BAC Sequence – LE_HBa0032K07

>C00HBa0032K07.2
AAGCTTCAGTAGAACATGATGGCTCACATGTGGAAGAGGGTAATAGATCTGAAGTGGAGGCCAAATTTGCGGACGGGGGAATATGACTAAGATTCATATG
CTGTGAGCGTTGGGAGGGGCTGTGAGTTTATTGGTATGCGTTGGCGGAGGCAGCAAAGATGGGGAAGATTCTGGGAGCATGTTGGAGATACTTTAATCGA
CATTAGGAGGCAAACAGGGGAAGAGATATTAGGATCACCTTGGAGAGAATTTGATGGTAGAGTGGAAGCATCCAAAGAGGACATAGTTTGAGCTTTGATA
GGTGTACTGGTAGTGTGTTCGGGACTTAAAGAGTTAGACAAAGAGCCTTCTAAATTAATGGTAGGATATTACTGGTGGCGTAGGTGATTGAGTAGGATGA
GCAGAAAAGGAGAAAGAGATGCGATAGAAGAAGATCGGAAGGGAAGCCCAAGATGTGTTAGATGGAGCATGATTTGGTGCAGGGCCAAGGATAAATGGCT
TGTCGAATGGAAAGTTTTGTTCATCAAAGTGAATATGTCGAGCAACATAAATACGTTCCGTGGACCAATCCAAAAAAATGATACCCTAGGTGAGATGGAC
TATAGCCAAGAAATACACAAGTTCTGTTTTGGAAATCAAACTTGTGTTTTTTGTATGGTCGAACGTAAGGAAAGCATAGACAACCAAAGCCCTTAAGAAA
AGAATAATCAGGTTTGGAATGATGGACTAGTTCATACGGACAGAGACCATGAGTTGTGACGGAAGGAAGATGATTAATTAAAATAACAGCATACTCAAGT
GTGTAGTGCCAAAAGCGAAAAGGAATCAAATTGTGAGCAAGAAGGCTAAGGCCGATTTTAACTACTTGACGATGCTTTCTTTCTACTGTGCCTTTGTTGC
TTGTGTGTATGAGGGCATGAGACTCAATGAACTATGCCAAGTTGAGTAAGCACTAGGGTACAAGTAAAAATAATTGAAACCTATCTGAACTCGAACTGTG
ATGGACACAATCTAATACTTGCAAATGGATTTACAAAATCAAAAGAACAGATGAAAGCATAGACATACATAGAGCTAGATTGATTGCTCGAGGAATTTAT
CATATCAAAAATATGGCAAAGACTACTAAGAAATATTCATATGGTGGCTAAGATGATCTCAGTTCGAGTTGTACTAGCTATGGAAGCCTCATACGCTTGG
CAACTATTATGTGAAAAATGATTTCTTATATGGAGAAGTTAACAGAGATATTTATATAAAGCAACTATCGAGTATGTTTCTAACTTATATCCTGATTATG
TTTGTAAACTTAAAAAAACATTATATGAACTCAAGCAAGCTCCACAAGAATGGTATGAAAAAATTGCTCAATATTTATATTTCTGTGGCTATACCATTTC
ATATTTAGATCCTAGCTTGTTTCTTTAAAAACAAGGATATTTGCATGTGGTTGTTCTCTTGTATGTGGATGATATGATAATAACAAGAAACAATGATGAT
GAAGTTGCAAGGCTTCAAGAAGAATTTGCCCTAAGATTTGATATCAAGAAGTTGGGAGAATCACATCATTTTCTTGTCTTAGAGATAACAAATACAAGTA
AAGGGGTCTTTGTTGTCCAAGAAGGATATGCCAAGAAGCTTGTGGACAAATTTGGAATGAAACAAAGCAAAATGTTTTCTACGCCTTTGAAGACTAGCAT
GAGGCTAAGGTGTGAAGAAGACTCACTTCTTGTAGATCCCAAATCTTACCGAGCTCTTGTAGGAAGTCTCTTGTATTTGACTATTACTACAAAGAGGATT
TTAAAGTATAGCAACTTAACATCAGATATGGACCTATTTTTAAAAGAAAAAATGGCTTGATACTGACGCAGATTTTGATGGTGATATAGATAATCGAAGA
TCTACATTAGACTATATTTTTCTTTGTGGTGGAATAGGGATTTCTTGGTGCATCAAGAAGAAGACTCAATTTCTTTATCAATTATGGAGGCAGAATATAA
AGCACTAACTCTTACTATTCAAGAATGTGTATCACTCCAAAGACTTGCTAAAAATTCTCATCTATCTATATCAAAGCCAACTACAATCTGCGGAGACAAC
CAATGCGCCATCAAGCTTGCAAACAATTCGATATTTCATGCAAGAACTAAGCATATTGAGGTGAAACGTTATCATTTCATTCGAGAAAAAGCTCTTGATA
GAACTTTATATACGCGGAGGTACGAAATCAGGAGAATATTACAAATATCTTCACCAAATCACTTTCAAAAACTTCTTTTGAATTTTCTCGCGGCAAGATT
GGGATAGTTCCAAAAACTTACTTTAAGGGGGAGTATGAAAGAAGTTAAAAATGATTTTTTGAATAGCATAGATTTTTCTAGAATATCCTATAGTAGAAAT
TTAGAAATTATCTTGAATAAATATCTAGATGTACTAGAAAAGTTGTATCCTAAAAAGATATCTGGATATTTCTTGTAGATGTATCTAGAAAAGTTTCTAG
AATTATCTATAGACAAGTATAAATAGGGGATGGTCTCGTACATTTGCATTCAAGAAAAAAAACCGTTATAAGAGTCTTCTTTCATATCTAGTCCTCCTTT
CTAACTTCTTTTTCTTCGGTTGAATCTTCTGATCTTACTTAATGATCTTGAGCTAGCAGAAGGGTTCTCTGATTATACTTTACTTCTGCTATTCTCTACA
CTTACTTGTGCAATAATATCATCTTAATAAACGAACAAGTTAAAGCTGCATCTAATACATGAATTAATTTTACACTATGTTTGCTTTAAAAATAGGACAA
AAGTTATTCATATATTAACTTTATACAATGTTTGGTTGGTTGGTTCCAAATGTTGTATACAAATTATTCATGTATACGGTAGTTGGTTGCGTTTTATGTA
ATCCTACTTTAGTAATGCTTGCATAACTTGAGAGCAAATCTGTGTATAACTTATGCAGGATAGAAGGTGTAATAAATTATGCGAACATTAATTATACATG
TATAAAACTTGTGAATTACACATTTATCGCTATCAATTACTTTTTACCTTTTTAATAGATGTATACTAATTTACAACAAATCAAATACATTAATACACGT
AAAGAAGCACTACCAAAAATTTCTTATCTTGTTAGTTGTTTTATTATGTTGAATCTAGTTGATTATTTTCTTTGGCGGTAAGACAATGATTATTTTAGTT
TCTTGTTTATTTAATTAAGGCTTAAGTCATCAGCGTCTCTTAAAGTTGTCCGCATAATTCACTTAGACGCTCCAACTAATAGTAGTACCAATCGAACACT
TTTATCTATATAATAATCGTTTCTATTAGACATTTTTTGATAATCAACAAAAAATGTGAAGAGTGTGTGATACACTTGCGGTGACGTGGCAACATGACTA
ATTAAAAAATAACATTTGGCATTGGGCCCAAAAATTATAAAAAAAAAAGGGAAAATTAGTAAACTAGTCAAAATATGTAACATATTTAGTAAAAATATCC
ATACTTTATAAATATTAGCAATAATGTCAAAAATGTCATTATTTTAAAAAATTTATGTGTCTCAATTTTCTTCCTATTTTATCTCTCTTTTTCAATTAAT
TCTATACATCCTTTTTTAAAAATAAAAAAAAACATTTTCTCTCATATTTATCTTTTTTAATTGTTAATTCTCTCTTTCATTTAATTTTTTTACTCTCATG
ATTATCTTTTCTGATTTTCCTTCAACATTCAAGTTGCAAAAATTTTTTTTGTCATATATTTTGGTTGTTTTTTTAATCCAAAATTGAATCAACGAGAATC
CCTTTGATTAAGGTATCTCTAATCTCTATCCTATTTTCAGATTTCTTTTCTAATTTTATTTTTGTTTAAATCTTAAAAAAATGTTGTTTGTATTTTTCAA
TTTCTGTTATGATTTACTCTCCAATGACTGAATCCAAGAGGCTTACTAGAGGTATTCATCTTAATCAACCAATTTCTGGTGATTTTTCATCCTTTAATTT
ATTTATTACTTAACAAATAGTGTATAATGTATGATCCACTGCTAAAATGAGGGAACAAAGAGGGTAAGAACATTTACAAGACTCATTGGTGTGCAAAACT
TTTCTCAAATTCAGAACGCAAATGTAGAATCTTTGTCTACTCGTGAGGATCTTGAAAAAGACGACGAAGATCGGATAGTTTTCGAACAATTTTCTATTAG
TTTGTTTTGTATTTATAGTTATTTAGAATTTGGTATGCTTTCTTAATTTGTATTCAAATCACTATGTATACTATCAATATTTGTATTTATTAAAAATTTC
ATGTTTCATGGTTTATGAATCTTGTATTTGTTCCTAATTTGTATTCATCCAAATGTATGTCAACTAGTTATGTATTTTATTTATAAGAAGAACAACTTTC
TATTAGTTTATTTGTATTCGAATACAAATACAAATAATAGACATATTGGAATGAATACGACTTAGAAAAGGAAACAAGATTTTGAAAAGAAAAATAAATA
CACAGTGAAAAATATATACGAATACAAATATATTTATTAAATAGCTACATTTTATTTGACATATATATTGGAACGAATACAAACTAATAAAGGTATGACA
ACTGAATTTGACATTTTTTTCTAATTTGTATTTATTCTAAAGGTATGTCAACTAGTTATGTATTTTATTTAAGAATGAGTACACCAAATATTCAATTATT
TCTTTTCAATTTTATATTTCATTCACTTTTTCATCATACTAATTTTTTGTATTTTATATATTATTATACAAAATTCTAAATAAAAACTAGAATAAATAAA
AATACAAATAAAATACATATTGAAATGAATACATACAGGATTTTTGAAGAAAAAAATAACTATATAGAGAAAAAATATATGAAAATACAAATATATTTCT
TAAATGACTATATAGATAAATTCGGCATACCTATTGGAATGAATACAAACTAATAAAAAACTATAATAAATATAAATAAAATATATTGTGGAATGAATAT
AATTTTAAAAAGATAAAAATTCTGGAGAAAAAAAATAAAATTTAAATTTTATTTGAAAATGTAACTGATGAGAAAATTAAGGATGCTTGCCTTTTTTTTT
TTGAAATATTCCCCTCCTTAATTTTCTCCTTTTTGTTATTAAATAATTATACTCTTTAAATAAAAATAAATAATAAAAACATAAATAAGATACATAACAA
ACTAAAATGATATTTTTACTAAATATTGAAATTGTTGCTAATGAGTCCTCTTAAATGCTAAAATATTGACATTTTGAAAAATTTCCACACACATTTAATA
TCTAATTTTTTAAAAAAGAAAAATGAAAATGTCAACCTATTCTACCCCACCTTACCCCACCCCACTCCAACCCCCTTTCATCTTCGTCTTCTTCCCCAAA
ACACATTCTTTCTCAAATTACAAAATCTTATTCTTTTGAAATAACTTCAAGATTATGTTTTTTTTCATACTAAGAGTGAAGAAGAAAGAAACTTTTGTTG
GCGATTATTCAATTCTACATCGATGACAAAATGAAATTGATAGCTCCAAAATTATTTCTATCAATTTTTTTTATATCATTTTTGATAAATTTAATGACCA
CATATGAATTTGAGTAAAAATCTTTGTTTGAAATTGTGATAAATAAATATCGGCTAACTATTTTTATACGTAAAATTCATTTATCTTTTTTCATCTTCAT
ACTTGTTCCTTGTTTTTATGAGATTTGAAATAAATCATACGAAGACTTTCTTTTAAATCTGAATCTTTATAGTTGATTTTCATTTATCTTCATATTTGGA
AGATATAAATTTTTTGTTTATAAAAAAGAAAAAAAATAGTGTTAGAGCTAAAATGAAGAAAGTTTTGTAAACTAAATTATGAAGAAGATGATATATAGGG
AGTGGGGTGTTTTCTTTTTTGAAAAAAGTGTAAATAAAGAAGAAAATATTTAAAGTTAATTATAATGCCAAGTGTCAATAAAAGAAGAAAAAATATAAAA
AAATAAATAAAAAAGACACTATTTTAAGTCTTTTCACGCGCTTCAGAAAAATGCAATACACAATTTTTGCGATATCAGCATTTTGTGTCTAATAGGTACA
TGTTTTGAACAATTTAGGTGTTCAATAGGTACAAGTCTCAGTTGAGGTGTCTAAGTGAATTACGCAGACAACTTTGAGGAGCGGTATATGACTTAAGCCT
TTAATTAATCTCTTTGCAATGCACATCCATACATGCATTAATCTATTTTAAATTTTTGGCTATTTACTTTAAATTGATTAATCCTATTCAATATATAGAT
TACATAATTGCTATTTATTTGTTATTTACTTTATTATCTTTAGCTATTGGTATTTATTTAATTCTAATATGTTATTTAGATAGTTATTTATTTTAACGGG
TATGATAATTATTAGTTCACTAAAATTTTTTGGAAATTAAAAAAAAGAATTAGCTCACTAATGTATTATAAAACTACCTAATCAATACTTACATAATTAA
TACCTACATTATTAATAGCTCCTCTAGAAAAATAATACAACCTCAGAATTAAATATATAACAACTAATTTGAAATTCTTATAAGTTATATTGTATCCCTC
ATATGACACGACTAGTTATTTTTTAAGTGACTATGAAAAATAGTGATATTTTGGGCCACAAGAAGAGACAATATAACGTCTTAATAATCAGAGAAGTTAA
AAACTTTTTAATCTCTTTGGGTGTCAAACACTAAAGAGAATATAATAAAATTAATCTAAACTTTTTAATCTCTTTGGGTGTCAAACACTAAAGAGAATAT
AATAAAATTAATCTTTTTTGGTCATTGTGGGGATTCGAGTTGGTTAAAAAATTAAATTGCTTGTGTATTTGAATGAAAAAGACATTGTGCTCTGTTGATA
GGAAATGGAGCAGGTGTCTTTTTCCCTTTTTGATATATATACTATATGCTTTTGAGAACCATAATGGAGTCCACAGAGAATTATATTATAGCACAATCAA
ATTGTTTTATAGTAGTTTTTTTTTTTAATTTTCCATGTGATGCTTGATAGTAGGTCTTATATTGGGAGGAAGTGCTGTCTATAAAAAAAATTATACAATG
TCATATTTAGGGGTTGAACTCGAGATGTTTAAATTTTTTTTAATGTTTAAGGTTCAAATTCAAAATATTTGATTAATAATCTCATCCATTCACCATATGA
TCCTCTTGTGGTTTTTTATAATAATATTTCTTTTGTGAAATTTTTTATAATAGTATATTTGTTAAGATATTTTATTCTATTGATATATCACAATATTATT
ATAAAAAGGGTAAAGGGTCAAATATAATTGTACCATTGGAAATAGTTTAAATATATTCTTTGTTATATTTTAGGTCTAAATTTACCTCTTTCGTTGTACT
TTGGGTTCAAATATATCCTTCTAATTATACTTTGACACAAATTTACCCTCAATTTTAACGAAAAACACGTGACAAGCTAAAAATCAAATAACGCATCTCG
GATTTTAAATACTTAATTCTTTTAGAAACTCATTTCCTCTACTATGATTTTTTTTCTTTGCATCTTCTTCTTAAAAGAAGGTAATAATTTATCGTATTCA
AAAATTAATATGGTTTTTCTTTTTCTTTCGAATTGAGGTTTTTTTAAAAAAAAAAATATCATGCTTAACGTCTTCTAAAAAGTGTCAATATTAATCAAGA
AAATACACTACTGAGATACGTTCTAAGAATTTTCAGCATCCAAAAATCGATGACTCCCTACGTTTATTATTTTCTTGTTCTTTTATAATAGTAAGAAGAT
GTGGGTACAATGATTAATTTTATAATTTGTGAGAGAAAAATGCAGCATAATGATATAGCGTGATATGCATATATTATTATTTTTGGTACAAGAAATTTAA
GAATAGAATAATGAATGAGAAAAATGAAAATAAGAGCTTAAAAACGAAGGGAATGAGTTGGATGAGTTACACAAATTAGTTTCTAAGCATATTGAGAGTA
AATAATTTGATTTTGAGTTTGTCATATGTTTTTCCATCAAAGTTAAGAGTATATTTGTACCAAAGAGAAGTATATTTGGACTCAAAGTACAACATGAGAG
GCATATTTGAACTGAAAGTATAATGAAGGGTATATATAGACTCTTTCCTTTAGTATATGGGTATATTTGACCCTTTACCCTTATAAAAATATATGATATA
ACATAATATGGAAAACTAATTTGAAGAATAATATAGTTATTAAAGTGAAATATTTTCATTGTTGATATTTGTTGTAGAGAGATTTAATTATTATACAATA
ACTAATTAAGAGTGACAAATGGCCAGGTTAAAAATGGATTAATTAAAAATCATAATATATTAATGTCATTAAAATTTTTAGCCCTCTTTATTAAAATTAA
TATTTATTAAAGCTAAAAATTATTTTTAACATAATGAGTGATAATAATGGGACCCCTTAGTTTTTGTTCATTCTAATAAGTGCATGTACAAACGACATAA
CAAAAGGGCCAGCCAATTCTTGAACTATCCGTATGATATTGATATCTAATTCGCTTAAAGTTTTGACAGAATTATTCCTTGTTCACACAGGAGAAGGAAA
TAAATAAAGGGAAAAACTATATAATTAGAGATACGTCGCTGGGATATATACTATTATTATATATACTTTGAAAATGTTACCTATTTTACTATTAATTAAA
AGTTTAAGATATATTAACGAGTGAGATTCGTTTGTATTTGATGTGATTCGCACATATCTGAGATGGAGAGTGACGAGCGAGATGAGAGAGGTGAGTGAGA
TTTGTTATATATACCAGATTCATGCCAATCCACTTGATTAAGAATAAATTACAATTAATTTTAATTTCATGTATTCTAAAGACATGTATTTGAGTATATC
TAATAACACGAAAATCTAATAATATATATAATAATACAAAGTAAAATGTATTTAAGTAATTAACTCCTAAATTAAAAAAATTTATTACCGTTTAAATGAA
ACATTTGATATTTGGTCGTCTATCTACCACTTCAACCACTACTTCTTTAAGGTTATAAGTAAATAATAAAAACTAAATGGTGAATTAAAAAGTGGTCAAC
TGGATCAGGTTATTACAAGAATGTACCTAATTTTGGTCCCAAAAACGAATTATTATTACTATTAATTGAGGGGTCGCGACAATATCTCCTTGCGTCATTT
TTTTAGTTGTCATGTGTATTAAAAATATTTGTTTCAAAATAATTGTTAATTTAAATAATTAATTGTTTTTTTTAACTTTGTCATTAACACGAATTATGCT
AGAATTAAGAGAGAGATATATTAATAAAAATTAAAGAATTACTTCCTCTGTTCACTTTTATAAGGAGTTCAAAAAAATATACTTAAAAAAGGAAAAATAT
GTTGAGAGTGAGATTCGGACTCAAGTTCAACAACGTTAAAAAAATCTTAAGCACCCATTATAAGCCATTGGGCCAATCAATCCACTTGATTATTGGGTGC
TTTGCGTTAAGCTTATAGAAATGCTTCTTAATTTATACATCGATACATATAATATGATACAAGGTTAATGGATGCTCGAGCATCGACAGACTCTATGAGG
GTCTGCCCTTGCTAGTCATTGTTTGACTTGGCACACTCATTAAGAAAACAATTACTGATATAAATATTTTTACCATATTGTCTCTACTAATTGATGTTTA
GTATTGAATCTTGAAAAATGATATAGAGAATAATATTTGATGCCAAGGTTAAAACATGAAAAGAAAAAGTAATCGTATTTTCTTGATATGCCAAAACTGA
TAAGTAAAATGAAAATTTACTTTCTTCATCCAACAATACTTGTCCAATATACTAATAATAGATGTCCAACAATATTTGTCCATTTTATGAAAATTCATGA
ATAATTTTACACGTAGTTCCTAATTTACCCGTATCATTAATTATATAAACATTTTCCTATTACATTTTTTAAGACATAGCATTTATTATATTCAAAGAGT
ACGTGATATAGATAGTAGAATTATCCTTCTATTATACTTTCTTAAGGGATGTGCTAAGTCAATGGTGGACAACTATTATTGAACAGAGAAAGTATTTCCT
CTGACAAATAAAAGTAAACAGAGAAAATAATAAAAGACATATTAGTGAACGGATATTCCTCATTAACTTTCCTGAATCAAACTTTATCATAACAACTAAA
AAAGAACGAACGAAAATATAAATTGTTCAGCCCAATCCCCACTATCTATAAGTGGGATAGTGGAGAGTGGGCATAAGAATGTGTAGCTCTTTTAAGACCA
CAACTGTTTATAATTATTATTGAAAAAGAAAGATTTTTATCATAAAGGAGGAGGAAAGAAAATGATGAAGCATAATGATAATTTATGTAAAACACGCAAA
GTTGATGTAGGGGCACTTCTCTATAGGCGTGCATGCAGTCAAATATTCATCATCATGTTTAATCTAATATGGGAAAACGACGTTACTACATATTTAACTT
GAAGGGTTCCATTATTTTAGAGGGTCCAAATCTTAAACCCATTAAGTAATTATTAGTCAAAATTCAAGCTTTTGCCAACGGTTGAAAGGTGGCAAATTTA
ATCATGAAAGAGAAGATATCATTTAATGACTCGTTTTTATAGTTAGATGTGGATGAAGTGGAGGTTTACTTCTGGAGTTTTGTGTGATGAAAAAATATAC
