGATACAGTTATCTCTGG
CAGTAAATGAATATGTATACCAGCAAAATGGCTAAACATATGAATTAGAAATGAATTCGTAAACTCCCTATTTCAAAAACTCCTTTGTTGCTTCTGGAAT
ATTAAATGTGAAGCAGTTTCATAGTTCACAAGTTTGGTTTAGCCTCTCAGCGTTCTCTCATAAACCATATATCGTTGATTGGACAAACTCCTTGCCTGTA
TCTGTCTTTTGACAACTTATCATAAAACGAAGTGGTCAATTATCTTTTAGTAAAAACATTTGTCTGTGGAGGACACATATTAGGGTAGTAGGTTAGCAGG
TAGAAGAGTGTGGTGTTGCAAAATATTACTTTTCTTGTTCGTCGATTTCATTATGATCTGTTGCTTCCTATACTTTGATAATAGTAGTTTTTGTTGTAGT
TATTGATGCTTTGTCATGCTTTCTGTAATATTTTGCCATGGCTTCTTCATTTCTGCTATTTCCTTTTCTGAACTGCTTAGATCTCTTTTTCATCGAGCCA
AGGGTCTATCAGAAACAACCTCTCTACCTCTAGGGTAGTTGTTGTTGTTTGTTAATCCCCCTTCTACTGGATTTTTTGTTACTACTCAGATCTTAGTTTA
GTCATGATTAATCGTCCTAGACTGTTTATTGTACTTGTGCTCAATTTTTTTTTATCATTTCACTTCACTTAAATATGTGACTAAAAGAGCTTCAGAATCT
TTTCAACTGGTGTGATTTCAGCGATTATATTATGACTAGCCTTGTTATGTATGTGCAGTCCTTTTGCCAACCAGATTATTTTCCCGACATAAAACTTATC
CTATTCCCCAAAAGCATGATTCTGTCTCGACTTCTCATTCTCACAGGTTTTCTACAATGTCTTGCAACTGATGGAATTTCGGTCAATAGCTTTTCCAGTC
GCAACGTTGCAAAAATTAGAAGCCTTTTAAAAGGCATTGAGAATCAAAATGAAGCAGATGAAGCCATTATTGTACTTTTCAAGTCTCCGGTAGGTAGCGT
TGGGAGTGTAACTGTGACATTTTCTACTATGTATGTGATTCAAATGGGAACAACTCCAGATATCCTTTTGATATGACTTACTTTTGACATTAATCCTTGG
TGGTGCAAGTGTTTTTGGTTTACAATTTGACTTCTACCTTTTAGCACATGAAGTTGTTTATTGTCAGTGTTGAACTGAATGTAAAACTTTTAAGATCCCA
TTTCTCCTTATGAGATCATTTTAGAGACCTATCAACTCATCAAGGATCTATCAGAAACAACCTCTCTTACCCACAAAGCTAAGGGTAAGGTCTATGTAAA
TCCTACCCTCCTTAGATTCGACATGTGGGATTACACCACTTGGTATGCCGTTGTTCCTGTAATGGTTATCGTTATACTATACCCCATCAATATAAATGTA
AGTCACATAGATATAGCTAATCCTGTATGGAACCAGCCTTCATAAGCTGGAAGCCTCCATTATAATTCAGCTCGCTCATTTGACACCTCTGGCTGTTGGA
AAAAGATACAGAAACTGATTTAGAAGAAAGCATACTATTTGATTTCCCCATTTTCTTGGTACAGCTGTGTGAATGTACAAAATCTGGGAGTAAGAACTCA
AAAGGGTTCTAGACAGATATGATTTAAGTCATTCTTAGCTCTTCCTAAAAGGGTAGTCAAGTTAAATGCTTAATGTTTGTATACACAATTTTCAAGTTTG
AAAAAGAAAAAAGAAAAAAACTCCTAGTGATAGCTGCATGAAACCTACCCAGAGATCCTGTATTTGTCACTTTTTACATTTTAAAGTGTTGTAAATGGCA
ATCTGCTTTTGTGGACAAAGGAGCAATGGTCGGAACTCGAATTGAACACTCAATGTTATTACCTCCAGGAAAAACCATAAAAATGGCATGTTGATTGTCT
AGTTTTGTTGTAGAACTTGGATGCTCATCAGAGAGTTACAGTATCTGCTGATGCAGCAGCGAGGACAAGCATTTCATTGTCATCGATTGAACACTTGCCT
GAGATATCCACTGCAGAATCACCTACAAGGATATAATGGCCCTTTTTATTATACATGCTACGAGAGGAGAGAAATCAAAGTAGGGTCTTGAAACAGTTTA
AGGGAGTCTTGGAGCAACGGTAAAGTTGTCAGTAATGCTTGCATTAGGTTAGGCTGTTTACACCCTTCCTGACCTTGCGAACATGGGATGATTTGTGCAT
CGAGATGTCCTATAGACAACCATTCGGAAAACCAGCACATACAGAACATCATAATGAAAGATAACACAATCAGCAAGATACCAAAGTTTTCTGTTTCCAG
CAAGTACATACAATGTCAAGGTTTGAGTGCAAGACCAATCATCCACAAGAAATTCATGCTGGTACACAGAAATCTAATAATGCTGCAAGTGATTAAACGT
TTATTCATGTCATATATGGCATACGTTTATGTCTTAAGTTCGATCAAGGCATTAAAATGTACATTAACACATGCACAACAATACACCCAATATAATCGCA
CAAGTGGGGTCTTAAAGCGTGGAGTGTACACGGAAAAGACCTTTGGGAGGTAAAGAGCTTGTTTTTGACAATCCATCGATTCAAGAAATTCATTGACACA
