BAC Sequence – LE_HBa0190J03

>C11HBa0190J03.1
ATAACTTGACTCTTTTTAAATTAAATTATTTTTTTTGGCAATTAAAACACTTTATTACTCACTGTGCAAGGATTTGGAGAGAATAACTTGTATCTTATTC
AATAGGTAAACATGTATAAATACAATAATATTAGAAGCTAATTAAGGAAAGAAATAAAGATATATGCTATCTATCTATATCTTTGTGCAATATCAAGAAA
GAGATCTATATACATTCTGTAATGCTCCCCCTCAAGCTAGAGCATGTATATTGATCATGCCCAACTTGTTACAAAGGTAATCTACTCGAGCTCTATGCCT
TCGTGAACAAATCAGCTACATGTGCTGCTGTCTTCACATAGCCCGCAAATATCAAGTTTTCCTAAATCTTCTTATGAATAAAACGTCAATCAACCTCAAT
GTGTTTCATTCTTTCATGATATACCGGACATGCAATATGAAGCGCAACTTCTTATCACACCAAAGTTTTGATGGAGTAGAATGCTTCAGTCCAATTTTAG
TTAAAAGATGATGTATCTACATGATTTCACATGCAGAATGTCACATTACTCTATATTCAGATTCTGGACTGGACCGACTATGTCACTACATCCCATATCC
AATTAGGCTTTGAAGCAACTGGACAAAACCAGAAGGAATTTTCTCTGGGAAGGGAACAATAAAAGCCATAAATTCCATTTAGTCAAGTGGGCACTAGTCT
TGTTACCAAAAAAAGTTAGGTGGTCTGGGCATTAGAGACTTAGCACTTCACACCAAATGCCTACTTATAAAGTGGTTGTGGAGATGCACTCAAGAGGAGC
AGAGCCTTTGAAAATATGTGATAATTGCTAACCATTGAGCAATAAACCACTGGTGTTCTAATATTTCAACAGCGCCATATGGAGTGGGTGTTTAGAGAAG
TATATGCAAATTATGGGAGGAGTTCTCTCAACATAAACACTTAATTGCAAGGAATGGACAACATATTAGTTTATGGAGAGACAAATGGATAGGCAACTCC
TCTTTAATGGTTGCTTATCCTAACATGTTCCAGATAGCAAGGGAGCCAAACTCTACTATTCAGTGGGAATTCTTGGAACATCATCCTTAGATGGAATATA
CACAGTGTTGCAATTAATAGTGAAACATAGGACCAACTTAACTGGGGAGAAAAAAGGTGTGGGAAGTTCTCAGTTAAAGCAACTTTCAAGCTTCTAGGCC
CACAAAATGCATATGCATACCACTGGCCTTGGAAGCTTATATGAAAGATCAAATTGCCTCCTAAGATTAGTTGCTTCAGCTGGACTGCACTTCATGGAGC
TTGCCTGACCCAAGACAACCTGACCAGAAGGAAGTTTCAGATGGCTACTAGATGTTATATGTGCATGAAGGAAGCAGAAACACACAACCACCTATTCTAC
AATGTCAAATAGCAGCAGACCTTTGGAGTATGTTTTTAGCTGTTTTTGGCCTCAAATGAGTCTTGCCTCAGAATATCAGGGATGTTATGATAAGCTGGAG
TTGCTGGAAAGTTGATGGCACCATCAAGAGAATCTGGAAGATGATACCTGCAACATGAATTATAATTACTACATAAAAAAGCTCTCAGGCACAGTTTCCA
AAACCCTCATCTTTCCTACTTTCTAGGAGGGAGGTTGAAGCTTCTTCCCGGCATCCTTTCAACCGGGAACCTTCCATTGACCTTAATCTACCACATTTTG
TGGTAGGTTTCCACCTCCCATTTCCTTTCATATCAGCTTGGGGTTTTTAAGACTTTGTATACAAGATTGAAGAAGACAAAATTTACTTCAATGCAAGTTT
CAAGTCTTTTGATATTACTAGACGGACAGTGGGTAGAGACACTTGGTTCGAATGGGTGGAGCGCAGTCGAAAGATGATGACAAGGTCCGATATGAGTCTG
AAGATATTGAGATGGATCTGCAACATCCTCAAAGAAGCATCCATAGATGAGAAGACCGTGTCTAGAAGGTGGAAGACGAGGGAAAATCAATCTGAATATT
TCTGCACAAGAAAGTCAAATGAGTATGGCAGTTATATGAGCATCCTTTCATTTCATGGTTTAGAGAGAACAATCATTATTATCCATGAGTTAGCTGTGAC
ATTCATGCCCATTTCTTGGAGTTTATTGTAGATCTGGCCATCCGCCATTCCATCAATATTCCATTCTGTTATTCCCGTTCCATCTGCAACTCCTTGAGGA
TGCATATGGTTTTCTTCGAATTGAATATCGGGAAAAGAAGGTCTGGGATAAAAGTTTTTGGAATAGGGGAGCCTATCCTTTAGAGCGCTAATTTTTCCGC
CCTGAGTAATCTTGAGCTTTGAAAGCTGGTCATTAATCCTTTCTAGGATTTCAAGAGAGTTATTAAACTCGCTTGAAGGTTTTGGAAAATCTTCAGGGGA
AAATTTATGGATTTTGAAAATAGGATTAGTTTCTAGATGAAACCATTTTTTGAAGAATTGGGTTTATTATCAATTTGACTGGTGCCACTGTAATTGTAAC
TGGAGTCTTCTATCTGTTTAGAAACAGCATGAAGAACTTGGTTAGTATAATTGTTCTGTTCGAATACCTTGTTGATATCTGCAACAGTCACGATGCTGGA
GTCCTTTTCTTCTGAAGGCTTCTTGAAAGAGCTGCTTTCAATACATCTTTCCTGTAAGGAATATTAAGTCCTTCAAGAGGGGTGTTATACTTTCAACAAC
CTTATCTTTGGTATGCCACTTATTTATCAAAACCTGAAGTGATGAATTAGTTTTTTCAATTTGGCTTGAACATTCAAACCATTATAAGAATTCAATTTCT
GTTTTGAATCTCTTCATATCTTTGAATCGTTTATCTTTAAATGAGACTCTCTGCTTTTCAGTGAAGAAGCACACAAATGTTAAAGTTGGAAATGGGCTCA
AGACTTCTTTTTGGAAGGACAATTGGTTGAGATTAGATAACTTAAACAATTTATTCCCTAACTTAGTTGTGATGGCAGTACAACCGGAGGTGAGTGTGGC
CGACACATGGACACAACAAGGTCGGAACATTCATCTCAGGAGGAACTTCAATGACTGGGAAATTGATTCAGTCATTGAGTTCTTCAGAATGTTGGAGGAA
CTTAAAGGTACTAGTGAAGAAAAAGACAGACTTTGGTGGAAATTAGATAGCAAAGGTAGTTTCAAGGTGAACTCTGCATACAAGTTTTTGAACCAAGGAA
ATTACAAAGACAACGTTGGCCGTGGAAACATATATGGAAGATCAAAATCCCCTTCAAAGTTGTCTGTTTTACTTGGTTATTGACACGAGAGGCTGTTTTG
ACACAAGAGAACCTCAGGAAGAGGAAATTTTCCCTTGTGTTCCAGATGTTACCTTTGTGGTGAACAGGTTGAGACAGTTAGCCATCTGTTTCTACAGTGC
AGCACAACTACTCCGTTATGGAGAATCTTTGTTAGCCTTAGGGGTATTAGTTGGGTCATGCCTAAAAAAATAACTCATTTGCTATATAGTTGGGAGGAAG
CAGGAGTAGGAGCTGCTGACAAAGACAGATGGAGGATTGTCCCGACTTGTATCTGGTGGACAATATGGAAGGGAAGGAATTCAAGATGTTTTGAGAGCAA
ACATTGTGATCTACAGATGATCAAACTAAATTGCGTTAGACTTTTTTGTTTCTGGTGTAAACAAATATACTTAGAGGACACTGACTCAATTATAGACATC
CTAGGATCTTGTTAGAAGTAGAGTCAGTTAGATGTCTTTTTGATTTTGCTGTAAATATGGTTTCAGTGCAACCCATGTACTGACTTGTCAATAAACACAA
CTGTTACCTTCTCAAAAAAAAAACAAGAGAATAGTCAACTTCAAAAAAAGGCTCAACTCAAGTAGAGAAAATCAGGGAAAACCAAATAACCCAAAACAGA
GTTCAGATGGTTCGAATACCTAGCAGTTCACAGGGTAACAAGAAACTAAAATATGAATAGCCAAAGGCTCCGGATAGAAAATCAATCAAGCAACAGAGAG
GAAATTTGAACCAACCGCAGCAAAGATCAGACAGTAGTTTGGCTAAAAATAGACCAAACAGCAGCAGGGAAAGAAATTCAAACTAAAGTATCACCAAAAG
AAAGATTGCAGAACCCGGATCTTGATGTTGAATCTTCAAAATGTAGTCCAATGATAAGAAAACCTCCATAAATCAACTTGGAATGTTCAGGCAACATCAA
ATTAGTAAGACAGACCACTAGTCGTGAAGTCACATGAACTAGAAATTTAGAAGTGGCTAGTTCCGGCAACCACTAGTACTGAGGAGGTTCGAGAGCCACC
ACTTCAAGTCTCACAATTTCGATTATGCTCTAATACCATGCGCAAGGAATTGGAGAGAATAAATTGTATCTTATTCAATAGGTAAACATGTGTAAATACA
ATGATATTAGAAGCTAACCAAGGAAAGAAATAAAGAGGAAATCCTAAAGATATGCTATCTATTTATATCTTTGTAGAATATTGATGTCCATAATGCTTTG
GTATATGGGCATTTAAAAATAAATGATCTGTACTTTCAGGTTCATCATTACATAGGACACATGTTGCTGCCACTTGAATACGCCATTTCAATAGTATGTC
TTTGGTATGTAGCCGTACTATAAATATATTTGCTTCAGCACAACTATGACATACCAAGTTCTTCCATTCCACATTAGGATCCTCACCTCTTAGCTGGTGT
ATACGCCTTTGAGATCAGAATTTTTTCTTCATGGATCAGCTTTTCAGTGACTCCCCAAGTCTGCCAGAATTTCCTCGTATGCAATATCTTTTGCACCATC
CATGATGCTTGTGTTGGAAGTTTCATAGTCCCAATAAGGAATTAGTTTCACTATGAATTTTCTTTCTTCAATTGTCAAAAGTCTCTTAAGCAATTTAAGA
ATATTAGTTTCGTAGCATAGCTGTTCAACTTAAGGCAATGTTCTTGCCTCTAGCTTCTCATTTAACTTGTTGCTTTGAAGACAAAAAATAAGAATGATTT
GTAGTGATAACAATAACAAATAATGAAACAAAGAAGAAGAAATGGAAGGTAGAGGGTAATGATGATTATAAGAGAAGGAAGGGAATAAACAAAATTGAAA
TCTGAATATGAAAAAAGCGAGTATGTACATTTTTTTAAGTATTTAACAATACCCCAAAATAACAATATTAATCAGGCTCAACTTCACTTAATCCTGATTA
AAACCGATCAAGGTCAGTTTTCTTTTGTTATTAATACTTGAGAGAGCCCTTTAACTTTATGAAAAATTAGTAGTATAATGTCTTTTTATAAATTAAGATT
TTAATTTTTGTAGATTAAATAAATATTGTGCATATACAATTCTGACACTATCTCTTTTATTTCAATTTTTTTATGACACGGAAAAACTTGCAGCCGCTAT
CCTTTGGGTGCTCACAGGGTAAAACCCCCACTCCTATACAATAACTCGCAAACCACTCCGTCAACAAAAAAAATAGTTTATTTATAGCCAAAACAACTAC
GGAATTACACTCTTCAACATTCATTCTGAACGAGTAAGAAATTGAATAACCAAAAAGAGTATCTATTTTTCCATGTAAACTTTGGTTTCAGTGATAATTG
AAGTAACTCTATGCCGCAAAACTGAAAATGGAAAGGAGAAGTTACCTTAAAATTTACGGAGATAACTTTAGTTGGAACGAGAGGGAAAGAGAACACGGTA
GAAAAGTAGTTTTTCAAATGGAGATGAAGTTTGCCCTAATTTCTCTGTCTCTAAGACTCAATTTGGCCTTAACAATTATACTTTATATTTGTTTTTTTTT
AATTAGAGGGAAATAAGGAAATATAATATGGTTAAAATAATCGTTCCAACAAAAATAAAAAAAATAGTACCATTGATGGTATTGTCTTTTTTTAGTTTTT
GTCCTGTTACATCTATTGTTTTGTTATTAGTTGTTGTTTTTTGAACTTTTGTTACTTCTCTTTGGGACTGCTTTGGACTGTTTTTCCTTTAGTCGAGGGT
ATATTTGTAAGAACCTCTCTACCTATGAGGTAGGGGTAAGGTTTGTGTACCTTCTACCCTCTCCAAACCGCACTTTGTGGGACCACTGGTTATTGTTGTT
GTTTGAGAGTTTTTTTTCCATTTTCTCATAGAGAGATGAATAAACTTTAGTTGTCTATTTTAGTTGAAGTCTCGAAATAGTGAGCATTATCTTAAAATGT
CGAAGAATGTACTCTGAAGTATCACTTTGACACATTGTTGGATGTATAAGTGTTTAACAGTTGTAATTAATCATGATTAAAATGGATCAATATCACCTTG
CTTTAGTTATTTAAGACTTCGGAGATCCAATATTAAATCTCCTTACCTTAATGTATAATTAGTTTTACGTCTTTCTGAATAAAGATTTTAATTTTGAAAA
GTAGATTAGGTAAATCTTGTCCAAATAATATTTGATCACTATCTTTATTGTTTCAACCAATTTTATTTATTCACCAAAATATATAGGAATATTGTTTTTT
ATTATTGGTATTCTATTTTAACCATATTATATTTTCTTATTTCCCTCAAAATAAATCAAATATAAAGAATAATTGTTAGGGCTAAATTGGGTCTTAGAGA
CAGAAAAATTAGGGCACAATTTTATCTCCGTCTGGAGAACTACTCTGCTATTCCGCTCGCTCTTGTTCCAACCGAAACTTTTTTTGTGATTTTAAGGTAA
ATTCTGTCCATTTTCAGTTTTGCGGAATAAAATTACTTCTAAAAACGATGAATCTAATGTTTACATGGAAAAAATATATTAACCTTTCGGTCATTCAGTT
TCTTTCTTGTTCGAGAGGAATGTTGAAGAGCGTAATTTTGGAGTTGTTTTGGCTGTAAAGGTTCTTTTTGTTGGTTGAGTGGTTTTATCATGTGGGATTT
CTTTCTTTTTTTGACTGTTGGTCGATTTTTTTTTTGAATTCTGTGAACACTTGTAGAAGTTGTAAATGAATCATTTGTAAGCAAATAATTTGCTGATTGA
ATTTTTTTTATCATGTGCATTTCTTTTTTTTTATCTTTTTTTTCCTGAAAGAATGATGAATGATTCATTTTTGGTCATTCAGTATCTTACTTGTTAGGAA
TGAATGTTGAAAAGTGTAATTCAGAAGTTGTTTTGGTTGTAAAGAAAAAGTTATCTTTGTTGACTAAGTGGTTTTATCATGTGGGGTTTTCTTTTTTTTT
TCTTTAAAGCAATATTTTGGACGGCGAAAGGCGACAAGGGCTTGCCTCGCCACGGGGCGAGCGGCAATCGCGGCGCCAATTAATACCAAAAGTTAAAAAT
ATTTAATTGCGTATATAAATTTCCAAAATCTCAATAGCAATAACATATATATAATTTCAAAAAAATAGCAATAACATATATTATCAAATATTTCAATTCA
AAAACATAAGCCTAATGAGGTAAGAGCTTTAGGTTAATGAGTATAAATAAGTCAAATATATTTATTTATTTTTTAAATGTTGGCAGTGGCCAGTGTCTTC
AGTTCTTCAGAAATTAGACTTCACAATAAAAACAGAGGGACTGAGAGAGTACTAAAAATAGGGAAAAAGAAGAGAAGAGAGAAGTCACGACTCACATAAG
AGAAGAGAGAACTCGTCGTTGCAGCAATCACAACCCTCGACCTCAAGTTTCCAGTCGAACTCACAGCAGCAGTCGTCGCGAACCCTAATTCCCGTCGAGG
TATTGATTTCAAGTTTCCAGTCACCACTTGCCCTGGCTTGCCTTTTTGACCTCGTTACGTTTTGCCGGAATTGGCGCAGCGTCGTGGGCTTGCCACGCCT
CATCGCCTTTGGCGAGAGGTGTTCGCCTTTAAGAACGCTGCTTTAAAGAAAGATGAATGAACTGTTGTAAAAGTTGGTTGGATTTTATTGAATTCTGTGA
GCATTTTATTATAATGTGGTAGTTATAAATGAATCATATTTAAGGAAAGAATTTGCAGATTGGATTGTTTTATCATGTGGGTTTTTGGGGGGTGAATGAC
CCGAAGGTCAGTTGGAGTTCTTATTGAATTCTGTGAGCATTTTATTATTATGTTGAAATTGTAAATGAATTATTTATAAAATAGAATTTGTAGACTGAAT
TGTTTAATCATGTGGGTTTAGGAGAGGTAAAGGTAGACTGGATAAGTATTAAAGAGAGAGATGTGATTAGGTAGGAGATGACATAGTTTTAGCTTGCTGA
GGACATGACCTTAGACACGAGTGTGGAGGACACAGTTAGGGTAGAAGGTTAGTAGGTACTAGGTAGAAGTGTGTGTTGTCCGTTCGTATTAGTAGTTGTA
GTATTGTTCTTGTAGTTTCATGTCCTTCGATTTCTGGTACTATCTTTTGTTCCTTATACTTCTATTATGTCTGTTCTGTTACCATCATTAATTTTTGTTA
TTATTTGTTGTACTTGCACTTCCATTACTTCTTTTTGGGAGTGCTTTGGACTGTTTTCCTTGAGCTGACAGTTTATTTGAAACAACCTCTCTACCCATGA
AGTAGGGGTAAGGGTTTGTGTACCCTCTACTCTCCCCAAACCCCACTTTGTGGGACTACACTGGTTATATTGTTGTTGTTTGAGGGTTTTTTCCCTTTTT
TTTTCATAGAGAAAGATGAATAGCCTTTATCTGTCCATTTTAGTTGAAGTCTCTCGAAATAGTGAGCGTTATGTTAAAACGTTGAAGAATGTACTCTAAG
TATCACTCTGACACACTGTTGGATGTTTAAGAGTTTAGTAGTTGCAATTAGCAAATAGAAAAATTGAAAGGAGCGGATATATGAGAAATGAAAAGGGAAA
CTGAAGAAGAAGAAGGGAAAATATCAAATTAAGAATCGAAAAGGAGAAAAGTTATTCATGAAAGAGACTTTACCCTTACACTTCTGCAATGAATCAAGTG
GTGCGTAAAACTCAAACTGCTAAATCAAATGATGAGGGTGTAAGTGAAAGAAAATGGATAAAAGTAGACTAAAGTTTAAATCTAAGATTTTAATTTAAAA
GCTGAATGAATCTGAAGTCAGTCTGCAAGTCAGGAACAACTCCTGTGCCAGACGTAGTAAGAATTTGGTCATTGCCTTGCACAAGTGAAGGATTTAGATT
TTGGATGGGGGTAGACTCTTTTATATCTTTAGAAAATTCAATATTTGCTATGAGAGAATGCATGATTAGGAGGATAACTGTAGAATGCTGGTCCTCAAAT
TGTGTTAAATGACCTTTGTCTTGTAAGTTGGTTTCTACCTTTCTTATAGATGCAATAGGATTCATCGTGGAATGACTACTTGATATGGACAGTGAAAACT
TAAAACAAAGTACTAAAAACTTTTTTCTGCACTTTTCTTTTTGAGTTAGTTGGCACGGATGAGTTCTGTAGATTTTTCAGTTTCCTGCTCTTTGGCAGGC
CATGTTCCCAGTTGTCACAATAGCATCCATATGATATTCAAACTCTATTTCTTTGAAGGTTGATGATGTGTATTAGTTTTTGATTTGATTTGTGATTAAT
TGTTTATTGGTAAGGTCTGTGTGGGATTACACGGAGTATATTGTTGTGATATTTATAAATGATTTCATCTGAAATTTTCTTCTAGTGTTCCATATTTCTA
GCTGTCCAAGGAGTTATGTGCTTCCCTATATGCTAAATGATGATCTTCATACAGTTTGATAGAGAGCCAAGCGTGCTTATTGCAGTCTCTTTATTGTTGT
TATCGTGTTTAGAACACGTAGTGTTCTATGCTCCTCAAGCTAACATATACAGCCTTATTGGTTGACCTAATATGATTATTTACTGTAGTGAGGTTTTAAT
TTCAGAAGTTATCCTCATTTTACCTTCTGATATATATTATTTTATCTTCTTTGAGGTTTTATACTCTTAAACCTAATTTCTGTCATTCTGTAAACTTTTT
TTTTTCAGCAGGAGGTTGTAAGCAGATATGCCATCAGATACTGCAAGAAAAAATGCAGCTATAGCTAATTCCATAGTGACCGACTACAAAAATGAAAGAA
GGAATTTTGACGGACCAGGTAACTCTGATGCGAAATCTATTCAGAATTTAGCTATCTGTGTGGATTTTGTTTTGTTTGTATTTTTTTTTTTAGTAGTTTC
TACTGAGATTTGTTACAAGGTTTCGTTGAATGTGTCTGCATGACAAAGACAAGGATGTGGTCATTTACACTGCCCACAATTTAATATTGGTGCAAAAGTT
GTATGCTTCAAATAATCTTTTGGCTGGCTTTTCTATTCAACTGATGAGGAATGAGTATTCTTAAGCGTGTTAGGGATGGCAAAACAATTCCAGTCTTTTC
TACTTTGACGGGAGCTTCACTTGAGAATTAGAAAGAGCTTGCTGAATTTGATAGAAAGGAGGTCCACTAGTTAGTAATTAGTGATGCCATGAAGAGTTCT
AGTTACTTGCATGGTTTCTTGAGGCTGTAAGGTGGCTTGATATTATTAGGTCTTTCCACTAAACCACGAAAAAGTGAAACTAAGAGCCTGTTTGATTGGG
CTTATAGCTTTTGACTTATAAGCCAAAATCCGTAAGTTAGGAGTTCTAACTTATGCTTTTGGCTTTTTTTTTTCCTATTTGGCTTAAGAAACTTAAAAAC
ACTTTTTTATTTTACCCAAACACTACAAAAATGCTTAATAACACTTGAAATAAGTCAATCCGAACAGGCTCTAAATCTTTTCATAATTCAATTATGCGTG
TTGTTCATTTGTATGAACAGTCATGGCTGTCTTTGAGATTGTGTAGAACAGTGTTGTGAAAAGCGCGCTTCAAAGCGAGGCGACCCATGTGCGCTTTTTT
ATCTTGAGGCGAGGCGATCTGAAAAAAGCTCTCGCTTCAGATGAAGAAGCGAGAAGCGACCCTAAGGCAAAAGCGCAATAAAGCGCGCTTTTTATAAAAA
AAAGCGACAATTAGGGTTTTTTTTAAAAAAAAAAATTTAGGTTTTTTTTTTAAAAAATAATCTGAAATATAACCTTCTTTCTCCTCGCGACTCTTCTTTC
ACGACTCTTTGCCTTCTTTCTCTCCTCACGACTCTTCTTTCACAATACTTCTTTCCCTTCTTTCTCTCCTGACGATCTCGACTGAGGCTGCCTCTCTCTT
CAACCTCCCGCGACTGCAGGTAACTTTTTGTTCATCTCTGTTTTAGCTAATGTTTATTAGTTCATCTCTATGAGTTCCTTTTCTCTTGAAATATTCAATC
TTCGCCTGTGCTTCATCTCTTCATCTCTCTGAGTTTCGACTACTCTAGTTTTTTCTTCTCTTCTCTTCTTTTCTTCATCTCTGCTACCTGCGCTGTTTTT
TTTTTTATTTTGTGATCAATCTAGCAGCCTTGTTGAAGAATAGGAGTTTGAATCTTTGTGATTTAATTATATTTTTTATTTTTTGCTTTATATGTTATGA
CTTATGAGTATTTTTGCCTATGTAATTTCTTTCAATCTAAGACTATATTACCTCTATTTAGTTGTTTAATATTTTTTTATTTTTATACTAAATGTCGCTT
TTTTTAAAAAAGCGCGCGCTTCGCTTCACGCTTCTGTGAAGCAAGCCGTCGTCGCTTTTTTCCGCTTCTCGCTTACCAAAACACTGGTGTAGAAGTTTCA
CACCCTCCATGAATTTGTATGCACAAAAGCAGAGATGGTTTAGATGCACAACTTTTATTCCCTCGAATGAATGTGACACTTCAAGTATCTTTTGGTTGGA
AATGCTATGAAGTTCATGGAGCAATTATATCATTTCAACACAATTTGTTGGAGAAACAAAGGGCAAAATCGAACTATAAATGTTACTTATTGATGAGAAT
AAACACTATGGTTTTTTCCTTTTCTTTTTGTGTTAAAACTCTGTTGTCAGCATCCTTTTCTAACATTCCATCAAGATTTTTGCCCTTGTCTCTAATTAGC
CTAATAGTTCTTTTTTTCCACATAATGTCCCTCTTGAGATGCCTTAACTTCTTCATAAGGACATAATCTGGACTTCCAGTTACTTGATAATTTTGCCCCC
GTTAATAAAATTACCTTATTCTATAAATAAATTAGTGACGATACAAGGAGTTCAGTTACTTGCATAGCTTATTGAGTATGTACAATCTGTCCTGGCCCCT
GTCAGCTACAATCTGGCTTGGCATTAATTTGTTTACAATGTTGTAAAAAAGACATGCGATTGTTGAGAAAGTTGAACCTACAAATTTATGGAGTACTTTA
CTTATTAAGAATTGGAATCCAATTTCACGCCTTCATAATGAACCTGTGGTGTACATAAAGTTTAGAATCTAATGATAAAACTTTCAACCTGTTGTCTTAT
TGGATTTTAATATTGCAAATCCTCATAGATACCGTGTAGCATTTTTTGATGATCAGTGTTCAGGATCAGGAGCTAACTCCGTTTTTTTGAAATAGGTAAC
TTTGTATTATATCACAAAACAGTACATGGGTTGTACTGAAATCATTATATACAATTGTCTCCTTTTCCGCTTGTTTCAGTCTTTATTGAGCCTAAAACAA
CAATTGCCAATACAATGTCATTAGAGTATACCTGATTACACCAAAAACATAACAATAAAATGCTGTTTAACTTGACTTTCTGGACATAACAATAAATTGT
AGTTTAACTTGACTTTTGTAATTATTACGTAGAAAATTCGCAGAAATAGGCTGTGTGCTCATTCATTTTCTTCTGAAAAATGTTTTGAGTTGTTGGAACT
TGATGATTGAGTTTCTATGAACAAACAGTTCGAGTTAATTCCTATGCTTGCTATATTGTTTTGGTTGTGAATAATGCTTATTTTTCTTTACTGTGAGTTG
TTTAGTATTTTCTGGGCTGTTATATATGCGAATCATCATAGATATCGTGTAGCATCCTTGACGATCAGTGTTCAGGAGCAAACTCCATTTTGTATAATTT
CTTGTTAAATTCAACATCTCTCGACTGTAACCTTTATGAAGTTTCACGCTACCTGATCACAGGAATAAAAATTAAATAGAAGATATCTTGTAGCTTCGTT
GTCCTTGACATGAATGTAGTGGTTAAATGATAAGTATATGAACTACTATATGCTGGTACATCAAAATGATTCAAATTTGAATATGGACTCTTCTCTCAGA
TAGTTCATGCCTCAGAGTAAATGAGGATACCAATCGTTCTATAGCAGAGGAGCTCACACTTTCATCTCCGCCGATTGGAATTTCAACTGCAATTGAAAAG
GGTAAACTCTATAGCATAAGATATTTTGTAATCAAGAGTTTGAACCATGAAAATATCCAATTATCAGTAAACAGAGGGATTTGGGCTACTCAAGCCATGA
ATGAGGCCATTTTGGATGAAGCATTTCATGTAAGTCGATTTTCCTTTTATATCCCATGATTATTATAATATAATGCCCATCTGTAATATATATATGCATA
TAATCTTAAATACAACAAATGATTGTGTTTATTTTGGGAGCAGAATTCCAGCAAGGTTATACTAATATTCAGTGTCAACACTAGTGGGTATTTCCAAGGG
TATGCCCAAATGATTTCTTCTGTCGGTTTGAGAAGAGACCAAGTTTGGAGTCAAGGAAATGGTGGTCGTAATTCTTGGGGTCGAAGCTTTGAAGTGAATT
GGCTGCGATTGTATGATCTGCCTTTTCAAAGAACTCTTCACCTTAAGAATCCATGGAATCAAAACAAACCAGTCAAAATTAGTAGAGATTGTCAGGCATG
GGTTATATTCTTGTCTTAGTACTATTCACTTAATTTTTCAATGTACTCTTGTTAGTAGAGAGGCTTTTATGACCCTGGTACATGTATTGCTAACAGGAGT
TACCTCCAGATATTGGTGAAGCTTTATGTGAGCTCCTTGATGGACAGGATGCTTTGGATGTTAATTTGAAAATGTATAGCTCTTTCCTTGAAAACTTAAA
TAGTGCCCGTTCCATTATTTGGAAACATACAGCCTTTTTTCAAAATTGAATTAGTGCTAGAGTTGTGGAAAAATTGGTCCAAATGATTTTTCTCTTTACA
ATTGTTATTGGCTCATCCAGGGATGTCTTTGCAAGGAATGAGCTCTCTTCTAAAAGGCCATATGTAGAGCCTTCACTGCATCTTGGAGATCAAGACTATA
ATGCATCTCTGATACCTAATGGGACCATGTTTTCACCCTCTTTACTCTACCAACATCAAATTGATGCTAGTAGACTTCACGTAGCACCTCTGAGAATTAA
TGGTGTATTTTCTGCTGAGGAGTCAGCCATTGCATCAGGGGAATCAAAGTCGGGACAGTCGAGGCATTCACAGAGGAATAGAAGCTTTGCTAATCTCCAT
GTAGACACTGACATGGGTCCTCAAATTAACATGTGGGGCTTGCCGGCAGAAAGAAGCCCACTGGCTAGTAATTTGACTGAAGATGACATTCTTGAAATGG
TTTGTGTTTCCTGTCTTACCATTATTTATTAGAAGTTCCCTTCTTACCCTTAATTTTTAATTATTGTTGCACAAAGGTCAAAAGGATTGTTCCTGTATTT
GTCCAGAAGATGAAATACTCTTTTGTACTCTCTCAAAGTTTGCTGATGATTTCAGTTTTCAGCCAAGAAAGCTTATTTCTCTTTTCTGACTATTTTGATA
TCTAGCGTCCTCCTTTTCTTTGAATGCATATGAATCTGTACTTTGTGTGCATTTATACAAAAATGGTTATCTATTGTTGAAGGCATATGCCAGAAATTGC
CCAATTCAGTAATTTTTAACTTACAAGCCCTTCACCAGATTTCTTGATACTGGACCATGTATCATCTGATTCTTTCTGTAGTTAGACTTTCAAATCTTCT
GTTTGTATGATAAGACTCACAGGTTTGGACTTACAATTCCTTAAACAAATGCACATCTATTGAACCTTGATACCATTAATTGTATTACTTTATTATCATT
AAGTATCAAGGTGTTTGTTTAAATCAAACTTCGTAGCAAAATGGTTTATAAGATTTTAGTTTAATTTCTAACTTTACATGAATCCTTGTTGTCTTAGAAG
TCAATGTAAGTCCTTTTTCATTGAGTAATACTTCCTGCGGGTATAGAAATAAATGGTTTATAAGATTTTAGTTTATTTTCAATAGTAGATTGGAAAGTTA
TCAGGTTATTCACATCCAAGGGTGTGTGACCTGGTGGTCAATGAAGTGGGCTGAGAACTATGATGTCTCAAGTTGAATACCCAACAGAGGTAAAAACTAG
GTGATTTCTACCTCAACAGAGTTACCTGGTAGCCGTACCTATGCTGCTGGTGGAGTCCGCAGGTATCTAGTGGGATTAGTCAAGGTGCACACAAGCTGGC
CGGACACCACCAGTTATAAGAAGTTATTAGGTTATTCCTATTTTATGGGTGAAGTTTTTCTTCTTCTTTGGTGCTTTATGCACCTTGACAAAGGTGCTAG
TCTAAGGAAATGCTAGGTGGGATTCGTAGACATTCTTCTTCTTTACATTTGCCCCCTACCTCCCATTAAGTAACACACACACACCAGCAACTTCTCTCTT