CATCGAAATTTAAAGGTAAATTTTATAAAAATGATAGTTAGATCGACATTGTTATATGAGGCGGAGCGTTAGTCAACGCTTTCATATTCGTAAACAGATA
CATGTTGTGGAGGTTCGACTGCTTAGGTGGATGTGTGTGCGTTAAGAATAGAAATGAGGATATTAAGAATAAAGTGAAAGTGACCTTTGTGGTGAACAAG
ATGAGAGAAGCCCGACTGAAATGTTTTAGACATGTGAAGAGGAAATGTGTGGATGCACTAGTGAGAAAGTGCAAGAGGTTGATTATAAAGGATATGAGGA
GAGATAAAGATGGACAGAAGAAGCATTCGGGGTGGTAATAAGACAGAATGCACAGTTTCAGATTACCTTGAACATGACCTTAGATAAAAGGATATGGAGG
ACAAGTGTTAGGTTTAAAATGCTAGTAGGTAATGTAGTGTTATCTTTCACAAGTTAGTACTACTTGTAATGCTATAGTTCTTGTTTTGATATCTGTAATT
ATTTATTATTTTCAAGTCTATATCTTAGTATGTTGCTTATTATGATTCGATTATTGCAAATTTGCAATACTTTTTTGTGTTGTTGCGCTCTCAAGGTTGA
CTTTATACTATTTCCTTATGGCTCGCTATATTTTTTTCTTTGTATCTAGATTTGCTTTATCCGAGCCTAGGGCCTTTCAACAATAACATATTTAACATCA
AGATAGTGGTACATTAGTGCACATTGATTCTACTCTCTCTAAACCCCACTTGTAAAGTTTCACTTGATATATTATTATTGCAGCAATATAAGTCTAAAAT
ATATACGTGGTGTGATTTTCCATTCAAATTTAGGCCCATTTACTAACTCAATCCATTTTAACCCATCAAAATATTGAATTGATATGTATACCTGAATTGT
CCTACTAGAAATCTTGTCATAATACTTTAAAAAAAACATTCTTTTACTTGATATGGCATACATAGTCAATTAGTAATAATACAAAAATAATTCTCTACTA
AAAAAATTTATAAAGAACAAAGTAATTAAAATTTTTGAATTGAACAGTTAAACTTTAGGTCATTTCAACCGCTAAAGTAACTTTTGAACGGACTTTGCCC
TATCAAATTCAGCCCAACTCGGTCATTTGACACCATGAGTCTAACTCCCTTGTTTTCTAGTCTGCTGAAATGTCATTGTGCAACAAAATAAAACTGATAG
AATACATGACAAGTTCATATGAGATGTCAGCTTGACCAAGGCATTTTGATGGTCAAATCACAAGTGATAATTCTCTTTGGGGAAAGGAATTCCCCAGTTT
AGTCATGTACCTAAGTGTGAAGTAAAACCTTAGTTTGGTTGCTGCAGACCACAACTCTGCAACAGCTCACCAAAAAAGAATGAATTTTCACTCTGATAGA
TGACCTGACTACCAAAGGGCCAAGTTCTGAAACATAAATACCAATGGGAGATCACCAATGTTCCATCATCAAATTTTTGAAAGTATTCCTCTGAGCAAAC
TACTCAAAACAGTTTAAATCAATGATAATAAGAAGTAAAAGTGAATCATCAAAATGAGCTTTTGCAGATAGTAACTCAAATAGCATTTATACAAACAAAT
GTTGAAGCCTTAACAGGTATTCTCTTCTGTCTCTAAGGTGAACCACTTATAAAACTAGCATCAACATGTCAAGGAAAACTAATCATCAAGAAAGCTAATC
AAGATGATGCTAAACATTTCCTAGGAAGAGTCTTGGTTATTTCTTTACAACATTCAGAGCTCAAAAGCTGCTTTGTCACAAACCTATATGACCACGATAA
GCCTGTGAAAGGCACACGTACTGTGCCCTAATTTTACTAGCCGCTAGTTTGGTGATTAACAAGCATCTCAACTTTTATTTATTTCGGAGTACTAAGGCAA
GAAAAAGAAACTCAAAACTCTGGAGATCTCATTTGGTGAAAACAGAGTTCATCCCCAATGGACCAACTCTAAATTTTTCCTGGAAAAAAAAAATTCCTGG
AATTTTACCAAATAAAAGCTGCAGAGAACTGCTTCATTGCTTTTGAGTCATAATACAACCAGAGTGATCCTTTTTCAACACTCAGTGACCTGACCTGGAA
ACCAAGCACATGGCATGAGAAGCACCGATGGCTACTGAAAGCACGTTATGGTTCCCAAGTCCATCATCCTCCATAAGAAACTTGACTTCAATAGGAGATG
ACTGTTTCTCCGGCAATCCTGGAACACCCAGTTGACAATCTTTTGCATAGCCCCACATGTACAGTTTCCCACCATCTGTCACCAGCAAAATTAATCATTA
ATGCATTACATCCTTTGTACAATAAGCTAAAGATCATACAGCACTGGTCATGGCTTATTAACCAACAGGTCTCCAAAGCAGCAATGGGAAGTGGGAACAA
TTGGATGAGAACAATTTTCTTATAAGTCCTTTATTCATAGCATCGACTTAATGGATGACAATTTCTGCATTATTCCTTATGTTATGCATCTAAACCAAAC
AGATTGTGACATGTTTTACCTGTTATAGCTGCCGACGATGAACCTCCACAAGATATATAGATGACTTTCTCGTGGGCCAAAGCCTCAACTTGGATGGGAA
CTTTCTGGTTTTGAAGAGAAGAATTACCCAGTTGACCATGGCCTCCATGACCCCATGAAAGCACTTCTCCTTTATCTGAGAGTAAAGGATACTTCTAAAT
AAGTATTTCAGATACATAGATCAGAGATGCATGTTACATAGAGGAGTTTCACTGTAAGCTACCAGTCAAAGCTAGAGAATGATATCCCCCACTAGCTATC
TGAATAACACGAACACCTTTAAGGCTTGGAACTGGTTGTGGTTTCCAACCACCTAATTTGTCACCTCTTCCCAGCTCATAGTTTGAATTGGCTGAGAAAA
GAAAAGACCAGAAATGTTATTGATCGAAAGAAAGGTCATGTAATAGGCAATAAGATGCTCAAAATACATCCAAGAAAGTAGAGAAAAAAGAACAATGCTG
GAATGTCCAGTCCTCTACCAGATAAAGTCAATATCTATTCTAGAACTTAGCACGAGACTTGATATTATTCTTACCTGTATCAAAATAGAAGTACAAGACT
CGATACTTATTTATTTATAATGGGGAAAACCCTGGAGCCAATGGCACAAGGTTTGAAACTCAGCAGATTTATAGGTTCACCCCTCTACCCTTCTCCATTT
AAATACCAGGCTTTTAACTATGGTAGGTTGTGATGTACGCCTAGCCCCCATATCACATGTTCACAATTACCACCAGATCAAAGCCCTGGGAGCACAAGAC
TTGATGCTTCATCAAGTTTGTATCTAGGTCTTGTTCATCATTATGGGTCTGGTTTATTATTATGCTGGGGCGCTGAACTTGCTGGATTTAAGAGCAACAG
ATGATCTGAAACAAATACATACATACATTTTATTACAAGTAGAAGGCTCAAACTAAAATGCTATTAGACAAATAACTTTTTAATCAAATAAAATTCGTTT
AACATCGTTGTACAAAATGAAACATATATTCTTTTATTTATAAAGGTGATATAACATATAAGAAATACTGTTTACACCAAATATATAATAGACTAAGGGA
ACTCATCCTAAGTTTGTGTTGGGTTGCTTGTGTCTTCGAAAAGTTATCAACCTATCCACCATATGCAGGCTGGGATCAGCTGCCACCAATTCTCCTCCCC
ATTTCTTCTACCTATACCTTTCCAGTTGTTGAGCAACTCAAAGGTAGTTTTAGATGTGACCCAACTGAGATCTAAACTACGATAGAGCATGTACCACATA
TTAGCAGTTGTCTTGCAATGGATGAAAAGGTGGCCATGTGTCTCCGCATCTAATCACATAGTAGACATTGTGAGCAAATCTGCAAACCACTTTTTTGTAG
TCTTTCATGTGTTAGGCATGCATTCCTAGCCACTAACCAGGTAAATCAAGAGTTTTGGAGGGATCTTGGTCTTCCAAAGCCACAGCATTGTAACGGAAAT
GTTGTGGTTTAAATTCCAGTAAGCAGGAGGTACATTTTTTGAGAATTTTTGTCATTCCAACTTCCATTTAATATATCCCACATGTTATGATAATAACATG
TAGGGGATATAGCTATTTTAGTCCCTGTGTTATTGTATTATTTTTTAAGGCCAATTGGATATTTAAATTTTCATTTCGATTGTACTTCATGAATTCTTCT
TGTATTATTTTGGTGGATTAGTTGTCAGTAACTACACACAATAAGTTGAAAACCAAAACAACTGCAAATTTGTTACTTTCGAAGCTTATATATAACCAAA
TCGTACATGTTTTTAGAAAATAAAATTCAGTGCACAGTTCATGGCAGGGGTGGGTGTATTTTGCTCCAATATTCGAAGTCTATTATCAGCTTTTCCCAAT
TTTATTCTTTTCCTCGCATTTCTCTTTTGATACTACTTCATTAATGTGAAACCTGTTTCAATACTTATAATAATTGTGCAAGATCCTAGAATGATCACAA
GTTATAATTAAGTTACGCTAATCTAATAGTAACTTGTGAGGTTAGAGAAGAGGGTGGATAGGTCAAGAAACGTAGCCCACAAGACACCACTGCAAATGCT
TCCAATTTCACTGTACCTACATTTTGTCCATATCCAATTGTGAAGTTCATCACAAGGATAACTAACTAACAAACTTCAAAAGAAATTGGTCTTCAATTGA
AGAATTATGCAGCCAAGGCATAAAAAAAAGGATTCTTTATATAGTGGATGATCCAAACTAGAATGGTTGAAAAACAAAGTATTCTCTAGGAGAATTTTAT
CTTGACCGAACTGCCTTTCGTAAAGTTATCAGTTCGTTATGGTATTTTGGCTCCGTTAGTAAAAGGACTAAAAACACAAATATTACTTAATTAAAGGTCA
AATGTGCTTAGTAAGATATTATAGGAACTAAAAGGAATAATACAATAGCATAAGGAACGATTTTCCATATCATATATGTTGTTTTAAAAAGTTTGGGACC
GATTGACACAGGATACATGTGTATAAGTTAATGTATGTGCCCACAGATTAGTATTTGTGTGTATACACACAAAAAAATATGCAATTAGAGTTAGGTTATT
CATTTGCTAATTGGAAGTCATATATATTCATGGACAAGAACAAACGCTATTTAAAATGTGTACATGTTCAATGACTATGTACTTCAGTTTAGAAATGACC
CGCTAACAAAAATTGTGTGTGTGTCTCACAAAAGACAAACACTGTCCATGCAACATTAGTTGACCCTTTTGCAATCTACCATTTGAGGAAAAGAAAGGAA
CAGATCCATGCAATTTGTTATTCAGATGACTAATTCATGAACAGAATTGCATCAGCTTGGGAAGTGAAATTTCTGGGTTAGCTTGACGTTTGAGACATCA
ATGTTCGACTAATACAGAAGGAACGGTTAAGTGTAATACTAGGGATTATGTTCCACAACAAGGCATTTGGATTAAGACTATCTAGACCACTTAATTTGCA
ATAAAGAAATCAAGACAACATCCAAGCGATATTTTGTCTCCACTTGAAGTCATGATTACCTTTCAGCACTCATGTATGACAAAAGAAAAGCATGCGACCT
TCTTTTTAATTTTTTTGATAAGGATCAAACACAAATAATGGTGTCAACTGGAACAAACCACCCTTCCTTTCAAAAAATTGACATGATCATAAGGCAAAAG
CATCAAAAGGCGATAGAATCTTACCTCCCCAATTCCAGAGCTCTCCCTCTTCTGAAAGTGCCATTGTGAAAAACCCACCACATGAAACAGCAGCTACACC
TGTAGGAAGTGATTTTACTTTTAAAGGGATGCTAAGACCACCTGCTTCATTGTGGCCTCGACCTGGTCCAAGGCCCAAGCGACCATCCCCTTCATCTCGG
CCCCAAGTATAAAGTTCACCTATTGACATCACGTAAAAATATAAACTCGAAGTTAAAGGAAAAGAATCAGCACTAATTTGTACTTCACATCCAAATTTTA
TAGAGTAAAAGACAGGAAATAATTAGAACAGTAAGTACTTCACAACAAACTCCTCAATAAGCTGTAGACACACATTCCCGTGTTTAACGCTATTATTTTA
CATTGGAGCGGTTTTGATAGTAGACATGGCCAACAGCTATCAACTATCAGTTTGTTAGTAAGAAGAGAGCTTCAAGCCAGTTTCTAGTGCACCTCCCATA
TATGCACCACCACACAAAAGAGGGAGGGAAATGCTTCAAGCACAAAACCTCTGACTTCCTTTACATAATGGGTTGTCGAATGGCGATAATCGAAGTACAA
ACTAAAAGCATCAAATTTTTTGTGTGAATCCGGATATTTTCTTCAAAATTTTAAAGTAAAACTTACATTTTCATTTAGTAAACTACATAAAGCAAATTGA
TTTCAATTTTACGCATTAATAAGAAAAGTTTTAAAATTATAATCAAAGGAAAAAGAATTATTGTTCAAATAGTGACAGTATCATACAAATGGAACAAAGT
GTAGTGAAGAACCACCCATCCTCTACATTCATATCATGAAAAACGCCTTTTAAAGAAAACTTTATTTCTACCCGTAAAGCAATGGATTCAACAACCTAGG
CATGCATTAGGTGAGACACTCAAAAGCATGAATTATCAAAACTAGAAATACCATTGGTTACTTTGCATCAAAAAAGTATAAGATGTAAGGGTGTCAAAAT
GGTGGAAATTTATGGCCATCCACTTCACCCGACCCAACCATTTTGTATGGGTTGGATATCCGATCATTTCAAAAGTGGGTCAAATATGGATCAGCCCATA
CTATTCATCAAAAATTGTGGATAACCTAGGGGTAATCCGCCACTCATTACTTAACTCAGAACTTGAATCTTTTACACCCTCTTTCCTAGTAACTTACACA
CAAAGGGAAAAATAAAGTAAACTAGGGGTACTATTTATGTTTTCTAATGAGATAATCACATCATTCAAAACTGGGCAAGTAGTATATTCCCCTTTTTTTA
GAAAGTGGGAAGTAGTATATTTTATTTGTTAAGATACAAATTTCTTATTCTAAGGTAAAGGCTTACCCGTAAATGTTCTTTGAATAACTTGATAGTAGAC
AAAAAACCATTTAACTAACATTATATAAACTTTTAGGGGTCAGTTGGTAGTTGGTTAGGAGCTAAGTTATTTATGCATTAAATCTTGCACTCGTAATACT
CCCCCTATACCGATTTATGTGACAAACTTTCCTTTTTAGTCTATTTCAGAAAAAAAAAATGACACATTTCTATAATTGGAAAGTGTTTTTAGAGTAGGAA
TGGTTATACACAATCCCACTTAGAATATGAATAGTAATAGGAATAATATATAGTTTCTGACTTGCTAAAGGATTGTATTATAGTGTCTATAAATAGGGTT
TCTATGTATAATGTAGACACACAATAATTCAATAATATTTTTCCCATTCGATAGTTCATTTCAATTTTTGAATATGTTGTACCGAACATCCCTAGTAGTC
TGGACTTGGGACATTTCTTTCTCTTAAGTAAAAGAAAATGAAAGCCAAAATGGCACTAACAATTTAACAAACACAAATGACCATGTCATTACACAACAAT
GACAATCTAACAAGTAACAATAATTCACCATATGTGCATCCATGAGTTCTCCACTCATTACACTAACAAGTAACAATGGACTCACAATTATTCACCACAT
ATCAACTACAAAACATTAATATTTTGACAATAACAAAACTCAGTAATGGCCAAATCACACCAAAATTTCCATCAAGATTCAAGAATTTAGTTTCTTCCAT
AAGACCACTCCAAGTGCCAACAATAAAGAAAAACTATAGTACTTTACAACCTTCTTCATATCTTGACAACTTGAACTTTTAAGATAAAACCCAAAGTTAG
AATACTACTTTTAAGATTAGAAAAAAAGGAATAATCAAATAAATATCTTATTGAACTCACCATTACTAAATACTTGAAAATTACCAACATAGATCGAGTT
TCTTTCACTAGTTGTCATCTCTAAAAATAATAAAATCAAATATGTCAGACAAAACTAAGTATCTTATTTTTTGCGAAAACAAACAAAAAATATAAAGACT
TACCAAGTTGAATTTTCTCAAGAAACTCCAAATTCGTTCAACACAAATAGGATTAGTATAAGCCAATTTTGGACACAAATAAGAGACATTACACACATTT
GGGAGTCCATAAACTTCTAAATGAATCAAGAATACGACCACCCGTGCTAAATACACATTCAACATAAGAATATGCAATACATTTCGAGTCAACGATAAAG
TAAAGGAAATTAGAACTTTCCACCAAATTAAGATATCAAAATTCTCAAATTTAGGCTCTTCAACTAGGTATCTTTCCAACTCATATATAGTGCCTACACT
TTTAGATTCTTCATGTAAAACTTAGTTCTCAAATTTTGAGACAAACCACAAGTAGATGAATTAGATAAACATGATTGATTCTTTAAAAAAAAACCTTTCT
AATGCTTACTTACATAGACCGCAAACAATTCCTTTAAGTAAGTTCCTTTATTTACTACTTGCCCCAAATAATTCTTCAAGAGCAAAACTAACGTACACAA
ACTTAATACAAGGATCCATTACAAAAGCAATAAAAAGCATTTTGTTTATCTTTTCAGGAGTTCCCCAATAAGTCTTGAACTTTTTTTCATCCCACAGTCA
CATTACGCAAATCAACATCATCACTTGTCATACACGCTTTCAAATATTCATCAAGCTCACACATATCCTGAAAATGAACATTACAAGTAACAAACAGTGA
ACCTGAAACTTCCAATGTAAGCTCATAAAATTTTTCAAGAAACTCTGTGACATTCCTCACATCAACCCAATCATCATTTTGGATTGAACCTGCAAAACTT
CCATCTCCACAAACATCAGTAGCAAGATAAGAAATAAAATTGCATAAAGAATAAACCTCTCAAAGGCCTTCTCAAACTTTTTTGTCGTGTCCAATATCAA
ATAAGTGGGATTCACCTAGTTGGACATCTAAAAATAACATTTTATCTTTTGCATTTCAAGAAGTATTTTTATCCTTGTAGAAGATGATCCAACATATTTC
ACCATTTGTCTTACTAGTTTGACAGAAGGACCAATTTCTTTCAAACTATCTTGAACAATTAGATTATGTATGTGAGTCATACATCTCACGTGGAGATGCT
TACCATTCACCATATTAGTTCTCACATATCTAACTCTTTAGACAATTCTATAATTGCGACATTTTGTAGAAGCATTATCAACAATAACAGTGAAGACATT
ATCCAAGTTTCAACCAAGTAAGCAATTACTATAGACTCTAAGCACCCAATCACTATCAATAAAGTATGTGTTTGACTGCTCACTTTATCGATAAGGATTA
AATGCTTCATAAAAAAAATATTGAATTTTGGTCCCTATCGCTGCAGTATATTAGTAATTGTTTACTTGATTAAAACTTGGACAATGTCTTCACCTGTTAC
GGTTGATAATGCTTCTTCAAATAATATCGCAATTTAGAGTTAGATATGTGGGAAACTGATATGGTGAAAGGTAAGCATCTCCATGTAAGATGTATAACTC
ACATACTTAAACTAATTGTACAAGATGATTTGGAGGAAATTGGTCTTTCTATCAAATGGGTAAGGCAAATGAAGAAATATATTAGAACATCTTTTACGAA
GGACAAAGAAACTTCTGGAAATGCAAAAGATAGAATGTGATAAAATGTTATCTTTAGATGTGCCTACTAGGTGGAATCCCACCTATTTGATATTGGACAC
CACAGAAAAAAATTTGAGAAGGCCTTTTGAGAGGTTAGATCTTTATGATGGTAACGTTATTCCTTTATCTTGCTACTAATGTTTGTGAAGATTAAAGTAT
TGCAGGTTCAATTCAAAATGATGATAGGGTTAATGTAAGAATGCAACAAAGTTTCGTGAAAATTTTTAAGAGCTCACATTGAAAGTTTCAAGTTCGCGAT
ATGTTACTTGTAATGTTCAACATGAGGATATATGTGAGGCTTTATGCATATTTGAAAGGGTGTATGACAAGTGATAATGTTGATTTGCGTAAAATGATTG
TGGGAATAGAAGAAAAGTTAAGACTTATTGTTTCCGTGTTGGATTCTCGTATAAGTTTGTGTACATTAGTTTCGCTCTTGAAGAATTACTTGGGAAGAAT
AGTAAAAGATAGTAAATAAGGAACCACAAACTTACTTGAAGAAATTATTTGCGGTCTACGCAAGTAAGTATTCAAAAAGTTCTAAGAATCAATCATTTTC
ATATGATTCATCTACTTGTGGTCTTTCTCAAAATTTGATAACTAAGTTTTACATGAAGAAACAAAAGGAAGATTCTTAGTTGGAAAGATACCTTGCTAAA
GACCAAGAGCCTGAATCAGAAAATTTTGATATCTTAATTTGGTGGAAAGTTAATTCTCCTAGGTTACCTATACTTCGATAGTTGACTCGAGATGTATTCG
TTATTCCTATGTCGAGTGTGGCATCGGAATGCATATTTAGTATCTGTGGTTGCATTCTTGATCCATTTAGAAGTTCATTGACTCGCAAATGTGGGCAATG
TCTTATTTTTGTCTAAGATTGGCGTAGTCAAGAGACAAATCCTATTTGTGTTGAAAAAAATTTGGAGTTTCTTGAGAAAATTGAACTTGATATGACTTCG