TGTGAGCATTATTATTCATCACCAGCAAAATTAGAGGTACTTCTGTTTTATTAATTATACAGAAGCTCAGAATTAGGTAAAGAGCTTGTTTTTGACAATC
CATCGATTCAAGAAATTCATTGACACATGTGAGCATTATTATTCATCACCAGCAAAATTAGAGGTACTTCTGTTTTATTAATTATACAGAAGCTCAGAAT
TCATTCAAGTGCTTATCATATCGTCATATATTATTATAAGTGAGAAACTTCAAATTGAAAAGTTGGATTGTCATTTTATTGCTACACTAAATATAAATTT
AATTAAATAATAATATTTTAATTAATTATATAAAGATAACATTAAAAGCCCTAACAACTATAATTTTAAAATATAAAATTTATTAATAATCTTATGCATT
GAACCGGATAAGTACTAGATGGTTCATCTGCCAGTAATTATTATAGATTAAATTTCCTCAATATTAATTAGAATACAATCTTTTCACATTTATTAGTTTG
ATTGAAGCTTCTAGCTGTTATATTTGTTCATTTATCGATACTTACTATAGCATATTATCTTATATGTAGTAATTAATTAGAATATAATGTTTACTCAACA
AAATATTTTCTTGTGTAATTTGTTCATTCTTTTTCTTAGTTTTTTTGTACTTGCAATGTATACATCTCATAACAATGGTTATACGTAGTTGTTGTTTGGA
AAAGTCTTTTCGTCTCCAATAATTGAACTTTTGATTTTCTTTAGTTACCTAATTTAATTGATAATGAATGATCTTATCTATTCCTTGAAATTATGCTCAA
TGATCTATTTATAAATGAATTCATAAATCAAGAATATGTACAACCCTCTCCATTAGGGGAAGCAGCTTTGTTATTTTTTACGAACGCGTTCGTAAAATAT
ATATTATTCTCGTTTATATAATATTTTATGAGTTTTAAGTTTTATAAATTATCAATGTTTCTTATATTCATATTTATGAGTTAAAATCAATTGGATGTAT
TGATATAGAAGTGTTAGAGATACCATTAGCTTTAACTCTTTGCTTAGCTTGAAGTTGTTTGAAACTTTAATTTTTTGAGAATTTGTGAAGTTGGTAAAAA
AAAGAAGTGGATAAATGAAAAAGAATAGGTATTCATATATATTATTTTAGTGATATATGTTTATTAATGTTTTTTAAATTATATAATTGTAAACGGATGA
ATGAAATTACTCTAATCGTTGAAATCGGTAATCAAAACAACGAATGGAATACACATCAAAAACATTACTTCTGAAAAAGTATCATGTAAATATATCAATA
CATTAAATGTTGCTGAAAATATATATAATTCATTATACATTTTACCTATCTAGATAAATTTAATTGTTGAATTTTGTAGTTTCAAATAATATTTAATCAT
CTAATATTGTTCAACAAAAAAAATCATTTGAATATAAACCAACTATTCATCTATTTTAGCTTGTACTTTTTCACTTTATTCTATTATTTATTACAATATA
TTTTTAATATGATTTAGTTTGTATGAACTACTTGTATTGGACATACGTGCGAACGTGTCCAGAAACTAGTATACATTATACATGTCACAGAATGCATAAG
AATTACTCCATCCGTTTAAAAAAGAATGACCTAGTTTGACTTAGAACGGAGTTTAAGAAAAGTTTTTTTTTTTAATCTTGTGGTTCTAAATTAAAGTTAC
GTCAAATGCATCAAAATGCCCTTTAATTTTGTGGTCTTAAACATGCCGCGTGGAAAGTTAAAGTTAAAGTGTTGTCAAAAAAGGAAAGAGGTCATTCTTT
TTTAATCAAACTAAAAAGAAAATAGGGAAATTCTTTTTTGAAACGGAGGAAGTAACGTACATGACAGAGCATTCAACACGAGCTCCCTTTCAAAAGAAGA
TGACACAACTATTAGTCTGAGAGTATATGGAAGTCACCATACCTGAAGAATGTCTTAATCCCTTCACAGCCTCAAAATTCTTGTAGGTATACCCAACAAA
ACTTAAATCTTCGGGAATCAGACGCTTCTGCCAAAATATTACAACAGAAAACAGCTACTTAAGCATGGCGTTATTGCTCTGATAGGACTCTTTACTCATT
GTAGCAAACGAAAACTCACCTTTCGATTGGGTCCTGAACTATTTTTTGCTGGTGCTTGATTTGCCTGCAGCAAGTTCCAATCGAACATCAGTCCGAAAGA
ATCCTCAACTAAGTTTTGTTGGTAACAACAGTTANACATGAATATCAAAATGATCATCCAANACAAAGCTTAAGTATTAAATGAAAAATACAAAATATAA
AGATAAAGAAACTAAAATCAAGTCATCGCAGTCGTTGTTCATTGGTACCATAGGCTCATCTTTAGTAAAACGGCAGCCTGGTGCACAAAATATCCCGTCT
AGGGAAGAGCAGCACCCTGAGGGGTGTGATGTAGCCTCATCTTTAGTGATAACTCTTGATCACACATACCACTAAGGTAGCTTATGTAGTAGCGAAACAT
AGTGTCACGATTAAATTGTGAAGATGAATAATCACTTCTCATAAACATCCTCTAAAATTTGGAAAAGAAGACAGAAACGGGATAGGATATAAATTGTAAT
TTACCTCATCAAACTTCATGAAATTTTGAGTGTCAAGAGCATCATTGACTTCTGGCTTATATGCTGCCTCCATGTTATAAAGTTTATCCCACTTTATGTC