TCCACCTCTCTTGCATGGCTGCTATTTAAGGCCTTCTGACTCATATTGTCTCTTAGACTGCTGCATTATTGATATTTTCAAGACACTACAGTTCTTATGT
TCTTAATACATCATATTTATTCACCTGGCTCCTAGCTATGAACTTAGCAGGTTCCATATTCTCTGTCCTTGCCGAATTTAGTTTGAAGAATTTTTTTTAA
CAAGTGTAATACTTCTTGAACCACATGTTGTAGCTGTTAGACCTACCAGCAAATCATGTTGCCATGATTAAGATATTACTGTAAACTTGCTGTTCATACT
CTTTTCTCTTGTTGTAGACATATGAAGAGTATCTTGAAGCTTGTAGCAGAGGCAGCAAAAGATCGCCCCACCCTGTTAGTAATCTTTGACATTTTTTATG
TTATATATTCCTGTATTATCGAATAAACTCATGAACCATGCTCTGTTGGGTTGGATTTTGAACTGTAAAAAGTTTACCTTTATCCTTTTAGTTAATCTAT
GTTCTGGAAAATCTATTCTAATTTTCTTTCTTTACGGAGAAAAGCTTGTAGCATTTAGCATTTCCTCATAGTGCTATAAGCAAGAGATGGTTAGCTCAAT
TGAGGAATTTGTGTCTAAGTATCAAGTTTGAACCTTGCACCTAGTGAACTAAGTCTAGTATTTAAGTGGAGAAGGACAGAGGGGCGGGTCCATCATCTCC
GGGTTTTGAAACTCACGGACGCCCAAACTGTTGGCTCCAGATGAACTTCTTGTTCATAAAAAACTTGGGGCGACTCCCATCCCTCTTTTTTCTCCATGCT
ATCTAGTTTTTTCTCCATGCTATCTAGTGGTTGATGATCTAAATGTGGTTGGTTCTTTGGGTGAAGTATTGTGATAAATTCATGTGCTATAGTTAGGGTC
CTCGAAATTTCAGTTTCTGTTCTACTCTTTAGCATGATGTGAGTCTTCGGTATCTACCATTTCACTACCCAGGCATCTTTAACGTGAATCACATTCCATG
AATATGATATCTATCTAGTTTTGTTGATGACATTTCCTTTTCTTTTCTCTAGCATGATTAAGTGGTTCATTAATGTATTTAAACTCGGTTTTTGAAAGTG
CTCTTGTTCGATATATGTATCTGTGGGTGTTTCTTAGTGTTGATATCCATGACTTGCACACAGATTTTTAAAGAATCTTTCGCTAGAAAGGATTCTGAAT
AAAACGTCAGGTTTCCATTATGCAATTAGTTACCTCTCTTTATCTAGGTTTCAGGACCATCACGGAGTACACAGAGGTCATTAGCCAGTCAAGAAAACTG
TGAAGATTCGTAAGTTTTTTTACTTCTCATTTCCAACACACTTGGGATGCAACGAACCAGCTGAGTGACCTATATCTATTATCTTTGCAGGCAATCAGGT
CGCAGTTCAAAGAAAAGGAGAGGTCACTAAATCTCCCCATTGGTTGAATTGGTTTTCTTGGCGAGCAGGCTGATATGGTTGATAATTGTATTGTTGCAGT
TGTCGCGAAGTGGTGGTTCTTGCGAAATTGTTTCTTTATTTTTGTAAAACTTAAAACTTAAAACTTAGGAGCATATATTGCTATAATGTTGGAGTATATC
TGTACTGTATTATATGACCCTCTTGTCACCCTTCTCTCCTTCCTGTTTTCGAATGGAAACTTTTATACTGTTAATGGGAACTTGTACTGGAAATTAGCAA
GTCTCTCTATACTCATATATTCATTCTTGATTCAGTCAAGTACTGTATAGATCTTAATTTTTGGGATGGAGAGGAATCTTTCTTCTTCCTTGTTTTCCTT
GTGATGCTACTTGTTATTCTTCAACGTCATTTTAATGGTCTATCAAATATGTATATTCACGTTCGAGTTCTAGGTATGAAAAAATCATGTGTGTCCGTAA
TAGTTGAGGATTAGTGTGGTTATCGAACACTAGATGGGAAATAGATATTCGGAGGAAGACTAGTCTTTGAGAGTTTTCAACACTGATGAATTGCTCTTGG
GGTTGTGGTCTGCCTTAAAAGACAACATGTTGGATATCAAAATAGTGTTAGATAGTTTGTAATATATAAATACATGTCTGTTTGTGATGGAGTATGATTA
CTTTGAAAAGTTATTTTATGATTATAAGAACTCTTGAAGTACTATAAAAAAATAATATTTAGATATAAACACGTTTTATTTTATTTTGAAGGAGAATTGA
TTGTATTTTTCTGATTTTGTATTCGAAAAATATATCTTAGAAAGTTATGTGATGATATGAAATACTCACTCTTAATTCCGCTTCCACCTTACATTGGTAT
CAAAGCTAGATAATCAAAACTAGAACTATGGAAAACAAATCAGAAGCAACAAATCTACAGAAACAGGTATACACATTTAAGTTCATGAGTAGCTAAACTA
ATTTATTCCTGATAATCTCTTGTTGATTATAATTGTTTATCATGTTTTAATAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTGCG
AATAAGTATGCCCAGACTATACCATCCTAAAGTTGAAACCAATAGGCAAGAAGGTCGTTTAGGGGAGTAAACAAAGTTGAGGCGCTGTTAGGGTAACTAA
TCAAAGAAGAAAACTGTAGTAGTGACCAGACGAGATGATTATTAAACAATTATTATTACATAATAAATAAGTATAATCCATTGAGAGGTTGGAAGGAATA
AAATCTTTAGCGAACAAATGAATAAAATGAACTCCTATTTATTAGATGATGATGTTAATTACAAAACATTAATACTCTATATATTAAAAGATCTTAATAC
AGATATAAAAAGAGAAATTTATGATATGTTGGTAACATATGAAGTAATAGAAGTAACAACCCAAGGTTGGACTAAATTAGATATACAAAATGATTTTTAT
GACGAATTTTATAGCACACCATTTTTTGGGTGATCCGGATTTCGACGTCAAAAATGCCAAAGTTTTTCGTGGACGTCCGTCAAGACCATGTCTATGCATA
CGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCCCATTTCGACGATTTTCGTGTGCTATAGCACAC
CATTTTTTGGGTGATTCGGATTCCGATGTCAAAAATGCCAAATCTTTTCGTGAACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTT
GTCCGACCCATTTGGAAGGTCAAACGAGCTCCGAAGCGAGCATACCCCTCATTTCGACTTTTTTAGTGTGCTATAGCATACCATTTTTTGGGTGATCCGG
ATTCCGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAGG
TCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGATGTCAAAAATGC
CAAATTTTTTCGTGGACGTCCGTCAAGACCTTGTATATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACAAGCCCCGAAGCG
AGCATACCCCTCATATCGATGATTTTCATGTGCTATAGCAAACCATTTTTTGGGTGATTTAGATTCCGATGTCAAAAATACCAAATTTTTTCGTGGACGT
CCGTCAAGACCTTGCCTATGCATACGGTTGGCTATCACGGCTTGTCTGACCCATTTGGATGGTCAAACGAGCCCCGAAGTGAGCATACCCCTCATTTCGA
CGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCTGGATTCCAACGTCAAAAATGCCAAATTTTTTTGTGGACGTCCGTCAAGACCTTGTCTAT
GCATATGGTTGGCCATCACGGATTTTCCGACCCATTTGAAAAGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAG
CACACCAATTTTTGGATGATCCGGACTCCGACGTCAAAAATTCCAAAAATTTTTGTGGACGTCCGTAAATACCTTGTCTATGCATTCGGTTGGCCATCAC
AGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCTGAAGCGAGCATACCCCTCATTTCGATGATTTTCGTGTGCTATACCACACCATTTTTTGGGTGA
TCCGGATTCTGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCCGTCAAGACCTTCTCTAGGCATACGGTTGTCCATCACGGCTTGTATGATCCATTTG
GAAGGTCAAACGAGCCCCAAAGCGAGCATACCCCTAATTTCGACGATTTTCATGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACATCAAA
AATGCCAAATTTTTTTGTGGACGTCCGTCAAGACCTTGTCTATAAATGCGCTCTGCCATCACGGCTTGTACGACCCATTTGGAAGGTCAAACGAGCCCCG
AAGCGAGCATACCCCTCATTTCGACGATTTTCGTATGCTATACCACACCAATTTTTGGGTGATCCGGATTGCGACGTCAAAAATTCCAAAAATTTTTGTG
GACGTCCGTAAATACCTTGTTTATGCATATGATTGGCCATCACGGCTTGTCCGAACCATTTGGAAGGTCATACGAGCCCCGAAGCGAGCATACCCCTCAT
TTCAATAATTTTCGTGTGCTATAGCACACCTTTTTTGGGTGATCCGGATTCCAACGTCAAAAATGCTAAATTTTTTCGTGGACGTCCGTCAAGACCTTGT
CTATGCATACGGTTGGCCATCGCGGCTTGTTCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTGATAATTTTCGTGTGCTA
TAGCACACCATTTTTTGGGTGATCTGATTCCGACGTCAAAAATGCCAAATATTTTCGTGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATC
ACGGCTTGTCTGACCCATTTGGAAGGTCAAACGAGCCTCGAAGTAAGCATACCCCTCATTTTGACGATTTTCGTGTGCTATAGCACAACATTTTTTGGGT
GATCCAGATTCCGACGTCAAAAATGCAAAAAAATTTCATTGACGTCTGTCAAGACCATGTATATGCATACGGTTGTCCATCACGGCTTATACGACCCATT
TGAAAGGTAAAAGAGCCCCGAAGCTAGCATACCCCTCATTTCGATGATTTTCGTGTGCTAGCACACCATTTTTTGGGTGATCCCTATTCCAACGTCAAAA
ATGCAAAAGTTTTTCATGGACGTCCGTCAAGACCTTGTCTATGCATACGTTTGGCCATCACGGCTTGTCCGACCCATTTCAAAGGTCAAACGAGCCACGA
AGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAACACAACATTTTTTGGGTGATCTAGATTCCGACGTCAAAAATTCCAAATTTTTTCATGG
ACGTCAGTCAAGACCTTGTCTATGCATACGGTTTGCCATCACTTCTTGTCCGATCCATTTGGAAGGTCAAACGAGCCCCGAACCGAGCATACCCCTCATT
TCGATGATTTTTGTGTGCTATAGCATACCATTTTTTGGGTGATCCGGATTCCGATGTCAAAAATGCCAAAATTTTTTGTGGACGTCCTTCAAGACCTTGT
CTATGCATACGGTTGGCCATCACGGCTTGTCCGATCTATTTGAAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTCGACGATTTTCGCGTGCTA
TAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATACCACATTTTTTGTGGACGTCCGTCAATACCTTTTCTATGTATACGGTTGGCCATC
ACGGCTTGTATGACCCATTTGGAAGGTCAAACAGGCCCCGAAGCGAGCATACCCCTCATAATACGATTTTCGTGTGCTGTAGCACACCATTTTTTGGGTG
ATCCGGATTCAAACGTCAAAAATGCCAAATTATTTCGTAGACGTCTGTCAAGATCTTGTCTATGTATACGGTTGGCCATCACGACTTGTACGACCCATTT
GGAAGGTCAAACGAGCCCTGAAGCGAGCATACCCCTCATTTTGATGACTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCTGACGTCAA
AAATGCCAAATTTTTTCGTGGACATCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAGGTCAACCGAGCCCC
AAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACATCATTTTTTGGGTGATCCGGATTCCGATGTCAAAAATGCAAAAGTTTTTCGT
TGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGTCCATCACGGCTTGTACGACTTATTTGGAAGGTAAAAGAGCCTTGAAGCGAGCATACCCCTCAT
TTCGATGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCAACGTCAAAAATGCCAAATTATTTCGTGGACGTCCGTCAAGATCTTG
TCTATGTATACGGTTGGCCATCACGACTTGTACGACCGATTTGGAAGGTCAAACGAGCCCTGAAGCGAGCATACCCCTCATTTTGATGATTTTCGTGTGC
AATAGCACACCATTTTTTGGGTGATCCGGATTCTGACTTCAAAAATGCCAAATTTTTTCGTGGACATCCGTCAAGTCCTTGTCTATGCATACGGTTGGTC
ATCACGGCTTGTACACCCATTTGGAAGGTAAAAGAGCCCCGAAACGAGCATACCCCTCATTTCGATGATTTTCGTGTGCTATAGCACACCATTTTTTGAG
TGATCCGGATTCCGATGTCAAAAAAGCCAAATTTTTTCATGGACGTCCGTCAAGACCTTTTCTATGTATACAGTTGGCCATCACGACTTGTTCGACCTAT
TTGAAGGGTCAAACGAGCCTCGAAGCGAGGATACCCCTCATTCGACGATTTTCGTGTGCTATAGCACACAATTTTTTGGGTGATCCAGATTCCGACGTCA
AAATGCCACATTTTTTTGTGGACGTCCGTCAAGACCTTTTCTATGTATACGATTGGACATCACGGCTTTTCCGACCCATTTGGAAGGTCAAACGGGCCCC
AAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCAACATCAAAAATGTTAAATTTTTTCGT
GGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGACATCACGGCTTATCCGACCTATTTCGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCA
TTTCAATGATTTTTGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGTCAATTTTTTTCGTGGACTTCCGTCAAGACCTT
GTCTATGCATACGGATAGCAATAACGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGTATACCCCTAATTTCAACGATTTTCGTGTG
CTATAGCACACCATTTTTTAGGTGATCTAGAATCCGACGTCCAAAATTCCAATTTTTTTCGTGGACGTCAGTCAAGACCTTATCAATGCATTCGGTTGTC
CATCACGTCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCAAAGCGAGCATAACCCTCATTTCGACGATTCTCGTGTGCTATAGCACACCATTTTTT
GGGTGATCCAGATTCTGACGTCAAAAATGTCAAATTTTTTCGTGGACGTCCGTCAAGACCTTGTCTACGCATATGGTTGGCCATCACGGCTTGTACGACC
TATTTGAAAGGTCAAACCAGCCCCGAAGCGAGCATACCCCTCATTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGAATTCCGATG
TCAAAAAAGCCAAATTTTTTCATGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACGAATTTCAAAGGTCAAACAAG
CCCCGAAGCGAGCATACCCCTCATTTTGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCTAGATTCCGACGTCAAAAATTCCAAATTTTT
TCGTGGACGTCAGTCAAGACCTTGTCTATGCATACGGTTGGCCATCATGTCTTGTCCGACCCGTTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCC
CTCATTTCGACGATTTTTGTGTGCTATAGCACACCATTTTTTGGGTAATCCGGATTTCGACGTCAAAAATGTCAAATTTTTTCGTGGACGTCCGTCAAGA
CCTTGTCTACGTATACGGTTGTCCATCACGGCTTGTTCGACCTATTTGAAGGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTCGACGATTTTCGT
GTGCTATAGCACACTATTTTTTGGGTGATCCAGATTCCGACGTCAAAAATGCCACATTTTTTTGTGGACGTCCGTCAAGACCTTGTCTATATAAACGATT
GGCCATCACGGCTTTTTCGACCCATTTGGAAGGTCAAACGGGCCCCAAAGCGAGCATACCCCTCATTTTGACGATTCTCGTGTGCTATAGCACACCGATT
TTTGGGTGATCCGGATTTTGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCGGTCAAGACCTTGTCTACGCATACGGTTGTCCATCACGGCTTGTACG
ACCTATTTGAAAGGTCAAACCAGCCCCGAAGCGAGCATACCCCTCATTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCG
ATGAAAAAAAAGCCAAATTTTTTCATGTACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGAAGAATTTCAAAGGTCAAAC
GAGCCCCGAAGCGAGCATACCCCTCATTTTGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCTAGATTCCGACGTCAAAAATTCCAAATT
TTTTCGTGGACGTCAGTCAAGACCTTGTCTATGCATACGGTTGGCCATCATGTCTTGTCCGACCCGTTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATA
CCCCTCATTTCGACGATTTTTGTTTGCTATAGCACACCATTTTTTGGGTAATCCGGATTTCGACGTCAAAAATGTCAAATTTTTTCGTGGACGTCCATCA
AGACCTTGTCTACGTATACGGTTGTCCATCACGGCTTGTTCGACCTATTTGAAGGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTCGACGATTTT
CGTGTGCTATAGCACACCATTTTTTGGGTGATCAAGATTCCGACGTAAAAAATGCCACATTTTTTTGTGGACGTCCGTCAAGACCTTGTCTATATATACG
ATTGGCCATCACAGCTTTTTCGACCCATTTGGAAGGTCAAACGGGCCCCAAAGCGAGCATACCTCTCATTTTGACGATTCTCGTGTGCTATAGCACACCA
TTTTTTGGGTGATCCGGATTTTGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCGGTCAAGACCTTGTCTACGCATACGGTTGGCCATCACGGCTTGT
ACGACCTATTTGAAAGGTCAAACCAGCCCCGAAGCGAGCATACCCCTCATTCGACATTTTTTGGGTGATCCAGATTCCGACGTAAAAAATGCCACATTTT
TTTGTGGACGTCTGACAAGACCTTGTCTATGCATACAGGTAGCCATCACGGCTTGTAAAACCCATTTGGAATGTCAAATGAGCCCCGAAATGAGCATACC
CCTCATTTCGACGATTTTCGTGTCCTATTGCACACCATTTTTGGGTGATCCGGATTCCGACGTCAAAAATTCCAAATTTTTTCTAAGACGTCCGTCAAGA
CCTTGTCTAAGCATACGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAGGTCAAACGAGCCCTGAAGCGAGCATACCCCTCATTTTGATGATTTTCG
TGTGCTATAGCACACCATTTTTTGGGTGATCCGAATTTTGACGTCAAAAATTCCAAATTTTTTCGTAGTCATCCGTCAAGACCTTGTCTATGCATACGGT
GGTCCATCACGGCTTGTACGACCCATTTGGAAGGCCAACCGAGCCCCAAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACAATT
TTTTGGGTGATCCAGATTCCAACGTCAAAAATGCCAAATTTTTTTGTGGACGTCCATCAAGACCTTGTCTATGCATACAGTTTGTCATCACGGCTTGTCC
GACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCACACCCCTCATTTGACGATTTTTGTTTGCTATAGCACACCATTTTTTAGTGATCCGGATTCCG
ACGTCAAAAATGCCAAATTTTTTCGTGGACGTTAGTCAAGACCTTTTCTATGCATACAGTTGGCCATCACGGATTGTACGACCCATTTGGAAGGTCAAAC
GAGCCCCGAAGCGAGCATACCCCTCATTTCAACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTTTGACGTCAAAAATGCCAAATT
TTTTCGTGGACGTCCGTCAAGACCTTTTCTATGCTTACAGTTGGCCATCACGGCTTGTCTGACCCATTTAGAAGGTCAAACGAGCCCCGATGCGAGCATA
CCTCTCATTTCGACAATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTTAAAAATGCCAAATTTTTTCGTGGACATCCGTCA
AGACCTTTTCTATGCATACGGTTGGCCATCACGGCTTGTCTGACCCATTTGGAAGGTCACACGAGCCCCCAAGCGAGCATACCCCTCATTTCGACGATTT
TCGTGTGCTATAGGACACCTTTTTTTGGGTGATCCGGATTTTGACGTCAAAAATTCCAAATTTTTTTTGTGGACATCCGTCAAGACCTTGTCTATGCATA
CGGTTGGCCATCACGGCTTGTACGACCCATTCGGAAGGTCAACCGAGCCCCGAAGTGAGCATACCTCTCATTTCGATGATTTTCAAGTGCGATAGCACAC
CATTTTTTGGGTGAACCGGATTCCGACGTCAAAAATGCCAAAATGTTTTCGTGGACGTCTATCAAGACCTTGTATATGCATACGGTTGTCAATCACGGCT
TGTAAGACTCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGTTATAGCACACCATTTTTTGGGTGATCCG
GATTCCGATGTCAAAAATGCCAAAGTTTTTCGGAAACATCCGTCAAGATCTTGTATATGCATACGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAG
GTCAAACGAGCCTCGAAGCGAGCATGCCCCTCATTTTGACGATTCTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTTTGACGTCAAAAATG
CCAAATTTTTTCGTGGACGTCCGTCAAGACCTTGTCTACTCATACGGTTGGCCATCACGGCTTGTACGACCTATTTGAAAGGTCAAACCAGCCCCGAAGC
GAGCATACCCCTCATTCGACATTTTTTGGGTGATCCAGATTCCGATGTAAAAAATGCCACATTTTTTTGTGGACGTCCGACAAGACCTTTTCTATGCATA
CAGTTGGCCATCACGGCTTGTAAAACCCATTTGGAAGGTCAAACGAGCCCCGAAATGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATTGCACAC
CATTTTTGGGTGATCCGGATTCTGACGTCAAAAATTCCAAATTTTTTCTTAGACGTCCGTCAAGACCTTGTCTAAGCATACGGTTGGCCATCACGGCTTG
TACGATTCATTTGGAAGGTCAAACGAGCCCTGAAGCGAGCATACCCCTCATTTTGATGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGAA
CTTTGACGTAAAAAATTCCAAATTTTTTCGTGGTCATCAGTCAAGACATTGTCTATGCATATGGTGGTCCATCACGGCTTGTACGACCCATTTGGAAGAC
CAACCAAGCCCCAAAGCGAGCATACCCCTCATTTCGATGATTTTCGTGTGCTATAGCACACAACTTTTTGGGTGATCCATATTCCAACGTCAAAAATGCC
AAATTTTTTTGTGGACGTCCATCAAGACCTTGTCTATGCATACAGTTTGTCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGA
GCACACCCCCTCATTTGACGATTTTCGTTTGCTATAGCACACCATTTTTTAGTGATCCGGATTCCGACGTCAAAAATGCCAAATTTTTTCGTAGACGTCA
GTCAAGACCTTTTCTATGCATACAGTTTTCCATCACGGATTGTACGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACG
ATTTTCGTGTGCTATAGCACACCATTTTTTGAGTGATTCGGATTTTGATGTCAAAAATGCCAAATTTTTTCGTGGACGTCCGTCAAGACCTTTTCTATGC
ATACAGTTGGCCATCACGGCTTGTCTGACCCATTTAGAAGGTCAAACGAGCCCCGATGCGAGCATACCCCTCATTTCGATAATTTTCGTGTGCTATAGCA
CACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGACAAATTTTTTCGTGGACATCCGTCAAGACCTTTTCTATGCATACGGTTGGCCATCACGG
CTTGTCTGACCCATTTGGAAGGTCACACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGGACACCTTTTTTTGGGTGATC
CGGATTTTGACGTCAAAAATGCCAAATTTTTTTGTGGACATCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTACTACCCATTTGGA
AGGTCAACCGAGCCCCGAAGTGAGCATACCTCTCATTTCGATGATTTTCGAGTGCGATAGCACATCATTTTTTGGGTGAACCGGATTCCGACGTCAAAAA
TGCCAAAATGTTTTCGTGGACGTCTATCCAGACCTTGTATATGCATACGGTTGTCAATCACGGCTTGTAAGACTCATTTGGAAGGTCAAACAAGCCCCGA
AGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTATTGGGTGATCCGGATTCCGATGTCAAAAATGCAAAAGTTTTTCGGGA
ACATCCGTAAAGATCTTGTATATGCATACGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAGGTCAAACGAGCCTCGAAGCGAGCATACCCCTCATT
TGACGATTTTCGTTTGCTATAGCACACCATTATTTGGTGATCCGGATTTCGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCAGTCAAGACCTTTTCT
ATGCATACAGTTGGCCATCACGGATTGTACGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCAACAATTTTCGTGTGCTAT
AGCACACCATTTTTTGGGTGATCCGGATTTTGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCCGTCAACACCTTTTCTATGCATACAGTTGGCCATC
ACGGCTTGTCAGACCCATTTAGAAGGTCAAACGAGCCCTGATGCAAGCATACCCCTCATTTCGACAATTTTCGTGTGCTATAGCACACCATTTTTTGGGT
GATCCGGATTCCGACGTCAAAAATGCAAAATTTTTTCGTGGACGTTCGTCAAGACCTCTTCTATGCATACGGTTGGCCATCACGGTTTGTCCGACCCATT
TGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACAATTTTTTGGGTGATACGGATTCCGACGTCA
AAAATGCAAAATTTTTTCGTTGACGTCCGTCAAGACCTTGTATATGCATACGGTTGGCCATCACGTCTTGTAAGACCCATTTGGAAGGTCAAACGAGCCC
TTAAGCGAGCATACCCCTCATTTCGATGATTTTCGAGTGCGATAGCACACCATTTTTTGGGTGAACCGGATTTCGACGTCAAAAATGCCAAAATGTTTTC
GTGGACGTCTATCAAGACCTTGTATATGCATACGGTTGTCAATCACGGCTTGTAAGACTCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGAATACCCCT
CATTTCGATGATTTTCGTGTGTTATAGCACACCATTTTTTGGGTGATCCAGATTTCGAAGTCAAAAATGCCAAATTTTCTCGTGGACGTCAGTCAAGACC
TTGTCTATACATATGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAAGTCAAACGAGCCCCGAAGCGAGCATGCCCCTTATTTCGATGATTTTTGTG
TGTTAGCACACCATTTTTTGGGTGATCCGAATTCCGAAATTAAAAATGTCCAATTTTTTCGTGGACGTCCGTCAAGACCTTTTCTATGCATACGGTTGGC
CATTACGGCTTGTCCGACCCATTTGGAAGGTCAAACAAGCCCTGAAGCGAGCATACCCCTCATTTCAACGATTTTTGTGTGCTATAGCACACCATTTTTT
GGGTGATCCGGATTCCGACGTTAAAAATGCCCAATTTTTTTCGTGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTACGAC
ACATTTGGAAAGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGATGATTTTCGTGTGCTATAGCACACAATTTTTGGGTGATACGGATTTCGAC
GTTAAAAATGCCCAATTTTTTGTGGACGTCTGTCAAGACCTTGCCTATGCATACGGTTGGCCATCACGGCTTGTAGGACCCATTTGGAAAGTCAAACGAG
CCCCAAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCAACGTCAAAAATACCAAATCTTT
TCATGGACGTCCGTCAAGACCTTATCTATGCATACGATTTGCCACCACGGCTTGTATGACCAATATGGAAGGTTAAACGAGCCTCGAAGCGAGCATACCC
CTCATTTCAACTATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCTGACGTCAAAAATGTAAAAAAATTTCGTGCCAAGTGTCAAGAC
CAGGTATATACATATGGTTGGACATCACGGCTTGTCTGACCCATTTGGAAGGTCAAACGATCTCCGAAGCGAGCATATTCCTCATTTCGACGATTTTCGT
GTGCTATAGCACACCATTTTTTGGTGATCCGGATTCCGACGTCAAAAATGCCAAATTTTTTCATGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTG
GCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCTCGAAGAGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTA
TTGGGTGATCCGGATTCTGACGTCAAAAATGCCAAATTTTTTTGTGGACATCCTTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGATTGTTCGA
CCCATTTGGAAGGTCAAACAAACCACGAAGTGAGCATAACCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTAGGGTGATCCTTATTCCG
ATGTCAAAAATGCCAAATTTTTATTGGACGTCCGTCAAGACTTGTCTATGCATACGGTTGGCCATCACGGATTGTACGATCCATTTGGAAGGTCAAATAA
GCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGTTATAGCACACCATTTTTTGGGTGATCCAGATTACGACGTCAAAAATGCAAAAAATT
TTCGTGGACATCCGTCAAGACCTTGTCTATGTATAAGGTTGGCCATCGCGGCTAGTCCGAATAATTTGGAAGGTCAAACGAGCCCTGAAGCGAGCATACC
CCTCATTTCAACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGCCAAATTTTTTCGTGGACTTCTGTCAAG
ACTTTGTCTATGTATACGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCATCATTTCGATGATTTTC
GTTTGCTATAGCACACCATTTTTTGGGTGATCTGGATTCTGACGTCAAAAATGCAATTTTTTTTCGTGGACGTCCGTTAAGACCTTGTCTATGCATACGG
TTGGCCATCACAGTTTGTCCGACCAATTTGGAAGGTCAAACGAGCTTCGAAGCGAGCATACCCCTCATTTTGACTATTTTCGTGTGCTATAGCACATCAT
TTTTTGGGTGATGCGGATTCCGACGTCAAAAATGCCAAATGTTTTCCTCGACGTCCGTCAAGACCTTGTATATGCATACGGTTGTCCATCACGGCTTGTA
CGACCCATTTGGAAGCTCAAACGAGCCCCAAAGCGAGCATACCCCTTATTTCGACGATTTTCGTGCACTATAGAACACTATTTTTTGGGTGATCCGGATT
CCGACGTTAAAAATGCCAAATTTTTTTGTGGATATCTGTCAAGACCTAGTATATGCATACGGTTGGCCATCACGGCTTGTCCGATACATTTGGAAGGTCA
AATGAGCCCTGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGCTCAGATTCCGACGTCAAAAATGTCAAT
TTTTTTCGTGGACGTCCGTCAAGACCTTTTCTATGCATACAGTTGTCCATCACGGCTTTTCCGACCCATTTGGAAGGCCAAACGAGCTCCGAAGCGAGCA
TACCCCTCATTTTGATGATTTTCGATTGCATGGCACACCATTTTTTGGGTGATCCGGATTACGATGTAAAAAATAGCAAATTTTTTTGTGGACGTCGTTC
AAGACCTTGTCTATGCATACGGTTGGCCATCATGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCAAGCATACCCCTCATTTCGACGATT
TTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCTGACGTCAAAAATGCCAAATTTTCTCGTGGACGTCCATCAAGACCTTGTCTATGCATG
CGGTTGGCCATCACGGCTTGTCCGCCCCACTTAGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTTATTTCGACGATTTTTGTGTGCTATAGCACAC
CATTTTTTGGGTGATTCGTATTCTGACGTCAAAAATACCAATTTTTTTCGTGGATGTCCATCAAGACCTTGTCTATGCATATAGTTGGCCATCACGGTTT
GTACGACCCATTTGGAAGGTAAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACAATTTTCGTGTGCGTAGCACTCAATTTTTTGGGTGATCCGGA
TTCTGACGTCAAAAATGCAAAAAATTTTCGTGGACGTCCATCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTTTTCGACCCATTTTGAAGGT
CAAACGAGCACTGAAGCGAGCATACCCCTCATTTCGATGACTTTTGAAGGATTCCGACGACAAAAATGCCAAATTTTTTCCTGGACGTCTGTCAAGACCT
TTTCTATGCATATGGTTGGCCATCAAGGCTTGTACGACCCATTTGGAATGTCAAACGAACCCCGAAGCGAGCATACCCTTCAGTTCGATGATTTTCATGT
GCTATAGCACACCATTTTTTGGGTGATCTAGATTCTGACATGAAAAATGCCAAATTTTTTCATGGACGTCCGTCAAGACCTTGTATATGCATACGGTTGG
CCACCACGGCTTGTCCGACCCATTTGGAAGGTCAAACAAGCCCTGAAGCGAGCATACCCCTCATTTCAACGATTTTTGTGTGCTATAGCACACCATTTTT
TGGGTGATCCAAATTCCGACGTTAAAAATGCCCAATTTTTTCGTGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTACGAC
CCATTTGGAAAGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGATGATTTTCGTGTGCTATAGCACACAATTTTTTGGGTGATACGGATTTCAA
CGTTAAAAATGCCCAATTTTTTGTGGACGTCTGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAAGTCAAATGA
GCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGTACACCATTTTTTGGGTGATCCGGATTCCAACGTCAAAAATACCAAATCTT
TTCATGGAAGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGTTCAAACGAGCCTCGAAGAGAGCATACC
ACTCATTTCAACTATTTTCGTGTGCTATAGCACACCATTTATTGGGTGATCCGGATTCTGACGTCAAAAATGCCAAATTTTTTTGTGGACATCCTTCAAG
ACCTTGTCTATGCATACGGTTGGCCATCACGGATTGTTCGACCCATTTGGAAGGTCAAACAAACCCCGAAGCGAGCATAACCCTCATTTCGACGATTTTC
GTGTGCTATAGCAGACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGCAACAAATTTTTGTGGACATCCGTCACGACCTTGTCTATGCATACGG
TTGGCCATCATGGCTTATCCGACCCATTTGGAAGGTCAAACGAGCCCCAAAGCGAGAATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCAT
TTTTTGGGTGATCCGGATTCCGACGTCAAAAATGCCAAATTTTTTCATGGACGTCCGTCAAGACCTTGTCTATGCATGCGGTTGTCCATCACGGCTTGTC
CGACCCATTTGGAAGGTCAAACGAGCCTCGAAGCGAGCATACCCGTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTATTGGGTGATCCGGATT
CTGACGTCAAAAATGCCTAATTTTTTTGTGGACATCCTTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGATTGTTCGACCCATTTGGAAGGTCA
AACAAACCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTTGTGTGCTATAACACACCATTTTTGGGGTGATCCGGATTCCGACGTCAAAAATGCAAA
AAAAATTTGTGGACATCCGTCACGACCTTGTCTATGCATTCGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAGGTCAAATGAGCCTCGAAGCGAGC
ATACCCCTCATTTCGACGATTTTCGTATGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCTTGAGTCAAACAATCCAAATATTTTCGTGGACGTCC
ATCAAGACCTTGTCTATGCATACGGTTGTCCATCACGGGTTGTACGACCCATTTGGAAGGTCAAAAGAGACCCCAAAGCGAGCATACCCCTTATTTCGAC
AATTTTTTTGTGCTATAGCACACCATTTTTTGGGTGATTCGTATTCCGACGTCAAAAATGCCAATTTTTTTCGTAGATGTCCATCAAGACCTTGTCTATT
CATATAGTTGGCCATCACGGTTTGTACGACCCATTTGGAAGGTAAAACGAGCCCCGAAGCGAGCATACCCCTTATTTCGATGATTTTCGTGTGCATAGCA
CACAATTTTTTGGGTGATCGGGATTCTGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCCATCAAGACCTTGTCTATGCATACGGTTGGCCATCATGG
CTTTTTCGACCCATTTTAAAGGTCAAACGAGCCCCGAAGTGAGCATATCCCTTATTTCGATGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATC
CGGATTCCGACATCAAAAATGCCAAATTTTTTAGTGGACATCCGTCAAGACCTTGCCTATGCATACAATTGGCCATCACGGCTTTTTCGACCCATTTTGA
AGGTCAAACGAGCACTGAAGCGAGCATACCCCTCATTTCGATGATTTTTGAAGGATTCCGACGACAAAAATGCCAAATTTTTTCCTGGACGTCTGTCAAG
ACCTTTTCTATGCATATGGTAGCCATCAAGGCTTGTACGACCCATTTGGAAGGTCAAACGAACCCCGAAGCGAGCATACCCCTCAGTTCGATGATTTTCG
TGTGCTATAGCACACCATTTTTTGGGTGATCTAGATTCCGACATGAAAAATGCCAAATTTTTTCATGGACGTCCGTCAAGACCTTGTATATGCATATGGT
TGGCCACCACAGCTTGTCCGACCCATTTGAAAGGTCAAAGAAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAACACACCATT
TTTGGGTGATCCGGATTCCGACGTCAAAAATTCGAATTTTTTTTTGAACGTCCATCAAGACCTTGTCTATGCATACGGTTGGCCATCATGGCTTGTACGA
CCAATTTGGAAGGTCAACGAGAACCGAAGCGACCATACCTTTCATTTCAACGATTTTCATGTGCTATAGCACACCATTTTTTGGGTGATCCCGGATTCCG
ACGTCAAAAATGCCAAATTTTTTCGTGGACGTCCGTCAAGACCTTGTCTATGCATACAATTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAAC
GAGCCCCGAAGTGAGCATATCCCTCATTTCGATGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGAATTCCGACATCAAAAATGCCAAATT
TTTTAGTGGACATCCGTCAAGACCTTGCCTATGCATACAATTGGCCATCACGGCTTTTCCGACCCATTTGGAAGGTCAAACGAGCCCTGAAGCGAGCATA
CCCCTCATTTTGATGATTTTCGTGTGCTATAACACACCATTTTTGGGGTGATCCAGATTCCGACGTCAAAAATGCCAAATTTTTTTGTGGAGGTCCGTCA
AGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCAACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGATGATTTT
TGTTTGCTATAGCACACCATTTTTTGGGTGATCCAAATTCCGACGTTAAAAATGTCAAATTTTTATTGGACGTCCGTCAAGACCTTGTCTATGCATACGT
TTGGCCATCACGTCTTGTACGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTTGATGATTTTTGTGTGATATAGCACACCAT
TTTTTGGGTGATCCGGTTTCCGACGTCAAAAATGCAAAAAAATTTTGTGGACGTCCGTCAAGATCTTGCCTATGCATACGGTTGGCCATCACGGCTTGTC
CGACCCATTTGGAAGGTTAAACGAGCCCCGAAGCGAGCATACCCCTTATTTCGAAGATTTTCGTGTGCTATACCACACCATTTTTAGGGTGATCCTTATT
CCGATGTCAAAAATGCCAAATTTTTATTGGACGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGATTGTACGATCCATTTGGAAGGTCAA
ACAAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGTTATAGCACACCATTTTTTGGGTGATCCAGATTACGACGTCAAAAATGCAAAA
TTTTTTCGTGGACATCCGTCAAGACCTTGTCTATGTATAAGGTTGGCCATCGCGGCTAGTCCGAATAATTTGGAAGGTCAAACGAGCCCTGAAGCGAGCA
TACCCCTCATTTCAACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGCCAAATTTTTTCGTGGACTTCTGT
CAAGACTTTGTCTATGTATACGGTTGGCCATCACGGCTTGTACGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCATCATTTCGATGAT
TTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCTGGATTCTGACGTCAAAAATGCAATTTTTTTTCGTGGACGTCCGTCAAGACCTTGTCTATGCAT
ACGGTTGGCCATCACAGTTTGTCCGACCAATTTGGAAGGTCAAACGAGCTTCGAAGCGAGCATACCCCTCATTTTGACTATTTTCGTGTGCTATAGCACA
TCATTTTTTGGGTGATGCGGATTCCGACGTCAAAAATGCCAAATGTTTTCCTCGACGTCCGTCAAGACCTTGTATATGCATACGGTTGTCCATCACGGCT
TGTACGACCCATTTGGAAGCTCAAACGAGCCCCAAAGCGAGCATACCCCTTATTTCGACGATTTTCGTGCACTATAGAACACTATTTTTTGGGTGATCCG
GATTCCGACGTTAAAAATGCCAAATTTTTTTGTGGATATCTGTCAAGACCTAGTATATGCATACGGTTGGCCATCACGGCTTGTCCGATACATTTGGAAG
GTCAAATGAGCCCTGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGCTCAGATTCCGACGTCAAAAATGT
CAATTTTTTTCGTGGACGTCCGTCAAGACCTTTTCTATGCATACAGTTGTCCATCACGGCTTTTCCGACCCATTTGGAAGGCCAAACGAGCTCTGAAGCG
AGCATACCCCTCATTTTGATGATTTTCGATTGCATGGCACACCATTTTTTGGGTGATCCGGATTACGACGTAAAAAATACCAAATTTTTTTGTGGACGTC
GGTCAAGACCTTGTCTATGCATACGGTTGGCCATCATGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGAC
GATTTTCGTGTGCTATAGCACACCATTTTTGGGTGATCCGGATTCTGACGTCAAAAATGCCAACTTTTCTCGTGGACGTCCATCAAGACCTTGTCTATGC
ATGCGGTTGGCCATCACGGTTTGTCCGCCCCACTTAGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTTATTTCGACGATTTTTGTGTGCTATAGCA
CACCATTTTTTGGGTGATTCGTATTCCGACGTCAAAAATGCCAATTTTTTTCGTGGATGTCCATCAAGACCTTGTCTATGCATATAGTTGGCCATCACGG
TTTGTACGACCCATTTGGAAGGTAAAACGAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCGTAGCACACAATTTTTTGGGTGATCC
GGATTCTGACGTCAAAAATGCCAAATTTTTTCGTGGACGTCCATCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTTTTCGACCCATTTTGAA
GGTCAAACGAGCACTGAAGCGAGCATACCCCTCATTTCGATGATTTTTGAAGGATTCCGACGACAAAAATGCCAAATTTTTTCCTGGACGTCTGTCAAGA
CCTTTTCTATGCATATGGTTGGCCATCAAGGCTTGTACGACCCATTTGAAAGGTCAAACGAACCCCGAAGCGAGCATACCCTTCAGTTCGATGATTTTCG
TGTGCTATAGCACACCATTTTTTGGGTGATCTAGATTCTGACATGAAAAATGCCAAATTTTTTCATGGACGTCCGTCAAGACCTTGTATATGCATACGGT
TGGCCACCACGGCTTGTCCGACCCATTTGAAAGGTCAAACAAGCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACCATT
TTTGGGTGATCTGGATTCCGACGTCAAAAATTCGAATTTTTTTTGTGAACGTCCGTCAAGACCTTGTCTATGCATAAGGTTGGCCATCACGGCTTGTACG
ACCAATTTGGAAGGTCAACGAGCCCCGAAGCGACCATACCTTTCATTTCGACGATTTTCATGTGCTATAGCACACCATTTTTTGGGTGATCCCGGATTCC
GACGTCAAAAATGCCAAATTTTTTCGTGGACATCTGTCAAGACCTTGTCTATGCATACAATTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAA
CGAGCCCCGAAGCGAGCATATCCCTCATTTCGATGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCAGATTCCGACATAAAAAATGCCAAAT
TTTTTAGTGGACATCCGTCAAGACCTTGCCTATGCATACAATTGGCCATCACGGCTTTTCCGACCCATTTGGAAGGTCAAACGAGCCTGAAGCGAGCATA
CCCCTCATTTTGATGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATGCCAAATATTTTCATGGACGTCCGTCA
AGACATTGTCTATGCATGCGGTTGGCCATCACGGCATGTCCGACCCATTTGGAAGGTCAAACGAGCTCCGAAGCGAGCATACCCTTCATTTCGATGATTT
TCGTGTGTTATAGCACTCCATTTTTTTGGTGATCTGGATTTCGACGTCAAAAATGTCAAATTATTTCGTGGACGTCTGTCAAGACCTTTTCTATGCATAC
GGTTGGCCATCACGGCTTGTACGAACCATTTGGAAGGTCAAACGACCCCCGAAGCGAGCATACCCCTCATTTCGACGATTTTCGTGTGCTATAGCACACC
ATTTTTTGGGTGATCTGGATTCCGACGTCAAAAATGCAAAAAATTTTCGTAGACGTCAATCAAGACCTTTTCTATGAATACGGTTGGCCATCACGGCTTG
TCCGTTTTCTGCATTTTCTTCTAGCTTTTGAACTCTCAAGCCTATACTATCCACTTTTGTACAAAGTGTAGTTAAGGTTTTGAGTATGTTCTCCATAAGA
TTATCTTGTTCTGGCTGTGTAACTTTGTCTTGATAGATAGTCTGCAATCATATTTTTGTCAGTTTTAATTACCTCAATTGTAAATGTAAAATTCAATATA
TTCAATACTAATCTTCTTATTTCTTTTGTTGTAACTGAATCCTCTACCTTTTTTGTTATCCACCATTTTACCTGTGTGTTATCTGTTCTTACAATAAATT
TACTGTAAACAATATATGGTTCAAATGCTAATAAACATTTATCTAATGCAAATAATTCTTTTCAGTTTATTTCCCATTTTATTTGTGTTACTGCATAAGA
TCCTGAATAATATCTACAATGGTGTTCTATTTTTTCTTTTTCGTATCTGTATTTTAAAACTCCTCCATAACTATGATCACTTGAATCTGTTTCAACAATA
TAAATAAATGTTCTATTTTCAACATGAAAGTAAAGTTTTGGTAATTTTTTACATAAATTCTTAATATTTCTTATATGTTCTTTATATTTATTGTCGAAAT
AATATTCTATATCTTTTTTAAGTTTTTTGTGTAATGGTTTTAAATGCTCTGCTAATTTTGGTATATATTCTCTTACTTGATTTACTAATCCTAGAAAGGA
TTGTAATTTCTTTTTCGTATCTATATTTTCGTCAAGGGTGATTATTTTTTGTACTATATGATTTTGCATTTTTATTCCATTCCTATCTATTTGTATTCCT
AGAAATTCTATTTGTGGTTTCATAATTTCTGCTTTCTTTCTACTTAAGCTTATACCTGAATGTTTGATTATATGTATAAATTTTTCTAATAATCTTATAT
GTTCATCTTGTGTTTTAGAATATAATAATATATCATCTATATATACAATACAATTTTCTAACTGGTTAAAGTGGTTGTCCATAAAATGTTGATATCTACC
TGGTGCGTTCTTATATCCAAATGGTAATACATTCCATTTATAGAAACCTTGCGGTACTGTGAATGCTGTTAGCTGTTTAGATTCTTCTTCTAGTTTTAGG
TGATAAAATCCTGATTTACAATCGAATTTACTGAAATAATTATATCCTTGTATCTGTCCTATTTTTAGTATTTTATTTGGTATTGGGTAATTATATGTTT
TAGTTTTAGCATTTAAATTGCGATAATCTATAACCATTCTGCTTTTACCTCTTTTTTGTTCACTATTTTTATAACTATAAACGCTGGAATTGTATGTTTA
CTATTACTTTCTTGTATGTAATTATTTTCTAATAGTTCATCTATATGTATTTTGAATTCTTTTAAATCATCAAAGTTATATTTTAATGGTTTCTGTGTTA
TTATACTACTTTCATCTATTAGTTCAATTTTTACTTTTGTCTTATGTTTTTCCCATCCTTGTAATGGATCTTCGTTATATAGTTGTTCTAGTTGTTCATT
TATTATTTTAACTTTATCTATTGTAAATATGATAATTTCTAATTGTGATATTTGTTTCTTATTCATATTTTCCATTTCTTGATTTATTTTTTCACTTCCT
TTTATCCATTCTGTAGGTTTTCGTTGTTTATTATTTACTCTTTTTGCTGCTATTCTGTTTTCGCATGGTGTAGTAAACCACCAATGTGTTTTTGTTATTA
TATGTGGGTAAAATTTATCTAAAAATGGCATTCCTAATAACATGTCTTTTGTCGTAAATTCAAAATTGTACATTTCTTCTATTGTTAGTATTTTATCCAT
ATTTGTATTTTTATATTTTTTGCTTTGTATTTAATCATACTTCCTTCATTATTAAATCCTGTTACTACCATAGGTGTTTTTAGTTTTTCCCGTTTATCTT
CTGGTAGACAATTATATTTACATATATTCGCTTCTGCTCTTGTATCTATCATAGGGGTATAATATCTGTTGTGATATCCTTCTATAATAATTTTTGCAAG
AATAAATATTTTCATTATTCATTTTGTTCTTTTTATAACTATTTTCTTATTTTGACAAGTTATTGTTAATTGTTCATTTTCTATATTGTATGGTTTAACT
TTTTCTAACCATTTTATACCTAATGTAATATTATGATTTCCTTGGTATATTTTAAATGGTATTATTAAGGGTATTCCTCCTATAATTATTTCTTTTTCCG
TTGTTTCCTCATTTATGTTTACTATCTCACTAGGTAATCCAGGGTATATGTGTCCTGTTTTTATAATTTCTTCTTCTAATACTAACTCTCTTGTTATGTA
ATTTTCTTCTTGTCCTGTATTTATCAAAATTTTATATTTTCTTTGGTCCATTAATCCTGTTATGAAATAATGATATGGTGTTATTTCTTCCTTATTTAAT
AAGTTTTGTGGGATTTCATAGTTTCTTTTAGATGTACTCATTCTTGATGAGGTAGCTCTTGTTAACGTATTTGGTACACTTGAAGTACTTAATCTTTCTT
TTACAATTTCTAAATCTTCTTCCGTGTCAATTTCTTTATGCTATAGTCATTATTGTCTATTACAGTAATTATTTTTTCGAAAGGATTTTCTTATCTTTAT
TTTATCAATTTTGTTTTTTGCTGCTATTTTATGTTTTGTTGTTAATATATATAAGTTTTTACATCTTGCTGTAAATATTTTACTGCCTGGTGCTAACTCT
ATTCCAGACATTTTCCAATATAATACTAATAATTTATCTATATTTCTGTCTGTTAATGCTACCGTATAATTGGCACTTATTATAAATTTAAATTTTTGGT
ATATTAAGTTTCCTTTTACTGCACTAATTACACTTTTTTCTATAGGGTGTATGATTCTGTCATCTGCTAAGTATATTTCAATAGGCGTATCTATTTCTTC
TCTAAAACAAACTTTTATTAATATTTCTGTTCCTCCTAAATGTACATATTTTATAGGTGTTTTAGCTTTTATATCTTGTATTTCTTTATTTATTATTCGT
TTACTTAGTATAGGTATATATGTTTTTCCTCTTGTATATTTACAATCTATAATATGTTCTTTCTGACTAACTACATAATATTCTTCCTTTTCTTTTAAAC
CAATTTCTCAAAGTAGGTATTTCAAGTACTTTTTCAACACTTAAGTCTAATTCTTTTCCTTTTATTTGTTCAAAAATTGTATTATCAAATATAATTTTTT
GGTCTGATAATTCTTCATTTTGATAATCTTCTTTAGATATTATTTTTATCTCATCCTCAGACATTATATTTCTTCATCTGTTTCATTATTATTTAGATTA
ATATTTTCTTCTTCATTTTTAGTTTCTGTATCTGATACTTCATATATACTATCGTTTTCACTTAATTCATAGTCTATGTATTCTAGTTGCATATATTTAT
CATTATCTATAATTACTTCTGCAATTTGCTTCCTTTTTGAATCTTTGGGTAGTTTACAGTCTCTAGCTAAATGTCCTATCTTTCCGCAATTATAACAAGT
AAATTGGGATATTTTTCTTTTTGGTCTATATGGTCTTTTTATTTTATAGTTTTTTATATAATACATTCGCCTTGGTTTCTTATATTTATACTTGGTTTTA
GTTTTTCTATAATTTTTATACCTTTTGGGCTTTTGCTTTTTATTTGTACATCCAAACTGTGGTGCTATTTTATTTTTACAACAGGCTAAATTCTTGTTTA
GTACTTTTTCCATTTTTAATTTTTCTTTTTGGTTTTCACATAGTTGTATGAACCATTGATGTAAAAATTTTATTCTACCTCATAAAGTATCTACTAATCC
TTCATCATTCCAATCTTTAATTATTTTTGTGCTAAATGGTTCTGGTAATTTTGTAAAATATTGTTGTCTTATTTCTTTTGCTTCATCTAAATTGTATTTT
GCTTTGTAATAGTATTCCTTAAATGCACATGTGTATTCTTCTATATAACACATTTTACATATAGCTAATTTTGTCATAAGTTGTCTATTTATTATTTTTT
CTCTGTTTTGTTCTCTTATATCTGTGGTCATACCTCCAAATTTACTTCTTATTGCTGATTCATATTTATCTAGTATATCTATATTTGTTGATGATGGAGA
TCCATCCATTTTCTTGTCACTTCTAAGTACTTCTAAACTTTCTAAGGGTAGATTTTCTATCCATAATCTTGTTGTTCCTACAAATGTTCTTTCTATATAC
CTTGGTGTTTCTGTTGTTTTATTTTGTTATCTATTAGTTGCTTAGATATATTTCCTATCCATAGTAATATTGCTTTATTTGTATCTGTGACACAATCTAG
ATCTAAGAAATTATATTGTTCGTTTATTGGTCTTGGTGTCCAATTTTTATTTAATCTACTATTCCATATTGCGTTAGTTCTATCTGATTGTTGATAACTT
TCTGTATAATAAGTTGGTGGTGTCCATCTAGGACTAATTCTAGGACTATTTCTGGGACTATTGTCTGGAGTTTTAACTCTTGACGTACTAGGTCGATTCA
TATCTCCTGTGTTTATTTCTAATTTTTTCAGTTTATTTACCTATTCTAGAATTTCTGTATATATCTCACTTATATCACTTATTTCTGATTTTTGGTCATT
TATTGTATCTGATTCATTGTCGTCTATTTCATTTACTTCAAGGTCTTCGTTTAGTTTTTGTTCCATCTCTTTTATTTCATTAGTTAATTCTAGCTCTTTT
TCTCTTTCTATCTGTTTCTCTTTTTGTCTAGTTTCATATAATAATTTTAACCTAGCTAATTCTTTTTCTAATTCACTTATTCTTGTATTTTTTACTTCTT