TATTTTTTGGTTTTTTCGCAAAAAATAAAATACTTATTGTGTTGCATGACACATTTGATTTATTATTTTTAGAGATGACAAATAGTGAAAAAAACTCTTG
CATTGTTGATCTTTGATTGCAATTTTCATGTATTTAGTAGTGTCAAGTTCAACACGTTATTTATTTGATTATATATCTTAAAGAATCAACTTCAAGTGGT
CAAGACAATAAAGAAGCGCGTAAAGTACTAAAGTTTTGTTATTGTTGGCACTTGGCACTGGTCTCAGGGAAGAAACTACATTGCCGTTCATTGTTGTATT
GTTATTGTTGGTGGAAAATTTGGTGTGATTTGGCCATTGCACTTGGAGTTTTGTTATTGTCAAAATATTAATGTTGTTTTTTTATAAGGCTAAGGTTGTA
TTCATCAGCATTAAGGACATGCCGAAGACCTCTATAAGATTTACATCAATTTTCAATCTACGACAAAACAACTACTAGATTACATATTTCCTATAAAATT
TATAATTTGTGCATTTTGATCTATTCCTTCTTCTTTACATAAGAGGTTGTCATATATTAGCCTTGTTTTCAAAGCACCTATTGTTTCTCTCCATCCATAT
GGACCACCATATGCATGACGGAATCATACTCCACCATTTTTTCTGAGTTTACCTCCCCCCCCCCCAACTTTCTCATCCAACAATTGTCCGGCATGGTCCA
CTCTATTTGTGTTAGGCCCAAAAAAAGTGCCACAATAATGTTATCATTTTGCAATGTAGGAATATGTCTATTAGTTTCCTCAGCTTTATTATATAGAGAG
CACCAAAAGCAATGTGAAACCCTCTCTTATTTAATCTTTCATGAGTGGAGTAACGTTTCCTTACAACCAACCAGGAGAAACACTTCACCTTGGTTGGCAC
TGTAAGACCCCGAAAATGACTTAGGTTAACTAGAGCCTAACATGTTGGTATTGATGGTCTAAAGTCCTAAATGAGTCTAAAATATGGTATATAGATAGTA
GCTAAAGTATTAGGGGTGTTGGAAGTCAAATGTCAAGGGACGACTAAGACGTTTAACGACTAAGTCACCTAAATGTCTAAAATGTGGTTCTATGTGTTTA
TGTGTGTTTCAAGTGTTTTCAGGTTCTTAATAGAGTTAATATAGCATGTATAGGCAGTGATTAAAGTTTCGTAAAGTTTGGAGGTCAAACGACCAAGAAC
GTCCAAGGCGTTCGAAAGATATGCCTTGAGTCGACCTTGTATGTCTAGGCGAGTTTTACGTGTTCGTTTTGGATGAAATTCATGTGAGAGGTGTTAAACT
TATAAACGATCATATTTGGGTTGGAAATGTCCGGGAAATTATCCCCAAGGACCATCTAAGAGTCCTTGAGGAAGGACCCAAAACTGTTGGCATGGCAGTC
CCAAGCAGACCCCAAACGACGAAGCAATCGACGGCTCGTAGGCCTGTTGACGCCCCGTCAAAGGGTGTCGTCGATGGGGACTTAACCATGAGAGGGAAAA
GAAGCTTGGCCGGCCATTGTAGCCAACGACGGAGGGCTGTGACGCCCCGTCGTGGTTGTAACGCCCCGTCAAGGGCAGGTGTCGCACGCAACTGCCTTCC
TGCGCAGGCTGCTGCCAAGTCAAAAGGTGAATTGTAAATTCACTCCGCTTCTAAATTAAGTCATGGACAGTTATTTAAGGATTATTTGGGTATTTTAATT
AAGTATATAAAGGGTAAACACCTTAAAGACTTCATTCTTCCAAATTGAAAACCCAAAACACTTACAAAATATCCCAAAACCTCCATTGAAGACCCAATTG
AAAAGGCATCTTGGTGAGGGGTTTTTGTGTCGAAATTCTTCATCAAGTGAAGAATTATCATCCTTGAGGTATGGCTTTTGATCCTTGAAACTCGTTTCAT
CAAGGAGCCCAACTCTCAAGATGTAATTCAAAGTTTGCTAAAGTGAATTGTCCAATTTCATGATTCTACCATGGGTTCTTGCATAAATGAATTCTAAACA
TCGAATTATGATCTAATTGATATTGTATTGATGATTTTAACATAAATTACCTATGAACCCATGAATTTGGATGAATCCTAGTTTTTGACTATAATGTGGG
TTACTTGATATTAAGCTAATATTCATGAATTGTTATGTAGTTTCTAATGGGCTTTATTCAATTGTTATCTAATTGATCCTAGATTGTTAAACCTAGATTG
ACTTGATAGAGCTTTCATTGGATTTTATTATTATTGCTTGAATTGTTGGTTATGGCCTTGGGTAAGGGCCTTGTGATGTTGAATTGGATGATTTAGCATA
GAATTGAAGTGTGAATAAGGGAATGAAGGTATGCTGCCCGGATTTCTTTAATTTGATATTAAGTATACTTCAATTCTATTGTGATTGGTATGGTCCACAT
ATGGTGGTGGTGTTATGTGTTTTACTTGCAATTGATGTGGCCTTGTCAACGTTACTTTATGCAATATTATAAGCATGGCCCTATTGGCAACTACTTGAAC
TTATATGGCTATTTGTACAGTTGATTTGATGATGTGTGATCATATCTACCTATATGTGAAAGTATGTGTTAGACTATCGATACTATTTAGTTAATAATGT
TATGTTATGGCTATGTGTTAAGTGTGTAGTCTTAGAGTTGATACATGGTTGATCCTAAGTTGGTTGGATGAGTCTAAAATGGTTAGGTTAATAATGTTAA
GGTAATGAATAGGATGACTAAATAAGGTTAAGGGTCATTCCTAAGAGTCTAAAGGAAGATAGGCAATTTGTGTTAGATGGAAGTATGTTGGTCTTGTTTA
GGTAGACTTGGGTCCCTTACTTGATGCTTATGTGAATATGTGATGTCTTGACTTAGGAACCTAAAGGGTCTTAGTCTTGAATAAATGAATATAGGTGAGA
CCTTGCATGATGATACGAGGTCATTTATGTGGAACCTTGACTTAAGGGAAAGGTTAAGATTGTTGAAGTGTAAGCCGTAATGGTATCCTTCAAAATAAAG
GAGTGACGGACTTAAGGTTAATTGGTCGGAACGGCATCATATCATACCTTAGGAAAGTCGTGATGAGCTTCTTGTCACCATAGTGAGATATGCCCTAGTG
GACCTTGCTTTGGTTGGTTGAATGTAATTGGGTCATGAACTAGATATGGGACCCTTTTATATGAACCTTAATGAGAATTGATCTATGAGAACGAAGGCTA
GCACCGAATGAGTATGGTAAGGGAAAGTAGTTCTAGTTAAGTATGAGACTAGAATACAAGGTATGCCCTTCATATTCCTTAACAATGTAACTACATTGGA
TGTGTCCAAGTTCTACCATTTGCAAGTAGAACAACCTCATCGGAGTAGGATAAAACTCCTGATTTCGTGTCTTGCTACCATGGTCTATGTCGGTTATTGC
CTATTCTCATCATATGGAATACCTATTAGCATTTGAGGAGTTTATGAAGTTTAGGTGGTGGTTTGCAAAATAGACTTTGAAGGTGTTATGTGGAGTTCCT
AGGTCTTGTCCAAGACCATTATTTGAATGTACTTTATGTGATGTATGAGTCTTAATGAACTACTGACTTATGTTAAGGAGTATGTATGTAAATAAATGAG
TACCTAATCTAAAGTGACTTAAGGATTCCTTAGCTAAAGTGTGAATATGGCATAAGAGATGATCTCTTCATGTCTTATCTTTGGAAGTCTTGAGTATGAC
TCTAGTTAGGGAAGTTTGTTAATTTTGTGGACATGATCTAAGCCTTAGGTGGTCTTAAGGATTATTTAGGTAATCTTGAAGAGGTCACTATGGACGTTAT
CTTCTTGATTTACTTAAGTAGGTCTTTTGATAGCCTTTGGGAAGAGAATGTCATATCATCTATGTGTTGGTGATTTATGTGAGCATGATTCTATCTTAGA
GAGTCTATCGGATCTCTTAAGTGTGTGTAAGGGATTGTATGGGCGGTCGCTTCATAACTCACTCAAGTGAGACTTAGAGTTCACCTTTGGTAGAAGAATT
TACCTTGATGTTTATGTTTGTTTTGTAAGTATGTATGTGACTCATTATAGGTAATCTTAAGGGTTGTTTAGGCACATCTAGAGAGGGTGTATGGGCAGTC
TCTCTTTGTGTGACTTAAGTGAATCTTAGGATGACTTAAGTGAGGAAATTACATGCTAGAATTATCTTATGTGTTTCTAAATTGATTAATGATGTTATTA
TGATTAAAGTCCATTTTCATGATTTTTATGCATAAAGCCATACTTAGTTCATGTGTTTGTACTAACTCCATGCGTTTATCTATCTATATAGTTCTTGGTA
GGTAAGGAGCTTTGAGAAGTGGAGACTTAGACTTAGAAGATCTTGATCACTTGACTCGAGGGCATATATGTGTCCTTTATGTTTTCATTCAAAGTATTGT
AATAGACTAAGTATTTCTATATTCGTATTTTGAAGTATGGATCGTGTCCCAAGTATTCTTGTGTCTTGAGATGATAAGATTGAGACTTAGTATTTCCTAT
TACTTTTATATGAAAGAGATTTTGAAGACTATATTATGTTTTGTGAAAAGTTTTAATTCCGCACTACTTTTCCCTATGTATATGCAATGAATGATATGAA
AGAGGCTTGTCTAAGAACTCCGAGAATTCGACGACGCCAGTTACAATCCAAGATTGGGATGTGACAGGTACCTTGGTTTTCAATCTGGTTCCATGGACCA
ATCTTACCACCTTTCAACTCTTTCACTTCCTTGATATATAATCTGTTAACTGATAGCACCCCATCGCTCCTATGTCTCCATCTAATAGAGTCTTCCTCCA
TTGTTGTCCACGTAAACCCATCCAATATTTGTAATGACAAAGCGACTCCCAATCTCCCAATCATTAAGGAATCTTCTAAACACAATGTTCCATCCCTGTT
GGGACCAAACATCAGCCACTGTCTCTTCCGGATTAGTACTCAGGAGGAGAAGGTCTAGAAACAAGACCATCAGTGACTCATTTCCAATCCAATTCTCCTT
CCAGAATGACGTCGTGGTTCCAGATCGCACTTTATAGTCTACATTTCTAATTAGGTAGTGTCACAAATTCCTATACTGAAACTCCATAGGTGTAGTTGAC
TAAGTTGGAGCACCATTTCTTATCCATACCGTATTTGTTTACTATCATCTCTTTCCACAAAGCATGTGTTTCCCTGGTAAACCTCCATAGCCACTTTGAG
AGAAGACATGCATTTTGAATTCTCAGATTTCTGATTCCAAGTCCACCTGACTGCTTGTGAAGTTGTACAACCTGCCATTTAACTAAATGTCGGCCCTTTC
ATTCTTTGTTTCCCAACCACAAAAATTCTCTTCTTAGCTTGTCAAGCCTTTCCTCCAAACAGTGACATTACATAAGTAAGCAGTGAGAAAGAGTTTATAA
AAGTAACTCTCCCTTCTAATGAGATGTATTGGGTTTTCCAGTTAGCTAATTTCTTTTTAGTCTTCTCAATGATGCCATCCTATATTTCTAACTCATTGTG
ATTGTGTCCCAGCAGCATGCCTAAATAGGTCATTGGAAGCTGCTCCACTCTGCACCCCAAAATAGTTGCCAAACTTTGTATTTGAGGAACCTCCTTAATA
GAAATATGCAGCTCTTCCTCCAGTTTATTGTTAGCCCAGAAACTGCCTCGAAAATCACCAAGGTCATCCTTATGAATGAAATCTGACTTGCCTTTGTTTC
ACAGAAAATGATTGTGTCATTTGCATAAAGTAGATGATATATGTGCATCTCCTCCCCTAAAAGATTGTCAATCGTGAATCCCCTTATCCAATGATTTTAG
ACACTCTCATCATGTTGTGAAAACCCTCCATGCCTGACGGTTTTTATACTAAAGGCAATCTACATCAACCATCTTTCCCCAAAACTCATCTGCTCTAGAA
TTTTGAGCAGGAATTTCTGGTATTCTCTATGTCCAAATTACACATGATGTCAGGATCTTCCCCTGTAATTCTTGAGTCAACAGTCACTTGCTATCAAAGT
TGCGTCAATGATCTGTTGAAGGCCATTTGATGTTTATTGACTAGCTTGCTTATCACCTTTTTAGTCTTTCAGCTAAAAGCTTGGCAATTATTTTGTAAAT
TCCACTTATCAAACTAATAGGTCTGCTGTCTCTTAATTGAAGTCTCTTAATTCAAGAGCTCCCACTTTCTTGGGGATTAGAGCTATATAGGTTGTATTCA
AACTCTTTTCAAAAACATGTTGATCATGGAACTGTTGCATTTTCTTCATGATATCTAACTTAATAATTTCCTTAGAAGCTCTGGTAGAATCTCGTAGGGA
AACCATCAGGGCCTAGGGCCTTGTCACTAGCACACAACTTGAGTGCTTCTAGAACTTCCTCTTCCTCAAACTGTCCCTGTAACCAAACCTTCTCTTCTTC
AATCACTCCTTCATATCCCTGCAAGTTGAATGTTGGTCTCCATTGCTTTGGTTCCTTATAAAGCTTTTGATAAAAGCTTACAATCATCTGCTTGATCTCT
TCCGGTTCAGTGATAGTTACCCTTTCCACTTCTAGTTTTTCATTTGTGTTTTATCTCCGGTGGGTTGTGGCAACTCTGTGGAAGTATTTGGTGTTCTTAT
CCCCTTGTTTCAACCATTGTACCCTTGACCTTTGTCTCCATGCTACTTCCTCATTCCTGGAAACTTCTGCAAACTCGTTTTAGTGGTTTACGTTCCTCGA
TGGATGTTCCTTTCTGTGCTTCTAATTACCTCTGTTTTCAAATCCCCATTCCTTTAGTTTCCCTTTCAACATCTTCATCTTTGTGGCCAACATATAGGAG
GTTGTACCAGTGACTGAAAAGGATGTCCACCATTCTGTGACTTTCTCCTTGAAACCCTCCACTCTCATCCATCATTGTTCAAACTTGAAATTTGTTTTCC
TTGGAGTCCATTCTCCACAATTCAAAAGCAAGGCGTTGTGTTCTGAACCTACTCTAGGAAGAACACTGTCTGATTTGTGGAAACACTTCCTCCCATCAAC
TAGAATATAGGAATCTGTCTATTCTTGACGCTGTTGTATGGTTTTCCCCCTTCTCCAAGTAAAAGATCCTCCAAATAAAGGAGGATCAATTAATTCCATC
TCATTAATCCAATCAATGAACTCTGTCATTGTCCTAGATAGATTGTTATTGACAGTTCTCTCATTAGGATACCTAGTGACGTTGAAATCACTGCACACAA
CCCATGGCCCATCACAAGAATGTCTAATTATTGTTAGCTCCTCCCACAATTCCCTTCTGATCTCTATGTTACAGTCAGCATACATAACACTTAGAAACCA
AGAAAGATTTTTTTTCTATGCCTATCAACTTACAAGCAAGCATTTGCCCTCCTACCCCTACCAGATGTACCTCTTATCCACATCACCGCAATCCCCCCCC
CCTTTCTTCCCAACTCATCTAAATGAAGTTCTCCCAACCACATGTTATGCCAAACTTATTTTAATAAAGTAGCATGCCCTCCCATCAATTTTCTCTCAAG
AAAGACATAAACATCAGCTCCCCATTGCTTAGTTAAACCTCTAACCAAGCTCCTTTAATCCCCCACCCATTCAACCCCCTCACATTCCAAGATATGAGTA
GGTTCCCCATCCTTAAAATTCACATGGAATTCAAGGTTCCTAAGTTCTTTTAAGAATAGAACTCTGTTTGGTTTATTTATTGTTCGCCTCATTCTTTTGA
TCTAATAGGCCTCTTTTTTTATCTATCTTCATAAAAAGGTCAAAAGCTATTTTAGCACATCCTTCAAAGGTTGCGCCAAACATCCTACTGAATTTTAGAA
CATTGGTTTGCACCCAGATAGTAGCCTTGTCCTCGTTCTCCTGTTCCAAAAGAGGTTCTGCCATCTAAATTGGCACCGGCTCCTCATATACGCTAAGATG
TCCTGCTAACAATTGACTTTGTTCTTCTCCAGTCAAGTTTTCATGTGCATCTTCCATGGAGAGGGTTAGGTCATTTTCCTCTCTTCTTCCTTCGCTCTGC
ATGTTAATTTCTCCGCTTGAATTCTGGCTTCCATGTATTTTCTTGATCTTCATTCTCATAACAGACTCTAGCTCTGTGTTATTAAGAGAATTTGGAGAAA
AAGGAGTGTACACTTATTTGAGGAATTTTAACATAGGATCAACACTTTCCCTTTAAGGAAATTTGTGCTATCAGAGGTTTGGGCTTTAATAGCCCACAAC
AATTCCCACAAAATTTCTTCCCTATAAAATTGTTGTGACTGTCTGGGTCCACTCCATGCATAAGTGTTGACACATTTCCTTCAAGGGTCATGTGGCTACC
ACTAGTAAAAGTGTCAGGGTCCTTGCTAAGGACCACTGGACAATCTTTTGAAAAAGACTTCCCAATTTTGTCATCTGAATCTATCAACTGTAGATTAGGG
TTTTCTATAGCCTTTCCTTTCTCACTCCTTGTATTGTTGCCTCAATTATTGGGCTCATCCCTTTCCTTTCTTCGGTATCTGGCCAGAGCCAGTGTAAATA
TGAGGTCACCATCGTTAATCTCCACTACAAAAGGAATCTTCTCTCTCGATCCCCGTACTCAAATTCGAGCTCATTATAGATGGTTTTTTAGTTGAGTCAC
TTCCACTGTTTCCAATCATCCCCCATAAAGATCTCCAATTTGTTTCATCACTTTATCATTCCAAACTGCAGTGGTAGACCTAGTGTACGCACTCAGAACC
ACTCGAAGTTAAGATTTGCCAGAAAAGCTCCTGCCATTGGTGTCCACCATTCTAGAAGTAGAAGGTGATTTTTCCAACCCCACTCTCCCATGAGTATGTG
CTTTGCATCTCGTCTCGATTGAAACTCAAATAGGAACTGAGTTCCATCCATGTCATAAATCTGCAAACTGTGGATGCCCATCCATGCCTTTTCCGCCCAG
CTCCTAACCACACTTTTGGTGGTTATCTTGACGCACCCTTGGAAATCTTCCCACCAAACACCTACTCAGTGGTCCTTTTTCTCCTTCAAAGAAAGCCATC
GGAGTCAAGCTCTATTCTCCAGCACTCCATTTGCTTCTTTGTATTATTTCTTTGTAACTATCCTTTCCCCTTAGTCCCATGGAAGTGGGACCTCATTGCT
CAGTAATAGAGACTTGTACTCCTGCCTTTTGATTTATGAATTTGTCCATCTTTAAGACAAGTCCCCCCATCCTTCATTGAATGAGTTTTCAGGTAAAATA
ATCATTGTTCCGGCTTGGCCATTTACTGAGACAACAGAGATAAACTTTCCATATTTATTGAACTTTAAGGTACAGTAAATGTTTAGTTGCGTGAATACAT
GCTTTAGTAACACAGAACTAAAGCACCAAAAAAGTCCTCAGTTAATATTTAATAATAGCTTTAACACTTCAGGACCACTTACCAGTTTATATTGTAATAT
TTTAAGCTATGATAGCGTTACTTTTAGCCCATTAGTGAAACATCAAACCAAAAAAAATCACAAAATCTAAAATCTAAAATCTAAAAAACCCATTAAGCAG
GCCCATAACAGAAAACACCAAATTTAATAAACCAAAACCGAACTTAACAGAATTATTTAGATTCGGTGTTCAGTACAACAAATTCAATAACCGAAAACCA
AAAACATGGAAACCGAACCAAACTACCGAATGCCTACCACTACTGGAAAGTAGAAAGCGTGACAAGTCTATTGAATATACTGGACACTTTCCCTGGCTCT
ATTCTGCAACCTGATGCATTGAGATGTAGACACACAATGGATGGTGTATTCGCTGTGAACAGATTTTGTAAGAGGGAAAACAGTATGATGCAAGGTGAGT
GTCCAAAGATCTGGAAGAATATCTGGAAAAGCATGGCTCCATCAAGATCAAATGCTTCACTTGGCTAGTAGTGAAGAGAGTTTGTCTTACTCATGAAGTG
CAACAAGAAAAAGGAAGAGTGGTGGTGACTAGATGCTTTCTGTACAATGAAACTGGGGAGACAAACAACCATCTTTTTTTGCATTGCAAGTCCACAGCTA
TTCTTTAGTCTCACAAAGACTGAATGGATGATGTCCAACAATGCCTGATCATACTGCTGATTTAATGAGTTGCTAGATGAGAAGAGGGGACAGCAAGAGC
CAGAAAAAATGATCGGGGATAATACCCTCATGTATATGGTGGGACAGTGGGAAGAGAGAAATGAGAGATGTTTTGAAGACAAATCAAGTCCATTCATGAT
GTGAAATGGAAATGCTTAGTGTGCCTATTTTTTGGTGTAAAGGGAACTATATAGAGGAAATAGATGAGCTGGTAGACTTTTTGGTGTAGATTTTTAGGTG
CTCTATAAAGATTTAGAGTCTAACCTTACTACCTAGTAATTTTTTGGAGGTGGCTAACATTCCTTAATGCTGAGAAATACAATAGTACTAGTTCTCAAAA
TCTCTCTCTCTCTCTCTCTATATATATATATATACATATATATAAAGAGAGAGAGAGAGATTCGGCCGACCATTGTGGCTATATTTTCTGCATCTTTTCA
TTCTCAGAAGCCCTTTCAAGGAAGTTGACTGCAAGCTATTTTACTTGGTGATGTCCCGGGGCTTTAAATCAATGGTAGAGGTGGTATAGCTGAGATGTGT
AGTTACATATTTGAATATTGTTGGTTAGCCAATTTCAAGATTACTAGAAAAACTATACTCTCTCCATCCCATTTCATGTGACCGTGTTTGACTAGGCAGA