TTTGAACCAGGGGTGAGCCTGATTATATTGATGAATAAAGCATAAGAATCTGTAATTGATCCAAAAATAAGACTATTATGGTAACACAAACCTTTATTTG
CTCTGCTCCTCGACAACCAAGACGATTTTCAGCATCACAAAGCAACTTACAGATCAGGTCTTTGGCTTCAGGAGTTAATCTTGCTTCCTCTGGAAATTTT
ATGTGATTTCTCCAATGAACTATCTATAGAACCAGAACAAGTGTCAAAACATAGCATTTGAATCATGCCACATAAGTATCGTGAATGGACTGTCATAAGA
CGGAACAGTAGCACAAGCATAGATACGTTGATTGTTAACTAAACAAAAAGGATAAATAATATCAATGTTGAACAGGAGAAAGTAGATTTGCTTCCTAAAG
TTTTAAATTTCGTCGTGCCTCTCTATCTCTACGAGGTAGAGGTAATGTATGCGTACACTCTATCCTCCCCAAACCCCACCTATATGTTGATGTTGCTGTT
GTTGTTAATGCTGCTTAATGAATTTTCACACACTTGTGTAGACCACTATACCTTTCTACATGTTGTTATTGGGTCTTCGGAGTAGAAAGGGGGATAACCA
ACGAGCATCTCATACATGATGGCGCCAAGTGACCACCTGAATGAAGCAAAGAAAAGAGGATAATGGATTAAGTCTATTAACTTTACTTTCTCTATTCAAG
GTGATCATACCTAAAAGAAAGAACCATAAGTGAAAGTCATGTTTAATCTTTGGAAGTAAGGCAATCAAAACTTTAAAACATCAGTCAATTAAAATCCATG
TTCATCACGAATAAGAAAGCTAACCAATCACATTCCACTCCATAGCCTTTCTTCAGTAAAACCTCAGGAGCAATATAGTCAGGAGTGCCCACTGTTGAAA
ATGCCTGCCATAGCAACAGGTTATATTACAGGTTCCAATAACTAATCAACAAAATATCATTTCTTGGAATAGTAAATGATATTTCTAGTTCGTTTCCATT
ACTCATGTGAAGCTAGGTACATACTGGTTGGCAGTCACATTTTGATAAAGTTCCAATGTGTCATTCAAAAAGCATAAGAGGTATCTGAAAACGAAGTTGT
TGACTTGCTCACTAAGCCTTTGCATGATAAATGAGTGAAGTAGACTCGTAACAAACTTGGCATGCATGACATTGACATTATAAACCAGCTTTGGGCAGGG
GGAGCTATTGGGTGAAAAGGTAGTCTAGTCTTTACAGGACCAACAATTGTTACTTCAGAATATAAAGAGTATTACACAACACTAGTTATTCCACCCTACA
ATTTATCTCCCATTCTTAATAAAGTTCATCTAAGTACTTCAGTTTTTTCAAATGTCTATGCTGTGTGAAGATTTTCGTTTTAACAAAACTTCATACTTTT
GGAAAGCAATGACTCAGTGCTAAATTCAACATAATCATGTACTTGCTTTGCTAAAATTTCTGCGGTAAAGTATCAGCTAGAGCTACGTATCAAAAAAGCA
ATATTATTTATGCATTTTTTTAGATCCATATGAATAAGCTTATCTAAAGCAGACAATTCAATACGCCAGGTCCCAACACTAAGGAGATAAGTATGTTACT
CTCCCGAAACAAATTGTTCTGGTACTAGATATTACTCCCTCCATTTCAATTTGTTTTTCTTGCTTTCCTTTTTAGTCCGTTTCAGAAAAGAATGCATTTT
TCCTTTTCTTTTTGGCAACTCTGTAGTTTCAACTTTATATGTGACATGTTTAAGACTAAGATTAAATGATATTTTGGTTCATGCAATATATATTTAATTT
AATGTTACAAGATTCAAAAGTCTTTTTTGCTTTCTTAAGTTTCGCGTCAAATCAAAACCAGACAAACAAATTGAAATGAAGGGAGTAGTTCTCTTCCAAT
TTTTAGTTTTTCTTTTCCATATCTATGATCCTTGAAAAATCAACCAAAATAAGGATTCTGGATTAAGTTTATAAGTAATGAGATAAGCTGTGTTTCTGTT
AATATTTAATAATGTTCTACTTACTAATTTTCTCCTGTTTATTTGCCAATGCTGCATTTGTTCAAGGGAGCTATTCCACTTGTTAGCAGATCCCTTTTCC
TCACCATCAATCACTTCATTTTCATTTATAGGAGATAAATTCGAACAGTCAAGGGGCTTGCATAGACCAAAATCAGACAGCCTCATGTGACCATTTTTGT
CCAAAAGAAGATTGTCAGGTTTTATATCCCTGCACAAAACGTTACGTAAAAGACATAAATCATTAAGATCATTTCAAATCATACATAGAAGTTCCAGGGT
ATACCATTACTCTATGACAAATATTCGAGCTAGCTCGAATGTGAATGTAGTTATGCTTATGAATAGACTCTATGGCCAAAACACTTTGAGCAATGTAAAA
TCTTGCGACTGTCTCAGTTAATGTCTCCTCCCTGATCAGCAATGTCATCATATCACCACCAGGCAGATATTCCATTACCAGATACAAGTAGTCAGCATCT
TGGAAAGAATAAAAAAGTTTTACAATAAAGTGGCTCGCTACTTCAGCAAGCAAATTCCTTTCGGCCCTAACATGTTCAACCTGTAATGTAAAGTGATGGT
ACGAAAGACAATCAGATCACTTCTTAATCAGTAGAGCATAGTAGTAGGAATAAATCTTATTTAGCAAAGAAGATGGATAACAATTGGCCCCTTAAGCATG