CCAAATGTTGTACTTCTTGTTTTGCTTGTATTTTTATTTTTTCGATTTCTTTTGATTTGTCTATTTCTTCATTTTCTTTTGTTATTCTTATCATAGCTGT
TAGACTATCTTCTAATTTTGCTGTTTCTTTTTCTATCATTAAATATAAATTATTTCCAATTTTTTTATATCTCCTTCCTAAATTTGAAAATATTATTTTT
ATTATCATTCCGTCTTGATTTTCATATGTCTTTTCGTCTACTGCAAATTCTTCTTTATTCATTATAATTTATGTATTATGTCATGTTGTAATTTATATTC
AAGGTGATCTATTTGTATTTCTAACATAAATATAGCTTTTCTTTGTGCTAATATCGAATTTTTACATACTCCTGCTAACATGTTTTCTATTAATCTTTCT
TTTCTATGTTGTAGTTCTCGTCCTTTTTCATCTATTTTTTCTATTAATTGTTGCCTATATGTTTCTTTGTTCATACTGTTTTTTCAAATAACAAACATAT
TTGTATTCTGTTTTTGAAATTATATTTATCAAATAATTTGTCTCATCGTCACTTGTTTTAATAAGTTGTGATAGTTTATATTCTATGTATAATTCATATC
TTTCGTACCTTTTTATCTATCTTGGTTTTCATTATTTTAGTTTCTTTACTTGTTGTATTATTCATTTATATTTTTCTATACAAAATTTTAAAAAGTTTAC
TTAATTTGTTTGGGTCTTTAATAAATTTTATCTTATAATTATTATTACTCCGTTTTTGTCAAACTTCAAACTTTTTTGGTTCAATCATTGATCCCTGAAT
ATCTCTAGATGATCATATAAATCATATATGTCAAAATAAAATTCATCATAAAAATCATTTTGTATATCTAATTTAGTCTAACCTTGAGTTGTTACTTCTA
TTACTTCATATGTTACCAACATATCATAAATTTCTCTTTTTATATCTGTATTAAGATCTTTTAATATATAGAGTATTAATGTTTTGTAATTAACATCATC
ATCTAATAAATAGGAGTTCATTTTATTCATTTGTTCGCTAATGATTTTATTCCTTCGAATCTCTCAATGGATTATACTTATTTATTATGTAATAATAATG
GTTTAATAATCATCTCGTCTGTCACTACTACAGTTTTCTTCTTTGATTAGTTACCCTAACAACGCCTCAACTTTGTTTACTCCCCTAAACGGTCTTCTTG
CCTATTGGTTTCAACTTTAGGATGACATAGTCTGGGCATATTTATTCGCAGAATATTTCTGTAGCAAACTTTCTAAAGATGGTTATTATAACATTATTAA
AACATGATAAACAATTATAATCAACAAGAGATTATCAGGAATAAATTAGTTTAGCTACTCATGAACTTAAATGTGTATACCTGTTTCTGTAGATTTGTTG
CTTCTGATTTGTTTTCCATAGTTCTAGTTTTGATTATCTAGCTCTGATACCAATGTAGGGTGGAAGCGGAATTAAGAGTGAGAGAGAGATTATATGAAAG
GGATGATTTTATTATGAGGGAGAACCCTAATGTAGGGTGGAAGCAGAATTAAGAGTAAGAGAGAGATGTATATGAAAGGGATGATTTTATTATGAGGGAG
AACCCTCTATTTTTACAACCAAATTTACATGTATGGCCAATACAAATGGCCGATACTTACTTTTACTCATGGGCTAATAATATTTGACCGACACAAAAAA
CAAAATACTCACTATTTCTACTTTACATAATGACCTCTTCTTTTTATTTCTGGCCGACACACACTATTTACTTTATGAAAGACAAAATACCTTTTACATA
ATTGACCTTTTATGGCCGACACACTAACTTTCTACTTTATTTCTTTACATACTGGCCTTTACTTTTACATATGGCCGACGCAAAACAATAAAATACAATT
ACAATAATACTATTATATTATTACTTTACATAAAGTATCTGATTTTTGCAAGTTATACCTATATGTTTTTGACAGTTGATTCTTTCATGCCTCGAAATCA
TTGCTTCTTTTATTATATTGTTTTTATTCTTTAGCGCAGAATGACTCAATGAGTCTTTGTGGTTTGGCGATCAATGAAGTTGGAATGACAAACATTTAAA
ATCACTATATACTTAACTCTTAATATAAGTAAAATTGTGCAAGTGTTTTTTCAGTCTGTTCAAATCTTTGTTAAAAGTGTACTAAAAATAATGAAACTCA
TCGAGAGTGAAGCTTGTCAAGTATGCAGTGATTTTATTCTAGTATCTTGAGGCACTAAAAACATAATTCACCTTGTGTTAAGCCACAAAGCTCCAATAAT
TAGACATACATGATTATTTTAATAGAGTATCTTGAGCTATTGAATATGAAACTAATTAAGAGTGAAGCTTCGTCCTTATCATCACAAATAAAAATTTGAA
TCAAATATGTAAAACTCAAACGATAAAACTCGTCAAAAGCAAAGATCGATAATGATTAAAGATGAATAGTAACTTGAGTTGCTTATTAATAATGGAGCTT
AGTGGTTCAAGGTGAATTACGATTTGAATCGAGTCTCTCTAACACCCAAAGATGGAACTAACTAAGATAGGAGCTTAATTACACATCATTAAAAAATGAT
TTAAAAAAATCATAAACGACTTAAATAATTATTCTAATTAGCCAAACAAATGAATATCAAAAAAGATTTTTTTTATATTAACTTATTAAATTAAACAATT
TGGTCTTTTTTTAGTCCTTTGTCCAACACATTTAGTAGAAAGAGTAGTTTCAAAATCAATTTTTCCCCCTTTTCCAATTAGTATAGGGTTTACTGTTTCT
ACAAATTCAATACCAAAATCCATATATAAATCGAAAATTAACAATGGAGAATGGGGATGGAACAAATGGGAAAAGGATAAGGGCTGAAGATGTAATATGT
AAGCTCAAGGACGATGGCGATTTCGATAAACTTCGCCTCAAAATTGTTCGCCGAATGAAAGAAAATGTCAGTATTTGCTTGTTCTTCTTTGGTTTTTGTT
GTTTAGAGTTCTTCATTGGGCTTAAACTGCTAAAGAGTATTTTTTTTAATCTTCGGTTTCTATATTGTTTTTATCTGTTTTTACATCAATTTACTGCTAA
ATCCTGAGTTGGGTTTTGTTCCATTGAAAGTGTATGTGATTGGTATTGGAGATTCGACGTTTATTATTGGATTTAAGTTATATACACAGGTAGTGATTGT
TAGAGTAAAGGTTAATAGGTATTGGAGTGTTTTTTTTTCCCTTCTAGTAGTGTTATTATTGTTACTCTCGTGTATCTTATTCCTGGATTTTATTATTACT
AGTTGTTCACTTGGTTTCAGTTATGTAGTGCTTGTTGTTGATAAAGCTCTCTTCTTTTTACAAAATGGCTTATTTGCTACGATTTGATATGCTTTACTTG
AGCCGAGGGCCTTCTAGAAACAACCTCTCTGTGCATGCACATCACTTGTGAGAATGGGTATGTTGTTGTTTACACTGGGCGTGAGGTGAGTCGAGGCGTG
TAGTTTTTTTGGGCTGGGTGCCTTATATATAGAGAAAAATGAGGCAAGGGATGTAGTTTTTCTAGTCCGGGCGCTTTCTATAGAGGAAAAAAGGTGTGTA
TAGGTAGGCTCAAGCTAGATAATATTTATGAGCAGAATGAGAAGACTATGATACTTGGCATGTAGTTTTTCTGGTGTGGCTGTCTACTATTGAGAAAAAA
GAGGTGTTCAAAGGTACACATGAGCTAAGATTCTGCTTGGGTGGGAGATGATATAAAATCTCTGTATGCCCTGAACTTAAAACAAAAGCATTAGTTAGTA
GTAACGACTCATTCAAGAAATGGATTAGTTTTTCTAAACTGTTAAGTTTGTATTCTTCAGCATTGAGGATAAGCTGACCACCTTCAAAAGAATTAGAGAT
TCCCTATCAGATCTATAATCTGTTTAATATCCTTTATACATGATTGTTTACACCAAACAAGTAAAGATACTATAAAATTCCATTTAACCTTGTGAATTGG
ACCCATCTGTAAAACATCTTGTATTTCTTCCCTCCATACTACCCACCATATACATGAAGGGATCAGTCTGCACTCCCCCTCCCCCTCCTTTCTTATCCAA
CAACTAAGAAGGGTCTGATGTATGCTCAGGCATGGTCCAGCTCTTCCCAGTGATGTTGAGAAACAAAATTCCACAACTGAGCAGTGTACTTACAAATGCA
AAAGAATGTGTTTGTTTGTCTCCTCAGTCTCCATACATAGAAAACACCTAGGAACAAGTTGTGTTCCCTTCCTCTGTAGCACTTCTTGAGTTAGGCAGGC
CCATTTTATAACCAACCAGATGAAGCACTTTACTTTTGTGGGTATGTCGCTTTTCCAGATGATGCATTGGTCATATACTTTAGTCACCAGAAGACCCCTT
GTGAAAGCACTCTTTACATAGAAAATCCCATTTCTATTGTGAATGAGAAGAGCTCTATTCTGTATTAATGATACTTGCACTATTTTCCCAATAACAGGGC
TATCTCCTATATCTCCCAATCATTTAAAAGCTTCTAAAAGGGATGTCCCACCCTTGCGTTGACCTAGACTTGGACTGTCATCTCCGGATTTACACAAATA
AGAAATGGATCAGGGATGCCTAGTAAAGAGGATTTTGTTCAATCTTCTTATCTCTCCAAAATTTTATCCTTGCACCGCTGCGTACCTTTAGGCAGATGTT
GGCTTCCATTGATTGCCACAGATTCCTAATTGTTCTCCACACTCCCGCTCCATATGTATGCGGTACCATTTCTGTGCACCATGGATAGCTTCACCATACT
TTGTCACAATAACTTTCTTCCATAGAGTCCTATGGAGCTATCCTCTGTGATGTATATCCATAACCATTTCGACAAAAAACACTCATTCAAACGCTGTTTT
CTAGTTCACCAGACAATAACCCTTCCCCTCCTTATTCCCTTGCCACAGAAACTTCCTCCTAATTTTATCTAGCTTTTTCACCACCTTTGCTCGGATTGTG
AAAAGGGACATCACATAAGTGGGCAGTGAGTCAAGATTAGTAACTTCAAACAAAATTCATTAGGGATAGAGTTTGTTCGTTTCACAGCCACACAAACAAG
ATACTGAAGTGTTTCACCTAAAATAAAATGATTTCTGTTACAAAAATCACACTCCAAAATATGTATATGAATCAATTCTGTGTCAAAGTTGATGGTAAAA
AGTATAGGTAGCATTAAATTTGATGGTCGTGCTTCCAAGTATGTGGAAAAACATGGGTTTGGGGTGGGAGCCAAATGGCAGAGAAAGTTTCTCTGTCGGT
TTCTGAAAGCATTAGATACCTGTCTTAGGTTGGTCAACAAAGAATATTCATCCTCATTATATTGAATTTTCATTTAGAATTTTGTCCCTCCTAATTTAGA
TATTTATTTTCTCAGAGAGAACTTGAGAATAAAGTACCCTACTCTTAGTTTCAAAAAAATAAATAAATAAAGGATCCTACTCTTGATAATAAAATTAAAA
CATACTTCTTGTCCTTGAGTATATATTTATGTAAAAATAAGATCAAAGATGCACAACGTTTACCTTTGTTATGGTGTACGTAAATGATGTATTTAGAGCT
TTGTAATTATTTACATGCTAAATTTAGTATGAGAGGGTGGTTAATTTTTCTAATTGTAAGAAAAAAGAACTATGTATATACTTGATTTGTTTTCAGGTGA
GCCTGTGAGGTAAGATAGTTTTTATTTTTGTTCTTCTAATTGATGGATGAATTGTTTGAGGTTGAGGAGCTAGTAGTTGATTGGGGTTTTTGTCCTCTAT
TGTCTTCTACTTGACTCCCACCAAGAAAAAAACTTTTGGTGCTTAAAGACAGAAGAAGCGCCAATGCCAAATTAATAGCAGTCTATTTTAAGTGTTAGTC
AACTTCACTTAGCTGCAAATTGAAAAGAAAGATAACACTAATTCTCAAGGAAGATGATGAGACTTTTCTATCAAATTTTAAAATTTTATATTTATATTAT
TTTATCTTTTAGTATATGAAAACACTCCCAACGTTTAAATGACCGTTTTATGTTCAGTTAGCCCGCTGTCATGTATTCGAACCCTGCTGCAGACTAAAGC
CTGTTACTTAAGTGAAGAAGGGTACAAGCACTGGCCTATCGAGTTTTGCACCGTCCTCTGCTGACCCTGGAGGATTTCACGGTTATTTTAAAAACAAGCA
AGAGAAGAAGGAGCATTTTATGCTAAAGTTTTGAATCAATGAAATATATTGTTTATATTGTTCAATATCTTTGGATCAATTAAGGCTGAATAAATTGTTT
ATCAATTTGTATTTTACTCGTGTCATGTCACTCTACTTTCAAAGTTTGTATCCTCCATAATGAGTTAATACTGAAAAAAGATGAATTGCTTTAACACCAA
GAAAGAACCATTGTCTCTTTAGTGAAAATATTTTGTTTTTTTGCGCAAAAAACATCATTTTTTTTGTGAATTTGAAGACATTTGTTTGCAACAGTCGTAA
TATGTGTTTTCTTAAAGAGCATGTTAGGGCTCAGCTTGATGTAGGATGGACTACAATTGTGTGGGGTTTTGAAGATAGCATAGGTTCTATTGAGCTCTTT
TCTAAAATATGCTGATATATTTAGGCAACATCTCTAGCATTGGGCTTTGTTGTTGTGCCTTGGTTTTATTCAAGATACTGTTTTCTGATGATTGAGAAAT
TCATTTGGGGCCAATCCTTTAAAACCAACTGCGGCCTTTGAAACTCGAGGATAATGAGTCCATGCCTTTTTCCTTCTCCAATAAGATACTAAGTATATTT
CGCATGGCACACGGCTCAAGCCTGTGATCAATGTCACAGTCCCTTAACCTTTGCCACTTGAACTAAAGCCCCGGCTGAAGTTTTACTCAATACCTAAGAA
AATGAAGGTGAGATTTGAGTTGAAATATAGTCATGAAAATATGGTCTAATAGTTCTCTCTGAAAAAAAAGAAAGAAATTAGTTTTAATGATGTAGCATAC
CGAATTTAATTGTAAGGATGAAGTGCTGACAAAATTGGCATACAAGAAGTGGAAAAGGGTATATGGGTGGGTTAAAGATACAGACTTTTGACTATGTACA
AAATACTCTCCCTGATTTCTCGGTTATCAAGAAAAATAAGACATACACCACATTAAGGATGAAATTGGAAAACAAATCAATAATAGCCTATATGATCGAA
AAGTTTATCATTGCCAGTTCTTGATTAAAGAGAGCTCTTTTCTGCCATTAGTTAGTTTCACTTGTCTGATCTGTTTCTAGTTTCTATATTTCCTGTTCTT
TTTTGCATTTTCACGATATTCAGAAAGTGTTCAATCATCAGCAACCTACAAAATATAGACTTACATTTCAAAGACTCTCGGGCTTAGTCTCTCCCAAGCA
AATATATATGTACCTTCGCCTCTTAAAACTGTAATCTTAATGGTTCTTGTGTGAATGAGTTGGATGTTGGTGCATCTTTTGGATAATGTTCTATCTGCTT
GACAATTATGATTACCAAGATAAATAGGCAAAAAACACATAAAAATTCATCAATACATTATTCACTTGAATTGATAACTTGAGAAACTGAAGATAATGGA
AAACCTCCAATCCCCTCCTCCTGTGGGTGAAGTGCATTAGTTGACACGGTTATGGTATGTCAGTGGGGCATGAACTTTTTTGTTACATATTTCTGTATCC
ATTATGTAAATTGATTTGTATATCATTTCTTTTGGCTTACGTGGTATGTTATCTTCTTGCTTTTTCTTCAGATAAGCAAAAGGAACAGAATGATGCTATT
ACACTTTTAAGCTTACATGTGTGCTCCAGTTGTGTGACAATTGTGTTTTTTTTCAGGTAGAGTTGCGAAATAGCTTAAGAGCTACAGTGAAAGAATCAGC
AGCACTTAACCGTCCAGGTGCAGAAAATATGAAACTAAGGCAACTGTCCGATGCTATATATCAAGAAGTTGGGTAGGTCATATTTTCAACCTTTTCCCAT
GGTTTTGATTTTCTCTTCAAGACACTAGAAACACGCCTGAGCTGTCCTTCGGTAGATCTCAACAACCTCCCCTCCCTTCTTTTAACTGGGTTGTTCAACT
AGGTTGTTTCTGTTTCGTCTTTTCTTTCACAAGCTTAGGACCTTTTGACTATAGGATAAGTGGTAGTTGTTTCTTTTTTGGGTGACTGGAAATTGTTGAC
ATGTTTTAAAACAATCTGGGCCTTTCAATTTGGTATTGAAGGAATAATTGTTTATCAACACAATGAAAGAGAATAGTTCTGACGAGTGCAGCAAAAAAGT
TGGTACTCGAGGGGGAGGGGTACGCGGATGGCGTGTCATGTGTTAGGAGAGAAATTTAAGGGGCCTAACTGATAGATTCTCAATTATTCTAGTCTTTTTC
CCTTTTATTCAAACAGTGAATTATGATTCTATGTTTCAACTAGTGGTATTAAAAGTTAATCTGGTAATGTATATAGAGTTCCACAAATTTAACCTGTTTT
GGTCATGAACTATAGGGAAAAAGCCATGAGTAAAATTTCAGATGATTTGTGGAATACAATCAGAACCGGTGATGGCATTCAAACGGAGATAACTGAAACG
GTTCAATCAGTTTACAGTAAGTTATTGAACCCACAGCTAAATGAAGCAGGTGAATCGGCCTTTCATTCAGACTTGCAGCCAGCTCAGAATGGAGTTGAAA
GTAATGGACATCTTGCTGTTTCTGACAGTTGTATTGATGCCACATTTTCTGCTGATGCGGAACCAAGTGAACCTCCTGGTTTTGCCCAATTAAGTTCAAA
TCGGAACGGGAAAAGTGACCATAAGGTATCACCGAAAGAAGTGTCAGGAATTCCTGTTCCTTCTGATGGAAAAGCAAAAGAAACATATACCCAGTCAGAG
AACAACTGCTCACTTGACCCTTTGATACCCGAAAGTGTGGATGTGGGTGCGCCACCTGGCTTTGCTATAGGCACAATAGAGAAGAATCCAGATGATGTTA
ATGATGAAGATCCTGAAGTGCCTCCAGGATTTGGCTGATGGCTTATTAAGTTGTTCATATAGTTCTGTTTATATTTTTGGGAAAGGTTAGCCATATTTGG
TTGGTCATTATTGTATCAAGTTCAAGAAGCTTTTGTTGGTACTTGCAGAGAGTACTTAACTTTCACTGCACCGACTAGCAGCTCATGACCTCTCTTTCTT
CAATTTCCCAAGGTTAGAAGCCTTAACTATGTCGCTTGTGCATGATCTTGGATAACAGATTAGTACTATCAAAACTCATAGTCTTCAAATATGAACATTG
GAGATGACATGATGTCTTGTTGTAAGATGTAGTCTAAACTAAGTTAATTTTGTTGGTTCTTTAGATGTTAACCGCAATATTTCTTCCTAACCTGCTCAAG
TTGGATTTTTTTTCTCCCTTCTGCTTTGTCTTTTAAATGTTTTTCTTTAGCTGAACTAGTTCCTAGATAACAAGCCTAAAGGTTTTCTTATTGATGAGAT
TGACAATGCTGATAGTGACAATCTTGATGCTAGTGATGATATCAATCGTGACCTTGATACGGAGCTGGAACTGCTAAGTAGGATGAATGGGTTTGTTTTT
CCTAAATTTTTAGGAGTTGATGCTGTGGATTGGACAAAGGAAAATTAGTTGGTCATACCATTTGGCAAGAAGGTATTCTTTGTAAATGCCTTTACATCAT
TTTCTAAGCAATTTATTTTTTTTCTCTTGGTTACAAAGATGAAACGTTATGCCCTGGTGAGGTGTCTTGCCTCTTATGGGGAATTATGCTAGAGAAAAAA
ACTACTCCTTTTGTCTCAATTTATGTGTCACCTTTTACTTTTTAGTCAGTCAAAAAAAGAATGCTGTACTTCTTTATTTAGAAACAATTTAAATTTAAAC
TTTACCGTTTATCCTTAATGAGATGATGTATAGCCACACAAATATCTATAATTTACTTAAACCAAAAGTTTCAAATATCTCTCTCTTCCTTAAACTTTGT
ACCTCATCAAACACCGCCCCACATAAATTGATACGGAGGGAGTAAGAAATTCTCAATTATTCATATTTATGATATGAATTTGTAAAACTAAATTGTTAAG
TTATGTGGCCACCTTGAGTAGTTAGAGAGAACATATCTAATTAATTATATTTTCAATATGCTTCTCTCATGCCAACCAACTTTTTATTAATGATCCAAGC
GCATGGGAATTGTTCTTGATGAAGGTTGGTGGTTAAATTTAAACTTAGGACATCTGGTTCGATGATAAATTTACGTTAATTATATCGTCAAGATTCTACT
AGTTGGAAATAAGTCTTAGACTTGTTAGAGGCTTTCTAATTTTATATTTCTCTCACACACACACCACTTCTAATTTTATGGCATAAGTTGAGCTTGAAAG
AAGTAGTGAGGATTCATATACTCGACCTTGACTTGTTTGGGACTGAGATGTTGTTTAAATATATCGACAAGATATATTCTCTTCTGAATGGAATTTTTTG
ATCTGTACTTATGTTGTTTGTGCATGCTACATGAGATGATGGAATTTTGTTGACAAGTCTATGGATAATGCAGGTATGCAGCACACACTAACTTCAGGTG
CAAGAAGTGTTATTTATTGGTTTTATTAAGTTCCAAGCATGTCTCTTTTGGATTCAGAATTTAGATTTGTTTGCCTAAAGACTCTTGTAATATGATTCAG
AATTTAGATTTGTTTGCCTAAACACTCTTGTAATAGGATTTGAAATTTTGATTTGTTTATCGAAACACTTCTGTAATATTATTCAGTTGCAAATGCATTT
TTTTTATGTTATTGAATGGACAGTTATGTTACTGCAATTAGTTGAATCAATTTTCTAGTTTTGGCAGTTTGATTAAAACATTCATTCTAGTTATTGAAAA
TGACTCACTTAATAGAGTCTCTCATATGGAAACTAGATTTACTCAAATCTCAAAAAGTTGAATTTTCAGATTAGATTAAACCAAATTGTTATGAAATTAA
GTTTTTTTTTAATTTTAATTTTTATTTTTACATAATAAATTTCATCCAAGTGCGTGTTCTAGAGGTCAATAAGGTAAAGACTGGCATCATAGTTATAGGA
AAAAAGCTAGACACTTGACAAAAGTATCAAGAAACATAAAATTGAGCGGTTTGATCCCAATAAGATTTTGTTCATTTTTAAGGGTGTGAATCCGAGGCCT
CTAGTTAAGACTTAAGGGTGATAAGATTTCAACCATTTCACCACAAATGAACACTTAATAATCCAATGAAATAACTTTATCTATTATTATAACTTTATGA
AAAAATAAAAAATATTAAAGGAAAGGAACTTTCATAAAATGAAAAGTAGTCATCTATTGTTTTTAAAATATGAGTGTCATTCCATGGAAGTGTTGAATTC
ATTAAGTATTATAAATTGCAGCTTAACTTAACTTTGGCTTTATTAATCCTTACCGTCCATTTATATTCTTTGAACTCAAATAATTCAATGTTGATACAAA
CCTTAATCTTAATTATTTATCAGGTTTAATTTTTAGTCAATCAAATTTCAATCAGCAAACGGTGTGAAGGAAAAGTATTCTATGAAAAATGTAGTTCTCG
TAAAAATAAGTGATTTTCTTGTGTTTATTATACGTAAGTAGAAAATATAATCTCAAAAATATTTATATATCATCTACACAAACACTATGGGAGATGGGGG
GATTAGAGGCAGAGAAGAGACAATCAATATGGAATGACACTTACGAAACTTATTTTCCATTCTTAGACTATTCTTAGTTGCTCTATCACATCACTTTCCT
TTTTTTTTTTTTTTCTATTCATCCTTTTAAATTCAATTTTTTCTTCTCAATTCTCATATGATAGTTCCCCTTTTGCCACACAATAATACTTTAATCAACA
TGAGATGCACAATTTGATTAAACAATTGAAGAAGCTTCCAAAAGGAATTGCCTCTGGTCCAAACTCTTACAAACAAGTCACGATCGGCTATATTTTCTGT
CGCTCCATATATTTCTATTATGTCAAAAATATTAGCAGGCTGCAAACATAATGTATTAGTACTATCCTTTTCTTTTTATGAGTAATTCCCTTCTTACTTT
CTTCTTAATTATTTTTTATGACTATGGTCTCAAGTAGTTATACGACGTTGATTTTAGACTCCTCCGGTAGAACCAACAACCATCTAATGAATTATCTTGT
ATTACTACAGATGATTAGCTTGCATACATTTTGATTAATTCTATAGGGTACCTGCTACGCCTCGTAGTACCAATTTAACTTTATTTTAAAGGATTGTTCC
TTTCAACTTTCTTTATCATAATGGTTCTTCTTTTCCTATACATTAATACTTTAATCAGCACTATTTGATTAAACAATTTAAAGAGTTTCTATGATGTAGA
AAATGAATCAAAGTTATAGGGCCACAAGAGCACTATATATACTAGTTGTTTCATAGAATTTGTACTATCAACTTTACTTCGGAACATCAACAGATTAGAG
TTCTTCTAGCCCATTTTGTAGCTATGAAAATCTTGAATTTTTTTCCTGTTTTTACCATACTTGGCTGTTTTTCATGGCCTAGTATACAGGGTGAATTAGA
GACGTATATAGTACATGTTGAATCCCCAGAAAACAAAATTTCAACACAACTTTTATCAGAGGATTTGGATAGTTGGTATCAGTCCTTTTTGCCAAATACA
GTAGCAAGCACAAACTCAAATGAAGAGGAGGGGCCGCGTTTAGTATATTCATATCGCAATGTTATGAAAGGCTTTGCTGCAAGGTTATCAGAAGAGCAAG
TGAAAGAAATGGAGAAGAAACCAGGCTTCATATCTGCACAGCCACAGAGGATATTGTCTTTACACACGACTCATACTCCGAGTTTTCTTGGATTGCAACA
GAACAGTGGCTTGTGGAGTGATTCCAACTATGGTAAAGGTGTGATCATCGGTGTTTTAGACACCGGGATTTCACCTGACCATCCTTCATTTAGCGACGAA
GGAATGCCTCCTCCGCCTGCTAAATGGAAGGGAAAGTGTGAATCGAACTTCACTACAATGTGTAACAACAAGCTCATTGGTGTGAGGACTTTCCCAAAAG
AAAATGGTTCGCCAATAGATGATGATGGACACGGTACTCACACCGCCAGCACTGCTGCTGGCAGTTTTGTGAGAGGTGCCAATGTGTATGGAAATGCAAA
TGGCACTGCTGTTGGTGTTGCCCCTCTTGCTCACTTGGCTATTTATAAAGCCTGTGAGTCGATTGGTTGCGCTTCCAGTAACATTTTAGCTGCAATGGAT
GCAGCTATTGATGATGGTGTTGATATCCTATCCCTTTCCCTTGGAGGGTTTACCAGACCCTTCTATAATGATCCCGTAGCACTCGGTGCATATACCGCAA
CTGAAAGAGGTATCCTTGTGAGTTGTTCTGCAGGTAATAGTGGTCCAGCCAAAAGTTCGTTATCAAATGAAGCCCCGTGGATTCTCACTGTAGGCGCGAG
CACTCTTGATAGGAAAATTAAAGCAACTCTTCAATTGGGAAACAAACATGAAATTGAAGGTGAATCAGCTTTCCATCCAAAGGTTTTAAACTCAACATTT
TTTCCTCTGAATGAACCTGGAAAGAATGAACGCGAATCTACTGAACGTTCTTATTGCCAAGATGGATTAGTGTACAATTCTAATGGAGGCAAAATAGTTT
TGTGCCAGGTAGGTGGTGGTATTTCTAGAGTTGGAAAAGGACAAGTTGTAAAGAATTCCGGAGGCGTTGGCATGATTATCATCAATGAGAAGGGAGATGG
TATCACTACATCTGTCAGTGCTCATGTCCTTCCTGCCCTGGATATTACTTATGCAAATGGAATGAAAGTTCTTGCCTATATGAATTCAACAAAGAAACCT
GTTGCTCGGATTACATTCCAAGGAACGATAATAGGTGATAAAAATGCTCCTGTTGTTGCTGCATTTTCTTCTCGCGGACCAAACTTAGCTAGTCGTGGAA
TCTTGAAACCGGACATTATTGGTCCTGGTGTAAACATTCTTGCTGCTTGGCCTACCTCCATGGAGAACAACACAAACACAAAATCTACCTTCAATATCAT
TTCTGGCACGTCCATGTCTTGTCCTCATCTGAGTGGAGTAGCTGCATTGCTAAAAAGCGCACATCCCACTTGGTCTCCTGCAGCTATCAAGTCAGCCATC
ATGACAACTGCTGACACAGTAAACCTCGCCAACAAGCCCATCTTAGATGAAAGGCTTCTTCCTGCAAATATCTTTGCGGTTGGTGCAGGACATGTCAATC
CGTCAAGAGCGAATGATCCAGGACTAATATATGATACCTCATTCAAGAGCTACTTACCGTATTTGTGTGGTTTGAATTACACAAATCAAGAGATTCAAAG
ACTACTACAACGCAAGGTGAACTGCTCGGAAGTGAAAAGTATTCCTGAAGCACAACTAAATTATCCTTCATTTTCCATCACACTCAGAGCAAATTCTCAA
ACATATACTAGAACAGTGACTAACGTCGGAGAGGCTAAATCATCTTACAGTGTGGAGATAGTTTCACCACCAGGAGTTTCTGTGATTGTTAAGCCCTCTA
CTCTGAAATTCTCCAAGTTGAACCAGAAGTTGACATATCGAGTGACCTTTTCAAGAACGGAGAATAGTTCAACCAGTGGTACAGTTCAAGGATTCTTGAA
ATGGACTAGTAATAGGCACTCTGTAAGAAGTCCAATTGCAGTTGTGCTAGTCTAGTGAAACTACAAGATTTAGTTTTTCGTTTCATTTACTTTTAGTAAT
TTGATCCTTCTACAATAAGCATGTATTAGTTGTTCCAATTTCTTCAAATGATCCATTGATATCAAATGAATCTGCTTCTTTTGTTTCCCTACTGTAACTT
TTTCTTTACAATGTCAGGAGTTTTTGACTAAAATGAGCTATTTTAAAAAACCAATTCACCAAAATAATATGTTTTTAATTTTTTTTACAAAACTAGTATA
AACGTACTTTATGGTAACGTTTTAGGATATTTTCATTATAAAAATTCAACGGACAAAAAGTTAACGGGTTGACGACGTTAAACACATAAACGTAACTGTG
AGTAACGTTTTAGGTGTAAAACGTTACTCAAGAGTACGTTTTTGGAGAATCCAATCATGGGCCACTGACTCCAATCCTGCAAAGGCGGAGTCAAATCATT
CAACTGTAAAACGTTACTATGAGTAACGTTTTACACCTAAAATGTTACTTTGACTCCCGTTTCTTAAGAATCTAATCAAGGGCCTTCGACTTCTGCAAAT
GTAGAATATATTTAGCTATAAAACGTTACTCACAGTGACGTTTTACCTTAAAAACGTTGCTTTCAATTAAAACACTCTGTTAAAGTCATATTCCTCAATT
TTTCAAACTGACCAAAATGATTATAAATAAATGTTGTTGTAATATTTTGCATGTTCAAATATAATTCAACAAAAAATTTCCTTGTGTGGTCCATTTTAAA