AGTTTATGAATGAAAGACTTTTGAAACTTACGGTCTAAAACAAGTCATACACATTTGTGCGACTATAAATTATCTTATATTAATGGTAAACTGGGAAGTT
TAAAGTTAAATTGTTTCTAAATATGATGTCATTCTTTTTGGGACAGACTAAAAAGGAAAGCATGTCTAATAAAATGGGATAGTGGTATTACCCTATGATG
GATGGATGATGAATATTCCAATTTACTACCATCACATTTCTTGGGCATGCTTCTTTTGAAAGGTCTAGTACAAAGCTTCATCTAGAAGAACTGTTTGCCA
ATTCAAGATTTTTCTACCTAGGAAAAGCAATAACTACCATCCAGATAACTCCGGATTGATAAAGTAAGATCGAGTTCAAAATGAAAGAAGTGATTTTATT
GTCAAATGAGTAATCCAATTATAACTACTAATGATGAATCAGCTACATAGAAGTTGAATACTTAAATCAAACAATCCAAAAATTGTAGCTATCGATCATA
AAGAAAAGCACATACCCACATTTTCTCTAGCTGGTGAAGTGTGAAACGTGATAGTGTTTGAATATCCTACCTGATTTTGTTATAGCAGCTGTATGTGTCC
CACTGGTTGCTACATGGCATATTTCTGCATCCCAAGAACCCTCCACTAATCTAGGGACCAGCTCTCTGTGATAAACTTTATGACCAAGAGCGCCAAAGCC
ACCGTAACCCCTGAAAACTTCATTTTTTCCATAAAAGAATCAAGTTACAATGAACAAAACTGCTGATTATGATTTCACCAAGTCATTCAAACTATTCCTG
TGATAAGATTAAAGATTATCATTGAATGGGCATCAGGAATATGCCAAGTTACAAAAGGTATGACCAGTTAGCTCTAGTACAGAAGGGCAAAAAAAACATA
TCAGCACTAGTACAAGTAGCCTAAGCTAAAGCTAAGGAGGTAAAAAAAATCCAAAAACATGTCAAACTATTCACCATCAACAATTAAATTTTATCTCTCT
TTCACTAAAGGAATTAGAATACTTCTATGTCAAACTCTTCAATGGAAAATGCATGAGTTCAATGTTGATTCATCCTAAAGCCTATTTCGCTAGACCTAGC
AGAAAGGGCGAGTATAGTGCCATGCTGAAAAGGGGTGATGATGTCTATATACACAATGGAACTGTGAAAAAAAAGTTCACAGTTTCGCTTGCGCAGCATT
ATATGTGTTCAAGCATCTTAGATTCACAAATATGATAATAAGATTGTTGCCAAAAATTGAGACTAAACATGGATTTTTTCATTCAGCATATAAATACCTC
CAACTTTTCTATACATCCCTATTTATTGGCAAAGTAAAACTAAGTGAAGGCCATGCCATATAGACAAAATTGGATTTTTTATTCAGCCCCCATACTACTT
CAAACTTTAGTACCTCCATATTTTTTAGCAAAACTACATGCGGGTCATGCTACAAAGAGATTACTATACATGAAAACCTTGCTAACCATAGGCATTATCG
CATTAGGCATTTTCCATGCTCCAGGTCAAAACAACAAAAAAAATGGGAAACAGATATGCGTTCATAAATCTTTCTTCTTTTTCTTCAATTCACAATTACA
CATATCTAAAGGTATGTCTTCCGACTACAGGTCGAAACAAATTATCAGAAGTGCTTAAATACATAATTCACATCTTTACCTTGTGCAACCATTCTGTGTC
TTCATTCATCTTAAGTTCACAATAACAATATAAGCGACAGTTGTCATGACAAAGAGATAGTAAACTAACTAGAAGGGGTTGCTCAGATGATAAGTAACTT
CCACCTGCAACCCTAAAGTTGTGGTTTGAGTCAACAAGGGAGCAAAAAGGTGGGAGCTCCTACTGAGAGGTAAGTAAAAATAAGAGATTATGGACAGGAT
AAATATATGCTGGTTCATCAGAGAGATCATTCGATCTCTAATACGTCCACATAAATACTATTTACCTTAGAAACTACATAAAGGACACACTATCAAGACT
ATACAAATATGCAATGAAAATCTCACTCCTTTCTCCTTACAACAGCTATTTACACAAAAGAACAGTGATAAAGCAAGTTTACACCCTCTTCCGCGGCATT
GTATGTGACCATTCATATTAAATTTACAGTTCTAAATAACAAGCAACAAGGGGCTGTAGCCAAAATAAGAGACTAGAAATGAAAAATCTTCGGATCAGCA
TCAAAATTACTTCAACCTTTTTCTCCATTCCTTTCTAGTTATCAAGCAAAACCAAGTGAAGGCACTAATAAGACTAGACAGATATTCTTTTGGTCAAGAC
CCAAATCTTTTCAACCTTTAGGACCTCTACATTTCATCCTATTGCTGAGCGAAAGTGAGACCATAAAAAAAGTTACTGTCAATGAAATCTTGTTAACAAT
AAGCATTAAGACCTTTCAATTCTCCACGTAAAAACAACAATGAGCAAATAAGTAATACATTAATTTTTCACTTTCTTTATTTCTATCACAAGGAAAGGCA
AAAAATGCACAGTACAAGGTTGGAATTGGTACTGACCAAGTGAAGACCTGCCCAAGAGAGTTCAGAGCTACGGAATGAAGCCCACCAAGAGCAACACTTC
GAACCGAGTCCAAATGAGTATTCAACGTAGGAACAAAAACTGGGTTCTCATGGCCAAACCCAAGACGACCCCCATCACCTTTTCCCCAAATCCACAGATT
CCCATCAACCAATAAAGCTGAATGGAAAAGCCCACAAGAAATTCCTATTTCAACGTCCACCTTCCCCTCATTGAATGAAGACGACAGCAGCACAGGAGCA
GAAGGAAGACGACCAGGAATGGGGGAGGATAACCGGAAAGTGGGAGACAAAGAAAATGAAGCAACAGGAGATGGGTATATTCTAATTTCTTCAATACCGC
CACCCAATTGACCGGAAGCACCACGTCCCCAGGAATACAGTTGGACAGTGACTGCTTTTTGTGAGTCGGTGGACTTAGATTCCCAAAGAAGAGCAACTTT
GGAAGAAGAAGACGAAGAAAGGTGACGCCGCCACCGGAAAATTGGAAGAGCACGACGAGTTCGGTAATAGAATGCCATCAACGTCTGGCTCGACGGCGGA
GCAGTGGTTGTTCAGCTTCTCTAGTTTATATATACTCAAAACTCAATGTTCTCTCATTGGTGAAACAAAGTGCACTTTCACCCCTACTCTTTCACATATT
TGAAACTTTTGCACCATCAATTTCTCTTTGGTACAAAAGATGAAAGAATTATTATGCCGTAAATTAACATGGGACATCAAACTTACCTTATAGTCTCGTT
GGTTTTGAATTTGATTGATCTCGTTGGTTTTGAATTTGATTAAAATATCATGCCACTCGATATTTGGTTAATATTTAGGCCTTAAGATAAAACAAATTTT
TCACTTGTATTTGATGGTGATAGATTTATTTAATTATGCAATTCAAATTAATTGTTCAATTCAAATAAACATGGATTAAAAATAAATTTTATACATGAAT
TTATCCAACAAATTTTATGTGCCTACAAAAGTATAAATAATTTTTAAGTAAAATTAATACCTTCAAACAAACAAAATATACATTTATAACAAACTTAAAG
TTTTTTAATTTCCTATTTCCTTTAGAGTCGTTTGGTGTGAGAGATAAAAATAAATAGTTTTGGGATAAAAATAGTCGTAGGATAAATTTTTGGTGTCTTA
TTTGGTTGTCATGTTTGATATAACTTATACCACCATTTATATCATAGTGATGAAATAAGTTATCTCAAAATAATATGAGAAAAGACATAAAGTCATCATT
GATGTTGTCCCGAAATTTTAAAAAGACATTTTAACTTTACAATAGTCCTATTACCCCACTAAATAATTTTGAATATATATAATTGCATTATTTTTCGTTC
ATCAAACAAGAGAGTGGTGTGCACTCTCTCAAAGAGAGTGAGCACCCTAAAATAACTAATATAATTTTATTTTTACAAGTATTTTGTTATAAAATATATT
TTCTTATTTTTCTTATTATTTTAACTTTTTTTTCCTTTATATTTTTCTCTTTCTTTCTTCTTTTTTTTTTCAAAATTGATTTTCATTTCCATCCATTGAA
ACTTATTATTTTCAGTGTCATTTTTACCACAACTTCACCTTTTTTTTTTTATCACTATTAGTTTTACTCTATTTAGTTTTAAAATTTTATCTAAACAGTT
TCTTACATTTTGAACAATTCGATAAACTATTTAGATTTGAAGATGATTAGAAATTATTAATGTAGTTTTTTTATTCAATTTCAATTAAGTTCTTTCAATT
TTTGAGAAAATCATTTCTAATTTTGAATGTATATGAAAATGAGTAGTTGATGATACCTTCAAAAATTTAATTTTTTTTTTTAAAATAATTAATTTTGTTA
TCAACTATTCAGTTAAGTCTAAATAATAGTATGAATTTTATAAAGAATTTGACTCGAGAAGAAGAACAAAAAGGAAAAGAAAAAAATGAAAATGAATTTC
AATTTGACATGGGGGGTTGGGAGGTGAAGAAAAAAAAAAGAAAATGAAGGGATGAAAGTAGGGGGTGAAAGATTTAATGAAATTTAAGATAAATCAAAAT
TGAGATTTAAAAGTAAGAGAGAGAAAAAGAAAGAAAGAAAAAGATAAAGGAGAAATTTTAAATTAAAAAAATTTGTAATTTTAATTAACACGTGTCATGT
AATGATTGGGGTGTGAACTCACTTGCTTGTTAAAATTTGGGGCTGATCGAAAAATGATATGATAACATCTGTTCAAAATTGTTTAGTGGGTTAATAGGAC
AATTGCAAAGTTAAGGTGTCCTTATGAAAATCCAAAACAACTTTAATGATGACTTTATATCTTTTCTCAAATAATATCCTGGCATAACTTGTTGTTAACC
AAACGACCCCTTAGTGTTATCTTATTCCACTTGAGAAATCAAATAAATTAATTCAAAAGTTATAATTTCAAAATACCAATTTCTTACAATAAATAGTGTC
TTATATTATTTTAGGTCGACACTAAACACTATATTGAAAGTGAAATTACAGGGGTTACTAAGTTATAGTTTCATCAAATATATGTATTCATTTGAGAATT
ACTAGAAGTTATTGAGCCGGCTTTGCAAAAATGGTACAAGTTGAGGTACTACTTCGTGTATTAAGCCTTTCCTTCTCATTTTGTTTAAAGTTGTCGTAAA
AATGTTCTCAGAATAGTCTGGATAAACCCAATCAAATTGTTAAGCCCTCTTTCACTTTCTATAATTTCCACAAGAAAATCGGCCGTCGTTCTCTTGGAGT
CGCCAGAAGTTTTACTCGGATGCAGCATCACTTCAACAATCCTTTGGACTAGCTGAATTTCATGACCGATTCCCTGTATCTGGAATTTTCAAGCTCTTAG
AGAGTGACCTTATTAATGTAAGCAAGTCTCCATTTCATCACTTTGTGTTTGATTTTTGGCTTTGATTATTTCCATTACAATAAAGGGTAGTCTTGCGAAG
ATTGTTAGAATGGGTTTACACCAATTGGGTCAAAAAACGAGATATCTATAATTCATTTTATTGATGGATTGTCATTTTATGTTTGTGGTGTTGTCTTGGT
CAGAGAGGAATTTAGGATTTGTATCAACATTGATGCACAACTAAAACAACAAAAGAAAATAGTTTGAAGTGGGAATTGATTGCTAGTTTTTTATGTAAAT
AACTCAACATTTAACCACGATCGCCATTTTTCCTTCGTGTAGGATGGGTGTATAATTATTTACCAATTCTAGAAATATATACATAAAATACCTAGTTTAG
GAGAGACCATGGGTGCACTTGCCCCAATTTTAGTGCATACACTCACCCCTGGTCTTGGTGCATGATCATGAAAACTAGGTGCTTTATTATCTGAGTTTTA
TGTTTTGGATTCTCTCTTGAAGGGAAATCTGGTATCTGTTTTAATCCCCTTGATGACATTGAGGTACATGAACTAGGGTTTGCTCAAAACATATGTTTTT
GGGGAACAGTAGAGGTCATAGAAAAGAAAGCAAAGCTGGGATATTGTCAAAATCAGCAATTGCTTGTTTAAGACAAATTGTTGGCTCGAAGTAGCTCAAA
TCCTGGAGCTCCTTTTTGCTATAACCCATCTTTCTATTCTTATCCGTTCTTTTCTTCTACTTTTTTGTGTGTATTATTCAGTCACTTCCTTTTCTCTTCT
TCCATTATTTCAGTTGAGGAGAAATTGCTGTCTGTAGTACTTTGGAATGCAGTACTTTATTGCCGTGCTATTTCTTCCATTGTGCCCCTTGTTATGGGTT
CTTAAGCCCAAAAATCATTCCTTCCCCTGTTAAATTTCTTGTACTTACACGGGGCCAAGTGCTAATGAACTACATATACTAAAAACTTCCATACATCTCT
TGTTGTGACATTCCAAATCCTGAACTCTGCATCTGCATTCTTTTTCATCCACCTGTATTTCATACTGTTAAGTCATTTACAAAGTAATTTTCTGCAGGGA
GACGATTGATCAACCACTAATACCTGGACTACCAGATGATTTGGCATTGAGATGTCTAGCAATGATATCACACGGATATCATGGCATTCTTGAAACAGTA
AGTAGGCGATGGAGGAAGCTATTCCATAGTGCAGAATATTCCAATTATAAAGCTAGAGAAGGTTGGTCTGGTAACTGGTTATTTGTTCTGACTGGAGGAT
CTGAGAATCAATGGGTTGCTTATGATCCTGAAGCTGATAGGTGGCACCCTCTGCCTAGGATACCCACGAGCCACCCTGACCAAGAGCACCTTGGTTTCTC
ATGTGCCTGTGTCTTGAATAAATTTCTTCTGATTGGCGGCACATATGGAGCACGTGATCAAGTAATTCCCCATCAAACAGCCCTGACGACAAATGAAGTT
TTCCAATTTGATCCTTTCAGAAAAGAGTGGAGAAATGTTGCAAGTATGAGAACAGCACGTTCTAACTTTGCCTGCAGTGTTGTCTCTGGTAAGGTTTATG
TAGCTGGAGGGCGCAACACATCATCGGGAGGAGGACTTGTTCTTGCTGAAGTTTATAATCCACTGACAGACAAGTATGTTTTTAGAAAATTATGGTATAT
TTTTTTGAGCAAGCATTACTTTATGAATTTTAAGTATAAAAGGAAATATGGCTTTTTGGATACAAAACTGATCTTAGATTGGGGTATATAAGTAGTTTAT
CATGCTATTATTTGGATCACAAGTTATCCAATTGTTGTCGAGATTGTTAAATTTATCTTAGGGACTTGGATATGAAATATAGCAGAATATACGAAGTATG
GGAATGCCATGTGAATGTTTATCTAGATGTGTGCTGCTTCTAAGTAAATACCTGTTTGTGTTGAGTGTTGACAGAGCTGTTAAAATACGATCCTTTTATT
CTTGAGCTGAGTACTGTGTCTTCAAGCAATGAATCTTAGATCTCAAAATGGAATTGCAAGCATACTAACAATGATTTCTGAACCAGACTATTTATCTTCT
TATTCTCTTGTTTCTGCGTGTTTTTAGTTTTTCATATCAACATATATCATTTTTTTAATTGTTTAAGGTAGTACATATTAGAATCAGCGACAAGTTCGTC
TTGTGAAGTAATTGCAAAGGTGTTGCCATACGAAAAGTGTAGTGACCCCAAAGAGTCAACGATGGCATCAGTGTTGTTTGCAATAGCTATGTTGCACCAA
TAATAAAGTAAAAGATGTATATTTTTATTTAATACTAATTACAGATTCCGATTTGCTCTCGAAAATTCTACCATTAGGTTCATTCCTTTCTTCCCATATA
ATCCACCATGTATATTCTAAGTTTTCCTTGCCCCCCAAAATACTAAATAAGAAGCTCCAGATTTGAGACGTGAATCGTCTGGGAAGAATAAGGTGATTCA
CATCTTCATAATGCTTATGACATAGAACACACCTATTATGAACGTTGACTCCCCTTTTTGAAGGTTTTCATGTGTAAGACAGGCCCTTCTAGCAACTAAC
CAAGTAAACAGTTGACTTTCATGGTAGCTTTGTTCTGTTGAATGAGAAGGGGACAGGGAGATTGTGCCAGGTAATGGGAGCAATATGAGAGATGTTGTGA
TTTTGGGTACTGTGGGTGTATAAAGATTAATGAGGTTAAGCTATTCCTAGGATGAACATGGGAAGAATGATTGGGGAAACGAGATTCCGGTGGAGTTCTT
GAAGAACACAGGTAAGACAAGAAGGTTTGGAATGGCTGATGGGGGGCTGTTCATATCATTTTAAGACTACAAAATGCTTGAAAAGTGGGGGTGGAGTACA
ATGATCCTGTTGTACTGAAACAAGGGTGAGATTCATAACTACAAGTTGATATTCATGGGGTATTAAGCTGCTTAGCCACACTATGAAAGTCTTGGAAAGG
GTGATGGAGATGAAGATGAGGAGGGGTGTGTCTTTTTTTGAGAACCGGTTCGGATTCATATTGGATGATCGACTATAGAAAGCATTCATGTTGTGAGGAG
ACTGGGGGAGAGTAAATGGAGAGAAAAAGGGACTTATATATGATATTCATTGACCTAGAAAATGTATATGATAAAGTCGGGGAGGTCCTATGGAGATGCC
TTAAGGCTGGAGGTGTATCAATGGCATACATTGGGGTGATGAAGGACATTATGATAGAGCCAAGCCCCGGGTAAGAGCAATGGAAAGAGACTCAGAGTAA
CACACAAGGATCTTAATACAAGCACTCCACAAATGCTTCCAGGCATATTTGCAATGACCCTTAATTGAAGGGTCTCTTCTGGACCCAGCCTCTCCCCTCT
CTGGTAGACTTCCTCCATCGGAGCAGCCATCTAGAACCCAACTTTTTTCATGGACAACAAAATCCTCTTTCGCCTTGGGGCCAAATCTTATGAATCACAG
AATCTAAATCCAAATCAGGGATTTGGTATGATTGGATCAGAAGTGCATGATACTACATGAGCAAACTGATACTCAGCAAGGGAGCCATGTCTTGGATATG
CAAAAGGCTCAAGGAGGCATCGGAGAACAAAGGAAAGACCTTCAAGTCTTGGAAATGCAAAGATAACACAACCAACATTTTCTTAACACAAAAGTTCAAT
CAATATGGAAGATTTGTCTCAGTAATTACTGTTAAAGGAAATGTCAGAGCAGCAATTATCCTGTCAGTTAACACATTCAATGAGGGGTGGAATGTTCTAA
TAGCAAAATAGAAAATTTCATTGATGGAAGTAGTAGTACAAAATTAATCACAAACAAGCAACCTAGACTCCTTAACCAAATCAGAGGGGGGAAGAGTTAC
AAAGAAATGTTTTTCAAGAACAAATGGACTAAGAGAGACATAGGAAAAAGGCATGCTGGACAGATGCTTAGTGGGGAGCTTTGCAAGAGCTGAAGACGCT
CCAACTCGTAATGACATCAGAAGATGGGCTCAACAAACTTGGAATGGAGCCCAGGGAGTTCAAACATAAAAAAGGAGAATAGAGAGAGTATCTGCTCGCG
CCGCACTTTTGGGGTTGAAGTTCCCACGTCTGCTCCTCTCTAGCTTCATGCCATTGAAGCGCATGTCCTTCGCATCACGTCACCGCTTAAAAAGGTGGAG
CACCCACTTATCTCAACACTGTTGTTTCCTTCTTCATTCCTTAAAACAAATAATGGAAATCCCCAACCATGCACTAGATCAAAACAATTATTACATGAAC
CATCACTATTCAACTATCCTCCTATAAAGATTTATTGGTCATTTGGGCCCTATTGGACAAAGTTATTGATATCATCCTAGCATTTAGTTTAAGTTTTCTT
ATCTATATGTAGCAATAGTAAAATTGTGTCCTCCATCCAAATTGGTTCGTACAAAATACCCTTACCTGGCAATAGTCGAATCTCTTTACTTTGCAACTTT
ATCCTTATGTCTTGGTTTCACAATGATTTTAGTTTCTATTTAATCCCTCTTGTGTCGTGTTGTTAGGCATTTTCCCTATCCATGTAGTCTCTTGCCTACG
ACGACTTATTTGAATTTTATGCCTCATGGACTAGTATCTACCCTTTGTAACACCGCTTTAGGGTGCCTATACAACAATAGCAATCAAGTGTTATCAAAAG
AAAAAAATCTCTAAAGTTTGTTACGGGAGAAACAAATACAATTATATATGTTTAGTCCTAGACTAATAAGTATAAGCGTGAATGACAAATATAAGAACAA
AGAAACTGAAAAAAAAATACGATAAAATGAAATATCAATTGCTTAGTGTCTCCTTTTCACAAGAGGTTCATTGGCAAAGAGAAGTATGTCTTAGAACATT
GATGACGAAACTAAAATGTACTTCAAGTGAGGCAAAGCGTTCAACATGTTTTGAGCCTCACTTCGGGCTTAAGCGCGCATTTGACAATACTACAACATAC
TCAATGTCATCCCCCAAATGGGGTCTGGGAGGGTAGAGTATACGCAAATTTTATTTCTGCCTCGTGGAGGTATAGAGGTTGTTTCCGAAAGACTCTCGGC
TCAAGTGCAACAGATTAAAGTATTTATGAAAAAGAATGTGACAGTGAAGAAAACATGCCAATTAATAAGGAAAGCAACACATGGCATTCAATGAAAAGAA
AGAGTAACAACAATGAAATGATTCAGTAATTGAAAAGGAAATATATAAGACTAATAATGCAACAAACACGGTTCGATATTGGTTTCTAATATTGGGTTAA