TTAGGAAGGATTTGGTCTCACCTGCCCTCTACTTAGCATTTCAGCCTTCTTCAATTTTTTCATTGCATATATATTTTTAGATACTTTGTCCCGGCACAAT
CTGACCTGCAAAGTAGATATACATAAAAATCAACAACTTATTATCAGGAGTAAGTGCTGGTAAACAGGAAACACATTCCTTGTGACCATGAGGTCATCGG
TTTGAGCTGAGGAAACAACCTCTTGCAGAAATATAAAATGAGGTTATGTACAATAGATGCAATAGCCAATATGGCATATTTCTCCCCAGACCCGTGCATA
GCTACAGTTTAATGCATCAGGCTGCCCTTAATGTCCAATAAAAGGAACAAAGAAATTTATCTGCTAGAACACTAAAGAGGCCTTTGAAAGCAATTAAGAT
TTTCAAACTTAGAGCACTCCAATGACAGAAATTATCATTACACGGAGCTCATAAGAATATTGAGAGATATAAAAGCAAAAGCATCATGAGTGACTCCAAT
TATATAATGTCTAAATAAATTTAAAAATCTTATGTAGAATATGATTATGGATTTTGCATGAGGATGGACGAAATTCATTAGACATGCTCCTTCTGGTTAA
GCATATGATCAATGAAGCGGATGACACAGAACCCAACTCTATAAAAGTTCTATTTATTTCCTAGTACATAATTCAGTAATAAAGGTTGAACAGTTCAACT
AACAAAAAACATAGGGTCGTGGGGGTGGGGTGGGGGGGACATAATACCAGAAGAATGAAATATTTTTCAATCTTAAGAGAAAGAATCTCAAACCTCTCCA
AAAGCTCCTCTCCCAATGATTGTCAAAAGCTCAAAATCATCGACAGAAATCTTGTGACGCTTTAGTCGGATATACTCTGTCTCTTTTCTCTCCAATTCCT
TTAGAAGGTTCATTTGTTCCTCTTTTGGTACACCAGAGCCTTCCAATTTCCTTTCTAGCAGTGAACGCCTACAGTTTATATACGATAATACATGAGGAAA
TACAGAAAAGAATTGTCAAAATTCCATCTAATATCACTCTCCTTTAGTGTGATTGGCTCAACTTATATGTATATGAGCCTAAAAAGTGCATTTGACATAA
CTCGTCTACAACAGTATTTTTTATTTCAAGATATAGAGTAGTACAATTTGGACGACAAGAGATGCTCCATTACAATAACAACCAAGTAAACAAGATAAGA
CACTAGCTACATGCATCTCTCCGAGACCTTTGTTGATCAAAGGCAACCCCTAAGCATATGTTAGCCACTTAGCCTAGTCCTTATAAAGAAAAATCATGAC
TTTATCCAACACTGGAGGAGATCGAAACTTGTAGCTCTAAAAGATTGATGCCTCTTCAGTGATAGAAACCATAAAAGATCCTTTCATTTCAGAAGTGGTG
AAGTACAAAATCTTAACAACTTGGCCTCAATACCAAGCTAGTACGAGTTAATATTGAATCCTCACTATCCAATTCCTCCATTAGAACCTGTTTCATTCTA
ATATTCATTAGTTCGGAGTTCTCTAAAGGTTCTATTGACCTGCAAATACTAACAGATCAAAAAAAACTGCTAGCTACACTGGACCTAATATAAGCACAAT
CTCATAAGCGAGCCTTAATCCAAACTACCTGTTGTCTCCTACATGGACTTGTTTCTTCCACGATGTCCTATGTTTTACTAAACCGACAAGAATTTTGAGA
GATTGTAGGTCCTTTCAAGACAAAGTAGGTCCATGTGATTTTAGATATATCTTGTCCGTGTTCACTACCTTCAATCATCAAGGTTGCTTTCTTTTATTTC
TTGATAGAAAAAAAGGAAATTTCAAGGGAGAAGCTTTCTAAAGACAAAAGGGGAGAGTGACTCTCTTTCTAGTCAGCTTAGAAGTAGATTTTGTCTTGAA
AATAAAGAAGAATTAGGAGTTACATTGTCTTTTAAACCAATCGCATAAGTTTGCATATCCAAACGAATGTGTGTGTATATAAACATGAAAATCCAAATAC
ATTGATATCAACTACACATTCCACATAAAAACTTTTCTAAAATATAATGTTTCATTCCGAAAAATCATAGACACAAAAATTCCAATAAATATTCGACATA
TGAATTCATGAATTGATAATTTTTATATTGGCTATCAACCTACTACATTGGTACTAGCTACTCACATGTTGCATCCCAAATAAACCTTGCATATATGCAT
ATACATATAACACGAAATCCGAATTAAACACCTAAATGAAGATTCAAAATCCTATCTTTTTAACCTAGCTGTCAACCTCTCTGTGCCACATTGAGATGAT
CAAGATACAGACTGCACACATTTCCAATTCAAAATCTAAAGTTACCTAACAATCACTTGTTGCATCCCAGGTAACTCCGATATAAACGCCTAAACGAAAA
TTCAAAATCCAATCATATTTACCAAGCTGTGTCAACCTCCCCATACCACATTGAGATAATCAAGCAAGCTACATATCACATACATTTCCATTTCAGAATC
TAAAGTTACCTAAATATCACTTGTTACATCCCAAATACATCCGAAATAAACGCATAACCAAAATATTCAATATCCCATCATTTTTACCAAAATGTCAACC