AATAATATTCACAACCTTTGATTTACATGCAATTGGTATTATGAAACGCGTATCTATATATATACTTTCAACAGTTCAATTTACATGCAATTGGTATTAT
GAAAATTTTTGATTTTATTTATATGATTTATAATGTTATATAAAAATATTAATTGGATTAACATCAATATGACATACATTTAAATGTATCATACCCGATG
AAATTTTGTGAATATTATTTTTAAAATGGACCACACAACGAAATTTTTTGCTGAATTATATTTGAACATGCAAAATATTACAACAACATTTATTTATAAT
CACTTTGGTCAGTTTGAAAAATTGAGGAATATGACTTTAACGGAGTGTTGTAATTGAAAGCAACGTTTTTAAGGTAAAATGTCACTGTGAGTAACGTTTT
ATAGCTAAATATATTCTAAATTTGCAGAAGTCGAAGGCCCGTGATTAGATTCTTAAGAAACGGAAGTCAAAGTAACATTTTAGGTGTAAAACGTTACTCA
TAGTAACGTTTTACAGTTGAATGATTTGACTCCGCCTTTGCAGGATTGGAGTCAGTGGCCCGTAATTGGATTCTCCAAAAACGTACTCTTGAGTAACGTT
TTACACCTAAAACGTTACTCACAGTTACGTTTATGCGTTTAACGTCGTCAACCCGTTAACTTTTTGTCCGTTGAATTGTTATAATGAAAATATCCTAAAA
CGTTACCATAAAGTACGTTTATACTATTTGTGTAAAAAAAATTAAAAATATATTAATTAGGTAAATTGATTTTTAAAATAACTCATTTTGGTCAAAAACT
CCAATGTCAGTGTATGTAACAGCCATATGCTTTCCCTTGTTCTTGATTTTGTATATAGTATAACAACATTAGTATGGGAACTTTAACTTCTTTGTACATG
TAATGTATGGATGATGCCTTAGCCCTCTATTTGATGTTGGACTTATTTTAGAGTCTAATAGTAATGATAAATTGTTCTTCGTTTGAGCTAGCACTCGCTA
TGGTCGTTGGAAAGAAAAATCCAGCATGAGTACTTTCTGCATTCATTCTACATTTTGGATTCAAACAATGAATGTAGGCTCATTACATGTAACAAATCAT
GACTTTTTAAAACGAAACGAGACTAGAAATCAAACATTGCAGTTTCTTATAGAACGATTGCAATTGGACTTCTTCCAGAGTGCCTATTACTAGTCCATTT
CAAGAATCCTTGAACTACACCACTAGTTGAACTATTGTCTGTTCTTGAAAAAGTTACTCGATATGTCCTTTTCTGGTTCTTGTTTGAGAACTTCAGAGTA
GAGGGCTTAACAGACACGGAAACTCCTTGTGGTGAAACTATTTCCACAATGTAAGATGATTTAGCCTCCCCGACATTAGTCACAGTTCTTGTATATGTTT
GAGGATTTTCTCTGAGTGTGATGGAAAATGAAGGATAGTTTAGTTGTGCTTCAGGAATGCTTTTCACTCCCGAGCAATCCACCTTATGTTGTAGAAGGTT
TCCAACCTCTCGATTTGTGTAATTCAAACCGCATAAATAAGGTACATAGTCCTTGACTGGGGTATCATAAATTAATCCTGGATCATTTGCTCTTTCTGGA
TTGACATGTCCTGCACCAACCGCGAAGATGCTAGCAGGAAGAAGTGTCTCATCTAATATGGGACCGTTGGCAAGATTGGTTGTATCAGCGGTTGTCATGA
TTGCTGATTTGATAGCTGCAGGAGACCAAGTGGGATGAGCGCTTTTTAGCAATGCTGCCACGCCACTGAGGTGAGGACAAGACATGGAAGTTCCCGAAAT
AATGTTGAAAGTAGATTTTGTGTTGGTGTTATTCTCCATGGAGGTAGGCCAAGCAGCAAGAATGTTTACACCAGGACCGATAATATCAGGCTTTAAGATT
CCGCGACTAGCTATGCTTGGCCCTCTGGAAGAAAATGCAGCAACAACCGGAGCATTTTGATCACCGAGTATAGTGCCTTGGAATGTAATCTGAGCAACAG
GTTTCTTTGTTGAATTCATATACTCAATGATTTTCATTCCGTCTGCATAAGTTACATCCATTGCTGGAAGGACGTGAGCGGTAGCTGAGGTAGTGAAACC
ATCTTCAGCCCCGTTTATTAGAATCATGCCAACACCTCCAGCATCCTCAACAGTTTGTCCTTTTTCAATTCTCGAATAATCGCCTCCTATCATACACAAC
ACTATTTTTCCTTTAACATCGCGGTCACTCAACGTACCTGATCCGCAATAAGATCTGCGAAACTCACTAGCATTAAGTGTAGGAACAAACAAAGGGAAGA
ATTTTGTATTAACAGCCTTTGGATGAAAGGCTGATTCACCTTCAAACATTTTTTTGTTTCCTAGCTGAACTGTTGCCTTAATTTTCCTGTCAAGAGTGCT
CGCGCCTACTGTGAGAATCCACGGGGCTTCGTTTGATACAGAACTTTTGGATGGACCAGTATTACCTGCAGAGCAACTCACAAGAATGCCTCTTTCAGTT
GCGCTATATGCACCGAGAGCAATAGAATCACTGTGGAAGGGACTAGTATATCCACCAAGGGAAAGGGATATGATATCCACGCCATCATCAATAGCTGCAT
CCATAGCAGCTAAAACATTACTGACAATGCAACCAAAAGAGTCACAGGCCTTATAAATAGCCAAGTGAGCAAGAGGGGCAACACCAACAGCAGTGCCATT
AGCATTTCCATACACATTAGCACCTCTTACAAAACCACCAGCAGCAGTGCTGGCGGTGTGAGTACCGTGCCCATCATCATCTATTGGCAAACCATTTTCT
TTTGGGAAAGTCCTCGCACCAATGATCTTGTTGTTACACTTTGTAGTGAAGTTCAATTCACACTTACCCTTCCATTTAGCAGGCGGAGGAGGCATTCCTT
GGTCGCTAAATGAAGGATGGTCAGGTGTGATCCCGGTGTCTAAGACACCGATGATCACACCTTTCCCATAGTTAGAATTCTTCCACAAGCCAATGTTCTG
CTTCAATCCAAGAAAACTCGGGGTACGCGTAGTGTGCAAAGACAATATCCTCTCCGGCCACGCATTCACAAAGCCTGATTTCTTCTCCATTTCTTTCACT
TGCTCTGCTGATAATCTAGCAGCAAAGCCTTTCATCACATTGCGATATGAATATACTAAACGCGGCCCCTCCTCTTCATTCGAGATTGTCTTTGGCAAAA
AAGAATTGTACCAACTTTCTAAGTCCATTGACATTGATTGAGTTGAAATTCGATTTTCTGGAGATTCAACTTGAACTATATAAGTATCTAAACTGCGCTG
CATACTTGGCCGTGATAAACAACAAACTATGAACAAAACAAGAAGGATATTCAACAACTTCATGGCTACAAACAAATTTGGCTAAAAGAAAACAAAATAC
ATGAACTAAATAATGTATAGTTGATGATTTTACATTGTTTGAAGAACTACAATATATAATGCTAAGGCTTCTTGAATTGAAACTTAAAATATTTACATCT
TTTGCTTTATTGATAAAGATTTAGGTGGCACATAATTAAAGTTATCCCTGTCATACTACCAATAATTTAAGTGCAAGGCTTCTTGTATGGAAACTTAAAT
TCTAAAATTATAAGAAAAAAAGGGCCCACGGGTCGTGAACTTCTTTTCTCGGAGAAGAAGCAATGACGGTATCTGGGGAATAAGCATCGGCTAACTCCTC
CATGAACTATGCTTGAAATCTCAGAAACACGTTTATATTATATTAATGTTATGTTACCTCTAAACTTATTTTATAAATAATTTTTTATCCCTTTTCGATT
TACGTGACACTATCTTGTGAGTTCAACGCGTGTTTGACAATTTTTTCAATTGTAGTGCCACGTAGGCCGAAAAGAAATAGAAAATTATTTATAAAATAAG
TTCAAGGAGGATAATAGGACCTTAGTAAAGTACAAGTGTATCTCTGAGATTTCGAGTATAGATTGAGAGATACTTCTGCATTTTCCCTAAGAAAAAATAT
TTTTTTAATGAAAAAAATACATACAAATGTTTTTTTACGGGACTCACTATAACAAATTATGAACTCATAAAGTTTAAATCTTGATTACACGTATCGTATT
ACAAAGAGAACTTTTAATTATTATTTTTTTCCACATGCACCATGTGGATGTTTGCTTTAGTATCTGACAATGTATTTTAATTTATCCTATGTCCTACTTA
AAATACTCATCTCTATAATTTTTAATTGGACAAAATGATAAAAGTTTATATCTAATAAATAATTAGTAAGAATCTTGGTAGGGTCAATATCATATTACAT
ATTGTAGGATTAAGATTTATTTGAGCGGGAATTCAAGAACAAAAAAGTAGTTTAAATTTTGAAGAAAAAAAAAAGGGCAGGTTGAGATCAGTCCAAATGT
GACAGGGTAGAGATCAACAAAATCGTCCTTTTTGTCCTTTTTTGTCAACAAATACAAAAAAAAAAAAAAAAAAAATTCGAATATGTCATCGAACTTTCAG
ATAAGGCTCACTTATGCCGTTAAAAGTTCGGATTATCTATGTCCTTACCGTTAAAGAAAAGGCTCAATCATGCCATTATTTTTTAATAATTGTTTTGCAA
AATTATTTTTGACACATGGCCACTTATAATTCGGCCACGTCATCAAATTTTTAATAAAAAAATCAAAATTCTGAATAAAAATTGAAGTACTTTTTTTTTT
TTTTTTTATCAAAAAATTGATGACGTGACCGAATTAGAAGTGATCACGTGTCAAAAATGGTTTGACAAAATCACCGTTATAAAAATAATGACATGAATGA
GTCTTTTTTTAACGATTATAGCATAAATGATTCAAACTTTTAACTGATGGCAAATGAGCATTTTCTAAAAATTTAATGACATATTTGAGTCTTTTCCAAA
AAAAAAAAAAAAATCACTTTCCAAAAAGGAGCTTTAGTTGAAAATGGTGAAACCAATCTAGCAAGTTGGAATTTTGCCTATTGAGATGTTAGAGGATAGA
ATAAAGATGAAAACCTAATAGATTAGTGTGAACATGTTGTTGTGAAGAAACTGGCTGACTTGGGCCTTATTTGGTTATTGTTGGGCTGTGTTTCTAGTGG
ATTTTTATTGAACAACTTTCATATACAACAAATATAAGGGGAACATTCACACTTAGTCACTTAAAAATTATTTAATTACCCTCAAAATAATTATGTTTGA
TAATTAGAATTCGTAACTACATGTTATATGGAGGAGAGAGGCGATTGAGAAATGCGAGAGAGAGGAGGAAAACAGTGGGAGAAAGGTGAATTGTATATGT
ATATCGGTTAGATAATTATATATTATACATAAATATTTATATATACGGTAAGCGAGAGTGGGAGAGGGAGGAGAGAGGCGGGCAAGGCAGGGAAAGGGGG
GAGAGAGGTGATCGAGACTGGGAGAGGGAGGAGAGAAGCGAGCGAGATTGAGAGAGGGAGGAGAGAGGTGAGCGAGAGTGGGAGAGCAGTGATTTGTATA
TGTATATAATTGTATATTATACATATACATTTGTATATAGGGAAACGAGATTGGAAGAGGGAGGAGAGAGGCGAGCGAAATTGGGGTAAGGAGGAGAGAG
GCGAGTGAGAGAGGGGAGAGAGATGAATTATACATAGGTTAAATAATTGTATATTATACATATGTATTTGTATATACTGTCGAATTATACATAAACAAAC
GTAACTGATTATACAAACTTGAAGTCATCTCAGATAATTAAGGTATAATGTTAGTTGGAGTGGTAATTATAACAAACTATAACTATGGTGAGTAATTAAA
TAGTATAACTTTGCTTTGTTGTGTAATTTTCCCATAAGGGATCGGAACTCTAGGTCCGCCTACATGGCGCCATCACAAATCAGGATTTCATTTTAATTTA
TTTATTTTCAAAACTAGTCTTTTCCTCTTATGAAAAGTTTTGATTTTTATGAAAAAGTTGTGACTTTTATGAAAGATTGTAACGTTTATGAAAGGTTCTA
ATCTTTTTGAAGGAATGTGACTTTTCCGAAGAGTTGTGACATTTCCGATAAGGCATAATAAGAATTTGTTCATACTACTCTTTGTTGTATATAAATAAAG
GGATTACCTCTAATTTTAAAACAACGAAAATTCTGAAGTTCTTCTTCGTCTTAGCACAATTAAATATTTGTGTACTTTGCTCCTATTGAGTGGCTTACTG
ACACTATTATTTTTGTATTAATACGCTGGAAAATACAATCGTTTCATCCGAAGAGGATCTAATTCTTTAAACCTTAGGTATTAGAGGAGAATAATTTTCT
TAAGGGGACAATGTGCATTCAGTGGACTCGATTCTTTCCTTTCTATTTCATTCTATTTTTATATATCTTGATATTTTTTTACAATCATTAATTTATGCTT
ATAATATTAATTGTTGTTTTGGGTTACATGTTTTTAACTTTGTTGTTTATGTTTCTGCAAAGTTATTGTCTCTAACTATATTCAACATATACACATATAG
TAGGTATATTCATTGTGCAGAAAATAAATATTGTGCTTAGTTCCAAGAATTCATGTTTTGATATTCTATATAAAATTCTATAACTTAAAACTGTTATATT
ACATATTATCTATTTTTACATAAATATGAAGTTTCTCACTTAACAATTGAAGAAGTTCATTATGCAAGTTGAAAAGTTATAACTCTTTCATGTTTAAGCG
TAATTCCTTTTTCTAAAGTTGTTAACAATTTTTTGAATTTTTCCCTAAGACATACCACAAATGTATAATCTATGCAACTTAAATGTGTTCCTTTTCTTAC
GAAATGCCTTTGTATATAAATCCTAATTTTCTTCTTTATTTTCATTTTAATGTTGATTAAGGAACAAATTATTTATTATTTCATGAATAATTCATTCAAC
AAATGTTCTTGAGTTATGTGATAATGACAAACATCAAATTCATGTTAAATATTGCTAATATATTTATGAACCTATTTTTTCATTATTTTTAATGTAGTGC
TTCCTCGTTTAATGGGATTAACGCGGTGTGGAATCGTATTAGTTGTAGATCAAATTATTCGGTGTGCTAAATCGTATTAGTTGTAGATCAAATTCAAATG
GCTAAGGCTGAGGGGTGGGGCACAGACAAGCCTCACCTCTTGAGCTAGCTTTCGTGGTTGAGTTATGCCCTAGATCCATTTCATATATAATATGTCATCA
GAGTAGGACCCATCTCAATTCTTGTTTACTGATGATGGCCCCCCTAGGGGTGCCACATCGGATGAAAAAGGGTTGATGGTTGTATCAGAGACGAACCCAC
CCGAATCCTTTGTTTCACCAATGTTGGGCCCCATTTATATTGTTCAAGCACCAGTTGGCAGGCCTAGGCATGTGGGGGGTGTTGAGTCCCCCTCGTCAGC
TGAGGGGTGGGGCCACGGGGACTTGGTTTCCTTATATAACTTGAGCAATCCTCATCTCTTGAGCTAGCTTTTGGGTTGAGCTAGACTCATAATCCATTTT
AAACCGTTCATGTGCAAATTCAGCTTGTTGTTGGACGGGAGATCTTATCTCAGCGACCTACTCCACAAGGCATAATTGTTTAAGCACTGTATGTTTGATA
GAAATCAAGTGATCAGAACCTGAAACTTGCAAGTACAGTGGATAGTTGTAAACGTAATCGGTCTGTCCATTTCCATTTTCCGTTGTGGCTGAGCCTGAAC
TAGCTCGAGCTTCAATAATTCTGTTTTTTTCCGCTTGACTTGTGATAAACCCCCTCAACCTCAGCATTATTTCTCCTATACGCGAAAGTTTGATAACGTA
AAGTGAAAGAAGAGAATAGAAAAAATAGTAGCTCACTCTGAAATGAAAGTAACACAAGAATAATAGAATATAATGAGTACTCTCTGCATTCGTTCTACAT
TTTCGATTCAAACAATTAATGCAGGCTTATTACATGGATCAAATCATTTTTAAAAACGAAACGAGTCTAGATATCCATTGCAATTTCTTGTAGCACAACT
GCAATTGGACTTCTTACAGAGTGCCTATTACTAGTCCATTTCAAGAATCCATGAACTATACCACTGGTTGAACTATTGGCCGTTTTTAAAAAAGTTACTT
GATATGTTTTTTTCTGGTTCATCTTCGAGAACTTTAGAGTAGAGGGCGTAACAGTCACAGAAACTCCTTGTGGTGAAACTATTTCGACAATGTAAGATGA
TTTAGCCTCCCCGACGTTAGTCACTGTTCTTGTATATGTTTGAGGATTTTCTCTGAGTATGATGGAAAATGAAGGATAATTTAGTTGTGCTTCAGGAATA
CTTTTCACTTCCGAGCAATCCACCTTATGTTGTAGAAGGTTTCCAACCTCTCGGTTTGTGTAATTCAAGCCACACAAATAGCGTAAGTAGTCCTTGAAAG
GGGTATCATAAATTAGTCCCGGATCATTTGCTCTGGATGGATTGACATGTCCTGCACCGATGGCATAAATGTTAGCAGGAAGGAGCGTTTCATCTAGGAT
GGGATTGTTGGCGAGGTTTACTGTATAAGCAGTTGTCATGATTGCGGATTTAATAGCTGCAGGAGACCAAGTGGGGTGAGCGCTTTTTAGCAATGCTGCT
ACTCCACTGAGGTGAGGACAAGACATGGAGGTACCCGAAATAATATTGAAGGTAGATTTCGTGTTTGTGTTGTTTTCCATGGAGGTAGGCCAAGCAGCAA
GAATATTAACACCAGGACCAATAATGTCAGGTTTTAAGATTCCGGGAGTAGCTATGCTTGGCCCTCTAGAAGAAAATCCAGCAACAACCGGAGCATTTTT
ATCTCCGAGTATAGTTCCATGGAATGCAATCCGAGCAACATGTTTCTTCGTTGAATTCACATAGTCGATGATTTTCATTCCATCTGTATAAGTTACATCC
ATTGCTGGAAGGACATGAGCGTCAGCTGATGTAGTGAAACCATCTTCAGCCCTGTTAATTAGAATCATGCCAACACCTCCAGCATCCTTAACAGCTTGTC
CTTTTGAAATCCTCGTATAACCGCCACCTATCATACACAAGACTATTTTGCCTTTAACAGCAAGGTCAGTCAACATACCTGGTCCGCAATAAGAGCTGTC
AGAGTCAATAGCAGTTAGTGATGGATCAAACAAAGGGAAGAATTTTGTACTGAAAAACTTTGAGTGAAAAGCCGATTCGCCTTCAAACACTTTATTGTTT
CCTAGCTGAACTGTTGCCTTAAATTTCCTGTCAAGACTGCTCGCGCCTACTGTGAGAATCCACGGGGCTTCATTTGCAACAGTATGTTCGGATGGACCAA
AATTACCAGCAGAGCAACTTACAAAAATACCTCTTTGTGTTGCACTATACGCACCGAGTGCAATAGAATCACTATGGAAGGGACTAGAACTCGAACCAAG
AGACAGCGATAGGATATCAACTCCGTCATCAATAGCTACATCCATAGCAGCTAGAATCCCACTGTCAGAGCAACCAAACGAATCACAAACCTTATAAATG
GCTAGGTGAGCAAGAGGGGCAACACCAACAGCAGTGCCATTAGCATTTCCATACACATTGGCACCTCTCACAAAACCGCCAACAGCAGTGCTGGCGGTGT
GTGTACCATGTCCATCATCATCTATTGGCGAACCATTTTCCTTTGGGAACGTCCGTGCTCCAATGAGTTTGTTGTTACACTTAGTAGTGAAGTTCGATTC
ACATTTTCCCTTCCATTTAGCAGGCGGAGGAGGCATTCCTTCGTCGCTAAATGAAGGATGGTCTGGAAAAATCCCAGAGTCCAACACTCCGATGATCACA
CCTTTCCCATAGTTGGAATCCCTCCACAAGCCAGTGTTCTGCTTCAATCCAAGAAAACTCGGAGTACGTGTAGTGTGCAAAGACAATATCTTCTCCGGCC
ACGCATTCACAAAGCCTGATTTCTTCTCCATTTCTTTCACTTGCTCTGCTGATAATCTAGCAGCAAAGCCTTTCATCACATTGCGATATGAATATACTAA
ACGCGGCCCCTCCTCTTCATTCGAGATTGTCTTTGGCAAAAAAGAATTGTACCAACTTTCTAAATCCATTGACATTGATTGAGTTGAAACTTGGCTTTCT
GGAGATTCAACTTGAACTATATAAGTCTCTAAATCGCTTTGCATACTAGGCCATGACAAACAATTAACGATGAACAAAACAAGAAGGATATTCAACAACT
TCATGGCTACAAATTAGCTAAAAGAACTCTAACTACATATATTCATGGAAGAAAAGTTGATGATTTTTCCTTCTTTGAAGTACTAACATATATAGTGCTC
TAGTCCTATAGTTTTGATTGGTCATCTAGATCAAGATTTAGAATTGTTTACACAATAGATACCCTCATGTTACTTAATGTATTATATTATGTGTGGGAGA
AAGTGAAGTATCATGTGATAGAAATTAAAAGACTAAAGTTGAAAGGAACAATTATATAACAACATAAAACATAAAATAATTTTAGTTGGAACTCCTTCCT
CTATCTCTATTTTCTCAACTCGAATCAAAGACTTCTGATTAAAAACACAATGATCACCCTTCGTTTTACTACATTCTTTGTTGATAATATAATCATCGTT
ATACGAGTATTACGCTTTACAAGCTCTTTTTATTATATGTGTATTCTTATTCCACATTCTATCAGACATAAAATAAAACTTAATTTTCCCAATTGGCTGT
AAGAATTCTAATTTCATACTACTTGCAAGCCATGCTTTTTCCTTTTTCTTTGTTTAGTGCATATTATATTAGGTGCAGAGCTACTGTATTAGGTAAGGTT
TTGATCGAACTCACTATCTTTTGCTTAGATACTGTAGTTATATTTAGGAAATTCATTAGATACGTATAAATATTTACTCAGCAAATTCACTAACTAAAAT
GAGCAAAGAGTTAAGTGACATGTTCTGAATTCATAAACTTTAAATCCTGGTTCTGCGTTTATATTATTACACCACCTAATGATGGGAACTTCAACTACTT
TTTTTCCCTACATGTACCATGTGAATGTTGCTTTATTTCTTGTTTGGTGTTGGATTTAGTATCTGGCTTCTTTTTTTTTATTTATCCTATATCCAACTTA
AAATACTCATATCCTTATAATATTTAATTGTACAACATGCTAAAGTTTACATTTAATGATAAATTACATCTTTCAATAATCTTGGCAGGGTCAGTATCAT
ATTATTTAAGTAGACCACTATGACTCTTGATGAGTATTTTATATTTTCTTTGATTCCTTCTTTTAGGTATTGGATGTTGAAATTCTCCCTCTACTTTCTA
GACATCGTAAGTTGTGGTGGGACGGATAATTTTTATTCTTTCGTTTTTAATTAAATATCTCGAATTCAAACTTCGAGAACAGAAAAATGATAAGGAGCGC
TTCCTCTTTTAATGGTCTTATCAAAGGCGGAGCCACCTTGTATGAAGGGGGTTCATTTGAATCCCATTCGATAAAAAATTATATTATTTATATATGATTA
AAATATTATTATATGTATATATAGTAGATGTTGAATTTACTTCGAATATTTCATCTGTCTATTTCTACATATTAAGAACCCCTGTATTGAAAATTCTGAC
TCTGCCTCTGAGCTTTACGGAAGCGAATCCGAAAGCCTTAAAAGGGAACACCAAACACCAATAATAGTTATGCTTTATTCCTTTATTATTTTTAAATAAA
GTTAGTCACTTTGTAAAAAAAAAAAGAAGATAAAAAGTAGTAGTAGCACTAATATATTAAGGACCCATCCAATTAGCAGCCATTTTTTTCCCCATTTATG
TTCATATTTTATATTACAATAATAACAATCTCTAAAGTTGACAAATTTGACTTCTTTGTATCGAGAAGTTAGGATATTGATTCAATCATATCAAAAATAA
ATTATTTAAAATAATATATTTATATCACAAAATATGTTAAATATATAAATATTAAATTTAGAATTTTATTATCGCCTTCAGATATCATTCTAAATTTTAG
AAACATAAAATAAAATCCCAATTCCGCCTTAGTTTGTAAATTTGATATTTTTGGTCAATTATTTGATATTGGATTTATTATAATATAGTACCATTATTGA
TAACCCTATTTAATACATTTAATGATCAATTCTAACATGTTTAAATAATCAAATTTCCATTATATCTTCCAAGTACCTTCACAAGGGTCAACATACTTTT
ACCTTAATTTAGGCCACAAAAAGACTGGTTCTCTTAGTGTTTTTATTTGTGATTTTCGAAAATGATCGATTCGTCATTAGTAAGAATATTTTATTTTAAA
AGTAAATGTCTTAATAAGAGGTGGAGTTTCATTTTTGTGAGTTTTGTATTTTTGAACGTAAAGATGAGTACTAGTGATAATATATACCTTTGAAATTTAA
AATATTTATATATCAAATGAATTTCTTAACAAAAATATATTGCTTCATCCGAAGATATTGAATCAGGTCAAACTCGTTTATGAGCTTCTACACTCATTCC
TATTTTATTAATGTGAATCTAAATTAATTAATTAAACTCCAAATTAGATAGCGCGAAGAAAAATAAAAAATAGAGAGTATTTTTGTGATTCCTACTTTTA
GATTTTGTGAGATAAAATATAAATAGAAAAAGCTAGGAGCATGTAATTTATTCAATTGGATAATTGATTTATCTTGTCTATGTGATTATGATTACAAATA
ATTAACAAGTTGCAAGTGGACACTTGTATTTACGTGAAACACAAGATGATTTTTATTTTATTTTTTTTTGTTAGAAAAATTATATTTTTTATATTTTTTA
ATTTTAATTTTTTATGTAATATGTTTAAAATAATAAATTAAATGATTTTTTTTATATTTATCATATATCTTTAAGATAAAATTATAACTTTATTTTTTAT
ATATTTTCTTAAACTTCATATCAAAATTAAGACTAAATAAATAAATTAAATAATGCTAAAAAGTATTAATAAAACTATATATGAAGATTAGAAATACTAT
GAATTATTGCAAAACTACTTGACAAGACACTATATGGATGTTTTAACATAATAATTGAATGGAAATAAGATGTGCCCTAAGCTAACACCAAAGAGTAACA
AATGATCCTTAAAAACAGAGTCGGATCTAAAATTTTAAATTTATAAATTCTATTTTTTTTTAAAAAAAAGAAAAAGAAAAATAGCTTACTATGTTTTAAA
ATAGCTTACATATACACATGATATTAACTAAAATTAATAAATTTCATTGAACTCTGTAGCTAAAATTCTAGTTTCTCTTCTCAGTTCAAGAAAGGTGGGA
CATGGACTGACTTTTGTTTTATTTTTACATGACATTTTTGTTTTTTTTTTCAAAAATAAGTGATACAATTTTATATGTGAAAATATTATAATTTTTAAAT
TTTCACTTTATTTTTAATGATATATTTTTATGGCCTAAAAATGTTATGACATGGTAATAATTACAGGTTAAAAGACCATTTATTTTTTAAATTGTATGTC
AAGTTGAATGTATCATAAAATAAAATAGTATATATAAGAAATAGAAATAAGTAGTAGGGTTCTAGTACTAAAAGTAGAAATAAGTCTAATATATAGGTTT
ATCAGATGATTATTTTTCTAAAAATATATCGTAAATATTTTTTTTTAAGAAAAGAAAGTCAATTGTCTATGAGCGAAGGTCCGACCTATATCCACGACTC
AAAAGCGAAGCCAGGATTTGAAATTTATGAGTTTGAGATTTTAGGATAATAATTTTAAATGCTGGTAATAATTTTGGAATTTAATTTATATACTTATTTA
GTAGAATCCTTGAGTCGATGATTTATAGGAAATTAACTTATTTAGTAGAATCATTGAGTCGAGGATCTATAGAAAATAACCATAAGGATAAGATCTATTT
ACGCTCTACCCTTTTTCGAGTTTGGAATTACATTGTTGATATTTAGTAGAAATGTTAACACAGAGAATTTGAGCCGAAGATGTAACCCTAGGGTCGGATA
GACTTTTAGTCGTGGGCTCATTTGAACTCATAACTTTTCGATATGGTATAGATATATGTGTAAAGAAATTATTAAAATATTTAAGATTGAACGGTGCAAC
AGAATTAAATCCATTAAATTTATATCTTGGATCCGTCTCGATCTCTTATTGTTCCCCTTCATATATGTTGTGTAAAGAATTCCCCTATTAAAATTAAGAA
TTCATCCCACAAAGGGACTCTGTTTATAAAACAATTACTCAGAAAGATAAGCACAGGAAACAAAGAGATGAAATGAAAGAGACAAGAGAACAACCAATAA
AGGTCGTGGTGGAGTGAGAAGTACTCCTTTATTCATAACTATAGGTTTCGGGTTCGGACTTTGAGTATGGAAGTGACTGGACACAAGTTGGGAAACAAAC
TAATAGAGAGAAGAGGAAAGAAAATTTAAACGAAAATGATTCCCCGAAAAAATGACATGTTCTCTTTTTATGGTCTGCTTTAACATGGCATTAGAGCGAA
ACACATCTCAATTCATTGTTTCGGATGTTGGGCCTTCTGGCTTATATTGTCCATACTCTAGATGTCTGGTCTATGTATTAAGCCTTTATAGAATTTACAT
GAACAATTTTGGAAATTATAACTATCTGGTACTGATTCATGTGGTAACATTTTTGATCTTATGAAAATGTAACATGCAAATATAATGTAATTCAACAGTT
TCTTTTGGAACCACTCTTGTTATATATTGTTCCAATTATTAAAATGAGAAGAAAATAAAACTAGAAACCAATTGTAGGCGGTAGCACAACTGCAATTGGG
CTTCTTACTGAGTAATTCTTACTACTCCATTTCAAGAATCCTTGAGCAATGCCACTGTTTGGGCTATTATTTCTTTTCGTAAATGTCACTTGGTATTTCA
ACTTCTGGTCCAACTGGGAGAATTCTAGAGTAGAGGGCTTAACAATCACAGAGACTCCGGGTGGGGAAGCTATTTCCACACTGTAAGATGATTTAGCTTC
CCCGACGTTAGTCACTGTTCTCGTATAAGTCTGAGAAATTTCTCCGAGTGCGATGGAGAATGAAGGATAATTTAGTTGTGCTTCAGGAATGTGTTTCACT
TCCTTACACTCCACTTTGCGTTGCAGGAGATTTCCAACCTGTCGATTTGTGTAATTCAAACCGCAGAGGTAAGGCAGGTAGTCCTTAAATTCGGTGTCGT
AGATTAGTCCTGGATCATTAGCTCTCGATGGATTGACATGTCCTGCACCGATCGCGAAGATGTTAGCTGGGAGGAGCCTCTCATCTAAGATGGGATCATT
GGCAAGGTTCACCGTGGTAGCGGTTGTCATGATTGCTGATTTGATAGCTGCAGGGGACCAAGTCGGGTGTGTGCTTTTCAGCAATGCTGCTACTCCACTG
AGGTGTGGACAAGACATGGAAGTGCCCGATATAATGTTGAAGGTAGACTTTGTGTTCGTTTTGTTGTCAATGGAGGTAGGCCAAGCAGCAAGAATGTTAA