CCGATAACCCATTTAGAATATAATAAATTACTATTTTAATTTTTAGTCATACATAGATATCAAACAAAAAACAACAATATTAATATAATTAATATATATG
GACCTTACACAATTAACATTACTCAACTCTGGCCTCTGAATTTACCTTTTAGGTTGTAGTATTACTTTAGTCTTTATTGTTGCAATTTAGTCTGATTTGC
TTGTTTCGATGTATGCCTGTGTGCGTAAAATTATTGGACAAATCATATATTTGTTTTGAAAGTATTTTCTTATCAGTTAAAATCGAAAGCTGATAACAAA
TATCTTATTGGTTCGCTTTTTGGTTTAACATATTTAAAAATCGATAAACCGAACCGATCATACTTAAAATCGAGCTGAATCAATCGATACACACCCCTAA
TCCGCGACCTCCACCCGTTTGGGGTGCCAATTTGATGGATCAATTTCTTACTCACACCCGTTAATAAGGTGGGAATCATTGTTTTTACTCCCTTCTTGGA
AATGATGTGATGGAAGTTGGAACCAATTGCTTTTAATTATCACCTTCGTGTAGTTCACTAAACAATTTTACATATTAGGATTTCTAGATTTGTTTCAACT
TCCTGGTTAGTTGCCAATTTTGAGAATTAATTTTTCCAGTCAAAATGAATCTACATTGTTCCATTACATTTCCTTGTCAAATTATTTTCTATGGGAGTAT
CTATGTAACTTATAGTTTTGTTCATGGAAATTTAATTTTGCAACTTTTCAAGATCAACATCAACAATAACATATCCAGTGGAATCCCATAGGTGGGAGGA
CAGATTATACCCCTACCTCTTGGAGGTTAGGAGACTATTTCGGGAGGACCCTCGACCCGAGTATAACATATTAGAATAATGAAAAGGAAGACGACAGTGA
AGAAACAAAACAGCTAAAGGAAACAAGAGCAACACAAAATAATGCGATAAGCTGAACGGAATAAACATATGATGATGTAATCAAAAACAGAACAACTACA
AGAAAACAGCTAAACCCCTCAAAAATCAAGACAACACTCCACACCTACTAACCTTCTTCCCTAATGTGCAACCTCCACACCCTACAAGGTCATAGTTTAT
ATATGGTAGAATTTTTTTCCTTAATCTGCATTCCAATTTCATATTTATTAGCAAGTACATATGTTTCATTTTATGTAACACTATTTCCTTATTAATCTAT
CAAAAAAAAAAGAAGGGAAAAGACATCAAGTTGCACCCTAAACTTGTTCTAAAAAGTCACTCACACACTCATACTTTACGGGTGATCTTTTACCCTTCTA
TACTTGTTTAAAATGTAATTATTACCACCCAAAATGCTGATTTGGCAGGTGCATGTGAATCACCCTGTACCATGGGACAGGCTTTGTATGTTTTACGGCG
AAAATAACACCACTTCAAATAAGGATTGGGTGTGGGTGGGTGTGTGTAGGTCACCCGTAAAGTACAAGTGTGTTAGTGACTTTTCCGGACAACTTTAGGG
TGCAGCCCGTCTTTCTAAAGTTGGAAAAAATTTAACTTTTAACTTCTCAAATTATCTTTATTCTTTAATGACATCATCTTGTAGCCGTGGAAACCTCATG
GCATGTTAAAGAACACAAGTTCCAAAAATCGGTCTTAAATCTCTCAAAAGTAGTCATGTAAATTGAAATGTGCATACTATTTTTGAGAGAAAACAGTACT
TCCATTAATCTTTGAAGCAGCAAAAAACTTTATAAGAAAAGCTTTTAAGAGGCATATGCGACATATACTATATTTATGAAATGAAAAACACTTCCCAATT
TAAAAGTAAAATAAGAAGAAAAGGTTAATGCAAGTATAAGGGTGATGAAAACATGGACTCAAAATGTGTATCAGTGGAACGTATATCTAGTGGAAATAAA
TTTTGATGCTTTGACTACATTTGCCGTTGGGTCGTAGTTCTTTAGAAACCTATGTACCTTGTTATTTTATCTTGGAAACGATTCCTTGTTGCTTCTAACT
TCTACTCTGTTTTTCTCTTTGAAGCAAAAGGATGGTCGGATATTTAATTTGACAGAATTTTAAGAGAAGAATGTTTATGTTTTATCCTATACTGTTTTTC
TTAATATTTTAAAATGTTGCAGGTGGGAAGACCTACCACCTCTGCCAAGTCCCCAAATGGATTGCATAGGCCTACCATACAATGGTAAATTTTATGTTTT
AACGGACCTTGTTGGGCTGTTAGAGCAGGAGACATCTGTTGTTTTTGATCCATCCGATGAAACATGGCTAAGTGTAAATGATACTTGGCCGTTTTCAAGG
GCCATGCATTTGGGAATTCAGGTACTTGATGGTGGTCATATATGCACAGTTGTAGATTGGGGTGGGAGCGCCATTGAAACTAGGGATGTTGATAACACGG
AGTGGCATCGTAGAGGACTGGTACCTCCTGTGGTTCTACCTGACCATCCCCGGCCTCTAGAGGTCTTTGATTATGGATTTGTTGCACTGAGAAATGAAAT
TTATGTTTTGGGAGGAAGAGTGCTGCGATGGGAGGAATCTGGGACCGGGAAGTTTAACATTGTGAAGTTGAGCACAGTTAGAGTGTGCAACCCACTGAGT
TTACCTTTAAGGTGGAGGGAGATTAGACCAATGTGTGAGCCTGCATTTGGCTCCATACTAGGTTGTGCATCCATGGAAACAAGATCTTTGTGATTTAAGG
TTCTGTGTCCTATGTGCTGCTGTTATGTTGTAAAAATGACTACATTGCAACCTTGCTCTAATAATAGGCTAAGAAAGTTATCATCAATGGAGATTATCAT
TGGTGGAATTATATTCTGACTGGTGCGAGTGAAGTGGATCTAGAACGTTGAGGAAAAGCTGCTAGCTTTGAGTCGAATTCTGCAACAATTGACAGGCATG
ACAAAGTTCCGGGAAGATTGTGGTAGATTATTCAGACAGCACATTATGAAATCACTAACATTTATAAATGCTCTAAGTTCCATTCCCGTGGTTCTTTTTC
CTGTTTCCAAAGGAACGTCTCTTCCAAACTCAATATACTGAGTTTCTTCTGTTGTTTTTAATTACCTCTACTGGCTTTCTTTCGCAGTTCTTGAATTTCA
CTTATGGTACTTAATCTGCTCATCTTTAATACTTTATCAATGTGATTCATGTTTTTATTTGCGCATTTGAGACAGCAGTAGCAGTTCTGCCTGTTAAGAA
ATGCACAATGCAATAGTTAAAGAACTAATGTTACAAGATTAGAAGATTTTACCAGGTTTTAGGTCTAGGATTCTAGGTGAAGTACACATTCAAGGTAAAT
ACACTTAACAAATAAAAAGAACTTCATGCTTTTAAAGTCTTTAATCGAGTAATGGTAGGCAAAGAGTTCAATGTCTCTTGTCTTTGCAACTACTCCCTCC
ATTTCAGTTCAAAATAAGTACCCTTTTTAGCTTGAACACTTCTATGTTAACTACTTATTTCACTTTTACTTACTGTTAAGCTAAAAACATGGGAGTGCGA
ACTCGGTTCCACGTATAACATACATGCGCTCTTTCTCAATCAGGTCTGGAACACACAATGTTGTCCAACCTTTCCCTTTGTCTTTACTACTCGATAGCGA
GCTAGCATAGTTGTTGATATGGAATAGCCCTTCATTAGCTTGGAGCCTGAAAAAGCAAAGTCCGATCAGGTGAGTATCGTTATCCGTCGTTACTGAACCT
GCTTGATTCGTTGTAGAAGCGCTGCCAATTCTCTTTATGTCTTTACTACTCGATCGTGAGCTAGCATAGTTGCTGATATGGAATAGCTCTTCTCTAGTCT
GGAGCCTGAAAAAGCAAAGTCCGATAAGGTGAGGGCCGTTATCCGTTGCTACTGAACCTGCTTGATTCGTTGTAGAAGCGCTGCCAATTCTCTTTAACAA
AAAAGGCATTTTAAGACGAAAAATATATAAATTTCTCCAGCTTCTAGCCTATATTTTCAAATTATTCACCAAATCTAAGACTAGACCCCAATTCCCAATC
TCATGTAATTTGATGTACACAAGTATATCTCATGCAATTTGTCATGTATGATACATGTATGATACGTGTTTATTTGCAAATAAAAGAATAATTATATATC
TATATTTTTCTTTTAAGCGGGTGCAAACTTCATATTGGAGATATAATAGTGAACAGAGAAAGTAGTTCATGAATTATGATGAACTCACTTGGTTCAAATT
AGAGTAAAATTGAAAGAAGACCATTAATGTCTTCTTGATTACAGATAAAGCTTATTTTGAGATAAAATGAATAGAAAAACGATACTTATTTTGAATTGAA
TGAAGTAAATGCTACTTATTTTGAATTGAATGAAGTATCAATTTAACAAAACCAACAAACCAACACACATGACTTCGATATACCTAGCTCTTTTAGGTAC
ATAAATATTGTCTAATTGCATGGATCCATTTATGGTTATTACCTATGAACATTACAGCTAAATAATCTCACTGTCTTATATAAGGCAAATATTGGATGAT
TGTTTGATTTTCAGCAATTTTCTCCATCCCTTACATAAACCAATATTAAATTCAGTCAATAACATCTCCATCTCCATCGTCTAAAATAACACGAGTCTGA
TGAACACCGTGCATTGATGGGTGCCAAGGCCCCATATGGACTATACACAAGAATGCGATTATGCTAAAACAGTTCCATCTAAACTTGATAACAATTTGCC
TTATTATCTACCAAATCGTTGAATCCTCCTACGTCTTAATTCTTCCAAAGATAGATCATGTATCTCACTTGTTGAACCAGGGGATGATGGTGCATCACCG
GTACGACCTGTGCCACACATTTCACAAACGTTCAGCCTACCTGAATTATCAAATGTACATGCATCACATCTCCACGTATGAAGTGTATCTCGTGCAATCC
TCGCACCAGCAGTTCCTCTCCCAGTAATTCTAGGTCGATGTCGAAATAAGCTCTTCACTAATCTTAAAGGCCAGCTCAGAGCATGGCTAAAACCTCTCAT
GAATTGTCTAACTGGATTCAGACCTGAATATGACGCTTTTAATTGCAAATACAGAAGGCCAGCTAGTATTCCCCCAAGGTGGCCAAGGAATGAGACACCA
GGGACAAACATTTGTACGAGAACAAGCTCTGCCCAGGCAGCATAACGAGTAGGAACCATAAGTCCATGTACAGAGGTATACTCATCTGATTGTGAATTGA
CGATAACTTTCATGGCGAAGAGGACACCAGAAAAACCCACAGAGTATTCATTATAGTAGGGTCTCTCGTAATCAAAGAACAGCAGAAGTGATTTTGCAAG
CAACAGTGTAACACCTTGGGACATAGCAACTAAGGTTGCAACCATTGATGCAAACTCTGCACTACCCATCGATGTCTCCAGTTGAATACCCTTCCACAAA
AGTGAAAGCATATTGTACACCAGGTGAGATTCATTTACGTGGAAGAACGGCGACAGGAAGAATCGCTTGAGGTCTGTGTACTGCATCAGCAAAGCAAGTG
TAAGGCCAACATAATAGTTTGAAATTCAATCTCCCAAAACTATAAATAACAGTTAAAGCTCTAGAAAATAGGTCAATATGGCACATATTGCTTACTAAGC
AGTATCTACTCAAAGGGAACCAACAATATGGAAATGTGATAAATCAACTTCTCTCACTTGCTTCCAATCTATGTTGCTCGAACTCTCCAAAAATGTGTCT
GCATCCATGTCAAATTCTCCAAAATGCACTACTTTTGGAGTCCAATATACGCACCCATCGACATTTTGAAGAGTCCAAGCAACACTAGATTGCAACTTTA
TGAACAAACTCATGAGTCCACATAAAACTCAGATATCCATCCAATGAATATCATAACCAACAAGTTCGCACAGAGCCAAGACCTTTGGTCTCTATCATTT
GTATCCTCCGCAACTCTATCGAGAGTTTTACAGCTAGAGGGCAGAAAACTGCAATTTCTTTTATCTTCAAAGAGGGAATTGGTGTTTTAAGCCATGATAG
AAGCCATATAAGTTCATAAACATATAAGAAAACCTTTACACATGCTAAGCTTATTTTACAAAAAAAAAAAAAAAATTATTTTATATATGCAATAGCAGTT
CTTCTCTGCTATGATCAAACAACATAGTGGTTGTAATCTAGTAAAATTTTCAGACACAAGGCGTGTTTGATTTCCAATTTTCCTAATTGGTCAAAATGTT
CGCTTGACAAACAAGTTCCTTGACAATGAGAAAAATGACTTCTCTAATGGAAATAAGGAAAACAAGGTGTAGTCAAGTTTATTGTCTTCTTTCTATCCAA
TCCCTGCAACCCCCACCCAGAAACGCCCACTCCCCATCGGTGTCATTGCGCCCATAGTGATTTGTTATATGACATATAAATGCTCTTCGAATAATATTTT
CTGGCTTACCTACCAAACACTATAAAATTAGTAAGAAAAACGCTTTCCTTTGTACCAAACACACCCATAATATTAGTATCAATTACCCATACCAAAAGCT
AAGTAACGTCTAGAAAATCAACAAAAGAATCAAACTTTAGTCACCTATGGTGTCCAGCAAGAAACAAAATCATCAGTAAAAATCAAAAAAGGCAAAAAGG
GTTGATTACCTTGAGAATAAGGTGAGGATTAAACCAAACTTGATCGATTGTGGGAAGGAAAGGATGAATAAATTTGGGCCTCAAGTAAATAATGGTATTA
GCGGCAAGAAGTGCAGCAGTAATAGGGGGTTTTCTGTCTAATCTGGAATACTCACTCAGCGTATGCAGCCCTAGCAGAGGAATCATACCACGAAATACTG
ATCCCCACTGTCCTCTTCCTCTCTCCATACCTAATTCGAGAATTTGGATGATTCTACTGCAAAGTCGAATACTCTGAAATCAATCTTTTTCTTTTGAGAA
GGTTTAGGAACATTACAGATGTTTCGCCTTCTTCTCAAGGCCAAACTCTAGATTGTACGGTTACTTTTCCCAAAATTAAAGTTTTGCCAATTTTTTAAAA
ATAAAAAAATGATCAAAAATACTTTTGAAAAAAAAAAAGTTTAAAAATATTTTATATTTTTTCTTTTTTGCTCACTTATAGCTTTGCAAGTTGCCATTAA
CAATCCTCTCTTTTTAAAAAAAAAAAAAAGTATTCATTATGTGTCATTTTCTTATTAAATGAAATAAAAATTCACCTCTATTAATTTTGTCCCATAATTT
ATCTAAACGAAAATAATATATCTTATCAAGTTCAAAAAATATATTTTAATTTCTAGTATTTTCTCTTTTTTTTCCAAAAAAAAAATTGAGATAATTAATT
TTTTTAAAAAAAATATTAGTCAATTTTAGTTTGTTTTTTTTGGAAAAAAAGAAAATATTAGATTTTAAAAAAATATATTTTTTGGATCTTGAAAAGATAT
ATTGTTTTCATTTGGATAAATTATGGGAAAAAATTAATTGATGTGGATTTTTATTTCATTCAATAAGAAAATGACACATAATAACTATTTTTAAAAAAGA
TGGTTGTTAGCTGCAAAAGTATAAGTGCGCAAAAAGGTGGATGAAAGGGTAATTTTAGACCAAAACGATGAATAGAAAGATATTTTTAGACAAAAAGATG
GATGGAGGGTATTTTTAGGCCATTTTTGCGGTTTAGGGGTATTTTCGGCCATTTTTCATTTTAAAAAATAATTGGTTGTTCCATTTTACGTGGCATTATT
TGAATTGATAAGTTTATGAAAAAATGAAGAGTTTCTGAAACTCGTGATCTAAAACAATTCTTAGATATTTATGTAATTGTTGATCATTTTATTGATAATA
AAGAAGAATTTTATAGTTAAAATTGTTTCTAATTGTAATAAGAGAAATTACTTGGATTGATACTTTTTAATAAATAATTAGTGATTTTTAGCGATTTTTT
TTGTTTATTACAATTTATAGTAACACAATGTTAAATCTGCAATATGTATTTAAAGTGAATTATGTAAATAATAAATATGTATTATAACTGTTTTTAAAAA
TATATTATTCTTGTTTCGTAAGAAATTGACACATTGTATTATAAGTGTATTAAAATGTGTGCTAAATGTATTAATCATCAATAAAACTTGTATGATATGT
GAATAATAAATTGTTCTTTGTAAATATGTATTAAAATTGTATTATAAATGTATTAAAAGTGATCAAGTGAAAAAAAATGTAATTTCTATAAATGGTAAAT
ATTTTCTTAATATAGTATAAATATATAAGTTTCTCTTATAATAAGATGACCTTTTTTTAGACGAACTAAAAAGGAAAGAGTATAACATATCATGGATCAG
GGGGAATAACATTGGCAGGATATTATGATTATTTACAAAAAAGAATTGTGTTTGGGAATTCCCACCCCACCATAACAATATTTTTTTTCTCTGTAACTAG
GTCTGGTCATTCAACACCTTAGAATTCTTAATAAATCCCCATACACCTCCTCTTTTTGTTTAACTTAGACCACTAAATATCAAGTACCTACTTGATCTAC
AGACACCTCTTTCACCGAAATATTTTGACCATAGAAATATAGGATCAAACTTAATGATATAGCCTCCATGATCCGAACCACGTAAATACTGGTATCAAGT
ATTAACAATGTACACCAGCTAATGAATATATAAACAATAGCACCCTCCAAATTGGTGTCTCCTGAAGACAATTCATAACAAGCTTTACAAGGATGCAATA
AGTAGAGTTAACTTGGCGACACAAAGTTAAGAAGCTGAAAAAAATTTAACAAATGATACAAGACTTGACAAGAGACTAGCCACTTACAACCATTCAATGT
GCAAAAAGAGGAACAAAAGGCCCTTCAGGTTTTGTCATTCATGAATAGTAACAATTAACAAGCAATGTCCAAGATAAATAGAACACACCCCTAAACAAAA
CTGAAAAGATAAAATAACTAAACCTCAGATCTTTCTCATGGGGAAAGATATTAATACATGTCTAGGAGTGTTATCAATATCAATACTAAATGAAACCATG
CTTATCATTAACTACTGAAGGTCATATTGTGCAGGTCCACACAACACAATCTTGAGAACTAGACCTGAGTTATGCCTTCAGTGAACTTAGGATCCTCACA
TCTGTACCTTCCATCAGGCCCAATTCTGAATCTCCTAGGATCACCAAATACATTCTCAGCAGCTGGTTACGAGCTGGAACGGGGCTTGCACTGCAAACTC
AACAGACTCTTCAACCGATTCATCAATCTTCTTATCGATGGCCTTTAACTCTGCTTCATTTACCAAGTTATTTTCAAAGATATACTTCTTCAAGATAGTG
ATAGGATCTTTTGTGGCATAGTGATTCTTTTTAGCTACCAAAACGAACACATTAAGGTCAAAGAAATAACGTATTGCCTCCACATATAAGGGTACACGTG
AAACAAAATAAGATAATAGAGTTTAAAAGGCTCATTCTCTTGTGGTACACGGTCATACAACATTTCTACAAAGGAATTTCGGAGCATCAGAGCTTTTTTC
TGGTGTTTTTGTTCCTTTTGTTTTGGAGGTATATCTCCCTAAGCGAATACATCTAGTGGTGTCCCTGAGATACTTCATGTAACATCTGTCTTAGAGTAAA
TGGAAGCTATAAATAATCAAATAGAAGTGCTCCTCATTTACATTTACACAGTTGCTCACAAAAATCACTATCTCAACAGTTTCAACACAATCAGCCAATT
TGAGGCTTCTCATGCGAAATGGCACTATCCACTTATATGCTATGTGATTGTGTAGACATATTACTAAAAAGAAGTGGTCCGCTATTGTGCTAAGAAATTG
TTTGGTTACACATAGCATTCACTACAAAATATGCCAGAGGTAAGTCAAAAAGATTTAATGAGTTCTCAGACAAGCTGGCTAAAGTTAATTTGATTCATTA
ATAGCTCTTTATTAAGTGCTAAAGGTTTACCCTTCCAAACCTTAGTAAACACAGGCTACAACCATTGTCGGATAACACTGATAAAAAGCAGCAGTATCAA
AGAAACAACAACAAGTGGTTTGAGGATAATAACACAAGTAAGCTGGAAGAATTTAAGACAGTTGAGCAAGGGAAATGAAACACTCACTAGGGTCACGAAG
CTCATCTCAATCAGCCAAAGAGTGTCATCTGAACTGGTAGGTCTCATATTTAATCAAAGTAGGACCTTTCCCTTACTAGCTCTGCTAACAACCTCCATTG
CTACCTCCCTTACCTTCAACACATCCATTCCATCAACATGAACCTCGGGCATCCCAAAGGCAGGACCTTTCTTCTAAATTTCAGGATCAAAAGTAGATCT
CAAGTGGGACATCCCAATTGCCCACAGATTGTTCTCATCAACAAAGATAATAGGCAATTTCCACAAAGCGGCCATGTTCAAGCACTCATAAAATTGTCCA
TTGTTGCAAGTTCCATCACCAAAGAAAGACAAAGTGACGTGATCACAATCATCCTCCTTCAAAACCTCCATTTTGTACTTCCTAGTGAATGCAACACATG
TAGCCACTTGGATTCCCTCACCAATAAAGGCGAAACCACCAAGAACGTTGTGCTCTTTGGAAAACATGTGCATCGATCCACCCTAGCCTCTACAACAGCC
CATGGTCTTTCCAAATAGCTCACTCATCACTTGACGAGCTGGGACACCTTTGCTCAATGCATGGACATGATGAAGATAAGTGCTAACTACAGAGTCGTCC
TTCTTCAAGAGTGTGATCAAACCAGTTGAAACAACTTCTTGGCCATTGTACAAATGCACAAAACCAAACATTTTGCCCCTGTAATACATTTGGGCGCACA