TCTATACCACATTGAGAAGATCGAGCTACACTTTGCAGACATTCCCAATTCAAATCGAAAATGTGCATTTTACATAACGATGAAAATTCATTATCCCATC
ATTTTTACCACGTTGAAACGATCGAGCTACACTTTGCACACATTTCCAGTTCAAATCCAAAATTTGCATTAACAGAATGATGAAAATTCATTATCCTATC
ATTTTTACCACATTGAAACGATCGAGCTACACTATGAAAAATTTTTATCCGATCATTTTTACCACATTGAAACGATCGAGCTACACTTTGCACACATTTC
CAATTCAAATCCAAAATACACCAGAAAAAAACCAAAATCGCATTCACCTAATCCAAAAAATTTCAAAAAAAATCATATAATTAGAAGAGAAAAATAAAAT
ACCTTTGTTTACGATCCTGGATTAGTTTCATATGCGATTTATAATGATCTTCGATCAATTTCTTCGCAGCAGCGACTCGTTCTAGAGTCAAACTAGAACC
TAATTGCTCCTCCAATTCTTCCTCTTCCTCCTCCGTTAACGCTACCATTATATGTTGTTGTTGCTCTTCCTCCTCTCTGTTCTTCGCCATAATTTTTTTA
AAAAAATCTTCGATCAATCGTCTTCCTTTTTATCAGGGCGACGATTGAGCGAATCGGCGAAGACAATGAAGAAGAAGAAGGATGAGAAATTCGATTATTA
TTTTTCTTTTCAATACGAAAATCCGTTAAAAAGGAGAAATGAAGATAGAATTGGACGGAGGGAACTTTCAGAACAAAAAAATTGAAACAGAAAATGGGAG
TGTTAATAAAACAGAAAGGCTGTTGGTTTTTTTTTTGTTTTTTTTTTAAAATGGACTATAATATTTTGTTAATTAATGACGTGGCACTATATTTTCGGGT
GGGTCCCTTTTGTTTATCGATGACGTGGCAATGTATTTTCGGCTGGGTCCCAATTTTGTTAATGTGGGTCCCGTTTTGTGGAGATGCCACGTCAGACTAA
TGGAAACATTTTTGGCGGTAACCTTGAGGGGGGTTCAAAGCTTTGTTTTTTTTAAAAGGGCGGAACAACTTGTAAAATGATTTGAGATTAGGATTGGTTT
CGGAATTTTTAGAGGCGTTAACTGAGCGGGTTAGGATGACGTTACAGAGATATTGAACAAGAATTGAAAAATGTGTTGGATTAGGTTTTGATCTATTCAA
ATTTACTTTTAATTTCTAAAAAAAGTCATGTTTAATTATGAACTGTCCAATTTTGTGAGCGGGTTAGGATGACGCTAAAGTGATATTAGACGTGTGTTGA
AATACGTGTTGGATTAGGTTTTGATCTGTTCAAATTTACTTTTAACGCTTAAAAAGTCATGTTTAATTATGATCTGTCCAATTTTGTGAGCGGGTTAGGA
TGACGCTAAAGTGATATTAGACGTGTGTTGAAATACGTGTTGGATTAGGTTTTGATCTGTTCAAATTTACTTTTAACGCTTAAAAAGTCATGTTTAATTA
TGATCTGTCCAATTTTGTGAGCGGGTTAGGATGACGCTATAGAGATATTAGAGGTGAGTTGAAATACGTGTTGCGTTAGATTTTGATCTATTCAAATTTA
CTTTAAACTCCTAAAAAATCATGTTTAATTATGATCTGTCCAATTTTGTGAGCGGGTTAGGATGACGCTATAGAGATGTTAGACGTGAGTTGAAATACGT
GTTGGGTTAGGTTTTGATCTGTTCAAATTTACTTTTAACGCTTAAAAAGTCATGTTTAATTATGATCTGTCCAATTTTGTGAGCAGATTAGGATGACGCT
ATAGAGATATTAAACGTGAGTTGAAATACATGTTGGGTTGGGTTTTGATCTGGTTAAATTTATTTTTAACTCCTAAAAAGTCATGTTTAATTATGATCTG
TCCAATTTTATGAGAATGAATATCATTTAAACATCTTTATAAAAACTGTTAGATCAATACGTTTTGTATTCGACCTCTATTGATTTCCATGTGTTTGTTT
TATGTCTTCAAAATTATTAATTTTTTTATTATTTGCTATTTGAAATTAATTGTTATATATGTGTGAATTGAAATAATATTTTGACTTATAGCATTAATAA
AAAGTTTTTTTCGATAGATAAATTTATCAAAATATTTCAAACTCTAATCCTATAAGAGGTATTGTTCATCGCGAATTCCAAACCCCAACTAATGTAACTA
CCAAATTGACTTTTAAAAATACCCATAAACTTCCCCCTACTAATGTTGAACCTTTACAACTTTGGTGAAGTCATCTTTTAATTACCCTTTAGAATAATTT
GGCGAAAAAAATTAAAAATTTCAAAAATTTTCAACTTACATATGATAAAACTTCAATTTTGAGTTATGTGAAATGAAGAATTATATGCAACATGAATGAG
AATGTTATAAATGGATGTTAATTGTTATGATTGAGAAAGCCGGTTAAAAAAAAAAGGATATTTTTTCAATCAAAAATTATTAAGTTTACGTGAAAAAAGT
ATTTATATAGTTTATGGTTTAGAAGTTGACAAAATATCTTAATTTTCTTAAGGATAATTCTGACCATATATATTTTGCTTTTGTAATAATAAATTGGAAA
AATACACCAAATCCCCCTTAAACTTGACACGAAAATTCGCTTTAGTACTTAAATTACACGGGCGTTTAAATATCATCTCTATCATCTTTGAAGTGATTTT