GACCGGGACCAATTATATCAGGCTTCAAGATTCCAGGACTAGCTATACTTGGTCCCCTAGAAGAAAATGCAGTAACAACCGGAGCATGTTTATCCCCAAT
AATTGTTCCTTGAAATGCAATTCTTGCAATTGGTTTTGATGTTGTGTTCATGTAGTCAAGAATTTCCATTCCATCTTTGTAGGTAATATACAGAGCCGGA
AGGACGTGAGGATCGGCAGGTATAGTGAAACCATCATCAGCGGTACTAATGATAATCATGCCAACACCTCCGGCATCTTTTACAGTTTTTCCTTTTACTA
TCCTGGGAATACCACCACCTGCCTTGCACACAACAATTTTGCCTTTAATTTCAGGTTCACTCAGAGTATCTGGTCCACAATAAGGTCTTTCAAAGTCAGT
TGCATTCAGTGAAGGATCAAACAGAGGTGAAAATGTTGAATTGTGATCCTTTGGATTAAAAGCTGTTTCGCCCTCGAATAATTGTTGGTTTCCGAGCTTA
ACAGTGGCCTTGAGTTTCCTGTCAATAGTGCTGGCACCTACTGTCAGAATCCATGGGGCTTCATTTGATAAGGTGCTATCATATGGACCACTATTACCGG
CAGAGCAACTTACAAGAATACCTCTTTGTGCTGCACTATAGGCACCGAGTGCAGTCGGATCAGTATAGAATGGGATGCTGCTACCACCAAGGGAAAGGGA
CAGGATATCTACTCCATCATCAATAGCTGCATCCATGGCAGCTAGAATGTCACTGTCTGCGCAACCAGATGAATCGCAGACCTTATAAATGGCCAGGTGA
GCAAGAGGGGCAATCCCAACCGCGGTGCCTTCAGCGTTCCCATACACATTTGCACCTTTCACAAAACTTCCTGCAGCTGTGCTGGCCGTATGTGTACCAT
GTCCATCCTCATCAATTGGTGAATCACTGCTTATTGGGAATGTCCTCGCACCAATGAGCTTGTTGTTGCACTTTGTTGTGAAGTTCGATTCACACTTACC
CTTCCATTTAGCAGGCGGAGGAGCCATTCCTTCATCGCTAAATGAAGGATGGTCAGGTGAAATCCCGGTGTCTAAAACACCAATGATCACGCCTTTACCA
TAGTTGGAATCCCTCCACAAGCCAACGTTCTGTTGCAATCCAAGAAAACTCGGAGTATGTGTAGTATGCAAAGACAATATCCTCTGAGGCCACGCAGATA
TAAAGCCCGGTTTCTTCTCCATTTCCTTTACTTGCTTTGCTGACAATCTTGCTGCAAAGCCTTTGATCACATTCCGATATGAATATATCAACCATGACTT
TTCATCTGAGCCAGCGATTGCTATGGTCTTTGGCAAGAAAGAATTGTACCAGCTCTCCAAATCCACTCTCGACGATTGAGTAGAAATTTGGCTTTCTGGA
GATTCAACTTGAACTATGTACGTCTCCAAATCGCTCTGCATACTATGCCATGAAAGACAAGCAAGTATAGCAAAAATAACAAAAAATATTTTCATTGTTG
CAAATGTGTTGGGAGAAAGGAACTATGAATTAGTGATGTACACATAGGAAAGTGGAGTTTGGTATTTTTTGCTTTGTGTACTACTATTATATATAGTGTA
GTTTGGTCCTGCAGTGGATGATTGTTGAATTGTTTAGTCAAAAGCACTCCTTTTGATATTTTTTCCTAGTAATGGTTGTCACAATCTTCTTTTCAATAAA
AAAAAAACAATTTTCCACTTGCAAAGCTGCATGTATAACTGTTAAAGAATGACAAAAGTCCCAAATCGGTGGTTAATTAGATGGGTGGACTCTTTATAAG
GCTTGGACAATCCTTTTCCCATTCAGAACTTTTTTTTATAAAAAAAAAGAGGTTACTTTGCTTAGACAAACTTATTCTCGAAGTTATTAACACCTTTTTC
TTGTTAAAACTATCCTTTAACGGATTGATTTCGACTTCCATGATATAACACTAATAGTCCTCCGTATTTGCAAAATTGGCGCACTCTTGGTCCCCAAACA
ATAGTTTCATGTGAGAGAAGGTGAGATTTGTAAATTAGCAACCTAGCATCTAGTCTTAACCAATTTCATAGTTGGTATTGTGCTCGTCCGAGTGTGAAGA
GGCACTTTGCATTCATATGAACAATGAGTACTCTTCTATTCGTGTTGTGACTATTGCACTATTTTGTTGTTCTTGTTCTTTTTTGTAGGCTTTGCACCGT
TTTAATTGTTAGTTGCAATGTTTTCTACTTCGTTGTACTTGAATTTGCTTCTCTTGAGCTGAGGGTCTTTCACCAACAACCTATCTGCCTCCATAAGCTA
GTGGTAAGGTTTGTATACACTTTATATGAAACTTCGACACATGTTCTTGCATTCATTCTCATTTTCCTCTTTGTAGAGCTCGCAAATGTCATGTAGCTAA
TATACACTTTGTGAACGTTTGACGTGTAAAATGTTGAAGGACATATATATGTGAAAGAGATTTGACTACAAGCTCATGATGGAACATTTTGATATTGTGA
AAATGTAACATGAAAATATGGTGTGAGTACTTTTGTCACTTATTATTCAACAATATCTATTGAAACCACTAACATAGTTTTGTTATACACTAATCCAATT
ACTAAAAACCAATTGTAGGTCGTAGCACAACTGCGATTGGGCTTCTTATAAAGTACTTCTTACTACTCCATTTCTAGAATCCTTGAGCAATAGTAGAGGG
CTATCATCTCTTCTCGTAAACGTCACTTGGTATTTCAACTTCTGGTCCAACTGGGAGAATTTCAGAGTAGAGGGCTTAACAATCACAGTGACTCCGGGTG
AGGAATCTATTTCCACGCTGTAAGATGAATTAACTTCCCCGACGTTAGTCACTGTTCTAGTATATGTCTGAGAAATGTCTCCGAGTGTGATGGAGAATGA
TGGATAATTTAGTTGAGCTTCAGGAATGTGTTTCACTTTGTTACAATCCACTTTGTGTTTAACGATGCTTCCCACCTGTTGATTTGTGTAATTCAAACCG
CACAGGTAAGGCAGGTAGTCCTCAATTGGGATGTCGTAGATTAGTCCTGGATCATTAGCTCTCAATGGATTGACATGTCCTGCACCAATGGCAAAGATGT
CAGCCGGAAGGAGCCTTTCATCTAAGATGGGAACATTGGCGAGGTTCAGTGTGTTAGCGGTTGTCATGATTGCTGATTTGATAGCTGAAGGGGACCAATT
GCGGTGTGAGCTTTTCAGCAATGCTGCAACTCCACTGAGGTGAGGACAAGACATGGAGGTGCCCTGTATAATATTGAAGGCAGATTTTGTGTATTTTTCG
TAGTCAACGGAGGTATGCCAAGCAGCAAGAATGTTATTACCGGGACCAATTATATCAGGCTTCAAGATACCAGGAGTAGCTAGGCTAGATCCGCGAGAAG
AATATGCAGCAACTACCGGAGCTTCTTTATCTCCGATTATTGTTCAATGGAACATAATTCTTGCAGTTGGTTCTGATGTTGAGTTGATGTATTGATGAAT
CTCCGTTCCATCATTGAATGTAACATACAGAGCTGGAAGGACGTGAGGATCGGCTAACTTGGTGAAATCATACTCAGGGGTACAAACAAGAAACATGCCA
ATTCCTCCGGCATCCTTTATAACTTGTCCTTTTCCAATCGTGGAAACATAACCACCGTCCATCCACACAACAATTTTGCCTATAATTTTGGGGTCACTCA
GTGTACCTAGTTCACAAAAACGGCTACCTATGTGGGTTGCATTCAGTGAAGGGTCAATCAAAGGGTAAAATGAGGAATCCGGAACCTTAGGACTAAATGC
TGATTCACCCTCAAATAGTTTTTGGTTTCCGAGCATAACAGTGACCTTAAGTTCCCTGTCAATAGTGCTTGCACCTACTGTCAGAAACCACGGAGCTTCG
TTTGATAAGTGCTATGGGATGGACCACCATTACCCGCAGAGCAACTTACAAGAATACCTCTTTTTGCTGCACTGTACGCCCCGAGTGCAATCACATCATT
ATAGAATGGCCTGCTAGATCCACCAAGTGAAAGGGACATGATATCTACTCCATCATCAATAGCTTCATCCATGCCAGCTAAAATTTCAGCATCGGGGCAA
CCAAATAATGGACTGACCTTATACATGGCCAAGTGAGCAAGAGGGGCAATCCCAACCGCAGTGCCTTTAGCGTTCCCATACACATTGGCACCTTTCACAA
AACTTCCTGCAGCTGTGCTCGAGGTGTGTGTGCCATGTCCAGCCTCATCTTTTGGTGACTCACTTTTTAGTGGGTAAGTCTTTGCACCAATGAGCTTGTT
GCTACACTTTCCAGTGAAATTTGAATCACACTTTCCCTTCCATTTAGCAGGTGGAGGAGGCATTCCTTCGTCACTGAATGAAGGATGATCAGGGGTAACC
CCTGTGTAGAAGACTCCAATGATCACACCTTCTCCATAGTTGTCATCCCTCCACAAGCCAACGTTCTGTTGCAATTTAAGAAAACTCGGACTATGAGTAG
TGTGCAAAGACAATATCCTCTGAGGCCACGCAAATATAAATCCTGGTTTCTTCTCCATTTCCTTCACTTGCTTCGCTGACAATCTTGCAGCGAAGCCTAT
TATAACATTATGATACGAATATATCAACTGTGGTTTTTCATCTGAGCCAGCGGTTTCTATTATCTTTGGCATGAAAGACTTGTACCAGCTCTCCAAATCC
ATTCTTGACGGTTGAGTGGAAATTTGGCTTTCTAGTGATTCGACTTGAACTATGTAAGTCTCCAAATCGCTCTGCATACTAGGACATGAATAGAAAAAAT
AACAAAAAATATTTTCATTGTTGCGAATGTGTTGAACTAATGATGTACACTTAGGAAAGTGGAGTTTTGCTGTACAATGTGCATAGGAGTTCAATGGCTA
TAAATATTTTTTAGTTGTTGTAACTAATGAGTGTAGGATTTAGTATTCTTTCTTTATTTTGGTTGTTATTTGAGTTTTTTTTTCAAAAATATTTGCACCT
ATATAGTTATAATTTTAGTTTAGACTTTATACTGAATATAATTGATATGAGTTGGGGTGAGATAGTTGAGATTTTTCTACCCTTAATTAGAATTTAGGAG
CACGAGTCGTAGAATGGGTAAAAAATCATGTTAGGAGCGCCGCTCCTTCAAATGTGCAAATTCGAATGTAGTTGGACTCCAATGTGGATATCAAGCACCG
AATGAGGAAACAACATATCCACTATAAAAATATATCAGTACTTCTTGGAGTTTACTCAACCATCGCGAGTTATAATTCTAATTTGATTTTCTGTACTTAA
GTCTTACAAAATGAGTAGTAGTTGAGTCCCAAACATATTAACTAATCGAGTTTGTCAACTTACAAAAGAGGCTTGCACTGTAGCACTGGAAACATGAAAT
AGTATCAGCGGTACACTGATTGTAATCGCCCTTCTTTGATAGTCACATCTCAAAGACTTGCCTATAACAACAGACCTGAAAATTCACTGTGGACGACAAA
ATAGCTTTAGTGGAAAGATTTTTTAAAAAAAGGAACTCGGGAACACATGTAAAAATAGCAGCAGCACCTTAGAAACACTTCCTACGGACAATTGATGTAC
CAGACTTGTCGTACTCGCTCTTCTAAATCCACATCTGATTAAGCACAAAACATGTTTAAGTTAGCAACAACACATGAGTTCAAAATGTAGCTTAAAATTG
CAAAAGTGTACGCAAGAGAAGATATTTGAAGACAGTGATTTTCTTACTCGTTGGATTAACACCCTGCAAATGTATATCTGTAGCCCTTACCTTTCAAAAC
GTAGTTGTCTGGTCGCTATACGAAAGAAAAAAGATGTTTAGCATTTTTGTCTACCTCTTTTACCTATCAAAATTTCTAGTGACATAGGATGGTTGATGAT
TACAAGAACTAAAAACTTTCGATTAAACATGGTGGCAATTGAGACGTGAATTAAAACACGGCAAGAGCATAAACCAATAAGCAATGAGAAATATAGAATT
ATATAACATGTGACAATGGAAGTTGCACTTATTTCCTAAAAACTTGTGATCGTTATCCTATAAAAAATTTAGATTCTCTATGGAGGTTAAATATAATGCT
ATGTGTTTGATGATGAGCTAGCACGGCATGATTAAAAATGAAAAGAAGTAACAAAAAAGCAAAGTGAAATAAAAAGCTTATGAGGGAAAAGAATAGCTTA
CATCAGTTGGGGAGTCATTCGTTTTAATCATTACATGCATTTCCAATCGATCTGTATGGTGGAGATATGAGCAATATTTGTCCAGTATTCCCCCTTGTTA
AATTCTAGTAGTGGTGTGAGCAATGAACATTTGGAAATAGATAGTTTAGAGAGGGAAGAGGGCATCCCTTTTTCTGAAAGTGAATGGAGATTAGGGCAAT
GGGAGATGGTCAGGTGAGAGAGGGAGGAGGGCAGTGCTGATTCAGCAAGTGATTGGAGATTAGGACAGTGGGAGATGTCCAGGTGAGAGAGGGAGGAGAG
CAGTGCTGATTCAGGTAGTGATTGGAGATTAGGACAATGGGAGATGTCCAGGTGAGAGAGGGAGGAGGGCAGTGCTGATTCAGGTAGTAATTGGAGATTC
GGGCAATCATAGATGTTCAGGTGAGAGAGGGAGGAGGGCAGTGCTGATTCAGCAAGTGATTGGAGATTCGGGCAACGGGAGATGGTCAGGTGAGAGAGGG
AGGATGGCAGTGCTGATTCAGCAAGTGATTGGAGATTACCGAAATTCCTGATTTGTAGAGTTTGAAGCGAAGTGAGGTGAGAAAAGGAGGAAAGACGGCC
AATCTGAGATAAATTACCACCAATACTTAGACATTGAAGAGAGGTGAGGCTTTTGAGATGTTGGCTGCTTAATGTTATCATATTGTATACCTCAAGTTCT
GTAATAGAACAAGGCAACTCCCAATGTTCAATATCTTCGTCACTCCCATCATGATGGATCACTAACTCTGTGAGTCTCTGTAAATGCCACTCCTTTCGGC
CATTCACCAGTTTCTTGCAATCACTGATACGGAGTTTATGTAAATTGAAGGGCAATTCTCCTTCTATTTCTGGACAATTGGAAAGATACAAATCCTTGAG
AGATGGAAGGAGTTCCTGCATACGTTCTGGCAGACACTTGAGCTTCTTACACTTCAAAATATGCAGTAACGTCATCTGGGCCGCTCCTCCACATGCCACC
GATAGTTTTTCAACATTCTCACAATTCGAAATAGTGAGAGTTTCAGTTGCAGTAGGAATCAAAAACCTAGTAAAGTTGTGGCAACTCATAATACTCAATT
TACACGCTGCTGGGAGAAACTCTAATGATATTATCATCTACACAACCACAATCAATCACACTCAAATACTCCACAAACATCTCACCAACTGGCGCCTCGA
ATTTCAATTTTGGGCAACCAGATATCTCTATTGTCTTCAAGGTAGTTGGCAGTATGCTAAAAGGAAAGGAGGTAATAGAGTTACAATCACGTATATATAA
TGCTTCAATCTGCTTCATTGCTTCAAGTTGGGATCTAAACAGTTGAGCATCATCAAAAACAACTGGACAACCTCTAACTTGTAACCTTTTTAAACTTGAA
AATTGGATGGGTATCTTCAAACTGAGCTCAGGGCAATTTTTAATGGAAAGGTTCTCAAGTGTAGGGAACTCTCCAATTCCTAGTGCGTGCCATTGCTTCC
ACCCCGTCATATCTTCAAATTCAAGCTTCTCAAGACAGTTAAAAGGCTTTTTGGAGGACAATCTGCCATAGAATTCTTCCATCGCCTCTGTGATTCCATG
CATCCCTTTAACGGAAAGGAATTTCAAACAAGGGAGTTGTCCTAGTGCTGGCAACGAATAACAGTTGTTGCAGTTTCTAAGAGACAATTTCACTAGCTTA
ACAAACAAAGGATCAGCTACCCAATTGGGGAAGTTTGTCCCTCTGTATCCACTGATTTCGACTTCTTTAATGTTTTTATGTGGGCGTAGCTCATCAAGTA
TGTCTATTTCTGTTTGTGAATTGTCAGCACTAATGCTTTCACTCCACTCCAAAGATAACTTGTCAACGTGATTCTTCTCCCTCATCTTTGCCTTCACAGC
TTCCCTTCTATCAACCACATTTTCCAAATTTACAACTGATAGAGATCCATACAAGTTTTGTGCTTCACCCAAATATTCCATTCTCCAACCACCTACAAGA
AACTTGGCTCCCACCAACACTTTGAGGCTTTTCAACCTGCTCAGATGTAGTGGCATCTTCAAGCGCCGAGTGTTGCTTATGTCAAGATGACGCAAGTTAA
TCAACTTTTCCATCTGCAGCGGTAGCTCCTCAAGTTTAGAACAAGATGACAGGAGAAGTGTCTCCAAGTTATACAATCCACAAATGGAATCTGGCAACCT
TTTTATCCTTGTCTGAGAAAGGTCCAAAAATCTGAGGAGCTTTAATTTGATAAACAATTCATTTGGCAACTCAACAATCGTGTAATGATGAGACAATGAT
AGCATCCTCAAGGATATTAGTGTAGGCAGTATGTTATGCAACACCCTCTTGCTTAGAGGGTGATAACGATAATCGCCAATAATATATATCGGAAGCAATG
TCCTCAGCTGCTCCAATTTGTAGAGGGGTGTCAATTTCTCAAACTCACCATCTCCTCCTATAGAATAAGATAAGTGCCGACATTGTTCCAACATATGCGA
TCCTTTGTTCTCTTCCAACCTTATACAAAGATTTGAAGATACAATTTGTGCCAAATCATTGACAAGGTCATGCATTAAGAATTTCTCTATGTCCCCTTTA
GAAGGATTTGGGACACTTTCTAATAATGATCTTGATCTCAACTCGAGAAAGTATTGGTTGCCTAAATCTTGAATTATTTCATCTTCCACAGGTACAAGAC
CATTGGCAATCCACAGATGAATAACTTGTTCTTTCCTAAATGGATAATCTTTAGGAAATATTGCACAAAAAGAAAAGCATCGCTTTAAATGTGCGGGAAG
ATCATTGTAGCTCAACATTAACGCTGGTAATATGTCATTGTCTCGCAGCTCCCATATTTCACTTCTCAGAATACATTTCCACTCTTCAACCTCTGATTTG
GAGCGTAACATGCCAGCGAGCGTCTTCAGAGCTAAGGGCAGTCCTTTGCACTTGGCTGCAATTTGTTTTCCAACCTCTTCAAGTTCCGGATGTTCCATAG
GATCCATGTTTTCAAATGCATTTCTTTTGAATAGAGACCAAGAGGCTTCAGTAGACAAATTGTCCATGCTAATTTGCTCATTTCCCATCATCAAGGCAAC
ACTCTCTTTACGTGTCGTCACAATGATCTTACTTCCTATATCTCCTTGTACAAAAATATTTCTCAAGTCATCCCACTCATTGTAGTTGTCATTCCACACG
TCATCCAGAACAATAAGAAATTTCTTTCCCTTTAAGCTTTCCTTCAATTTGACTTGTAGCTGGTTAAGATTGTCATCAACCTTTAAGTCGGTTGAGCCAA
TTTCTTGAAGTAACCCTTTCGTTATTCTGAAAACATCATATGCCTCAGAAACACAAAACCAAGCTGTCAAAATAAAATGTTTCTGCACTCTCTCATCATT
GTAAATGGCTTTAGCAAGTGTTGTCTTGCCCAGGCCGCCCATTCCAACAATAGGAACTACAGCCAGATTTTTTCCCTTTGTATCCATCGACAACAAACGG
CCAATCAAATTCTCTATTTCGTTCTGCCTTCCAAAGATACCAGAATCATCCACCAAAGAAGTTGAAGGTGTTCTAGTTTCTTGTTTGGTCGAAATAAAAT
GCTCCTTTAAGCCAAGGCGACCAATTTGCTTTTCCAACACCTCCAACGTTTCAATGGTTTCTTCCAATTTATCCTTTATGTTACGAAAGAAATCATCACT
CAAGCACAGGTTGAGGTCACTTACTTGTTTGTTGCTTGTTTCTGCAAGATTTTGATGCTGGCCTTCCACCTTAAGCCTCAAAGCTTCATAATTGACTTCT
TCTATTAAATTTTCAGCAGAGTCAACAGTATCTCGAAGCTCATTAAGCCAGTCGCTCACAGATGGATTTGATGCTTGCTTATTCTCTGCATCACTCAGCA
CAATCTGAAGACCACGCAAAGTCATTTTCAGCTTCTTTAAGAGCTTAACATGATCCTTATGCTTACGAAACATGTTGAGCAGATCACCGTGAGGAGCAAG
CCTATCAAACAGAACATTCAAAGCTGAGGAGAGAAATGCACCACCAACTGCTAACCCAATCTCCATTTCTCAAATCTGAAAGGAAACACAAAATGATTTT
GAGAAGATGAATTTTTCTGTATCTATCTTCAACTACTAAGAGAGTGAGTACTTTACTTCACCTGTTGAATGTTGAGAGTAGTTTGCAAACAAGAATGATC
AGTGATTGCTTGAAATGAGTAAAACTATTTTTCAGGAAGCAAAACAGTCCTCTTTTCTCTTTTTAAAAAGTATGGACTTGAATAAACAAAGACTGATTGA
ATAATTGAGGCAATTATTCAATTACTTTTGCTTTATGCACCTGTCCATTTTTCAACAGCTCATTGTAGTGCTTAATTGGGCCTACCATAATTGTGAAGAA
TTGGATTCTGTTCCATTTTCCTTTAAGGTATTACTTTTTGGCATGATACGTAAATACACCCTTTAACTTGGCTTCGAATTATATTTATGCCCTTCAACTT
TGGGTATGCACTAGTAGACATTTAAACTTGTATAAAGTTGAATAAACAGACACACATGTCATCCTACATGTCATTTTCCGTCCTACGTGGTGTCTTACGT
GTATTTTGCCATGTAGGACTCATGTGTTTATTTATTTAAAAGTTGAATAGTTAAAGCTTTGTCTGTTTGTGCATTATGAAAGTTGGAGGTCAAAGTTAAA
ATTTAAAGTCAAGTTTAGTATCCAATATATGTATTATGTCTTACTTTTTCAATGTTTAATAAAGCCGATGGTCTATCGGAAACTACCCTCTACCTCACAA
GGTAGTGGTAGGGTCTATTTACACATCTCACTTTTCGGCCATTTACCAGCTTTTCGCAATCGATGATCACAAGTTGTCGTGCAATCCTCAACTGTTTGTG
TTACAACATCAACTTCAAAGAGTATGACTTTTCATACAACAACAAGAGGCAAAAGAGGAAGGATATTTTATTTATAATCAAAACTGTCCCTATTTTCACT
TTTCACCCAACAACAACACTTTGTCTTCATAATGTTTTATTTTCATTTCTTCTTACTTTACTATCACACACAATTTTTCTTTTATTTTATACTTGAAAAC
ACGTCAACAAGTTGGGAATTTGATTACACCAAAGAGCTATGGCAATTTTCAAAATATAAAAGTTTTCCCTTGTAGTTGTTTTGTTATATACAAGAGTTAG
AGTTTTCGAGCTTGAACGATTAAAAATTGTATTAAAGTCTTTTTGATAGTGCGAACTAAAACACATCATAATAAATTATTACCAAGCAAACTCAGATGTA
TTTTTTATTTACAATAAATCAGTAGATACATACCACCATATAGTTTGGTCTTTGGTGGGGACTGACAAATATACCACCAAATTGAGATATTTTTATTGGA
AATAAACTTTCACCAACTGAGACAAGATGTTTTATTAGATGTTAAATTATATAGAAATGACCTGTTGTAATTTTTTATACATAACATTCTGTATTTTATC
AAAGCACAAGGGTGCAACTCTAAACTCTCTCTCTCTCTCTATATATATATACTAGTTTTTGCATACGTGCTTCGCACGTGTGTTTCATGTGAATTTTTAT
AGATACATTAGAATGACTAAAATTTCATGGAAATATATATGTAAATTGTAATGAATAATAAATGTAACAATTACAAAATAAGAATAAAGACTTACGGCAA
TAAAACATTCATAGAAAACTAAATTTTGAAGTCTAATAGAGAGAAAAAAAGACAAAAAGAAACAAATTTAAGGAAAAAAAAAATGTAGACATTATTCTTA
TAACACTGATGTATTTATACATGAAAAAATAAGTACACAATTATTTAAATTTATACCATTAAATATTTAAACTATAACAGATCAATTTATAAAAAGGGTA
AAAGCGTAATCTAACTTTCAATTTTTTTGGTTCATGCTTTTAGTAATACTAGTATTTGGACACGCATGTTGTGCGTGTAACCCTTTCTAGTGAGCATAAG
TATTTTTAAAAATTGCATCAATATATAATAAATATATTCAAAAATCAATGACATCCAATATCTAAAGTGTAATCTTGAAGATTCTTAATTAGTACTAAAT
TGATTTTAATTTTACTTTATGAGTTAAAATTTGATATGAATTTGTCAAATTTTAATAATTTTTGTATAGATATTATGTTTTGAATAAAAAACAATTAAGT
TAATTAAATTCATACATTACAAACTTAATACACTCATATCATCAATTAAACACTTGTCCTACCACCACAATCAATATAACATTTCTAAACAAACTTCATT
TGATAATACTCATCGCAATTATAATATATTGTTGTTAGAAAAAGAAATTCAACATTTCTTTTATATTTTTTGGAATTGTATTGTTAAAATTGTACTTGAA
AAATAAAATAACATGATAAAAATAATACTATGACACTTGAGTGATGAGTAATATAAATTCTGAATAAGAAATGGAGGGATAAACTATGGATCAAACAACT
AAAATAATCAACTAAAATTAAAGCAAAGATAATTAATAAAATTTCATGAGTAAAATAACCAAAATATGATTTTTTATTCATTCCTTTTTTTCTTTACATG
GGTTGTTATCTTCCCTTCTTTCTTTTGGATGAAAACTCCATTAAAAAATTTAAATTCAAACAAAGAAAGTGAAGCTGAATAGCCAATGAATATCACATCA
CTAACATGCCAAAGCTCATAACACATTTTTTTACTTTTATTGGGTTATGATATTTGTTATCAAAATTCAATAGTTAATTAGCTTTATACACAAATAACTC
ACATGAATCTGCATATGAAAATTCAATAAATTTGACCTACTATTGACAATATATAATAATAATAATAATAGTAAAAAAAAAAATACAGACAAAGAATTGT
GCTAACAAAAAATATGTCAGAACGAAATGTGACTTACCCCGTTTGTATTGGCACAACTCAAAGTACAGTTCTATTCGATCGACACTGAAGCATCTCATCA
ATTGATTTTCCCTATGACAAAAAAAAAATTTATCTCATAAGATATCGACACAAAATTACAAATTTTATTTTTCGTCAAAGATTAAAATCTTAAACATCAG
TCAAACATCATAAAATATATTATAAGTAAGAAGTAAGAAACAAAATAAAAAATAACTTAAAATAACATGCACAATGCAACATCCAAAAGAAAAATATTTC
AATGCTCTCTATCAAACTCATAATAAAATAAAATGTAAAAAGCAAGAAGAAATACATATATGAAATGAAAAGACAAGGATCATAGTGGGGAATGTAAAGA
GACAATAGTTTCTTTAGAAGATTATTAATGAATAATTATTTTTTTTATAATATATGATATAATATATGATTGATTTGATTTGACATACCTATTCTAGAAC
CTTTTAATTGTTAAAGCGATTAAATGATTTTGATTTTATTGATCACATCGTCCTGTTGTCTTAATCGATAAACACCCTTTTTGGAATGTTAGTTAGCAGA
CAGTTTGACACTAATTGCACGCTTTCCTAGAAATCATTAATATTAATGACCATATGCCAAAGCTTAAACTTGTTAATTAAGAACAAAATTTGTATTTGCA
AAGCAAGAAGTTTAACTGAATATTGGGCTATTGACACTGACATTTTGATGAATAATGACTGTTCCCATTGAGATTTTTTTGAAAAATATACTGGTTATCT
GAACTTAAGTAATTTGAACATAATTAACAAGAAAAGAACATTTGTAATCAATTTTCATGAAATCATCTCTCGACCCTTAAAACCTTATTTCGTAAAGAAA
ATACGAAGAATAAAATATGAGTCTTGTACGAGTGTAGTTTGAAGTAGACAATGTTTTTAAGGCTGTCAATACTTGGAGGACCAAAGTAATAACTGACGTT
AAGTTTAGGGATATTTTTCAATACTTATCGCTTATATATTCAGGGGTTAAACTATGTATTCAGCCATTATAGAACTTACAAGAACAAATTCGGAACTATA
ACTATTTGAACTAACTTATGTAATGTTTGCTGGAAATAGCCCCTTGCAGAAATGCACGACAAAGCTGCGTACAATAGATCTTTGAGGTCCGTCTCTTTTC
CATACTTGCCGTAAAGGGAGCTTAGTGCACCAAGTTGTCCTTTTGTGGCGTACTAATTCATGTAGTAAACATTTTGAAATTGTGAAAATGAGTACTTTTG
TCTCATATTATACAATACTTTCTGTTGAAGACACTAACAGAGTCTTGATATACATTGTTCCAATTGTTGGCTGTAGGATAACTGCAATTGAGCAATACCA
CTGTTTGTGCTATTATCTCTTCTCGTAAACGTCACTTGGTATTTCAACATCTGGTTCAACTGGGAGGATTTAAGAGTAGAGGGCTTAACAATCACAGTGA
CTCCGGGTGGGGAATCTATTTCCACGCTGTAAGATGATTTAACTTCCCCGACGTTAGTCACTGTTCTAGTATATGTCTGAGAAATGTCTCCGAGTGTGAT
GGAGAATGATGGATAATTTAGTTGAGCTTCAGGAATGTGTTTCACTTTGTTACAGTCCACTTTGTGTTTAACGATGCTTCTCACTTGTTGATTTGTGTAA
TTCAAACCGCACAGGTATGGATGTTCAGGGGAAATCCCGGTGTCCAAAGACTCCAATGATCACACCTTTTCCATAGCCTCCACAAGCCAACGTTATCCAA
GAAAACTCGGAGTATGGGTAGTGTGCAAGGACAATATCCTCTGAGGCCATGCAGATACAAAGCCTGGTTTCTACTCGACTTCATTCACTTGCTTTGATGA
CAATCTAGCAGCAAAGCCTATGATACGAATATATCAACCGTGGCTTTTCCTCTTGTTGTGCGGAATTTGAGATAATACGAGAAAATATAAACGCGAAAAA
CAAGACAACAGATTTACGTGGTTCACCAATAAATTGGCTACGTCCACGGGAAGAGAGGGAGCAGTTTTATTATGGAGAGGCAAAAACAGAATTACAGAAT
AGGGTTTCCCATAGCGTCTATATATAGTGCTAAGCTACGCCCTAACAGGCTTGGGCCCAACATACAGAATCAACAGAAAATTAAGGGCCCAATACAACAA
CATTGTATACCGTCCTTTCTGTTTGTAGCGGGTCCGATTCAAGGCATTCAACACCTCTGAGTCAGCAATTTCTATGGTCTTTGGCATCATGGAAGGAAGC
TTAATTCTCATAAACTTCTTAATTAAGAACATATTTGCATTTGCAAATCTACAAGTTTAACTGAATATTGGACTGTTTCCCTTGACATTTTTTTTTGGTA