TGTCCTCAAAAGCTCTTCCCAACACAATGTCCTCGTACAATACCAATTCTTCCTCCTTAGTAATCATTTAAATGAAACAACAGACATAGATAATCACAGA
AACTCGAATCTTTTCAAACAACTACATGCTATAAGATAAATTATAAGAATATTAAACACTAAATTACCACAATAACAAATATTGGGTCAAAAGTTGCATG
ACAAAAATAAAAACTGAGCTTGCAAATGCCAAAATTATCAAAATTGGGATGGACCAACAAACACAACTATTTAACAAAATCACAAACAAGACGAATAATG
CAAACAACTACAATGTCATATGGCATTCAAAAATAAGCACTAAATCAAAATGAAGAACACTCAAAAGACTTAGCGATCCAAAAAAGGATGAATCTTTAGC
AGACAACAGAATTTTCATACGAATAATCTAAACAAACAAGCACTAAATCACTATAAAAAAAACATGAAGATTAAAGTTACTCCTAAAGTAACAAATTGAG
CATGACCCAAATGAAAAATCGAGCTTGAATAGACAAAATCAACAAACAAACAGGGAAAAATCAAGATATACTAGATTGGAGATAGAAGATTTGGACTTCG
ATTTCTTTTCATTAACAACATCAGAAACGGCGACAACATCATTATTGGATCGGCATTGTGATTAATGAGGATAGAAATTCTTATTGAGGGAAAGATTATG
AGAAGATTGTCCAAGAAAAGAAGAGCTACCCTCTAGAGATTGAGCCAAAAGGGGGTTTTCAGCAGATGTAGTAGAGTAAAGGGGCAAAGGTTGCAAAACT
TTTGTTGCAGAGAATGACGTCGTCATGGATGAATTACAAGAAATGTGAGTAAGACATGAATGATTATATAATTAAAAGACATAAAAAGGGAAAAATTAGG
CGGAGGAAATGAGAAAGCGAATGTATATAAATAACCGTCAAGAGCGTTGGTTGCTCTCTACTGGGCTTTCTTGTCTTCTCATCCTAAATTTTGTCTTCTA
ATTTGTGGGTATAGTTGGTTTCACAATAAAATAATAAAACTATATACTAAATTATTATTATTATTATTATGAAAAGATGAATGATTATAGAATTAAAGGA
AAGAAAGAGGCAGAGGAAATGAGAAAGCAAATGTATAAAAATAACTGTCAATAGCGTTGGCTGCTCTCTACTGGGCTTTCTTGTCTTCTTATCCTAAATT
TTATCTTCTAATTTGTGGGTATAGTTGGTTTCACAATAAAATAATAAAACTATATACTAAATTATTATTATTATTATGAAAATCTATTTGTTTCATCTGC
TATATTTACACTATTATGTCTTTCTTGGCCTTTTGGCTAAGATCTACTTATTACTTTACTAACTATGTAACTTTTATTGGGCATGACTTCTAAGTTTTTC
CCCTATAAATATTCCTCACTAGAGGTACAATTATTTTAAAAAAAATTTAACTAAACCATATGAAAGGTCTGGTTGTGAGTGTGAGACATCTAGGTACCTC
TATGAATTTGAGAATAAGATCTCACTTTTTTTAATCAAATTTGAAAAGAAAATCTCAACTCTAAACATTGAAAGACATAGAAGCATGACTATAAATAAAG
AGAAAGAATCATAGAACAAATGATGATTATACATAAGCAAATAGTTTTTCTTTCAAGTAATAACAATTAGAAGTAGGATTGAAGAACTCGTGATAACACA
TCAATAGATTAGTCTAATCGTTGTTTAATAGTTTTTGTGTCAATAAGTTTAATCACTCAATTGTAAATTGTCTCCATTAAAGGCACTAGACTCAATTGAT
TTTTGTTAGGAATTTGTAACAAGACGAAGTTATCGTCTTCATAGAGTTCATCAGGTAGAGTAAATTAGTGTTGAAACAAAGAAAGTACAAAATCTACATA
GAGTCATCAATTAGCTTACTTACGGATTTGGTTATTAGAAGTAGGTGACTTATATAATCTTTTTTCATGACAAACACAAAGTAACAACAAAATCCAAAGT
TTATAAGATTAAGAGAAAAAATATTTTGCAGTAAAAATAACCTTTATTTGAGTTTGCAAAAGAAAGAGTACTTTGACATCGAGATCATCTCTGCATACTG
TATATGGGGGGCTTTGAAAAAAAATTCTAATAGATTATTCTTGTCATTCAGCTCATCCAAAGGGGACAAAAATGTACCGTAACCTCCGACAAATTTATTG
ATCGAATAACATAAAAAAGAATATCACAAAGTATGTGTAGTTTAGTGTCCAAATTACCAAGAGGTGAAAGTCCAATGCCAAAGGCTTGGAGGTCTAACTC
AAAACATAAAATCCTAATGTGAAAAATAGAAAAGAATCAATATGAATTTAATCAAAGTGTTACCTCGTACAATACTAATGTGATTATGGATAAATTGACA
AAGCTGACTTATTACCTGCCAGACAAGACTATATATGGTCGAAGATTATGCTAAGTTTTACATTTGATATTGTTCTCTTTCATAGTGTATCTTTATTATT
CCAAACAAAGGGACTTAATTTACGATAAATTTTTTGAGATCCTTCCAGAAGGATTTAACTATTTAAGTGAACCTTAGTATAACTTTCATCTCCAAACAAA
TAAACAGGCAGAATACACTATTCAGAATGTTGGACATATGTTATGTGCTTGTGTATTGGACGTCATAAGAAGATGAGATGATCATTTACTTATTATTGTG
TTTTTCTTATAATAGTAACTTTCTCGTATTCAGATGACTCATTATGAAGCACTGTATAGGCAAAAATACAGGCATATTAAGGTATTTTAATGATGATTCA
TCGGCATCAATGAAGAAAAGAGGTTCAAGTGATGAATGGAGACATTGGTAAAAAGAAAATGCGACTTGGAATTATGAATGATGAAAACTTTGAGAAGAAT
GATGATTTTTATTATGTGGGAAAATGATAGTACCGGTGAGAATACAATTATGGCGGCGTCTCTAATATAAAAAATGGAGAGAGATGGTTAAGGCCTTAAG
GGATAGTGAGGGAAGAAAAAAGTGAAAAAAATAATTTAAAAATAAATAAATAATAAGTGATATGTCATTTAAAATTTGGTGCAGATGATGATGTGTTATT
TCATTATATGTTTGAAGTTCAAGAAAAACCAACTAGGTTTAAAATGGTGAATTACATTGTGTTTAAGAGTTTAGTTGGCAAAGGATAAAATAGAATAGCT
AAGAATACAAGGTTATACGAATAGAAAGATCCATCCGTTCATTTCACCTACAAATAGTACTAGAGTTATTCTTCGTGCGACAAATTTATGAATAAATTAA
ACTTTTTACAAAGTACTAAGCAAAGCAATTTTCCACACCGGATAGGGGCATGAAAACATTACTCAAATATTGGGAAGATTTCGTTTATCAAATTTCATTC
AAAGTTGGAAATGGCTTGAATGTGAAATTGTAGAAAGATAGGTGGCTTGAGAATTTTATTCATTTTGAAAGAGTTTACCCAACCCTCTTCCTAATAGTAC
GTGATCCTGACTCTATAGTTGTGCAGAACAAAGAGGACAATCAATGAATTCTACTTTCAAGATAAACTTCAACGATTGGGAGCTTGATAGTCTGTTTGAA
TTAATGGATAGACCGGAAGGTTACAACATGAATCCAAAGCTACAGATATCATTTGTTGGGGTCCTAAGGCAAAGGAATACACTGTAAAGGAGGGGCATAA
ATCTTTGCATGCCCAGAATAATATTATAGATTCTTGGCCATGGAAATTTATCTGGAAAACAAAGCTATCACCAAAGGTAATATGCTTCAGCTGGTTAGCA
TTAAAAATGCTTGTTTAACCCTGAACAATCTTTGTAAAAGAAACTTTCAGCTGGTCAACAAGTGGTATTTGTATCAAGAAAGTACAGAATCAGTAAATCA
TCTTTTATTGCATTGTGCTCTGACTGCAAACATATGAAATATATTCCTTATCATTTTCAGTTTTAATTGGTGAGCCTGAAAAAGTTATGAATTGGGCAGA
ATGATTCCAGTATGTATTTTTTGGTGCCTATGAAAAGAAAGTAATTGATGATTTGATGGAATTTTAATTCCTAACCATTCACTCAAAGTTAAATGTTTGT
TCAGCCTATTTTGTTGGTTTAACTAGTCTTATGTGAATAGTTCTTCTGCTTTCTTAGATATTTTTAGCTCTTTTATTCTAAGGAAAACATAGTCATGTTT
TAAGTCTCCTTTAGATTTTTCGTATTTGTATCAGACTCCTCTGTCTTAACTTCTATCTTGTAACAGAATTAGCATATCTACTTTTGTACTCTTTGCATTT
TAGTGCCGGTAATGAAACAACATACATTATATAAAAAAATAATTAATTTGGTAAAGTAAGAATATTTTGTAGAACTTTATTAAATAAGGATAATATTTAA
ACAAAAACCTCAAATGATCATAATAGTGCTAATCTCCCCATTTGAACCTATTAAAAATAGATGAAATCAATAAATAAATTACGAAAAAATTTGACCTATA
AATTGAATTTTGTTGTTATATCATTCTTACATTTATTTATTTATATATGTAAGAAATCTCTAGATTTTTTTTATTTGTAAGTGTTCGTAAGAATTATTTT
TTCTTACAATAACATGGAAATTTCAAATTGTAACAATCGAAAAAGGCTTAAAATATCCATCAAATATGTGAATTGGTAAAAAATTACTCATCTCTACCTT
CGAGCCTAAAATGCCTTCAACCTTTTGGCTCGATTTTGCCCTCATCTTTAACAACCTATATAATGCCCTCAATTAAAAAATTCATTAATGTGGAAATTTT
AAATTGTAACAATGGAATAAGGCTTAAAATACCCATCAACTATGTGAATTGGTAAAAAATTACTCTTCTCTATCTTTCGGGCCTGAAATGCCCTCAAACT
TTTGGCTCTATTTTGTCCCATCTTTAATAACCTAATAATGACCTCAATCAGCAAATTCATTAATGACGTGTTACCATCCTATTGACTATCCTAACAATTA
ATTAAACTAACTAAAAAGACCAAATATATACACAAAAGCACCCAAGAGAATTTTAGGCCTGAAAGTTAGAAGAAGGGATAACTTTGTACCAACGCACAAT
TAAGAGTATCTTAAGCCCTTTTTTTTGGGTAAATCATATAAATATATTAAATTAAAAGAATATTTACCGTCTATATCAATATAAATTTTTTAACTTAATG
TAACACTTTTTTGAAATTAAAAAAGTCGTACAGTCACACTTTGCTTCCTCTTGTTTTTTTCTTTATTCTTCTTCTTTCTTCTTTGTCATTTTTTTTCTTC
CTCTTCTCTTTCTTTTTCTTATTTTTCTTCTTCTTTAGAATTTGCATTAAATAGCTATCCTCAAATTAATTTTTATTCATATTTCATTATTTTTATCCAA
AAACATGATGAGAAAAAGAACATAATTAAAAATTAAAAATTTGTATAAAATCATGTTCTCAAGCAAAAATTTGAAATCTCTAAAATTACAGCAACAAAAG
TTCGCCATTGATAGTCATTGTAAAACTTTAATTTTTGAATTTATTATTTGAATTTTACAATTTGTGATTAGTTTGAATAGATTGTTCCTACAATAATTGA
AAATATTGTCAGGAGTCTATATCTCAATTTTGGGAAAGTTTGGTTAATCATTCATGTTCTTAGTGATACAAACCAAAATAATTTATAAGACACATATAAT
ACATGTTCTATTCAAGAATAATACAAATTTAATTCAATTTATCGTGTCTTTTGTTAGTTACGTTTTTCATTTATTCTTAATTTTCTCTTTTAATTCAACT
TTGATATTGTGTAAATACATTTCATTGGAAATTTGAATAATGTTGTAGTTTATTATTTGTTACGATGAGATTACTTGTTTAATTCATTATTGATATAAGT
TAGTTCACTCTATAGATCATTGTTTGGTCTTTCATCAGTTACATTTTCTTATTCATGTTTAATTCTCTCTTCTAATTCAACTTTAATATTTGTGTAATAC
GCTTTTAATATAAGTTAATTCATTTTGCAGTTTATTGATTAATTTTTACGATTGAGTTACTTGTTTAATTCATTATTGATACAAGTTTTATTCAATTTAT
AGATCACAAAATATTTTTTCGTATGCTATATTTTGCATTCTTGTTTAATTCGCTTTCAATTCAACTTTAATATGTATGTAATACACTTTTAATTCAAATT
TAATTCATTTGGTAGTTTATCATTTTATTTTTTCATTTGTTACGATCCAATTACTTGTCTAATTCATTATTGATACAAGTTTTATTCACTTTACGAATCA
TTAACTGCTCTTTTGTTTGCTAAATTTTGCATTCATGTTTATTCTCCTTTAGTTCAATTTTAATGTATGATATACATTTTTAATCAAGTTTAATTCATTT
TGTAGTTTATTGATGATGCGTAGAAAAAAAAGACTAATCTAGTCGTCCTGATTTACTTTAATTTATAAGACATGTTAATATATGTTTTATTCATTAACAA
TATATATATATATATATATATAATACATCTTGCAAACTTCACTCTCTCTTTAATGATCCCAATCCATATATTTTATAGTATACTTATAATATATGTATGA
TACATTTTTAATGCATATTGCAGAATATCATTTCAATTTAATACAATTTCAAAAAATAACTTATGTAGTAACTTTTAAGGGTTAATTTTTTTTTTCCAAT
TTAATACAATTTCAAAAAATAACCTATGTAGTAACTTTTAAGGGTTAATTTTTTTTTATAAGTGCTACAAATTTGTTAAGGTTTATTTTAATACACATTA
TTTTTTGTACCACATAAAATATTGAAGGATCAACAACTTTAAACCATTATAATGGTTGACAACTTAATTTTCGGGGACACATAAAGAAAAAATGAGCTTA
GAATTTTCTTCTCCCTTTAGAGCCACAATGAATTGAATTTGTGATCTTTGCATTTTTATGTTTGTTTGTTTGTAGACTTGAGCTCTCTGTTTCTATTTGA
TATAAAGTGAACATTTAATCCTGTTTTTAACTATATATAGAAAAAGAAATTGTATTTGTGGTTAAAGATGTGGATCATTCAATTGTAGCTTTAAAATACT
AATAATATCTTGCACAGAAAGAATAAAAAAAAAAAGGAAAGAGGCAAGAGAGAAACATAAATAAAATAAACGGAAAAGGGCTTAAAATACCTTTGAAGTA
TTGAAAATGATATAAAATTACCCTTCATCCACCTATTGGCTCCAAAATGCCCTTTTCATCAACCTATTGGCTCCAAAATATCCTTGTCAGCTTCTTTAAT
TGTTTTAAAATTACACTCTTTAAATTTTTTAAAATACTTTGCGTTCAATTATTGGTTATAATTTAATTTATTAATATAATTTACAAACCAACTCATACCC
ATTCATTACTAACTAACCCCACAAAATTAATAATTCAATATAATATCAAAATCATCGTAAACACTACTAAAATACGATGAAATTATAGATTTATGAAAAT
GACGTCCAAATTAATCGAATCCGAAATGAAGCTCCAATTAAATTTAGGTTGAGTCGTTTATTTAGGATGACACTTTCAATAGGATTTTCTTTCAAGATTG
AATTAGAAATTTATGATTAAAGGTAAAGAAGTAATACATCCCAATTAGTTCATGCACTTTTTTAAAATATAATTTTATAAATATTTATGATTTGTTTTAA
AACCTTTAATATATTATTTTGAAAAGAAGTAACCTATGAAGAAACATCACATAATTGAGATGTAATAATAATTAAGATGAACATAGTCAGACTTTTAAGT
TTATCGATACTTTTATTTAGACACTTAAATGTATGATAATTTACTTCTATAGATATTTTTCGCCTAAAATTTTTAAAAGCACTCAATTTGCAGTAGCTTT
TCTGTTGTATTAATAATGTAATGGGTTTATTAATTTGGAGGGGTTTAATTAGTAATGGGTAGGGGTGGGCATAAACACCGGAAAACCAAAACACCGAACC
GAACCGAAATTTTTTCGGTATTTCGGTTTTCAGTTCGGTATTCGGTTTATTTTTTTATATTTTCGGTATTTCGGTTCGGTTTTCGGTACGTATTACTTTG
AAATTCGGTATTTCGATTTAAACCGAAATATTATATTTTAATTTATAAATTATATTATATTTAATAATTATTAATATTAAATAATTTTTTTTTAAAAAAA
AAAAACCCTAAATCCCTAATACCCTATCCTCTTCACTCTTCAGCACAACTTCTTCAACTTTATCCTCTCTCTTCAACTTCATCTCTTCAACTTCATCCTC
TCTCTTCAACTTCATCCTCTCCTCTTCACTCTTCAGCACAACTTCTGCCTTCTTTTCTCCTCTTCCTCTTTTACTCCAGCCGGCGTCCACCGCCACCAGT
AGCAGCGTCGCCAGCCGCCGTCCTCGAGCAGCAGCCAGCCAGCAGCCAGCCGCAGTAGCCAACAGGTCAGCAGCCGCCCGCGAGCCGCGACAGCAGGTAG
CAGCAGCCAGCAGGTCAGCCGCAGCCAGCCGCCGGCGACAGCAGCAGCAGCCAGCCACCAGCCAACCCAGGTGCAGGTATGTAAATCGTAATTTCAGTTT
TTTTGATTTTTTATTTTTATTTTTTCATCTGATTTTGTTTTTGCTACTAGTTAATAGTTATTGGGAATTTATTATGATTTTTTTATATATTGTCTATTTT
TACTTTTTAGCCCATTAAGTTGAAAAATCAAACAAAAAATTGTAAAGTTTAAAATTTTAAAAAGCCCACTAAACAGGCCCATTAAAAAACCGAAATAAAA
AACTGAACCGAATTAATAAAAACCGAACCGAATTAACAAAAATCGAATCGAACCGAAATATTTCGGTTCAGTATTCGGTACGTAATTTTAAAAAACCGAA
AATCGAAAAAACCGAAAAAAAAACCCGAACCGAACCGAAATACCGAATGCCCACCCCTAGTAATGGGTGGGTATTGGATTGATTTATAAATTATACCAAT
AAGTTTAATTAGAACAAATAGTTGAGCGCCACATATTTAAAATAATATTTAAATAGTTTAAATATAAAATCGTTAAATAAGTGGTCTATTTTTGAACCAA
AAGGTGGATGACAAGGGTATTTTGGACCCAATAGGTGGGTGGAAAAGGTATTTTGGTGCAATTAGGTGGATAAAGGGTGATTTTATACCATTTTCAATAC
TTTAAGGGTATTTTAAACCATTTTCCGTAAAATAAGGATATAATAATGTCATATATTGCTATAAATGACAATAATTAAAAAGTACACTTAAAATAAATAA
TTATTTTTTAAAAGGGATCCACCATAATAATTAATCCTCTTTTCTTTTGATTTCTCACCCGATGTCCGAAGCCCACATTGAAGCTCCAACTAAATTCACA
TCCTGGTTAAGGGTGAAACACTCCCACCAGTATACCACAATCAATTTTGTTGTATTTTAAGCCTTTTTTCGTAGTAACAAACAGGGCTGCGTATCGGTCG
GTTCGATTCGGTTTTGAAGTTTATAGAGTTGGCTTATTGGTTATCGGTTTGTATAAATGCTAAACCGTTATAGAACCATTAAGATATTGGCTTATCGGTT
ATTGAGTTATCAGTTTTTGATCGTTATCGATTCGGTTATCGATTTAACTGTTTAGATTTGACACACAAAAAAAAACATTAAAAATTACTTAGAAAGAAGG
TGAAAACCAAATAAACCATGCACTTGAGTTCATAAGTTACATCTTGCTCAAAAGCAAACACTTTTATATTGAAGAATAACCAAGTGTTTAAGACAACCAA
AAATAAAATCAGGAAATCAAACTTTAAGTCAAGGATTTTATATACAAAATAATATAATTATAATTATTTAATTAACTATCGGGTTATCGGTTAATCCATT
AACAAAAAACTTTAAACCGTTAAGAACCGACAATCCGATAACAAAAAAAATCAAAACCACTATCAGAACCGCTAAATCAATAACCTAATACTATAAATCA
ATAACTTTTTTATCAATTCAGCTTATCGATTTCGGTTCGATTTTGAACAATCCTAGTAACAAAGATAGGTTTCAAAAACGGGTCACAATGAACCGGTATG
TTACAAATGGGTTTGGCCCGGTTAGGTTCTTTTCATTGTTAAGACACCTCAAATAGAGTCAAAACGGTCGATTCCCGTCTTCCTCAGTCTCCACTCTCCC
CCATCACAGTTGATGAATCTTTCCCCTTGAATTTCCTATTCATCTCCCTTGAAGATCTGGAGGCTCCAGTCATGTTGCGTCCTCACTTGGCTCGCTCCTC
CTCTTTACTGTTCCTCTTCATTTTGGTAAATATATCCGTGTAATCTTGAATTGTCAAACAGTCATTTTTCTTTTCAGGTTCTAAGAACTGATTAATTTTG
TTTTTCCTTTAACGGATTTACATCGAATCTACTGATGATACTTAATTTTTAGCTCGCCCAAATGTGCATTTCTGATTCTAATTTTTCTAAAACTTTGATA
ACCTTATCAGCGAATTGATGGAATTGAATGTTTGGATGAGATGTTATTTGATTATTTGACTATTGATTTTTGTTCTAAAGTTGTTTACACTCTGAAGAAT
GTTTATGTGAGATACCTGTGAATGGAAATGTTTGTATGCCCTTGTTTTACATGATCATATTTATTACGAGTAAAATCTCTGTGAAAGTGAATAAACTCCC