TTTACACACTGAGACTGTAACACCACTCTCACCCGCCACATCATATCCACGTAAGCGCCACATCATAACCATGTAGGTATCACATCATTAATTTTTAGTT
CTTTTTTACTTATTCATTATTTTCTATTAAACACTTTTAATATTAATTATATCAAATAATTAATTTATAAATGCATACCCCCACCCCCTATCTTTCATCT
TCCTTGTTCTTCACCATTTCAACCTACAACACTTACTTTTCTTCTATACTATTCAACAATTTATTTAAATAACTAGAATGAAATTATTCACTATAATATT
CACATTATCTTCTTCGAATCCACCCCACACATTTACCCTTTTGGAGGAAGATTTTTTTTTTAAAAGCCAAGGTTTTATTGTCAATTCAAATAGGTAATGA
AGATTACATAAGTAAGTTGATAAAAAAATATAAATTCTATGAGAAATATTTGAATAGGTCTAGAAATCAAAAAGGGTCACTCAAAATTAAGAGAGTTTAC
ATTTACAAAATCGACACCAATAATATAGAGCGAAATCAACGTGAATAAAATAACTTTGATATTGAATTTTACGAATTAGTAAAGGATTAATAAAATAAAA
ATAGTTTTTTTTAAGTGGGAGGAATATGGAGGAGAAAAAAAGTGTATTGGGGAAGACAACAAAATGAAAAGAAAAAAAATAAAGAAATTAAAAAGGGATC
CACTAATTCTATATTTTTAGAGAGTTAATATATCAAGAAAAAGCATTTAAAATATTAATTATATATTGACCAATAAAAAAAGGCTAAGTGTAGAATTTCA
AAAAATTCTAAATTCTTTTTTCTTCTTTCATGCGCTTTAAGGAGAGTACACCCACTCTTCCTGCCTCGTCATCCCTAAGGGGGTGTTTAAATCACTTCAA
AGATGATAAGGGGATGATTTAAACGTGCGTATAATTTAAGTACTAAAGCGAATTTTCATGCCAAGTTCAAAGAAAATTTGATATATTTTCCCTAATAAAT
TTGACCCTAACTAGTAATATAGAGCATAGCAGAATCATTTTGCACATAATTTGAGATCAACTATGCATAAGTTGGATTATTAGGTTTGGTTTTTTTCTTT
CCTTTTTTCTAGGGTACAAAAGGTTAAATTAGCTTTGAACTATGTGAAATATGACGAAAGCTTCGCACATTATGATATCACGTATCTCACAATTAAGGAT
TTTTTTTAAAATGAAGTATAAATTTGAAATCACATCATTATTTTCGCCGTTAATCACTCTTTCTTCCTCTTTAACCTTGTATAATTGAACTAATATTTTA
TGTTCATATATATTCAAGTTGTTTAGAGTGTTTCTATTGATGATAAAGATGGTGGTGGAGCAATAAAGAGAGAAAAGTGAAAGGTTCAGGAAAGAGATGA
TAATATATAGTAAATGCGATATTGACAATGATAATAATAGCAAGGAGAGTGAAAGGTGGAACTAATTTTTTTTTTATAAAAGAACTCAAAATTAGAAAAA
GAAGAGCTAAATTTGTCTTTGAACTAAGTGAATGTTCAAATTTGCCTCTAGCTAGATTATAAGAAAGGTTCAAATTTTTTTCTTTGTTTTTTTTTAAAGA
AAAAAAGATAAGTATCAAAAACATATTTAGATTTAACGTGAATTATTAGGTTTATTTTTGAACGATTGACAGCCTTTAAACTTCTCATTTACTTGACCAA
CTCAACATAAATATACACTGATCATGCAACATGACTGAAATATACTCTTAAATTCTCGTGAAGTTTAGAAGTGTTTCAACATTTCTCCTGACTTTTTATC
AAGCGTCACATGCTCCAATTAGGGGCAGCTCAACAGATTTGGATGCCTAAAGCGAAATTTTAATTAGAAGTCTAAATTTTTTTAAATGAGGCAATTATTA
TATTAATTGTTAACATTATTCTATAAGTAAATATCAAGGAACACCCCACCCCTCATATTCCACGAGAGGTGGAGACCTGGAGGGTCGAAAATATTTCACC
GCACCACACGATTCTTTCGCGAAACGCTCTTCCCACTCTTGTCCTCGTAAGCAAAGAGGTTTCAAGATAGTAGGGGACCGAAAGCTCTGAGCAAATATTC
TAGAGAGCGTGCCCTTAGTTTCGAGTCTTTTTCTATTCTAAAACGAAAAATTAAAAAAGAAAAAGAAGCCAATTTTTTTCTATGGACCCCTTTTAGCAGA
TTACTTTACTGACCGTAACTCATTCAAAAAGAGTAAATGAACTTAAGTTTGATAAAATTGCTTATAAACCTTTTTGATTTAGAAACACCGAGAAAGGTCA
ATCTAGACAGACAATTCATTTTATTTAACACATTTTACTATTAATTTATATTTTTGACAGAGTATTATCGTAACTTAACATAGAGTAGTATAAAGGAGGT
TTAAAATATAATAATGTGAATTTTAGCAAAAAAAAAATAAAATGTAAAAAGACAAACAACGCTTTCTTGACTTCTTCAATTTGATTGAGGTTAAGGAGAC
TAAATAATTTTTTAATATATAAAATAATACATTTATCATAAATAATTATTTTTTCTATAAAAAATTAACACTTAATTTATTTTTGATAAAAAATTGAGGC