ATTTGCTTTGATTTTTTGATAAACCTTCTCTAGAAGTTAATAATACCTTTAACTTATCCAAACTGTCCTTTGCAGATTGGATTCGACTTTGATAATCACC
ATTCTGTTGTCTTAATCGATCAACACCCTTTGTGGAATGTATGCTTATAATGAAACTGCCTTCATTTTCAAGAACCGGACCAAGAAAAAGATCCAAAGGC
TTGTGGTAAGTCCTTCTTCATCCTTAACAAAGAGCCTCAGGTTCGAGTTCTGACTATATAGTAACCTTCATTAGAAAGCGTCAATACGAATTTGGATTAA
GTGGGATCCCAATACGGGTAGGGGAAGCTGGATGGGAAAAAAAGAGAGAGAAGAGAACATAAAACTAAAATGATAATGATTTCCCAAATACATGAAAAAA
ATATAAAAGTTTGACATGTGTTGTCCATATGAAGTTTCTGACACTATATTTTTGCATTCACTCTCCTTTTTTATGTGTAGAACGTGAGAGTGTTGCGTAG
CTTAAGTGATGTATATTAGATGAACTTTGTGAAACGTTTGACGTGAAAGTGATGCTCGTGAAAGAGGTATAACTACAAGCTCAGGTGTTAACTATGTCTT
TAACCTTTATAAAATTGCAGGGCTGCATACGATAGATCCTATAGTCCGGTCCTTCCATAAACTCACACATAGCGGAGACTTAGTGTACCAAGCTGCTCTT
CAATGTAACATGCAAGTAACAAATTATTCAATGGTTTTTATTGAAACCACAAACATAGTGTTGTCATACATTGTTCCAATTACTAAAATGAGAAGAAATA
TAAAACTAAAAACCAATTGTAGGTTGTAGCACAACTGCGATTGGACTTCTTACGGAGTACTTCTTACTACTCCATTTCAAGAATCCTTGAGCAATACCAC
TGCTTGTGCTATCATCTCTTCTCGTAAATGTCACCTGGTATTTCAACTTCTGGTCCAACTGGGAGAATTTCAGAGTAGAGGGCTTAACAATCACAGTGAC
TCTGGGTGGGGAATCTATTTCCACTGTGTAAGATGATTTAGCTTCCCCGACGTTGGTCACTGTTCTAGTATATGTCTGAGAGATGTCTCCGAGTGTGATG
GAGAATGATGGATAATTTAGTTGAGCTTCAGGAATGTGTTTCACTTTGTTACAATCCACTTTGTGTTTAACGATGCTTCCCACCTGTTGATTTGTATAAT
TCAAACCGCACAGGTAAGGCAGGTAGTCCTCAATTGAGATGTCGTAGATTAGTCCTGGATCATTAGCTCTCAATGGATTGACATGTCCTGCACCAATGGC
AAAGATGTCAGCCGGAAGGAGCCTTTCATCTAAGATGGGAACATTGGCGAGGTTCAGTGTGTTAGCGGTTGTCATGATTGCTGATTTGATAGCTGAAGGG
GACCAATTGCGGTGTGAGCTTTTCAGCAATGCTGCAACTCCACTGAGGTGAGGACAAGACATGGAGGTGCCCTGTATAATATTGAAGGCAGATTTTGTGT
GTTTTTCGTAGTCAACGGAGGTATGCCAAGCAGCAAGAATGTTATTACCAGGACCAATTATATCAGGCTTCAAAATACCAGGACTAGCGTAGCTTGGTCC
GCGAGAAGAAAATGCAGCAACCACCGGAGCTTCTTTATCTCCAATTATTGTTCCATGGAACATAATTCTTGCAGTTGGTTCTGATGTTGAGTTGATGTAT
TGAAGAATCTCCATACCATCATTGAATGTAATATACAGAGCTGGAAGGACGTGAGGATCGGCAAACTTACTGAAACCATACTCAGGGATACTAACAAGAA
TCATGCCAACTCCTCCAGCATCCTTTACAACTTGTCCTTTTCCAATCGTGGATACATAACCACCTGCCATGCACACAACAATTTTGCCTTTAAATTTGGG
GTCACTCAGAGTACCTGGTTCGCAAAAACGGCTGCCTATGTGGGTTGCATTCAGTGAAGGGTCAATCAAAGGGTAAAATGAGGAATCCGGAACCTTAGGA
CTAAATACTGATTCACCCTCAAATAGTTTTTGGTCTCCAAGCATAACAGTGGCCTTAAGCTCCCTGTCAATAGTGCTTGCACCTACTGTCAGAATCCACG
GAGCTTCGTTTGATAAAGTGCTATGGGATGGACCACCATTACCTGCAGAGCAACTTACAAGAATACCTCTTTTTGCTGCACTGTATGCCCCGAGTGCAAT
CACATCATAATAGAATGGCCTGCTAGATCCACCCAGGGAAAGGGACATGATATCTACTCCATCATCAATTGCTTCATCCATGCCAGCTAAAATGGCACTT
TCCGAGCAATCATTATCACAGACCTTATACATGGCCAGGTGAGCAAGAGGGGCAATCCCAACCGCAGTGCCTTTAGCGTTCCCATACACATTGGCACCTT
TCACAAAATTTCCTGCAGCTGTGCTCGAGGTGTGTGTGCCATGTCCAGCCTCATCTTTTGGTGACTCACTGTTTAGTGGGTAAGTCTTTGCACCAATGAG
CTTGTTGTTACACTTTCCAGTGAAATTCGAATCACACTTTCCCTTCCATTTAGCAGGTGGAGGAGGCATTCCTTCGTCACTAAATGAAGGATGGTCAGGG
GTAATCCCGGTGTCGAAGAGTCCAATAATCACACCTTCTCCATAGTTGTCATCGCTCCACAAGCCAACGTTCTGTTGCAATTCAAGAAAACTCGGACTAT
GAGTAGTGTGCAAGGACAATATCCTCTGAGGCCACGCAAATATAAATCCTGGTTTCTTCTCCATTTCCTTCACTTGCTTAGCTGACAATCTAGCAGCAAA
GCCTATGATAACATTATGATACGAATATATCAACTGTGGCTTTTCATCTGAGCTAGCGGTTTCTATGGTCTTTGGCATGAAAGACTTGTACCAGCTCTCC
AAATCCATTCTTGACGGTTGAGTGGAAATTTGGCTTTCTGGTGATTCGACTTGAACTATGTAAGTCTCCAAATCGCTCTGCATACTATGACATGAAAAAC
AAGCAAGTATAGAGAAAAAAAGAACAAAAAATATTTTCATTGTTGCAAATATTGAACTAATAATGTATACTTAGGAAAGTGGAGTTTGATGTTTTTTGCA
TTGTGACTACTACTAGTATTTATAGTGTACTTTGGCCTCTCAAATATTTGATTGTTTAATAAAGTATTATTGTGTGTTTAAGGAACTAAAGTTGAATCAG
CAATTAAGAAAGTAATAAAAAGGAAAAGATGGTGATGTGAATTAGTTAGTCTAATTGAACATTTTCCTAGAAATAATTAGTGTTAATGACCATGTAACAA
AGCTTAATTCTCATAAACTACTTCTTAATTAAGCACAAATGTCCACTTGTAAAGCTGTTAGTTTAACTATATTTGGGGTATTGCCAATGGTGATTGTTTT
GATTAAGAACTTCTAATTCTGGTAATTTGATTTGACAAACACGCTCCAGAAGCTTTCAATATCTTTTGCTTGTTAAATCAGTTATCAATTATGATTTTTA
GTGACCATTTCTTGTTGTCTTAATCAAAAATCACCCTTTATAGAATGTTAGTTAGTACGCGGTTTGATAATAATTGCACATTTTCCTAATAATGATTAGT
ATTAATGACCATACGCCAAAGCTTGATTCTCATAACAATCTTCTTAATTAAGAACAAATTTGCATTTGCAAAGCTACTAGTTTAACTAAATATTGGGCTA
CTAACATTACATGTTGATGAATGATGACTGTTATTAACACCTTTTACTTGTCAAAACAGTCCTTAGGGGATCGGATTCAGCTTTTATGATCACCGTCTTT
TTGTCTTAGTCGATCATCACCCATTATTGAATGTAAATCAGTACACACTATGATACACCCTATAATAAGACTGTGTATAATAGATCCTTGTGGTCCGTCC
CTTCCATACACTCACACACACAGAGAGGGCTTAGTGCACTGAGCTGCTCTTTTTTTGGTACAAATTCATGTAGTACTTAAACATTTTGATATTGTGAAAC
TCGTACAAGTGATGAAAATGTAATGTGAATAACTTGTTGTCACATATAATTCAACAACTTCTATTGGAATCACTGACATAAAACATTGTTTCAATAACTA
AAATCAGTAGAAAGAAACACATAACTAGAAACCAATTGTAGACTCTAGCACAACAGCAATTGGACTTCTTACAGAGTGCTTCTCACTAGTCCATTTCAAG
AATCCTTCAATAACACCGCCATTTGTTCTGTTGACTCTTTTCGTAAACGTCACTTTGTATTTCAACTTCTGGTTCAACTTGGAGAATTTCAGAGTAGAAG
GCTTGACAGTCACGGAAATTCCGGGTGGTGAAGCTACTTCCACACTGTAAGATGACTTAGCTTCCCCGACGTTAGTCACTGTTCTTGTATATGTCTGAGA
AACTTCTCCGAGTGTGATGGAGAATGAAGGATAATTTAGTTGTGCTTCAGGAATGCTTTTCACTTCCCTACAATCCACTTTGCGTTGCAGGAGGTTGCCC
ACCTGTCGATTTGTGTAATTTAAACCACACAGGTAAGGCAGGTAGTCCTTAAATGGGGTGTCGTAGATTAGTCCTGGATCATTAGCTCTTGATAGATTGA
CATGTCCTGCACCAATAGCGAATATGTTAGCCGGAAGGAGCCTTTCATCTAAAATGGGATCATTGGCGAAGTTCACTGTGTAAGCGGTTGTCATGATTGC
TGATTTGATAGCCGAAGGGGACCAAGTGGGGTGTGAGCTTTTCAGCAAAGCTGCTACTCCACTGAGGTGAGGACAAGACATGGAGGTGCCCGATATAATG
TTGAAGGTAGACTTTGTGTTTGTTTTGTTTTCAACAGAGGTAGGCCAAGCAGCAAGAATGTTAACCCCTGGACCAATAATATCCGGTTTCAAGATCCCAG
GACTAGCTAGGCTTGGTCCACGAGAAGAAAATGCAGCAACCACTGGAGCATCTTTATCTCCGATTATTGTTCCTTGGAACAAAATTTTTGCTGTTGGTTT
TGATGTTTTGTTCATGTAGTCAAGAATTTCCATTCCGTCTTTGTAGGTAATATACAGAGCTGGAAGGACGTGAGCATCGACAAACATAGTGACACCATAA
TCAGCGGTACTAACGACAATCATGCCAACACCTCCAGCATCCTTTACAGCTTGTCCTTGTTGGGTCATGGAATAACCGCCCCCTACCATGCATATAACAA
TTTTTCCTTTAATTTCAGGGTCATTCAGAGTACCAGTTCCGCAATAAGGGCTATCAAAGTCAGTTGCATTCAGTGAAGGATCAAACAAAGGGGAAAATGC
TGAATTGTGATCATTTGGATGAAATGCTGATTCACCCTCGAATACCTTTTGGTTTCCGAGTGTGACAGTGGCCTTGAGTTTCCTGTCAAGAGTGCTTGCA
CCAACTGTCATAATCCACGGAGCATCGTTTGATAAGGTGCTTTCATATGGACCATTATTAGCAGCAGAGCAACTTACGAGAATACCTCTTTGTGCTGCAC
TGTACGCCCCGAGTGCAATGGGGTCTTGATAGAATGACCTGCTACTTCCACCAAGGGAAATAGATAGGATATCTACTCCATCATCAATAGCTGCATCCAT
TGCAGCTAGAACGTCACTGTCATCACAACCAAACGATTGACAGACCTTATACATTGCCAGGTGAGCAAGCGGAGCAACCCCAACAGCAGTACCTTTAGCA
TTACCGTTCACATTAGCACCTTTCACAAAACCACCAGCAGCTGTGCTGGCTGTGTGTGTACCATGTCCAGCCTCATCTATCGGTGAATCACTGCCTAATG
GGAAAGTCCTCGCACCAATGAGCTTGTTGTTACACTTTTTAGTGAAATTCGACTCACATTTGCCCTTCCATTTAGCAGGTGGAGGAGGCATTCCTTTGTC
GCTGAATGAAGGATGGTCAGGATCAATCCCGGTGTCTATGACTCCAATGATCACACCTTTTCCATAGTTAGCATCCCTCCACAAGCCAACATTCTGTTGC
AATCCAAGAAAACTTGGAGTATGTGTAGTGTGCAAAGACAATATCCTCTGAGGCCACGCAGATATAAAGCCCGGTTTCTTCTCCATTTCCTTCACTTGCT
TAGCTGACAATCTAGCAGCAAAGCCACTGATCACATTGTGATATGAATATATCAACCGCGGCTTTTCACCTGAGCTACTGGTTGCTATGGTCTTTGGCAA
GAAAGACTTGTACCAGTTCTCCAAATCCATTCTTGACGATTGAGTGGAAATTTGACTTTCTGGAGATTCGACTTGAACTATGTAAGTCTCCAAATCGCTC
TGCATACTAGGCCATGTAAAACAACCAAGTATACCAAAAATAACAAAAAATATTTTCATGGCTAGCTGCCAATTTGTTGGTAGAATAGAACTTTGAACTA
GTAAAAGTGGAGTTTGATATTTTTGCATTAGTGTACAACTAGTATATATAGTGTGTTCTGGCCTTGCAAATATTTGATTGTTTAATCAAGAGTTTCGTAA
GGAAAAAAGTCTGATATACCTCTCAATTTTGCGATTTAAACCTGATATATACGTCTCATATTTTGTGTTGGTCTTTAATCGTAACTCTCAAGACAAATAC
TTTTTTCACGAGCCATAAGTTTATCTTTTCGCATCATAATATCGTCCAGTTAGATATAAATTTGATTTCTAACTAAAAATTTTTAAAGAACAACAAATTG
AAGATGCAAGACTTGGTAGACTCCCAATGGATTTTTATTTTTTTTGAATAGTTTAACCATTACCACTACTCTTTGTTAATTAAAGTATTAGTAATTATTG
TGTGATAAAAAAGGTGAATCAAAGAACTAAAGTTGAAGCAACAATTTAAAAAGAAGGGGGGAAAGGAAAAGGATGGTAATGTGAATTAATTAATTAAATT
AAACAAGTTCCAAGAAAAGATTAGTCTTAATGATCACATGGTTAAGCTTGATTCTCATAATCATTTTCTTGATTATGAACAATTTTCTATTTGCAAAGCT
GCAAGTTTAACTACATTTGGACTATTGACAATGACAATATGATTGAATAATGAATGTTCTCATTAATGACAATCTAAAAATATTTGATGATTTATTACTC
ACCGTCTCTAATTATTTGTTCACTTTTAAATTGTCACACTTATTAAGAAAATAATAATTGATGTGGTGAATTTACCAATTTAGTCATATTAATTATGAAC
ATGATGAATTAAAAATCTAAGATTTTCAAGAAGTTCTATCTTTTCAAAATTAATTAATTGAGTTTATAATGGATAAAAAAGACTTTGTCCTTTCTTGATT
TGTCAAAAAAGAGAAATATTAAAAACACTCCTAAACTCGAAGCAAATTATTAGTTTTATCTCCAAACTAATGAAAGCCTTAAAAACACCCCTTTATTTGA
CTGATTGAAGCTAAATACATTCCCGATCTTGCAACAGAAGTGAAAAACACCCCTAAATTCTCGATTTATATTAAGAACCCCGTGCTCCTACAAGAGTTTG
AGACCGATTGTTATGCCATGTTACATATTGGCAGTGTGTCGGGTATGTATCTAAGTTTAGTCAGTCAAGTAGAGGGTGTTTTTAAGGTTGTCAATAGTTC
GAGAATGAAACTAATAATTTGCGTCAAGTTTAGAAGTGTTTTTTCGATACTTCTCTCTTGTCAAATGGACAAATGAAAAAGAAAAATTGAACAAGTAATT
TTACATGTATCGGAAAAGCTTCTGACTAGCCAATTTCCGATGGATTTCCCTCCAAAATTTCCGTCGAAAATTCGAATTAGTTAAAGTGAGTTGAAAGTAT
TTTATTTTGTTGTGAATTAGTAGTGATGAAGAGGTGATCTTATGAGTGGATCTCAAAACAAAAACATGTGAGGTTACAAGAGAGAATGGCGCCGGAATAC
ACTTATTTGCAATGCAATGTGACAAATTGAATCAAGAATAATAATAATTTATGTTGTGTGGGGGGTAATTGTTGAACGGGAAAAATTGTTAGGTTGTGAA
GCTTGATTAATATTTGATGTATAGTCATATATCAATGTTCACACGGTTCAATCTTTTTTAGGCTGTCATTTTTTCTCTGTAACTTAAAATATTCTGAATT
ATTAATAAATATATATATATATCCATCGCCGTGGAAGTTTACTCACGAGGTGTTATCACGAAATATTGGTTTCTCTCTTTCTCTCTCTAGATCTCTCATT
TCTCTCTCAAAAATTCTTGTGTTCTTCATTCATTAAGTTTAATGTGTGTGCACGGATTTGATCCTAACAAAAATGAGTTGGAAAGAAGTGGAACGAGAGC
AAACAAGTGAAGACTAAAAGAGACAGATAAGATGTCAGAGAATATCAGGTTTAACAAAAAACTATGTTATAACTATACACACATTTCAAAGTATTATCAT
TAATGAATTCGAAAGATAGAGTGAATCGGACGGAGGGCTTAAATCAATAATAGCATACTTATCGTTTTTTGAAAAACACATCAATGACTTATTATCGGTT
TTTAGGGACAATACTTCCCGTAGAATATTTTCGATTCCCAGAATCTCAATTCGAAATCTCTAACTAGAGATTGAAGGGAAAAAGGTTTGATATACCCCTC
AACTTTGTCATTTAGAGCTGATATACCCCTTGTTATGAAAGTGACTCATATATATTCCTACTTGTAAACAAATGGCTCACATATACCCTTTTCCTCTAAC
GGAAATGGAAAAAAAAATTAAATCTAATTTTTTATTATTTTTTTCCTAAAAAATATAATCCCAAAAATTGAATCCTCGTCAAACATATTTTTTTTATTTT
TTTTGTTTCAATGACTAATTTATAATTATTATTTTGATAATCAAATTTATTTATGTTTCACTAAAATTCTTGTAAAAACTTATTGTAGATGACCAAATTT
TTTCTTCGAGTACGAAACTAAATTACAGTACACACAAAAAAATAGTTTAAATTTTTTTTCTTTAAACTAAGGAATGAAAGAAAAAAATAAAATAAGAATA
AGAAACTCAAATAATTATAATAAAAGAAGTCAAAATATAATTTATGTATGAAAAAAATAAAATATACCTTGAACTTTGATAGAAGAATCATATATACCCC
TAAATAATTTTTTAAAAAAAATTAAAAGTAATAAATATAAATTTAAAATTAATTTTTTAACTTCCGTTAAATGAACGGTATATGTGAGCCGTTTGTATAT
CAGTAAGGGCATATATGAGTCACTTTTATAATGAAGAGTATATCAGCTCCAAATGACAAAGTTGAGGGGTATATCGGATCCTTTTCCCATGATCGAAAGA
TATCATGGTCTACCAAAAATCTCAGGACAATCAACTCTCTTATTGTTTTCACATTAACATCACATGTCTTTGTATTGAATATGAAAATTGAAAGAAAATT
GCTTTGAGATCCACTCATAAGATCACTACTAATAATTGACAAGAAAATAAAATACTTTCAATCCCCTCTTTTAATTTATCCGATAAAAAAAAGCATAACT
AAAAACACGCGATTTCTCGACAAAAAAATCCTAAAAAAAAAAAACTACGCTCTGATTTACATTTCACAAAGGATGTTGGTCGATAAAAACAACAGGACAA
TGGTCATTAAAGTCGAAATCGATCCCCTCTAAGGATAGTTTTAACAAGAAAAAAGATGTTACATAACAAATTCTAGAGAAGTTGTAAATGTAAATAGTCC
AACATGTAGTTAAACTTGCAACATTATTGCAAGTGTACATTTGTTCTTAATTAAGAAGAATATTATGAGATCAAGATTTGTCATGTGGTCATTAATGCTA
ATCCTTTCTAACAAAGCAATTAACTAGACCAATTAACAAGAATAGCACTACATATACTCCACTGTTCTAAGTGTACATCATTAGTTCAAATTTTCCTTTC
TCTCAACACATTTGCAACAATGAAAATATCTTTTGTTGTTTTTTGTATACTTGCTTGTTTTTCATGGCCTAGTATGCAGAGCGATTTGGAGACGTACATA
GTTCAAGTCGAATCACCAGAAAGCCATATTTCCACTCAATCGTCAAGAATGGATTTGGAGAACTGGTACAAGTCTTTCTTGCCAAATACCATAGCAACCG
CTGGCTTAGATGAAAAGCCGCAGTTGATATATTCATATCACAATGTGATCATAGGCTTTGCTGCAAGATTGTCAGCAAAGCAAGTGAAGGAAATGGAGAA
GAAACCGGGCTTTATATCTGCGTGGCCTCAGAGGATATTGTCTTTGCATACTACACATACTCCGAGTTTTCTTGGTTTGCAACAGAACGTTGGCTTGTGG
AGGGATGCTAACTATGGAAAAGGTGTGATCGTTGGAGTCTTGGACACCGGGATTTCCCCTGACCATCCTTCATTTAGCGACAAAGGAATGCCTCCTCCGC
CTGCTAAATGGAAGGGAAAGTGTGAATCGAACTTCACTACAAAGTGTAACAACAAGCTCATTGGCGCGAGGACTTTCGTAAACAGTGATTCACCGATAGA
TGGTAATGGACATGGAACACACACAGCTAGTACAGCTGCTGGGGGGTTTGTGAAAGGTGCTAATGTGTATGGGAATGCTAAGGGTACCGCGGTTGGGATT
GCCCCTCTTGCTCATTTGGCCATGTATAAGGTCTGTGATTCGTTTGGTTGCTCCGATAGTGATGTTCTAGCTGCTATGGATGCAGCTATTGATGATGGAG
TAGATATCATGTCCCTTTCCCTTGGTGGAAATAGAAAGTTGTTCTATGAAGACCCCATTGCACTCGGGGCGTACAGTGCAACAAAAAGAGGTATTCTTGT
AAGTTGCTCTTCTGGTAACGAAGGTCCATACGAAAGCACCTTATCAAATGAAGCTCCGTGGATTCTGACTGTAGGTGCAAGCTCTACTGACAGGAAACTC
AAGGCCACTGTCAAGCTCGGAAACAAAAAAATACTCGAGGGGGAATCAGCATTTCATCCAAAGGGTCACAATTCGACATTTTTTCCATTGTATGATCCTT
CACGAAATGAAACCGACTTTGACAGCCTTTATTGTGGACCAGGTACACTTAGTGAAACTGAAATTAAAGGCAAAATTGTTGTGTGTTCAGCAGGTGGTGG
TTATTCCAGGATTGATAAAGGACAAGCTGTAAAGGATGCCGGAGGCGTTGGTATGATCATCTTTAATACCGCTGATGATGGTTTCACTAAGTTTTCTGAT
CCTCATGTCCTTCCGGCTTTGCATATTACCTACAAAGACGGAATGGAAATTCTTGACTACATGAACACAACGTCGGAACCAAATGCAAGAATTGCATTTC
AAGGGACAATAATCGGAGATAAAGATGTTCCAGTGGTTGCTTCATTTTCTTCTCGCGGACCAAGTATAGCTAGTCCTGGAATCTTGAAGCCTGATATTAT
TGGTCCCGGTCTTAACATTCTTGCTGCTTGGCCTTCCTCCGTTGACAACAAAAAGAACACGAAATCTACCTTCAACATTATATCGGGCACCTCGATGTCC
TGTCCTCACCTCAGCGGAGTAGCTGCATTGCTGAAAAGCACACACCCGACTTGGTCCCCTGCAGCTATCAAATCAGCAATCATGACAACTGCTAACACAG
TGAACTTCGCCAACGATCCCATATTAGATGAAAGGCTCCTTCCGGCTAACATCTTCGCCATTGGTGCAGGACATGTCAATCCATCAAGAGCTAATGATCC
AGGACTGATCTACGACACTCGTTTTAAGGACTACTTGCCTTACCTATGCGGTTTGAATTACACAAATCGTCAGGTGGGGAACCTCATGCAACGCAAAGTG
GATTGTAGGTCAGTGAAACACATTCGTGAAGCACAACTAAATTATCCTTCATTCTCCATCACACTCGGAGACATTTCTCAGACGTATGCTAGAACAGTGA
CTAATGTCGGGGAAGCTAAATCATCTTACAGCGTGGAAATAGCTTTACCACCTAGAGTTTCCGTGAGTGTTAAGCCCTCTATACTGAAATTCTCCAAGTT
GAACCAGAAGTTGAAATACCATGTGACGTTTACGAGAAGAGATAATAGCCCAAATAGTGGTATTGTTCAAGGATTCTTGAAATGGAATAGTAAAAAGTAC
TCTGTAAGAAGCCCAATTGCAGTTGTGCTAGAGCCTAAAATTGGTTTCTAGTTTTAGTATGTATAACAAGAATATATTTGAATAATTTGTATTGTTACAT
TTTCAACACATCAAAAATGTTACCACATGTTACATTATTACATAGTAACATTGATCACTAACAATAAAAAAACAAGAACAACATAATCCCATAAGTGGTG
TCTGAGGAGGCTGGTGTGTACGCAGCCTTACCTTGTGGAGGTAGAGAGGAAGAATACGATAGACCCTTAGCTCAAGTGACCTTTTTGAGAACTTGAATGC
AGCAACCTATATGAGAATTCATTGACAACTTGTATGATTAAGTACTTTGTTGTTGTAAAACTGCAAGTTTAACATATTGTATTGACATTTTGATGAATGG
TGACTGTTTCCTTTGACAACTTAAAAAGATTCTTAGTTAGCTTTGGCAAACTTGCTTATCTATATATATCAACATTTTATTGCTAAAACTATTACAACAA
CATATCCAGTGTAATCCCACGAATGGAATACAGAGTGGGTACCTTGCTAATACCAGTGGCGTAGCCACCCTTATGTCATTGGACACCCTTCGTCGGAAAA
TTATACTATATATACAAGTAAAATGACAAACAATGTGGCTAAATAACATATTTTGAACACCTTGACGTAACAATATGATGTAGCCTAGTGATTTCGGACT
CTTTGAAAGAGTAAAGACATGCAAACTTAAGGTGGTGTTCAAATCTCAGTAGTAGAAAAAAAAATCACTTTTTTAGAAGAGCAGGTTCATTTTAGCACTT
GGACATCTTTCGTGAAATTTCTGACTCCGCCATTGGCTAATACTATTCATGTTAGTTAAGTTGTGTAAAGATAAGACACTTAAGTCTAACTCAACCCCAA
GAGCTAGCTCATGAGCAGAGGATTGCATAAGTCCATATAAACAGACTATAACAACCAATGTGAGACTTTAACCCACTCTAACATCCCCTTCACGTCCAAA
GGCACAACTAAAGCGTCGATCGAAATCAAAACGGAAATGGACCTGGCTCTGATACCATATAGAGAGTTTTTGGACAAAGAGTCAACAAATTTTTTTATTT
CCTCTCGATTTTTAGTGATCATCACGATAAGGGGGGCCTTAAAACAACAATTTAAATGTTTTTTTTGTGTAAGAGAGGGTTGAAAAGTGGTTATTAGGGA
AATTTACCTATAAAGCATATGTGCTCTCACGGCTGATAGACTTACTAAGAGAGGTAAAACGCTTCCACACCCTATTGATGGTTCTTCGAATGGCCCATTA
ATGTTGATATCAAGAGGTATAATAGAAATTCAAATTTGGGCTCAATTTGACAAATAAGAGTTCAAACTTTGAGGGTGTACGTCTAGATGTCTCAACTTTG
TCAACCATCAAGTAAATACTCAACTCGATCGTCTCCACTATATCTCATGAACACCGACATGACACAACAATTTTGGAGTGTCTAGATGATCATTCTGTAA
GTTGGAGTATTCAACTAAGAAAGTGAAAACGAATTGATGTGTCTAATTATCCGTTCTCAAAATTGAAGTGGTTAATTACTTGCGACTAAGATCAAATTTA
AATATTGTAAATTCTTTATGCTTGAAAAAAAAGACTAAGACTTCACTTATTTGTTTTCCCTAAAATGAACATGACTTGCCTTTAATTAAGATCTTGTGTC
TTTTTTTAATAGATAAAGTTGGAGTCCGGAGCCTAAAGGATATAAAATATTAATAAAAATTTCAAAATGGTATATAAAATTTTATTTTAACCAAAACGAT
AAAATCGCTGGAACAACAACGATTTTCTCCACCGAAAAAGCAAAATCGCTGCTACTGCAACGATTTTGCAATATGCGATTTTTTATAAAAAAAAAATCAA
CTCGCTAACTAGGCAGCGATTTTAAAAAATATATATTTAGAAAATCGCTTCCTAGGCAACGATTTCCATTTTAAATAAAAAAGAAAAAAAAATTAGGCAG
CGATTTTCATTTTTTTAAAAAAATAAATAAGAAAATCGTAGGAAAAACAAATTTTATTGATTTTCAAATACTTTTTTGAAATTCAAATATATAGCTTATA
AGAAATATGCATTGTTTTAAAAAAATTAAGAATAAGTAAAGTAACAAAAATATTTTCTTTCTAAAAGAAACGATATTATATTGAATTTAAATTTAAATGA
TGTTTGAGTTCAAATAGAATTCTAACTTTTTAACCTCTTTTATTTATATTTCCACAATGTCATATAATATTAATCTTCATATTTTTTCATCACCGATCAT
TAGCTTCATTGGTGAGTTTAATACCTTCTTCATATTCTTTATTTTATTATAGATTTTTTTTAAAATATTTTTATTTTCTAAATGCAGATGAGAGATTGTC
TATTTACAAACTAACTTTTTTCTAAAAAAATAAAATAACAAATTGAAAATCGGTGGTTTATTAAATTTTTAAAAAAAATTGGAAAATCGTTGCATGTGCA
GCGATTTCATTTTTTTAAATTAAAAATTAGCAGCGATTTTCTATTAAAAAAAAATGAAAATTGCTGCCTAGGTAGCGATTTGGATTTTTTTTTTAACAAA
ATCACATTTACTGCAGCAATTTTGTTTTTTTCGGTGGAGGAAATCACTGTTGTTCCAGCGATTTTGTCATTTTGTTTAATATAAAATTTTATATACCATT
TTAAAATTTTTATTATATTTTATACCCTTTAAATTTCGGACTCTATAAAGTTGTAGCGCAACGTTATTCCTTGCCAAAACAAAAAAAATCCACTAAATTA
TGTTCCATGTGGATCTGTTATTATTGACATAAAATAATAAAGTCTTTAAAATTATCAATTGAGCAACATGTTATTTACTTAACTAAGGTTCCATGTGGAT
CTGTTATTATTGACGTAAAATAATAAAGTCTTTAAAAAATTATCAATTGAGCAACATGTTATTTTTACTTAGTTAAGTGTCCATCAAAATAATAAAGTCT
TTAAAAAATTATCAATTGAGCAACTTGTTATTTACTTAGTTAAGTGTCCATCAAATTTTCTAAGAACCTCACTAGGGTCAACCTCCAATACACATATTTC
AGAAAATTCACAGATTAATATACGCGAAATTTGGGATAATTCTAATTTCATATCTTGTGATACATAAACTTTCGAAAAAATTGATACCTATCTTTTAAAA
GTAATGATTTATCTTTTAATAGTTTGTCACTAATGGACCCATAAATTTGAGTTGAAACAGAGTTAGCGATACATATTTCGAAAAATAATGAATTTATACG
CACAAAAATATGATATAATCATGAATTCCTTTTTATGACATATAAACTCAGGGGAGGGAAACTTTTCATCGTTCAAAAACAATGAATAACATTAAATAAG