AATCGTTCTAGAAGCTCCTCCACTTGTTGCAAAACAGGTTATGAAATTCAGTTGAAAGGGTGAATATATATATTTTAATGGTGGTTTCTGGGACAACTTG
TGTGCAGCTTGACTATTCCACCTTTTACTGCCACCCCCAAATGAGTCAGGGTGGTTAAGTTTGTTTGCCAAGGTTTAGTAGATAAGAAGAAATCACCTAA
TGTTTTTGTTTTTTGCCTCCTACTGATTTGAATTTGAGATCTCATGGTTCACCTCCCACTTCATTGGACCATAGGTCACGCGTCCACACCCAATTGATAT
TCTAATGTCACACTTCATCCTTGAGTCTTTAGGTTACAAGTGAATACAATGATTTTATATTTAGACTATTATATTCTTTTTTTTTTGAGATAAGCATTTG
ATTTTACTAACCATATGTAGGACTATGAGCTTATTGGTTCCAGGAGCATTCATTGTGTGTTAACTTGAGACACTAGTATTGCATTTCCGTGGACCTTAGT
TTGTCTAAATTGTGAATGTTTATATTGTATAATGATTTTTCTTCTTTGTTTCTTTGTTTTTCTTGCAATGTAGCCTAGTCACACTGTCACAGTATATTTA
TGTAACAACTTTCTCGTGGTAGGGATGGTTAGTGGGAGGTGAATATTGACAAGCTTAAAAAAATTGGCACTTTCTTGGGAATTGTAGAATCAGTAGCTTT
TGATTAAATTATTTCCTTTATTTTTCTTTTTTGTGTTCAGTACTCTGGAAAGTATTTTCAGATTTCCGTGTTAATTCGTTTCACTTTGCACTAATGATTT
TCTCAAAGCCATTTACTCCCACTTGAAGCCAAGAGAAACTATAGAAAGGGTACTCATTATTGCAATAATATTTGGCAGTTGCTGAGTCATAGTTCACTTG
GTTCTACGGGTGGAAATCGTAAAACAGGGAAGTCATCGGTATTTTCGTTATTTAACCTTAAAGATAGAAGCAAATTCTGGAGCGAGTCTGTTATTCATGG
TGGTGGTAAGTTCTAGAAATGCATGTTTTTTTGTGTACTTGGTTGTAAAGATGACTTTTACTAGCTCAATTTCCATTAACGTTATGCTGTATGGGTACAG
ATTTTGATGATCTGGAAGCATCTAAACCGGAAAAATTGAGTGTTCTCAATTACACCCAGGCAGGTACTTGTGTTTCTCCAATATTTTAATTTTCTTCTAC
CTTTTGACAAAGGATTAATTTTCACTTTCTTTTATATTTGCCTTTGATGTGTATTATACTCCCTTCTCAATTTTCTATATTAGTGCTTCGTAAGATAAAT
CTTTTTTTTAAACTTTAGTTCTGGAGACTATTAAACATTTTTTTTCATGCATTTACCTTCTATTTATCTATTGAAGCTTCTAGTTTTCTAGAAGATGTAA
CTAGTTAAATCACATTGTAAAACTTGTATAATGGATAGAAGCAGGGACTCGTATCGTGGGGATTTTCCCATGAACTACCCTTTTCTTTGTAAACACGGTG
GTGTCCGGAGCAACTTGTGCACACCTCGACCACTCCATTGGATATCTATGAACTATCCTTTTTAGAAAGTCAAATAAATAAGCATTCTAGTTGATGATAT
AGTTTCAATTTTTTAGCATAAAATTTGTGCTTTTCTTTTAGCTCATGTATTCATCTTTTGACATGTTCATTATGCAACTTTGAATGAAAATGCCGCAGGA
GATTTTAAAAGAACTACACTCCATTATACCTTGAAGCTCAAATATTAGGTGGGAGAGCCCCGGATGTTGAAATCTGAGTGTCAAGCACCACAACGCCTCA
ATCCCAAGCTAGTTTGAGTTAGCTGTAGGATTTATCATGGGTCATATCGCTCCATTTAAGCTCATCAAATTAATATTATGCTAAATAAAATAAAAATTGA
AGTGCTACATGGTCTCTATATTCTTATTAGCGCGCGCACATTACTAAAACATCTTTTTAATTATTTGGTATCACATATATATATATCCCTGACTTCCAAC
GCACCTTGTTTGTTTTTGCTGGATCTGCATGGATTCCAAGAGATTGTAGGTCTTTTAAGATTACTTCCTTCCATGCTAATTTAGATCTAAGTTGTTTCTA
ATTAACACCTTTACTTACCATGATTTAACACTTGCGGATGGATGCATGGATGCATTTTCAAGATTACTTCCTTTCATAGTGTTGCTTATACCACATTGGT
ACATCAGTTCCATAGAGAGACTCCTCTCTAAAAGCAAGAAAGATCAACAATAATGAGGTGTTGTTTTCCACACCTTCGACTCTCGATTAGGGTTGCAGAA
GGCTAAAGGGTAATCTTGAAACAAGGGTTAGGTCACGATGGGCTTGTTGATTTCAGAAAGGAACTTTCCTTGCTCTGTGTTTAGCGGGGAAGATTTGAAA
GGGGTACTCCATGGAGAAATTTGTGATCCTGTGCAGGTTTCTTGGCGAGCAAGAGGCTTGTTGTGTTTTTCGAGAAGGTTGGAGGTGTATGGACTATAAT
TTTTCATTGGTGGACTGAGAATATAGTGTTGGAGTTGAAAAGAAGAAGACCGAGTCTAAAGTAGTGGTTGTCACGTTCACCTCTACTAACGGTTGTTCAA
AGGAAAAAGTGTAGTGGTGGCCAAATTTAGGAGCAGTTGTGGTGGATTTCAATCACATTGGAAGGAGTATTCATGTTTGGTTAGAGAGGGGTGCATGTGG
CGGTAGAGTGTTGTGCGGGTGACAAGGTAACAAGTCTAGATGGCTTCATGTTGGCTTTCTTTTGGCATTTTTGGAGAATAGTAAAAGCTAATGTTGTGAG
CATAATGATGAGTTTCTAGCGGGGTGAATTTGAAAAAGCTTAAATGCTTCTTTCATTGTTATTATTCGAAGGCAGGGCCACCAGCGTTGGGGACTACAAA
CCTATTAGTGTAGTGGGAAGCACTTATCGGATCTTTTCAAAGGTGCTTTCTACTAGTCTCAAGAAAGTATTGGTTTAGACACATGTCCACTTCGTAAAAT
GCTTTTAGTGAAAGAAGAAAAAATTTGGATGCAACTTTGGTTGTTGTTGAAGTGGTAGATTCGAGGAAGAATCAGGGTGTGCGAGGTGTCTTGTGCAAGT
TAGATCTTGATAAAGCTTATGGCTATGTTACATGAAATTTCCTCGACATTATGATGCTGAAGATGTGCTTGGGAGAAATGGAGGAAGTGGATCAATTTTT
GTTCTCTTATGTGAGATACTTGATATTGGTGATTGGAGATCCTTGTGGTTTTTGTGGTAGTTAGAAGGATTTGAGGTAGGGAGATTGTTTATCACCCATG
CTTTTTATCTTCGTGATTGAGGCTTTGAGTAGGATGATGGACAAGGATAAGTTGGGCGGTCTTATCAAGGGTCTCAAGGTTGCGGTTGGTCATTGGTGGC
AGGGTTATCAAAGGTGCGCTTTAAGCGCGCTTAAGTCCTGAAGCGAGGCTCAAAAGGTATTGAGTGCTTCGCCTCACTTTATTTGCGCTGGAGTGTCGTT
ATCAAGGTTCTAAGACAAACTTTTCCTTGCCAATGAGCCTCTTATGAAGAATTGACACTAAACAATTGATATTTCACTTAAAATTAAAAAAATTTAATTT
CATTGGTCATTATTTGTCATTCATGTTTGTAACTAATAGTCTTGGACTAAACATATATATTTATATTTTATCCTCCCTTTGCACCTTTTTTCATTAAAGC
CCACACTTTATTTGCGCTTTGCTCTTAAAGTCCTGATGGACCTTAGAACTTTTTTGCGCTTTTCGCCTTTGATAATACTGGTTGGTTGGTGGTGGTAGTG
GGACCTTGTCGGTTTCCCATCTTTTATTTGTGGATGTTATTTTATGTTGTGTTTTGCTGATGGGATTCAGTTGGACTACCATGGACAAGTGTTGACTTGG
TTCTAGGTGGTATTAGGGATCAAAATTGATCTTCGAGAATGCTAGATCTTTCCCATTGGTGCAATAGACAACATTGATGTGTTTACTCAACTTTTGCATT
GCAATGTGGTTTCTTCCATAAACCTTGGATTACTTCTAGGTGCATCAAACAAGGATCTCAACGTTTGGAATTCATTTATCTAGAGAGTAGAGAAGATGCC
AACAAGGTGGCAGAAGAGATATTTGTCCAAAGGAGGAAAATAAATGCTTATCAAGAGCACTTTATCTAGAAATACTACTTATTGCATGTCCTTGTTCAAT
GCACCTATCGTTATCATAGCAACATTGCAAAGGTTGCAAAAATTGTCTTCGGGATGCGGCTAATGGGGCTAAGAAGTTTCACTTAGTTTGTTGGGAGACA
TTGACAATGCCAAAATGATGAGTTTCAACAAGCCACTTTTGGGCAAGTGGTTGTGGAGATTTGGGTTGGAGGGGGAAGCTTTAGGGAGAGGTGATAGCAG
AGAAATATGGAGTACTGGAATGGGGAATTGAAGAGGGGGGTGGCGGAGAACAAAGTTACTATGACTTATGGATGTGGTGTGGAGGAATATATTGAAGGGT
TGGAAAACCTTTAAAAACATTCTTTTAAGGTATGGGTTGGGAATAAAGTTGGTTTTCGGGGCGAAAAGTGGTGTGGTGCTAAAAGATGATTTTCTGGTGT
TGTATAAGGCCTCTTGCCAAAGGGAATTGTTTGTCCAGCAAGTTAGGGGGACAGAATGGGATTTTGGGATTTGAGGTTTAGGAGGAATTTGCAGAATTGG
GAGGTGAACGAATTCCCGAGATTGCGAACTTTAATTCACAAGCAATGTGAGCCCATCAATAGACCTGATGCTTTGAGTTGGAAGTTGAGAAATAACAAAG
TGTTCTCTGTCAAGTCTATCTATGAGAAACTTTTGGTTAGGATGGATGTTAGTTTCTCTTATGATTTGGTCTCGATACCTAAGGTGTTGAGGAAGGTGTG
CTTTTCACATGGTTGGCTACTAAGGGGTGATATTGATGATGGAAGAATTTTAGGAAAAGAAAGATTGTTTGTAGGAGCGGCATATGAGCGTGTTGAGTTG
AATATGAGTATGATAAACTAGTTCATTAAAAATGGGTTAAATGCTCTACTCATATTTTAAATGAGTACAAAGGAGTTACCCAATGAATAATATGGGTACC
CATATTTACCCATATTATTGTAGGGATCATCTTAAAAGCTTTAAAGCAAAATCTCTTACCTCACTCTTCACCCCTTTCACCTCCCACTCTACCCCATCCC
ACCCCCAACCTCAATGCCTCAAAAATTAAATTTATTTTTTATTAGTTTTTTTTTCAATTTTATTTTTATTTTTTAAAAATAAATTTATTTTTTACTATTT
CGACCCACTCCCACTACCACCACTACCCCCTCCCCCCACTATAGCCCTTTCCCTAAAAAAATTGTTTTCCAAAAAAATCAATTTTTTAGCTTATCCAACC
CATCCCTATTCCGGTCGGTTACACCTTAAAAAAATATTAATGCTTCTTTTATTTCTTTTATAAATGAATTTCTTTTACCCATTTAACTACACATTTTTAA
ATGGATAATATGAGTTCGACTCATTTTTTACTCACCCCAACTCATTTAAGATGGGTAATTTGAATGGATACCCATATAAAATACTCATTTTGCCATCCCT
GTTGTTTGCATGAGATTATGTTTCCTATGTAAGGAGGTAAGCGAGGACGTGGATCATATTTTGTTACATTACAAACTAGCCATGAGGCTTCGACATTGAA
TGTTACTCCTCTTGCTCTTTTGTGTGTCGTTTGGAAGGAGAGGCATAGAAGAGCTTATGAAGGGGTGGAAATGAGCTTTTCTCAGTTGACAAGTAGTCCC
TGATCCCTTATTTTGTTTTAGTGCACCCATGAAGTTCCTGTTTGTATAGAGGTCTGGGTGTCTTTTGGGGTAAGCCATATATTGTAGGTCTCTCCTTTTT
TTGTATACCTCTTGTATACAACCATAATGCCCTTGTTATTATCAATGAGATCTTTAAAATAAGACGGGAAATATTGTATAAGCTATACATATATTTATCG
TACTGGAATTGAAAAGTTGTTACCGAACATTGGATAAACAATGGACATATCGTGATTGTTCTGTCCAATACATCTAATGAAATGTGGCCAAAGACAATAG
GTTGAGTGGCTCGAGGCCTTTATAAGCCCATTTGGTGGATTCTTTTGCGTTACCCATTTGAGATAACTGTATGAGTCAAATAATACTTGAATGAGCCATC
ATATTAGTGTATATCCCTAAAAGCCTTAAATAACTATATGCTTGATGTGTTGAATATTCTATTAATACGTTCTAAGATGGAACAGAGGGGAAGTATATTT
TTTAATAAGAGGAGTAAAATACCAGTGAACCTTTTCAAAAAAAAAGAAGTGGAGTGAAATAAAATATTGTTCTCTTGTACTGCAGGTAATATAGCAAATT
ATTTAAAGCTTCTGGAAGTTGATTCCATGTACCTTCCGGTACCTGTGAATTTCATTTTTATTGGATTTGAAGGGAAGGGTAATCAAGGTATGTATTATTC
CTTTACTTTACCTTTTATAAAAAGGTATCCAATTGTCCCTTCACAATTGAAGATGACTGTTTTCTTTGTTATATTTCTGCATTGTAAATATTGACTGTAT
TATTCTTTACTACTGCGATGTGGTTTCTGCTCAGAATTTAATCTACAGCCACTGGAACTAGAACGCTGGTTTTCAAAGATTGATCACATCCTTGAACATA
CAAGGATTCCTCAAGTGGGAGAAGTTTTGACACCATTTTACAAAACTAGCATTGACAGAGAACAGCGTCACCATCTGCCTCTAATAAGCCACATAAACTA
CAAGTACTTTTTGTTTTCCTTCCCCGAAACAACCATACAATCCGCGTGAGTAAAATAGTTAATGCACTACAGACTGATCTGATAAGGTATTCAAATCTTT
GTGCAGTTTCTCTGTTCATGCCATTCAAATGGGTGAAAAGGTCACATCCATCTTTGAGCGTGCCATTGATATCTTTGGCCGCAAGGATGATATGTCTGAT
AACAGGTACTTGAAATCCTTTCTAATATTAGAGAATTTATGTTTGTCTGTGTAACTTTCTGTGACTATTGTTATTTCTTAGATGCGTTTCTTCAGTTCCT
CTATATAAATGTGTGTTTGCAGGGATGATGGAACTGTTCTGTGGCAAGTTGATGTGGATATGATGGATGTTCTCTACACCAGTCTCGTGGAGTATTTACA
ACTGGAAGATGCCTATAACATCTTCATTTTAAATCCCAAGCGCAATGGAAAAAGAGTCAAATATGGATACAGGTTTTTCTTGTGAAAATTGAACTTTTTA
TATTACTAAACCTGTATAGTCTTCCCAATAGCAAACACGGATGCGAAGTAGTTAATAAGGCTTCAGTTATTAAATTATACAAAGATGATTAGAAGTCCAT
ATTTTACTATTGGAAGCAGCCTCTATACTTTCTCCAGACTCCACTTGTGAGATAACACTGGGTATAATGTTGTATTCAACAATCAGAAGAATGTGGAAGT
TAGTAAAGGAGGACAAGTCTATGAAGGGATGACAATGGGGCGGGTTGAGCTTAACCCACAAAATTTCTAACCCGCATAAACCCGCTCCGCCCCGCTCTGG
TAACTATAAATTTCAGTAAAAAAATCCTTTTTCACCATTTGAAGCTACGCTCAACCAACTGTAAATTTTTCTTTGAAGACATTAACATTACTCATTACCA
GCTTGATGATCATCAATGGTTATGATCTCTTAGTACTATCCTGGTATCTACAACCAACTGGTACCACAACGAGGTTATAACAATCTCTCTCTCTCTATAT
ATTTAGTTTGATACATGTAGCTTGAAGTATTATATAATTTTAAGCAAAGCTACGTATATTTTTTTGGTATATTCCAAAGAACAATATTAATTTTTACTCT
TTTTTTAAACCAGCAAATCCCCCGCCCTATATTAGTTTAGAAAAAAATATCCAACCCGCCCCGCACCCACCGCCTTGCCCCGCTTAGCTTAAAACCCACA
CGCCCCACATCCGTCCGACCCGTTGCCATCCCTAATTCTATTAATTTTTTGAAGTTGTAGCAACAAGGGTAAAATGATCAAGCTTTGATTACTACAGTAA
CACCAAACTCACATGCATGGACGTGCAATATATATATTTTCTGGATGATTTCTGCATGTAAATTAAGTTTGACAATTGAATTAATATCGGATAATGGTCA
GCATTGTGCTCTTGTGTAATAGTATCTTTCTTGACCTAGAGCTTATGTTTTTGAGGTGTGGAACGATCTGCTCTTGCATGACTAGTATTGCCATGCTGAA
GGCTGAAGCCTTGTGTTACATGATGCTCTATTTGTTAGGGTTGACAACTCCTATTTTGCTGTGTAAGACCTATTTACTTCTGTAATTTTAAATATTGAGT
CATCAAAACTGTTGTCAATGCTAACACCCAGTGTTACACCTCTTAGATGTAAGTAAATCTATACTAAGTTGCCATACTCACTTGTTCAGAAAACATTTAC
TTGATTTAATTGATTGCATTGGAGTAAAAATATGCACAAATTTCATTTTGTTCCAAGTATTTTTTAGTGTTAAAGGTTGCACTTTTACATGGTTTCATGT
GAAATATTCTATTTTTGGAAGATAGGCAGTATTTTGATGTAGTTCAAACTAAAAATTATCAACTCAATCGAAAAAAGCAAGTTGAAGTGGATTTTTTTTG
TAGAACTTAAACAAATAGTTATCCCCAGTAAGTACTCCCTTTCAATATTTTTGTCTTGTATGACTTGACATGGAGTTTAAGAAAGTAAAGAAGATTTTTG
AATCTTGTGATCTTAAATTAAAGATATGTACAATGTACCAAATGTCCTTTAATCTTGCGGTCTAAGACATGCCATGTGGAAAGTTGAAATTAAATTTAAG
ATGTAGAATGTACCAAAATTTCCTTTAAGCTCGTGGTCTAAGACCTGCCATGTGAAAAAGTTGAAATTAAAGAGTTGCCGAAAAAGGGAAGTGACATTCT
TTTGAAACAAAAAAAAAAAGGGAAAGTATAACAAACAAATTGAAATGGAGGGAGTAACAGATATGATCTCATAAAAGTTGAAACTAAAAATAAAAGAAAA
TTACTTATATTTAGTAGCTCACATATACATACAGATACATTCTCCCTTTGCTCCAAAAATTATGACTTGCTTCTACCAAAGAAACTAAGATTTGGATGTT
TAAACAGATTGTATTGAATTAGAAAGTGCTTGTAAGAGAACCTTTCAAAGAAAAAGATAAATGTGCTTAAGCCCTAAAGCGAGGCTCAAAATGTATTGAG
TGCTTCGCCTCGCTTTATTTGCGTTTCAGTATCGTCATCAAGGTTCTAAGACAAACTTTTCCTTGCCAATGAGCCTCTTATGAAGAATTGACACTAAACA
ATTGATATTTCACTTTATGATTAAAAAAGTTCAATTTCATTGGTCATATATTTGTCATTCCTGTTTATAATTAATAGTCTTGGTCCTCTTGGATTAAACA
TATATATTTATATTTTTTCCTCCCTTTGTGCTTTTTTTCATTAAAACCCATGCTTTTTTGCGCTTTACGCTTAAAGCCTCGACGGACCTTAGAGCTTTTT
TGTGCTTTTCGCCTTTGATAACACTGGTTTTAAGAAATGTGAATAACAGGAGTAGTTAACGAGTAATATGCAGCAAGACAAACTATTGTATTCTAACTTT
GTGTTTTTGGTGTAATCGAATACACTCCATTGACACTGTCTCTATGATTGATGTTTTAGACTCATTATAGGGATAGGACAGTGCCTTTCGAGTTTATTAT
GTAAATATGGTTTTCAGTACAACCCATGTACTGATTTACAGAAATAGAAACAATTACCAATCTCAAAAAATAAAAAATAAAAAAATTGACTAGATGAGAC
TTTTTTTTTTGTTTGATGAAGTAATATGTTCCATTAAAAAGCATCAAGGAGATGCAAAGTTACAAGGGGCATAGTTACAGGTAACATAATGACAAAAAGG
AATATTCAGCTCAGTTCAGCCCCATACAAAGTGTTAATCTAAACCTGGGGTGCTAACAAAGTCTAGAAAATGTCCAGCACTAAGAACTGGGGTCAACTTT
GACCAATAAAAAAGGTCAAGCAAAACATTTAGCTTAAAGTGAGTGATTTGGAGTTGAGATGCCATCAAAACATCTCTTGTTCTTTTCTGTCAACAAACAC
CAAAAGATAGTGGCAGGAATCATCTAGCAGATTTCAGATCCTTGTTACAGTGGTAAAATATGTTAACCAGCTGAATTCCTTTCCTGTTACAGTTGCCTAG
TTTCAGACAGGCTTCATATAATGCAATCCAGTAGATGAGACTTATGAAGGTGCAGTGGAGTTTTTTAAAGACTTTGGAGGAGTTTCAGGGGCCATCAGAA
GCAGAGGACAAATTGTATTGGAATCCAAGCAAAGATGGGACTTTCACTGTCAAGTCTGCCCATTTAGCAATCAGCAACCATGCTTATCAGATTATTGATT
GGCCATGGAAGGTTCCTTGGTAGTCTAGAAAGACAGTGTCGAGTCAAGGAAGGCTGAGAAGGAGAGGATTCCAGTTATGTTCCAGATATTTGTTCTGTAA
TTCCAATGCAGAAACTAATAGCCATTTGTTTCTTTATTGTTCTTCTAGTTATCAATTGTGGCAGCTCTTTCTTAATTTGGTGGGAATCAAATGGTGTATG