CCCCTAAAATTGGGGGCCCAAGGCATGTGCCTTACATTTATAAGCATTGAGCCAGCACTGGCTTTATAAAAGCTTGAGATCATATATTATGTCATGTGGC
GAAATCAAAGTATATCGGAGGATACTTAAGTTTAATTAGTTAAATAGAATGAGTATTTTTAAAATTGTCAATAATTTATAAATGAAATTAATAATTCAAA
TCAAATTTATGAGTGTTTTCGATACGTTTTTTTTAGAAAATTAATCTTTAACTATGAACACATGACATCACTGAATGCTAAACTAATATCATATAAAAAT
AAAATCAAACTTAGCTTGTTTTAATAATGGCAAAGAGTTATCTGACTCAAACTATTAATCGAGGATAAATCTATTCCATTTCACACGATCCAATAGTAAA
TTTAAGTTTTTTTTACCTTTTCACTAGAAGGAATATTTTTGGTTTATGTTGCTTGAAATAAAGACCATCTACAAGGTATTAGGACGACGTTTGAACTGAC
TTAAAAGTTAATCAAATTTATTTATAAATTAATTTTTAATTTTAAAAAATGTATGACAAATATAGAAAGTAACTTAAAACAAATTAGGAAATATTTGGCG
AAATAACTTAAAATAAGTTCAAAACTAAAAATTACTTCCTCCGTTTCAAAAAGATTGGTCTAGTTTGGCTTAGAACGGAGTTTAAGAAAAGAAAAAAGAC
TTTTTAATCTTGTGATTCTAATTTAAAATTATGTTAAGTGTATCAAAGTATCATTTAATCTTGCGATCTTAAACATGTCACGTGGAAAGTTAAAATTAAA
ATATTGTCAAAAAAATAAAAGAGTCATTATTTTTGAAACAAACTAAAAAGAAAATAAAGTTATTTTTTATACGAAAAGAGTGAATCTCTTTTTACTTTTT
TATTTTTAATTTAAAAATTATTTTAATTTTAATTTTTTATTTTTAATTTAAAAATTACTTTTTTAAATCTATCCAAACGATATTTAACAAGCAAGGCACT
CAAATGACAATTGGAATCCTACAAAATTTTCTTTTGACTGTCAAAAAAACAGTTGGTATATTTTTTGGATTATTATCAATTCTAGTCAACTTCAACCAAA
AAATACATCTGTCAGTCTATTCAAAGGTCAACAAATTGTTGAGGATAAAGACAATACTATTTTTTATATCATCATGATGTAAGCATTACGTGTGAAAAAA
AAATAGACTACCAATTGTTTCACCGAATAAAAACAACTTTTAGCGGCATTAAATATTGATAATAATAAAGAGTACTAAATTTTTTACCGATATTAGTTAA
GTGTCATTAACACCAGTGTCGCTAAAAGCTTAGGAACATATACAAAAAGTATCAATTACTACTAAAAATACATGTTTAGCGGTAATAATGAATTAATTAC
AGCTAATAATTATTTTTGTTGTAGTGAAACGAAGTTGACCATTGTTCTTAAAATTAAAAAAAATAAATTACATTAATCAATGTAATTTGTTAGTTAAATT
ATTTACTTATATTAGTTTATTTATTGTAAGTCAAAATGCCTACTGAATAATCAATGTTGATGTGTAATATAAAAAGTTGTTGGATAACCAGTGTTGATGT
GTTAAATTAAAATGCATATTTGTGTATTATGTCTAAGTTAAATTTATATATCTCGAGGTCAAGTTCAGGTATACATGAAAACTCAGACATGTTGACCAAT
CATTAGTTGATCATATTTTTATTCATGGGAGTTGATTGAGATCTTTTAGTTAGGATTGTAAATTGAATCTCTTTAATTTCTTCGTATTTATTTATTTATC
ACCACTTATAAGTAATAAAATCTTATAATTGTATAAAGTCAGAGATAGTATTTTTTTCCACAAGCCATGCAAGTCAACATATTGTTGATTGCAGGTCTCA
TTTTCTAAAAATCCAATTAAAAGTAAACTTAAACTAGAAGCAAGTCAACCTCATTTGCTCCCCTAGTTCTTTATGGACCCTTTTAGGCTATTAATGAGGT
CAATGAAAATGCCAAAGTAATAACTAACAAGATCAATTTAAAAAGTTAGTAGATTTCAATAAATAGTTACATAAATGCTAACATTGTGCAAATGATAGTG
TCACAATTCTACTAGGTAGTTTCATTTAAGACATGTGTCAGATTCTTCAAAAAAAGTCTCTCCGAAGACATTTGATAAAATTGGAACGATACAGAGAAGA
TTATCATGGACCCCGGTGCAAAGATGACAAGCACAAATTGAGAAATGGTCCAGATTTTTCAAAAATATTACATTTTCGAAAGATTCAATATAGATGTGGC
TACATTTTAAGAAATTTCGAGCTGTATATAATAACATACTCGATGTAATTGAAGAGAGTGATATACGCAACCTTACCCCTGTCTTTGAGAAAGAAGAAAG
GTTGTTTAAGATAGTAAATCGTCTAAAAAGACAAGTATTGGTAGAGAACACAACAATGAAGAAATCAAAAGGAGAAAAAGAACAATGGCAACAAAGAGAA
ACTTCCAATTTTTTTGGCTAAATTTCTTTGATAAAGAATTGAGTCCAATTCATAATGTCCTAAACAATATGAAATACTTGAAATGGAAAAGCAAATCTTC
TATGAAGATCAATAATAACTTATTCTATAACATGACTCAAATAAACCATGTAAAAGAATTACCCCTAATATTCAAGCTCTAAAACATGTAAACTAAATCT