TCTTCATCAATAGATCCACAAAATTTGAGCTCAAACAAAATCAGTATAACTCTATTTGACTTGAAAATTGTAATGTCCATTCCAAAAGGTCTGAGTTTCG
CCATGATTTTTTTATTTTATGTTTTGAGTTTTGGGGTCCCAAAACGCCAAATCATGATTATCCAAACTTTTGGTGTGGTGTAGTTATTTTTTTTATTGGG
AAAATGCTTAAATATGTCATTGAACTTTCAGAAAAGGCTCATTTATGCTATCACTTAAAAGTTTGGTTCATTTATGCCATTACTTTTAAAGAAAAAAGAC
TCATTTATACCATTATTTTTTAACAATGGTTTTGCAAAATCATTTTTACATGTGACCAATTATAATTCGACCACGTCATCAATTTTTTAATAATAAAAAA
AAATAGTTCAATTTTTATTCAGAATTTTGATTTTTTTCAATTAAAAAGTTGATGACGTGGCCAATTATCATCAATTATTTAAGTTAAAAAAATAAAAAAA
AAAATTAATTCAATTTTTTTTTCAAAATTATGATTTTTTTATTTAAAAAATTGATTACGTGACCAAATTACAATTTACCACGTGTCAAAAATGGTTTTGT
AAAACCACTACTAAAAAATAATGATATGAATGAGTCTTTTCTTGAACGCTAATAAAATACACACATTAATATACACGAAATTTAAGAAATCTTAATTTCA
TGTCTTGTGATATATAAACTTCGAAAAGGATACCTGCCTTTTAAAAGTAATGATTTATCTTTTAATATTTTGTTGCTAATACACCCATATATTTGAGGTC
AAACAGAGTTAGTGACACATATTTCAAAAATAATGAACTTATACACACGAATATGATATTATCCTGAATTCCTTTATCATGACATATAAATTTAAGATTT
TTTTTTTCATATTTTAAAAATAATGAGTATCATTTAATAAGTTTTCACCGATACATCCACAAAATTTGAGCTCAAACAAAATCGGCCACACAGAGTCAAA
CTTTATTTGACTTGAAATTTATAAGATTCATTCCAAAAGATCTGAGCTTCGCCATGATTGACGTTATTTTCTTTTATTTTTTGAATTTTGGGATTCCGAA
ATGCAAAATCATAATTATGAAAACTTTTGATGTAGATAAGCACGCGAATTATTTTTAAAAAATATCGTCAAACTAATTCATTTATCATGAAATCCAAAGG
GTCCATTCAACAGTTTCTTAACTTTGTCATGATCAATATTGTTTGTTGTTTTGTTTGTTTTTTTTGTTTATTTAGAGGTCTTGAAACACTAATTTATGAC
TATCAAAGCTTTTTATGTGTATAATCACATGAATTTTTTAAAAATTATCGTAGACCAATTTAGGAGTTCTTAAAATTCAAAATGATGATTATTAAAACTT
TTAATATGTTTTAGCACATGATTTTTTTTAAAAAAAAAGTTATTGCCAAACCCTATTTGTCTTGAAATTCAAACGTCTCAGACTTTATCATACCAAAAAA
GCAAATTTATAATTATTGAAACTTTAACAATATAAATATATATATATCTAAAATTATTCTTATAAAAAACCATGAATTCACGTGCCTAATAATTTAGACT
ATAAACTCCATTATTTCGAATGCTATCTACAATTTTTACACTTTAAGCTAACAACATCTACATTTATAATAATAATAATAACAAGGAATTATAAATTTGA
TTAAAACATGAATTAATCCTAGGGGCAAAAAGGTATATTCACACATCCAAGTAATGAGGGGGGTAGGGGTAGGGTGGGTGAAAAGGGGCTAAATCTTTTT
TTTATAGCCCAACAAGGTCGTTATAAATTTATGTTTGTCGTCTAATTTTTGTAGGTTGCTAGGAGATTTGTTCCAAAAAAAAATAAAAAAAATTATTTAT
GTGATGGTATTTAAATAAATATTAAAATATAAAAATGAGCTATTTTTTAAAAAGTTTATGATCTAAAATAAATTATAAAGTAACTATTTTTTTTTATTCT
ATAAAATAAAAAATTAAACTTTAATTTTATTCATATAAAAATATATGATTTTTTTTTTTTAGAAATTGAGTAGAGAAAAAGATAAACATAAGTTATAATA
GAGGTAGTAATAGATATCTAAAAATTAAATTGAAGAAAATAATAAAAGTGATCCCATATATTGAGAGTAGGTTCAAAATAATTTTTTTAAATATGTAATA
ATATTGTTCCTTTAAGTTCACCAAACATTAAAACTTTCGTTAAATATAAAATTTTTGTGTTTGTTAGATTTGATAAAGACAACGGAAAATAAATTATCAA
AAACATCAAAAAAAAATATTTTATCACAATCTAAAATATATAACACAAAATCACTTTAAACAGACAAAAAAATATAATAGCATAAATTAGCTAAGTTTCC
TCTCTCTTGTTTCTTATAGATCTAGTCCAACCTAACATATTTCTTAGATAAATACTTCCTTCGTTTATTTTTATTTGTCATTTATTCAAATGAATTTTTA
TTTTTATTTTTCACTTGTTCAAATAATTTTTTTTATTTTTATTTGTCACTTTTGACATATTAAGAAGAGACACATATGTTTTTTAATGTTTTACCCTCCT
CGTCATTAAATACTCTTTCTCCAAATTACTATTTTTCAAGACTTAGAACCTGTTTGCAATTGCGGCTAAAAGTAACTGACTTTTAGAAATACTTTTTATT
TGTGTTAGAATAATTCATTTGAAAAGTGTTTTTGATAAGTGGATTGTGTTTGTCCATTTTCTTTTTAAAAAAATATATATTTTTGAGAGTCAAATTTTGA
AAAAATACAAGTATTGATACACTTTTAATATTAAGATTATCTTATATGTCTACAATAAAAATTTTAATTAAATTTTTATTTTTATTAAATTAAAATATGC
ATATTTAAATTTTCAATCAATATTATATATTGATAACTAAAAAAAAAAGATTGTGTATTGATATAATATCAACATGATAATTTATATATAATTAAATGTA
AGACAAAATAAATTTAAAAAGTATTTCACAAATTAAATCATTACGTATAAAAAAACTCATCACAAAAATAAATAAATAAAAAGATATATATTGGTAAATA
TGTATATATTACAGGGATTTTTTGATCTTGGAATAAATAATTTTCTACTTCTAAAATTTTCAGCTTCTTTTCAAGTTGTTTCTGCTTTCAGTTAAAAACA
CTTTTACTATTAGTCAAACATCTTATTTTTCATAATAAATATTTTTTATTAAAAAAATAAAACTTTAATACTAAATCAAACTTTGTTGAGTAGTTAATAA
GGACGGTGTTTATATTAATTTAATTCAATTTTTATTATTATGTAATTTAATGAAGTAAAATTAACAATATGTTTTAACACATGACATGCATGTATTGACT
TGTTGTAAGAACCCTGTGCAGGTAAGTATTACCCGTAGCAATTTCCATTATTATGTGATTTAATGAAATAAAACGAACAAAATATGATTTAACACATTTC
ATCCATGTATTGGTTTGGTGTAAATATCCGATGTGGTAAATTTTACCCACTATCAATGTTAACTTTTGACTAATTTAAGTAGGCGTTTGGCCATATGATA
CCATATCACAATATGATATCATTCGTGAGATGGAATCAGCATTTGGACATGTCATTTTACGCTGATTTCATCTCATGATTCCATATCATTAGATGAGATA
TCATATTCTCCAAAAGCAATGATACAGAATCATATGGGAATACCATATCATGATTTGAGTTATTTTAATACAAAAATTTATTCACAAGTTTATATTTTGC
TAAAACAACCCCACATTTATATATACTAAACATTTATTTCACATGTAAATAAAATTTATGATCACATTATTACGTTTTAAAATTTATTATTTTCACCGAC
TTAAAATTTATTATTCTCACTAACATATAGTCACTTTAACTCACATTTCACGATTATTGAGTAATAAAATTTTGAAGAGCCCGTGACAAGTTTTTCATTT
TTACTCAAATATATTGATGAAACAATTACTTAAGTGGAGAAAAAATAATTTTGTGATAATTTATTATACGATTTTATGACTTTTTATTTATTTGACAGTG
TTGAATATACAATTAGGTATGTTTATAAGAAAAAATATATTAACACCAAAAATTTTATATCGCATGTCCAAATTAAACTTTAATATTATATCATGATTAC
ATATCATATTATAATATTATATCGCATGGTCAAACGGATCCTAAATAACCAAAATAGTTCATTTAATTAAAAGGGCCACTCTTGTCATTTTCCCTAGAAA
TTGGACCACCTGTGAATCCTAATATTTAAACCCCCAAAAAAACAACAAACAGAAGTCTCCTTTTTTATAGTTTCTCTCAAAATCAAAAACTGAATTTTTT
TTTAAATAAAAAATGAGTATTAAATTTCTTCTTTTTCAGCAGAATCATCAAGGCTTCAAGATTCTTGATTCTCCTTCACTTCACAAATCTCTACCTTGTT
TTCATCAACACCCAGTTGTTTCTTTTACCAAGAAATGCTTCCACTCCTCAGGTTTGTTTGTTTTTATACTTACAAGTATTTATAAAAAAAAGGAGAGATT
TTTATGATTGTTTTTCAATATTCATGTGTATTTATGCTTACCCTTTTGATAGTTTTGTCCAATTTGGGATTCTTGATGTGGTATCATTGATGAAAGAAAA
AAGTGATTTTGTGAATTTTTTTGTAATATCAAGTGTATTTGTACTGCCCCTTTTTTAATGAATTAGTTCAACTTGTACTTGAGTTCTTGAAAGGAATTCC
CTTAATTATACAATCTTTATTCTTTTTGGGGAAATTGACATAAATAGTTGCTGGCCCAAAAAAAAAAATTGCCATAATATTTGTATAGAGCATGTGTATT
ATCTATAGCTGATGTAGACATTTTTTGCTGAGCAACCAAATCTGTAACTTCCCTCTTTCTCTTTTTACCTCAATAGTGTATTATTTTGCTTAAAGTTTGA
ATCTTTTTGCTTCTCAAAGTAAAACTGTACTTCGGTAAATGGGTTCTTGAAGGGGGTATGATTGATGAAAGAAAAAAGAGATTTTGTGATATATTTTTCA
GTATCAAGTGTATTTATAATGCTATTAGTGATGAATTAATCTAATTTGTACTTTTGTGCTTGAAGGAGTTTCCCCCATCTATACAACAGCAAGTAGGTGT
GTTTTATTTTGCTCAATTGTAATCTATTTTCCTCAAAGTTTGAATCTTTTTGCTTCTCAACCGTGCAAAGTACTTAGTTCTTTTTGCTTCTCAATAGTCA
AACTGTACTTAGGTTCTTGAAGGGGTATGATGTTGAAGGAAAAATAGATTTTTTTTTTTTTGTATAAAGTGTCGGTCGTAGTATTAGCATATTCATTTAG
TCTTTGGTTTAGAGTTTCTGATTATCATATGTGGTTTATTGGGTTTAGGTGATTGCACCTTGTTGTTCATGTTATGGTTTCTTGCATATATGCTCTGTAC
TATTTGCTATTAGCTCTCATGTTTTTCTTTTTGATTACTGCTTTGATTTTCTTGAGCAAAGGGCCTTTCGGCAACAGCCTATCTACCTCGGAGAGGTAGG
GGTAAGGTCTACGTACACCCTACCCTTCCTAGACCCCCCACTTTGTGGATTTCATTGGGGTTTTTTTGTTGTTTTTCATATCAAGTGTATTTTTACTGCC
CCTTTAAAAAAAATTTAGTTCAATTGTAATCTATTTTGCTCAAATTTTGAATCTTTTTGCTTCTCAAAGTACAGTTGATAATGTGCTCTTTACTTTTAAG
TATAAAAAGAAAAAAAGAAAAAAAATTATGATCTTTCTTCAATATCAAGTTTATTTCTACTGCCCCTTTTGATATATTAGTCCAACTTGTACTTGTGTTC
CTTGATTCTTGAAGGGGTATGATTGGTGAGGGTTTCTTCAACTATAAAATCCACATTGCCAATTAGGTGTTTTTTCTGAAAATTCAATATGTTCTATTTT
ACTCAAAGTTGAGATCCTTTTGCTTCTCAAGTTTAGTTGATAATGTACTTTATTTAGGTCATGAATGTGATCTTTTTATATAGGTGGTAATTCAAGCGGT
TGTTTAGTAGATGTATCTCAGAAAAGTTATCAGATTTTGTGATTGTTTTATTTTTCAGTATCAAGTGTGTTTCTACTATCCCTTTTAATGAATTAGTCCA
ATTTGTATTTGGGTTCTTGAAGGGGTACGATTGGTGGGGTTTCCATCAGCTATACAATCCACATTGCCAAGTAAGTGATTTCTAAACTCAATTGTAATAC
TTTGCTCAAAGTTTTAGTTGATAATGTCTTTTTTCTTGCTCATGAATGTGATCTTTTTCGGTATTCAGGACTATTGGTTACTAGATGTATCTCAGAAAGT
TTCTCAGATCCACTTGGGCCTAATGACTTTGAATCACTTGAGGTTTTCCATTTTTACATCTGGAGCCATTTACTCAAAGTTCAATTATATGCTTTTGTGA
ATTTGACTTGTATTTGTATGTGGAATCGAGCAACGAAAGACTTGTTAATTTATTGGTGACAACCATTTTTCTTTGAGAGGTATGGCTATGAATACTATCA
TTGCATAAAAAAACGAGTTTGATATAGAAAATTCTCTAGCATCCAAGGGTGTGGTCTAGCGGACAATAAAATGGGAGAGCTAGAAGATACCTTACGTGAT
TTTTTCCCCCATTTATTTAAGCCTTAGCCAGCAGAGTTATCCGATACTTGTCTTGGTGAGAGGTAGAAGATACTGAGTGGAATAGTCGAGGTGTGTGAGG
TGTGTGCAAGCTTTCCCAGACATCACCCTTATAAAACATAGAAAAAAGTAATAGAAAATTCTCTATGTATGTGGATAAAGTTCCAGATATGAGAAGTAGT
TGATATAGGAAGCAATTTGTTTTGGTTCCTAGCCATTTCAAGCTGATGTACTGACTGTTATTACTAATTGAAGACATTTCGATGTGAGGGCAATGTTCTC
TGGTTTGATTACATTTCTAATGTTTCCAATGCTTCTTTCCCTTGAGATTGTGAATCAAAGAGGTTGATTGGCTCATATTTTAATTCTTAAACCTCTCGAT
ATTTTTGAAAAGGAAAAGAAACATAATAGGGAAAAGGGGGTTATGTTGTTTCCTTGAATGTTTCGAAGCCGACATTTGATTTGTTGGATTTGAAGTATTT
GCATTTAAGTTTTGTTTTTTTTTAACAATAGACATTTTGTTATTACAGAATTTGAAACAAAAAGAGAACGCCTTTTTGACAATTTTGAAGGGAGCAAACT
CTTTTCTGCCCCATGTGGTTCTTGCTAGCACAATTTTGGCTCTTATCTATCCACCTTCTTTTACTTGGTTTACCAACAGGTTTGTCTATCATCCAATTGG
TGCTTATTTTCTCATCTATTTTGTTCTATCCCTCTAGCATCTCATGCTATCTTACTTTTCACCTTGCAAAAAGTTTTGCGATAGGTCTGATAACTCTTTC
AGAAGTTCGCAGGGACACATAACGCTTGTTTCTGTATTTTGATCTTATTAATTGATACTGTTGTCTGTTAGACAAAGAATTCAATTGACAAGTAATCATT
TTCCCTGTTTGACGTATTAAGTAACATTGGTTACTGCATGAAGCAAGTGCATTTATATTTTGTTAAAAGCAAGCAAGATCATTTTTAATTCTAATTTGGA
GCTTAAGTTCTACTTTTGGAGGTGTTATATACTGTCTATGCAAATTAGTTAGAATAGAAGAAAATATTTCCTATGTATTCGTGAACTAGGTGGCATCTTT
ATGTTGTTGAACTACATAAATTAACAGTTGTAAGATACTTTTGAGTCTTGTAATACACATTATTAAAGCTAATAATTCGAAGAATTTCAAAATGTATGCA
TTTGATCACTTTCTGAAAGAAGAGTTTTGTTCAGACTTTTGTTTGTTTGGATTACTTATCATGTATACTAGAATCAACAACTCATTCCAAGGAGAAACTC
GTATAAATTTTGCCGGGACAAATCATTAATTGCATTCTAGAGGACTTATATCTCTCTGCTAGACTTGGTCAAAGTATCGTGGCTTGATCAGGTCATTTGA
ATTTATCCTTATAAATGTATACTGAGGCTTCTATAACTAAACCAATTGGCATTAGTTGTAGCAGGAGGTGTGGTAGAGACCCGTGCCAGAGGTCAGAGTA
ATTCCTTTATTGAAAGTTTTCCGTGGATATATCTATTTCTTTTACCAATTTATCCCCTCTAGAAAAGGATGGAGGTGTAGAATTGGATCTTGGCAAAAGT
CTGTCATTCAATATTTGCACCGATTTGGTCTCACGTTGTCTATCTAGGATAGTTAGAGAAAGGTATTATGTGACAAATAGTTGCAGAGTGCATACCAAAA
AGTCTAAACTGCTTAGTTTTTCACCTCATCGTATGGTCTCATTTTTAACCGTGATGTTTGCCGTTTCTAGGTACTATGCCCCTGCATTAGGATTTTTAAT
GTTCGCTGTTGGAGTCAATTCAAGTGAAAAGGACTTTCTTGAAGCTTTCAAGAAACCTGCTGCCATTTTTGCTGGTTATATCGGTCAATTTGCTTTGAAG
CCACTACTCGGGTATCTTTTTGGCACAGTTGCAATGTCTGTATTGGGTCTTCCAACTTCCTTAGGTAAAATCTCAGACCCCTTTTTCAGGAAAGAAAATA
GTATGCTGACTAAAGTTTTGTTATCTGTGTATCAGCTGCAGGGATTATGTTGACCTCTTGTGTTAGCGGAGCACAGCTGTCAAATTATGCTACTTTTCTA
ACCGATCCACAAATGGCCCCTCTTAGTATAGTGATGACAGCGTTATCTACAGCTACTGCTGCTTTTATCACCCCGACATTAACTTTATTGCTTATTGGGA
AAAAGTTGCCTGTGGATGTTAAGGGAATGATTTCCAACATACTCCAGATTGTTGTTGCACCTGTTGCTGGTGGGCTCTTTCTGAATAGGTATTATATCGT
TATGTGTATGTATATCCTTCAATGATCCGAACTTCATTCTTTATGACTTATGGTTTTGCTTCAACAGATGCCTCCCACAGATTTCAAATGCCATTCGGCC
GTTGTTGCCTCCCCTGTCAGTTTTTGTGACTGCTCTCGCTGTAGGAGCTCCACTCGCTATTAACATAGATTCCCTCATGTCCCCTTCTGGAATGTCTGTT
TTGTTCCTAGTGATTGCATTTCATTTATCAGCTTTCATCTTGGCCTATTTTCTTTCCGGCCTAGCCTTCCACAAAGCACCCGATGTCAAAGCTCTACAAA
GAACACTGTCATACGAAACAGGTTTGGAGACTACATAATATTATCACCGTGCACGAGATGCATATATTATTGAAACTTGATTGACGTTGTCATTTTCAAA
TTGCGTTTGCAGGCATGCAGAGCAGTCTTTTGGCCCTTGCTCTTGCCAATAAGTTTTTTCAAGATCCCCTTGTTAGTGTCCCACCAGCTATATCAGTAAG
TCATCTATCAATTTTATAGCTTTATATGCGTTCATCTGAAATATGGTATCAGAGTCGAATCTTTTGCCCTCCGTTAATAGTTTGGATGCTTTTTGCCCCT
GTCGTTACCAAAAGGTAGCATTTTTGTCCTTTCAGGTTCGGAATCTTTAAAAAAAACATACGGATAAAGGAAAAAGTGTTTAACCGTACAGTTTAGGGGC
AATTTTGATCCTTTTCCGTTCTCTCATCCTATTCATTTTTCATTCTATTTTTTTTTCTTCAGTTTTTAACTTTTAGTCACATTTTAACATTTGCTTGGTA
CATTTTTGCAGGTTGTGATCATGTCATTAATGGGCTTCACACTAGTGATGCTGTGGACTAAGAAAAAAGAAACTGTTATGGAGTGATAAAAATTATCATT
CATCGAGTTTCGAATCGTCTGTTGACTGATCCTCGAAAATTTCTCGATTATCAAAAAAAAAAAATCCACACATTATCTGTCCTAACAGTGCTTGTAATGT
CAAGAACCTAATGGTACAACTAAAGACGGCATCACCAAATGTTGTGTGGAATTTTATTTTCTATATGTAATTTTCAGTAGAAATAAATGTGTACTACATT
TTTCTTTTGCTATAGGTAGGTCAAGTGTTATTTAGTCTTTTTTTTAATTAGTGTTGTCTTTTTTAACTCTCATATAATATAAATTTTTAAAAATTTAGTA
TTACCATTGCTTCTGTTATTGTATTATTTTGTTATTGTTGTTGTTTTCTTCATTAATATTCACTGTTATATTTATTTTATATAATGATATTTAATATGTT
TTATTTGAGCTAAGAATTTATTGAAAATAAGCTCTGTATCTTTCTTTTGCATGTTTCCCGAACTCAAAGGCATTAACTATAATAAGTCAATATTCTTAGC
ATCAAAATGAAATTTATTGACAAGTTTAAGAAATTGTCAATATATTTTGCCTTTGAATATTTATATTTTAAAATCAAGGGAAAAGGGTGTGATATACCTC
TCAACTTTTTCATTTGGAGCTGATATATCCCTTGTTATAAAAGTGGTTGATATATACCCCTACTTATAAACAAATGGCTCACATATACTCTTTTCCTAAC
GAAAAATAATAATAATAATAATTTTTATTATTTTTTTCTAAAAAATATAATCCTATATGAGTAGAATTAATTCTCGTCAAACATTTTTTTTTATTTTAAT
GAATAATTTAGAATTATTATTTTTGATGATCAAATTTATTAAAGTTTCACTAATATTCTTGTAAAACATATTGTAGATGACCATTTTTTTTCTTCGACTA
CAAAAATTAAATTACAATATAGACATAAAAAATAGTTTTAAATATTTTTTTCTTTACACTAAGGAATGAAAGAAAAAAATAAGAATAAGAAACTCAAATA
ATTATAATAAAATAAGTTAAAAAAATAATTTATGTATGAAAACAATTGAAATATACTTTGAACTTTGATAAAAAAATTATACATACCCCTAAATAATTTT
TTTTAAAAAAGAAAAGTAAAATATATAAATTTATAACTAATTTTTTACTTTCGTTAAATAAAGAGTATATGTAAGCTCATTTTGTAACGACAGAAGTATA
TGTGAACCATTTATATAACGATAAATGTATATATAAGTCAATTTCATAACGGCAGAAGTTGTCAATGAATTTATTTTATTTAAAACTCCATTCATATTTT
CTCTTATCTAAAACAAACAAAAAAGAAAGTGAAAAACTTGACTCAATTCAATCAACAATGGCAGTTCCAATTTCATTATCCCTCTCAAAACTTCATTCTC
TTCCAAATCCAAAACAAACCCAGTTCTCTTTTACACATAAAGATCCAAACTTTATCTTCTTTACAAGAAAAAAGACTCATTTTCCAGCACCCATTATCAG
TAATTTGAAAAATGTTGCTGCAATTTTGGGTTTTTCTGGACTTGCTTTTACAACACTAATGGTGGGCTCAGCTTCTGGTTCTGAGTTAGGTTTAATGGGT
TCTTCTTCTTTTCAATTCAATGAACCTTCTAATGCTCTGTCATTGCACACTTGGGCTAGTCATGTTTCCACTATTGTTGAATGGTAATTTCTCTGTTCCT
ATTTTGTCTCACATATTTGACTTAATGAGAGTTTAAGATGTTAAATTGTGTTTTTTAAGATGTTAATTTTGGATTATACTTACTCCGTTTTGTATTACTT
GACCCTTGTTGACGCATGACATTTTGAAACTCTAAATTTGACTACTATTACTTTATGTTGTTATTTAATATTACTAAGGATGGTATGGGAAAAAGGATTT
TCTTGGCTTGCTAAAATGGAGAAGTAAAATGAGATGGAGGGAATTTATTATATGAGGTGGATCAAGATTTGAACTTTGAATTGAGGGTCCATTGGGAACG
GTCTCCCTATCTTCACAAGGTAGGGGTAAGGCTACATACACGCCATCCTCTTCAGACTCCACTTGTGGTATTACATTGCGTATGTTATTGTTGTTGATCA
AGATTTGAACTTTATAAGTTTGAGTTTGAGTTTGGGTGCTACCATAAAGCATTTGATTTATTGGATTCAAAATCTAGTACTTCTAGTTATTTTGTGAGTT
TTCTTAAGAGTTAATTGGTCAAAAACACACCTAGGATATACCCATTTTTTGAGTTTCATATAGGAAATATCATCATCGTTCAGGTAGGAAAAGTAAACAA
TTGATAGTTGAGGTGTGTTTTGATGAATAACGGTGATAGTTTAGGTAGGAAATTCGCACACATGATAGTTTAGGTTTGAAACTCGAAAAATCGGAGTACT
TTAGGTGTGTTTTTGACCCTTCTTTCTTTTCTTAATACATATACAAGGTTTGAGCAAACTCTATTGTGGTTCAAACCTGTTACATATACTATGCATCCAC
GGTTCGCCACAGCATATTTATAGGGAAAATGTTCAAATTTATCCATCTGTTAGGCAGAATTTACCACTTCATTATAAGGTAGAGATAAGGCTACAGACAC
TCTCGCCCTCCTCAGACTCCATTTCTCAGAAAAATGTCCAAAATTATTCCTGGTTTAAAGTAATAGTTAAAATATTAGTTTAACAGATGCTAAAACATTA
CATCAAAGCTCAAATTTGAATTATCAAAAATTACGGAAGTTTTATAGAAAATGGAATGGCATCAACCAATTTCATGACGTCCTAAAATGGAAAGGGTGTT
ATGTAAATTTGGGCAGAGGGGGTATTGTAATGTGCAGTGCACTCTGTCACGGGGTGTTATTTGTTCATATGTTTTTTTGTGCAGAATGAAATGACATGAT
TTTTAACTTTGTTTGAAAGGGTAACTGCTATGGCTCTGGTTTGGCAATATGGAGAAAAGTCGGGTTATGAATCTTGGAAGGGACTCTCCTGGGGTATGGT
AAGTAATGTTGCTTAGTCGTGATCATTCATTTGTTGTGCAGATGCTTTTGCTTTTGGAAGTCATATTTTGATCAAAATTTCGTGCTCTAGGTTTGCAATA
TTGAATCTTCTTTCTGTCGATGAGCTTGACATGACTGTAAATACTTTTTGAAAATGACTTCTCTTAATATGTTGAAAATTTCAGTTTAATTGATGAATGT
TATATTGTCCCTTCTCGATATCTATTTACCTATTGTTAAGTGAGATAGAAGCTTAAGTCTTTCCCTAAAAATGGCAGTTGAACTCAAAAACTCTAGAAAG
AACAATTTTCGAAATATTTTTGTTGCTCAAAGGAAAAAACTTCCTATGGTATGTACTATAGAGAACTTGAAAAAAAATAAGTTGGCTGTTTACATATGTG
AAATCTGTAAAGCGAGTCTAGTCTCAGGTTCAAAACTCATCAGAGGCAAAACACTGTTGTGATTTCTTTCCAATCTGCATAAACCTTGGTGGACAGAGTT
ATGAGGTACCTATGTTCGTAGGAGGTAAACGGTACCTGATGGAATTAGTCAAGGTGAACAAGTTGGCCCGAACACTGCTATCATAAGAAAAAAAAACTCT
GTATGGTGAACTACATGCAAGCTTTGTGACATTTGTACATTCTTTCTTTGCGATATATTAGAGTCGCAGAACTCTGATCAGTGCCTATATCTGGTCCAAT
AGAAATGGCTGTTATGCATAAATAGCATTCTTCTGGAAGTAGAAAAGTAGATAACAGTCTTTCCTGTTAATTAAAAGTTCGTGTTCTCGTACATTTGATC
AGACAATAGTCTAAATGTCTACTTCATTTAATTCTTGTTTATGGATTGGGATTGGGTTAACTTAATTAGTCGATCAACGTTTTACTACCATACAGTAATG
AAAACAAATTATAAGAGGCTGAAATGAATATATTATCGCTGTCAGCCTATTATTGCAGTGAGTTTTTTCCTTCTTTGATGATTCCGATTATCTCCCACTA
ATCCATTTCCCCGATTCAACCAATCCCAAACCTTACGGGAAATAGTTGTGTCTTGATTGATTCATGACTAACTCTTTTAGGAAGAAGTATGAAGTCTTTT
TTCCCCCTCTATTTTATTATGTTTTTCAATACTATCCTCAGCCAAAAGCAACAATAACAATTACGCCTCAATCCGAAACAGGTATTTTCAACCAAGATAC
ACGATTTAAACTTGTTTATGACATGCTGTCCAACTGTGAAATGCTTCATAGAGAGCGGTGGCGGAAAACATGTACATGTGATATAATTTGTTGAGGTTAC
ACTCCCATCACAGTGCTACTGTAATCCATATATATTGTTGGCGGCTATCCCGTGAAGTTTAGAACTTCTTGCTCTTCAGGTTTCTTTTTTCACTTTCTTA
CCTTTCTCATGTCATGGACAACGTAGTTCAAATGTCGAAATTTTGTTGATTTTGATTATTGAGTTTTTTGTTCTACTATTATCTAGTCAGTGACAAGACA
GTAAAAATTAGAGCTTTTCAAGTTGTGAAAATGTTGTTTTTTCTTAACAAAGTGATGTACTTTTGTTTGACTGCTTATGCTGAGTTATCGCGTCACGCTT
CTCTTTGATCATTTAGCAGTTATCTCCATTTCTTTTCTCCGATTTAGGTGCCCCTGCTTGGAGGAGCACTCTGTGCCTGCACTTGGCATTTCTTTTATAA
CTCGGAGTCTCTTGAGGTAAGTAGATGCAATTCTTTATCTAGAACGAAATTTATGAACTTCTCTTGGTAAAATATGATTGCGGATTCGCCCTAAACCATT
CCCCTATGGGCAGCGGTTGATCTACTATGTTGGTTACAGGTTCAACTGAACTCAGTAGATCCTTATATTTAGAAATCTACTAAATCTATAAAGATATTTG
ACTGTGGACTCATTAGTATCGACTTGATATCACTGCAGGAGCTCGTAAACTTCAAATCCTGTAATCCACCTCTAATCGCGGAGATATGACTTAACGTTCC
GTTTCCATGCATGATTTTCAGGTAGTAGTGGCTCTACAAGCAGCTTTGACAGTAATTGGTAATGCCACAATGTGCTTTGCAGCATTCCGGATATACAGAT
CAACACAGAACCAGTCAAAAGAACTGTGATCATCGTCTTTGAGTCATTTCACCCTACTAGATTCTCCGTCTAACTCGTACATAACGTAACGATCGTTGCT
CCATGCTAAGAAATGGAAGAGTTTTTATAGCCAGTGTAGACCGGAGCTCTAAGCTAGGTCAAGAAAGCGGATTCAGAATTTTGAATTTGTATTGTTTAAC
TTTTAAGGTTCTTAGACTAAAACTCACTGTACATTTTTGAATTCGTGTACTCGAGATTCAAAATTTATAAATATTGATGGTTAAACCAAATTCTCGATTA
TTTCACCAGATATTTGCTACATCCATTGAATTATTCTCAAAATAGTACTTCATAAGTAAATTAATTTTATCATTTTATTCATAATATTGTAAATGAAATT
TTTAATGAACCTAATATAATTGTACTATGCTTTAAAATATAAAATAAAATAAGGAGACAAATTGGAGGCAACAACACTGACATTTTTTTAACCTCACGTG
TTAAGAAGCTT