TGAATTTCCATATTTCATCATAGAAAACTAGTCCCTGAGTGATTATGATGTAATAGTTTGTGAGCAATCTGATCTCTTACTTTCATCGCGTTCATTGATC
TCACAACAACTTCCGGGATCATTTCATCATCAACCAAATCGAACCTTAATTCTTGACGTAATTCTTCACCTCTAATCTCACAGATATTGTGAAGTGTACA
ACAAGCTCCAAGAACAACAGGCAAATCTTGAAGTTTCACTTCTGTTCTTTTCTTTAAACAACTCCATCTTGCTTTCAATCTCATAAACGCTTCTTTGGCA
ACTCTTTGAACATCATTCACTTTCTCATTAAAAGCATGTTGTGTCCATGTAACATTCTGATGAGTAAACGGAACTAAAATCCAATCCGTTAATGGAAATC
CTGAACTCCCAACAATGTAAGTACCATTCAAGTTTCCTCTGTTTGCTCTTTCATAAAGTATCGATTTTTCCAAGACTTGATCATCTGTCATCGAACCAGG
CCATCCTATACAAACATCTGTGAAAATCCCCTTTGGATCAACAACCCCTTGTACTGTAACGGAGTAAGATGTCTTCTGATTCCTCTCAGTATGCCTTTTG
TTGAAGTAACTCGCGACACTTTCCTTAGGCGCGATAATTGGTACATGTGTCGTGTACATTGATCCACCTACATTTTCTATCCCGGAAAGGATTTCAAACT
CGTGTTTAATTTCCTCCATCTTAAGTTCATCAGGCCATTGTATGAATTTCGCCATTAACACCCCTCTTATAGCTGTGCATACCTCGAGCACGAGCTTATG
ACAAGTAGATATACCTAACCCAAATCGCCTAGACACTTCTCGGAGTGGCTCTCCTGTAGCCAATCTCCAAATGCATACAGCTACACGTTGACGAACAGGT
ATCGCCATACGTAACATCGTGTCCTTTTTTGTCACTACTGATTCTATTTCAGAACATATAAAATCAAACGTAGCTTTGCCCATATGAAATGCTTTCTTAA
ATTCCTCTTCAGGGAAATCAGGACGGTTACATTGCTCCCACCACGCATTTGATCTGTTTTTCACCCATAACCTCCTCTGCTGTAATGGCTGCTGAGAATA
ACCAGAACCAGAGCCAGAACCAGAGATAACCTCAACTAGACCATCTTCATTCTCATTGGCATTTTCACGAACACGTTTAGTGCCAGAGACAACACCATGA
TCAAAATCAAATTTTTGGTTCTTGTAATCAAAAAGGGTGTGATTTTCAACTGATTTTGATTCTGGGTGCGTTTCGTTTTCGACACCCAGAAATTTATTTA
GGATTTCCTCAACTGGGTTGTGATCAAAATCGTTAATTTTTATCTTTTTCGACATGGATTGATGATGATGATGATCAGAAGATGGAGAAAGAAAGTCGAG
TTCTTGAAAAAAGTTTAGAGAATTGAAATCTTCTTGTGATGGAAATGAAGAAGAAAAAGAAGTGATTTCCATTCAAATAATGAAGCTTTTTTTTCTTAAT
TCTTTTAATCTTTTTCCAGGTGTGAAAGTATTTGAAGATTTTGTCAAATATGAAACAAAGAAAAGTGTGTGAACACACAAGAAGTAATGAATTGAAGAAA
ATTAAAAATGGAGTTTTTGAATATATAGAGAATTTTAATGCACGCGGTGAAAGGTGGGGGTGGGTGGGGTGGGGTGGGGGGTGGGGGTAAGGGACCTACG
CGGTGAAGGAAGATTCTTGTNGGGTGGGGGGTGGGGGTGGGGGTGGGGTGGTGGGGGGTGGACGGTGGGTTAAATGAGTTTTTGAGATTTTTAGTATACT
ATGAGTTTTATCTTATGGTTTTAAAATATTATAATTTACTTGACATAATTAGGAAGGATAGAAAGGGTAGAATGTATACGGATTAATTTTCGATAAACAT
TCAGTTTAAAAGCGAAGTACACGTGAAAAAAAAGATTATAAGAAAAGAGACAATAAAATAACATGAGACTAGCAGCATGTAGTAACACGTGATAATTGGA
TACTACTACTAAGAAGAGAAGTCGTTTTCAAATTAAGATGAAAGGTTAGTAGGTAGTTGAGCATTGTCGATTTATCGTTTTTAATGAGTTTCAAGTTTGA
AAATTGGATTATTATGATTAATTTTTCAGGTTCTTTCACTCACAAATATTTTTAAAAAAAAATAAAAATTAGCTAAATATATGTCTAAATACACTTCAAC
TAATCAAATATCATTTTACAAATATTACATTTTATGTTTAAACAACCACCTAATTTTCAATTAACTAAGATGTACACTTTGGATACACTCATAAAGTAAA
TATATGATATTAAGATTATTTTTTAAAAAAATTACATTTATTTAACACTTAATAAATCGTTAAATTTATGAGGTTTCACGGTATCTAACTTGAGATTCTA
TCAGAAACAATTTTTAAAGCTTTTTACGGTAAAAAATAAGGCCAGTATACGCTTTACTCTTTCATATACCTCCACCAATAGGAATACAATGAGTTTATTG
TTATCACAAGTGTGCATATTAATTAATTAATTAAAAAAAATTAATATATAATTAATTAAAGAGTATGAAGACCAAAATCATATTATACACATATCTTTGA
GGGACTAAAATGCTAATTTTAAGTGAAGGCTTTAATATTAAAAGCTT