CCTGCAGACACTGTGGATCTTCTTTAGAACTGGAACAATTTGGGAGGTATAGTTAGACAGAAGAAATGGTGGAGATTGGTCCTGCTTGCATATGGTGGAC
AGTTTGGATAGAGAGAAATTCCAGCCTTTTTGAAGATAGGGGCAGTCATATACAGGAGATTATGTTGAAATGTGTACTTCTGTTCAACACTTCCACTTTT
GGTGTAAAGAGTGCTTTTTTAAAAGAAGGTGGTCTATAGATTTGATAGGGCAACTGCAATTGTTTTTAGGCTTTTGTTTGGTAGCTCTGCCCTGGTGCTT
TTAATTCCAATATTTCCAATTTAAAAAGTTTTAGACTTTTGAGTTAAACAATCTTCTTTGAAGAAACCCCTTGCCAATGGTTTGGGCTTGGGACTTTCAT
GTTGGAGGTCTCAAGTTCGAAACCCTTGCCAGCGAAATCAAGAGGTATGCCTTATGGGTAGAGATCATCGCACTGGGCTTGCCTAGTGCGAATTATCTCT
CGAGTGTAGTTTGCGATTTATTGCATAGGAGTAGGGTATTTTACCCTGTGCACCCAAAGGGTAGGAACTGTGAGTGTCCCGTGTCATATAAAAAATATCT
TTTAAAGATACAAATAACTTCCAAGTTTAAACATTATGCTAGATTACTAGTAAGGGTAGAGTACTAACAGAGGATTTGGTAATAATGAAGAACTCTCCTT
GGATCACTAGTAAGGGTAGAGCACTAACAGAGGATGAGGTAACAATGAAGAACTGTAGATTACTAGAGTTCGAGGAATTGCTCAAATATGAAGAAATTGC
ATGGTGACAAAAATCAAGATCACTATGGTTAAAAGAGGGGGATAAGAACACTATGTTCCTCCACAAAATGGCCAATGCACACAAGAGGTACACCAATATT
GATGAAATAGTGATCCAAGGAGAACTAACCCAAGATCCTGCAAAAATTGAAGGAGAGATAGTAGACTTCTACAAGAAGCTATATATTGAAACTACTAACT
GTTGACCTGCCTATACTGATGCAAATTGCCTCGGGTTATCAGAGGAGGAAAAGGAGAATCTGCAGAGGAACTTTGAGGAGAGTGAAGTCCTAAAATGTCT
GAAAATGTGTGCAATTAGGGATTCCCATGGGTTTTTTCTTAAAATGTTGGGAGGTGGTAAAGGAGGACGTCATGAAAGCTTTCCAAAACTTCTATGAACA
AGAAGTGTTTGAAAGAAGTTTGAATGCAACATTTATTGCTCTCATCCCAAAGAAGAAGGGTGCGAAGGATTTGAGAGATTTCAGACCCATCAGCTTAATA
GGCAGCATCTATAAGCTTTTTGCTAAAGTTCTGACAGAGAGAATTAAAAGGGTAATGGCTAAACTTGTGGATTCCCGACAAATGGCTTTTATCCAAGGAA
GACGAATCATGGATGCGGTGTTGATAGCTAATGAGGCAGTGGATTCCAGACAAAAGCAAAAGAAACCAGGAATACTTTGTAAGCAAGACATGGAGAAAGC
CTATGACCATGTTAATTGGGAATATCTTTTGACCACAATAGGGAGATTGGGATTCGGAGGAAGTGGATCCAATGGATCAGACATTGTATCACTACTGTGA
GATTCTCAGTACTTGTGAATGGATCCCCTGTTGGTTTCTTTAGTGCAGAGAGGGGACTAAGGCAGGGAGACCCTTTGTCTCCTTTCCTTTTCCTACTTGC
TATGGAAGGGCTGAACAATATGATCAAATCAGCTAACGTGAGGGGATGGCTTAGAGGTTTTGAAGTCAGCAGACCGAAAGTTGATAATGTGGAAATTACC
CATCTACAATACGCGGATGACACATTGATATCATGTGATGCTGATGAAGGCCAACTATAGATGTTGAGGGTGATCCTAGTGTTGTTTGAAGGGTTCTCTG
GTCTACACATTAATTGGAGGAAAAGCCACCTCTATCCAATTAATGAAGTACACAACATGGAAGCATTAAATGCGGTTCTAGGAGGGGAAATTGGAGCGCT
GCCTACATCATATCTTAGGATGCCTTTGGGGGCCAAATCTCAGTCATATGAACTCTGGAACAATGTGGTTGAGAAATGTGAAATGAAGTTAGCAAGATGG
AAATCACAATATCTCTCCAGGGGTGGCAGGCTGACCTTGATTAATTCTGTTCTTGATTCACTACCAACCTATATGATATCAGTGTTTCCAATTCCCAAAA
GTGTAATCACTAGCTTGGATAAAATCAGAAGAAAATTTCTTTGGCAAGGAAACAGTGAGAGGAAAGGCTACAACTTGGTTAAATGGGATGCTGTGATAGT
GGGAAAGAAGCACGGAGGTCTCGAAATAAAGAATTTGCTGAATCAAAGCAAAGCCCTTATGATGAAATGGTTATGGAAGTTCAACAATGGAGAGCAGACC
AACAGGAAGGAAGTCATTAAAGCTAAATATGAAGAGGAAGATAACTGGATGACCAAAGAAGTGACTACAACATATGGGGTGAGGAATGGAGAGAAAACAG
AATTTTGGAAAGATGTTTGGCATGAGGCAAGTAGGCTAGAGGCCTTTTATCCTGATATATGCTCTCTGGTTTCTCACCAACAGAAGACTATAGTAGATCA
CTGGACTCCTCAGGGGTGGAACTTCATCTTTAGAAGACAATTAAATGATTGGGAGATTCAAAGGGTAGCAGATTTTTTCAACACCATTGGGCAATTTAAT
GGACTGGAAGGAGATCGGGACATTTTGTTGTGGAAAGGCAATCGAAAGGGCAACTTTAAGGTAGGTTATGCATACAACTGGTTGAACCACACCAATCAGC
CTCAAAGTAACTGGCCATGGAGAGGAATCTGGAAGTCAAAAATTCCACTCAAAGTGGCATGTTTTGTTTGGTTGTTAGCCAAGGAGTATGTATTGACTCA
AGACAACTTAAAGAAAAGGGGGATACCATTATGTTCTAGATATTTCTTTTGTGGGGAAACTGCTGAGACAGTTAACCATCTCTTTCTACAATGCAAGATG
ACAAGTCAACTATGAAGGTTAATCCTGAGCCTTAAGGGTATGTCATGGACCATGCCTGCCAAGATCACAGAAGCAATTCAGAGTTGGGAGGAAGCAGGAA
TGCAGTCCAAGAGTAGAGACAGATGGAGAATTGTCCCAGCTAGCTTATGGTGGGCAATATGGAAGGAAAGGAACTCTAGAGCTTTCGATAGTGTTGAGAA
TAGTATGCAAAAATTCAAACTAAATTGTCTTATGCTGCTATGTTTTTGGTGTAATCAATTATACTCAAGTGATACTATCTCCTTAATTGATGTACTAGAC
TCAATTTAGTTAAAGATAGTAGAATTTGAAGTACATGTCGTAAATACTGATCAGTGTACTGACTTTTGAGGAATAGACAAAGTTACCATTTTCAAAAACA
AAACAAAACATTATGCTTGAACTTATGGAGAGAGAAATGTTTCCATCAAGAAAGAGGTCACTTCTTTTGGATGAGAAAAAGAAAGGTAAGTCGAGCTATG
TTCTGGAACTGACAGTGTCATTCTGAAGGTTTAATCAGATTTGAAACTTAAGTACTAGAGCAAGTAAAATGTGGGGGTGGGCTTTCGGTATTCGGTTTGG
GTTTCCCAATTTCGGTTATTCAGTAATTGGTAGTTAAAAGCAGATACTAAATTCTTAAATTTTGGTTCGGTAATTTGGTAAACGGTAAATTAAACTTTGG
TTTGGTACAATATTAGACAATATCATATTGAAGTTATAGACGATTGTACTACAAAATTAATACTATTTCTCCAACCATTTTTTTTAATGTGGAGGCACAA
TATTATAGGATATTCTTAAACTTTTTCTTTGAACTTGTGAGTAATGAATATGTTGATATATGTCCGTCCTAAAGTAATAATTTGGTATTCGTGAAATGCC
GAATACCAATGGTACTAATGTCTCATACCAAGCCCAAACCTGAATACCATAGTACTAATACTTTACTCCCGAATACCTTACCAAATACCGAATTACTGAA
TACCAAATTACCAAATAATTCGGTTTGGTAATTTGGTTTTTGGTATTCTGTGCCCAGCTCTAGTAAAATGTATAAAATCTGTCCTTATGCAAAATTTCAA
TGTAATACATTGCAGGCCCATGTCAGTTTTCTATTGTGTGTGTATATAAGGGTTTTGGAGCCATTTTGTTTTAATCAATTTTACATTACTTAGAAACTCA
TTTCTCTACTATCTAGTCTACTTGCTTATTAAGAATTGTGTAAAAAGCTTTGTAAACCTGGAGATGGACTAAGATCCGTGAAGCTTAATACATGTAGTTC
TTAGTCCTTGCGGTACTTCTCTGGTAACTGGAATTTAACTTGGTCAAAATATCCTATTAGCAGCAAATATGTTTTACTATGTGCTTCTGCATCAGCTGGC
TTTCAATTTTTTGCTTAGGTCCTTTATGTGGGTATTACATGCAAATGAGTACAATGAAGAGTAAAAGAGAGAGAAAAGGATGTCCTCAAGCTAATTTAGG
ATATAAGAAAACACAGCACTCCAATGTGTAGAATGTATTCTTGCAGAGATATTCTGTGCATTTGCTGCATCCGGATCATCTCTGATCACATAATATATTT
CCTTATTCACATGTCTCTTTATTTCTATTTTCTGATTCATCTGTATATTTCTATTTTCTGATTCATGTGTATCTTCTATTTCTTAAATCATGTAGGCAAG
GGTTATCCGAAAGCGAAATTAACTTTCTTAGGGAGGTAAAATTGTGATTTCAATACCCCTTTATATTAGTTGGATATGGATCATCAGCTTCATGTTTTCT
GATCTTATACTTCATTCAGTGATTCTTGATTTGTCAAGATCTATTTTTGGGTAATGTTTTCACTGGTTGGATGCTTCTTACAGAATAAGGAGGTACAATC
AAAAATTCTTCACTCAGGAAGAGCATCAGAAAGTATCCTTGGTAGGTAAATGGGTGTTCAGATTTTCTTAACTGTAGCATGATTGGTTTTTGTATGTCCT
CTGAGAAGCATTAACTAAGACTGAGGCTTATTTTTACAAAAACTGTGACAGCTCTCGAGAAGATGACAAGACCATTGTATGCCAAGCATCCGATGGCAAA
GTTTTCATGGACTGTCACAGAAGATACAGATACAGTAAGTTATCTCTCCTCTTGGTTCCTTATATCATTCGGGATCTTAAATTTCATGCATTTCACCGGA
GATGGAATTTATAGAGACCCAATGTGGATTTACTTGTTGTGTATGTGCCTATATTACTTGTTGCGCACAAATATTATGCTCTTCTGTATCTAGTCAAGGA
GAAAGTTCAATTCTTGTTAGAAATAGATGAGCAAGGAATCTCTTGCCGATGCAATTTATTGTGTAATTTATTATAGGGGCTTGGATTGAATATTTTATTC
TAGAGTACATGCCAATGCTCTAGAGTAATAAATGAAGCAGATACAGCTTTTACTGGATGTAAAGATGTTATGCAGGTAGACTGAATGATACCAATGATCA
GGGAATTTTTTTAATGCAAGTTTTCTTAGTTGTTAAAATTCAATATGCTAACCCCCCCGTCCCGTAACTGATGAATTAGTGAAGCTGAGTGCCTTTTTTT
ATTTTTTTGAAACTGGTTATTTTTGTATTCCTCAGCATTAAGGGCTGTGCAGGCTACCTCCAAGAACTGTTACAAGAAAGGAAAAAACGAAAAGACATGT
TTATGAAGAACCTATGAAGTCCACTAATTGTATCTCCTCTCTCTGTCCTGTTCTTACACCCAAAGCGTAGAGTAGTAATTACTTTCCATTTGATCTTCTG
TATTGTACTCTTCTTTTTCTTTTTTGATAAGGTTTAAGTGAGTGTCGAAACTTGAAAGATCATCACTGTGACAAATGCTCATTCTTGGTTTTATAAGCTC
AGTACAGTAGGCTTGTCAAAAAATCAGTCAACATACTTGTTTCTCTTAGTTTTCCATATCATCTATTATTTAATTTTGTACTGTTCTTTTAATTTTATTG
ATCTTTGAATGTTCTTTTTTCTGGTGATCAAAAGCATTTCTTAGTCAGTTAAATGCGCCACATAATTGCCGTAAAGATGCATAGTAAAACTAAGGTTCTC
GTACTCCCATTGTTCTGATGTGTGTTTGTTCTGAACTGTTTACTTTCTTTAACAAAACCAGGCAGAATGGTATACTAGATGCGTTGATGTATTAAACAAT
GTTGAGAAGGTATCTCAAGGAAAGGACATGGCTGAAGTTGTGCAGAACAAGGTTATGCAGGTATTACACCACTTTATTTTCTCCCCCTCCCCCCTGGATA
TCTCCCGCTAATTGATCATTATAGAAGAGAAGTACGGCTAATACTGCACTAACTATTTGAACATTTTACATCTTGGATTATCTGAATCCTCTATTTGACT
CTAGTTATTATGATACTTTATTCCTTTCAAGTTTCTGAATGGGAGAAATGGAGAATTGAAGCTTCGTTTTGAGAGAGAGTTAAAGGCTGGGAAATTTAGC
GGTTTTCATGCTGAATGTCTCACTGATACTTGGATTGGAAATCACAGGTTAGAGTCTTACTTACTTCCCTTCACTCACTCAGTGTCTTTCATATTTGTGA
TTTTTGTTTCATTTCGTAATAGGTGGGCATTTATTGATTTGACTGCGGGCCCTTTTTCATGGGGACCTGCTGTGGGTGGAGAAGGTGTGCGCACAGAACT
AAGTTTACCAAATGTGGAGAAAACCATCGGTGCGGTTGCAGGTACTAAAGCGGTAGTCACATGTTTTTGCTCATCGCTGAGACTTTGTAGATAGATCTTT
ACACTTTAGATTGTATTTATGAAGTTGACCAGGGATGTCTTAGAAAAATTTGTTTTTTCTCCCTGTTGTGTACATGGTACATAATGGTCTTTGTTGACCA
TTGATGTATGTGTTTTTGTTATTCTCTCTTTGATGCCTTCTCTTAGTTTATCAAGGCAATAAGACGGCCCAAATAGAGCAGCATGGATATGTAAAATTCA
TATCTGTGGCCCTAAGAAGTTTGGGATTGAAGTGTGGTAGTAGTAGTTGTTATTGTACTTGATTTTACAATGAGTAGACAGAGTCCTAACTCCTAATAAT
CAGAAAAGTCAATAAGGATTGACGACATCCATAGAAGTCGAGGACAAAAACCTAGTTTTCTCAGCGATGGTATGGTGTGAAGAACCAGCAACCTACCGGA
AAAAAATACCGGAGAAGATGACTGTTGAAACCAGTAGCCAAGGAGAGAGGTCAAATCCTTGTATGTCTAGAGATACAGAGGTAATTCACCAAAAAGGAGG
AGAGGATGCAGAGAGATATATTTCAGATATCAATGTATACAAAAAAGGAGTGTCCTTTGCTGACAGAAGGCATGTGTCCACAGTTGGGACCTTTTTCAAG
AGAGATTGAAGTGGGTTGGGGGTCCCAGTAGTAATAGTGGTGGACAGCTGGAAAATGGAGTTATGGAAGAAAGAGAAAAGACCCTTTCAGTTCATTTAAG
TGGTAGGCTAGATGGTGGAAAGCCCATTCCCTTTAAATCAAATGAACCGAAGGATAAAATAGATCCAAAAAAATTGGGCCCAGAACAAGAACAAAAGCTC
TTCACAGAGCCTTTTGTCGAGCTCATTAGTATTTCAAATTAGAAACATGTCGTTGTTCTAACTTCGTAGAATTCGAAGGTGAGGGAGAACTGGATGCAAC
AGGAGTAACGAGAATGGAAAAAAGGGAGAAAGAGCAGCACAATCAACTACAACCACATGCTAAAATTCAGGAGGAAGAGTGATCAATAAGGGAGGACAAT
CCAACTCAAATTAATGGAGAAGGAGAGATGGATTTTTCAAATTCACTCTTGGTTATGTATACAGAGCCAGAACCTTTGCAGGTTGACAATAGCACACATG
AGGAAGATTTAGCTGCACATGCCACAGAATGGATCCAAGCGAACATGATAAAATTAGGTCAACAATTTGGTGTCGATTTTAAAGGACGCAAAAAGGAAGC
GTATACCATGTTAGCTATGCTAGACCAAAGGAGGGAAAAGGATCCTGGAAAAGAGGAGAAGATGAAGACAATAAAATCTAACAATGATGTACCAAAAGAG
GTGAGAAATTTGTTCTTTAGTATGAATTTCAAAGACGGGGAACCAAAATCTAGTGGGAGGATTTTAGCTCTAACCAATCAATGAGAGTGAAAATAATCTC
ATGGAATGTGAGGGGGCTGAATGGGAGGGATAAATAGGACACTGTGAGGAAACTAATACATCAGTGCGAGGCAGATATTTATGTTTTAGTTGAGACAAAG
CTGGAGGATAATATTGATGGACTAATACCGAAGATATGGGAAAATAGATGGATGGGAGAAGTTCATAAGGAGGCAATGGGGAGCAGAGGGGGGATTGCAA
TTTCGTGGGATAAAAGGGTATGGAAGGGGGAACTGGTGGAGATTGGCAGGCAAAGCTTAATTGGGAAATTCATAGGGGTACGTGAAGAGTTTAGTTGGCA
CATAATTGCAACATATGCTGATTGTAGTAGAGAGATCAGAAAGGTTTGGGAGGAATTGAAAGCCATCAGAGGAAGGATTGTGGAACCATGGATAGTTTGC
GGAGATTTTAATGTTACTAGATACCCATCAGAGAGAACAAACTGCCGCAGACTTAGTGGTGCTATGACAAAATTTTCCTCTTGTATTGAGTTGGAGTTGA
TTGATCCTCCTTTATTCGGAGGATCTTATACTTGGAGAAGAGGGGACAATCAAATGAGTGCTGCAAGAATTGATAGATTTCTTCATTGTGCTCAATGGGG
GGAAAGCTTCATTCACATCAAACAAAATGTCCTACAAAAAATAACATCTGATCATAATCCTTATGCTAACATGTGGTGGTTGAGAATGGAAAAAATCTTA
TTTTAAATTTGAATCTTGGTGGTTGGAGGTAGAGGGATTCAAAGACAAGGTAAAGGAATGGTGGGATTCTTTTAACATTGAGGGGAGAGTAGGATATATA
TATTAGCTGAGAAAATGAAACTGTTAAAGGTAAAGATGAAAGAATGGAGCAAAGAAAACAAAGGTAACTGGAAGCATAGAAAAGAAGACATTTTAAGGCA
GCTAGCAAATTGAGAGAAAATACAGGAACACAGAACGCTTACTGATGATGAAATTTTACAGAAGGCAAATCTGGGAATGGAGTTTGAAGAGATAGCCAAG
AAAGAGGAGATAGCATGGAAACAAAGATCCAGGGTACAATGGTTTAAACATGGAGACAAGAATACAAAGTTTTTCCACAGAATCGCGACCTCTCATAAGA
GGTTCAATACTGTGGAACAACTTATGTAGAAGGTAACATTGTGAAAGATCTAGCTATGATCAAGGAGGCTGTCCAAAATTTCTACATAAATTTATACAAG
GAAGCTGAACACTGGAGGCCTGATCTGAACATTCAAGACGTTAATATGATAAATGGAGAGGAACAAGTATTGTTGCAAAGACCTTTCGATGAAGAAGAAA
TACTAGAAAGTATTAGGATGTGTGCTAAGGAGAAGGCTCCTGAACCGGATGGCTTCCCAATGATTTTCTTCGAGACTTTTTGGGAGGTTTTGAAGGAGGA
CATAATTAACACTCTTTCATAGTTCCACTTCAATCAGAATTTTGAGAAAAGTTTCAATGCAACATTCATTGCTCTAATTCCTAAAAAGGTTGGAGCTTCC
GAACTAAAAGATTATAGGCCAATCAGTCTAATAGGAGGGGTCTACAAAATCATAGCTAAATTACTGGCAGAAAGACTCAAAAGGGTGGTGAGCAAATTCG
TCAATAAAAATCAAATGGCTTCCATAAAAAGGAGACAAATCATGGATGCTGCATTGATAGCTAGTGAGTGCATAGATTCAAGGATGAAAGGTGGAGTTGC
GGGTTTATTATGCAAGTTAGACATCCAGAAAGCATATGATCATGTAAATTGGGCATTTTTGCTGAATGTTTTGAGACAAATGGGCTTTGGTAGTAAGTGG
CTAAAATGGATAGAAGTGTGCATTATAACAGTCAGGTTCTCAATACTAGTAAATGGTGAACCTGTTGGCTTTTTTGCATCAGAACGGGGGTTGCAACAAG
GTGATCCACTGTCTCCTTTTCTATTTATTCTAGCAATGGAAGGTTTTGAAAGTATGATGAGAATAGCTACAAAGGACAGGTGGATCAAGGGTTTCCAAAT
AGGAGATAGAACAAGGAATGGGAAGGAGATCAGCCATTTGCTATATGCAGATGATACTATCATCCTTTGTGAGCCAAAAGCCAAACAACTGAACTACATC
AGATTGATTCTGATCTTATTTGAAGCAGTATCAGGGCTAAGGGTCAATTGGGGGAAAAGCAGGTTGATTGCAGTCAAGGAGGTGCCTCAGACTCAAGGAT
TTGCAAGCATTCTAGGGTCTAAAGTAGAGAAGTTGCCGACAACATACTTGGGAATGCCACTATGGAGCAAACATAAAGTTTTGGTATATGGGATGGAATT
CTGGAAAAAGCAAAAAAAAAAAAAATTATCAAGATGGAAGGCTCAATATCTATCCACGGGGGGTAGAGTGATCTTGATCAACTCTGTTTTAGATTCACTG
CCTACTTAGGTTATGTCGTTATTTCCAATTCCTCCAATAATTATCAAAGAGCTGGATAGACTGAGAAGAAACTTCCTCTAGAAAAAAGGTAAAGAGGGAG
AAAGCAAGGGTTACTATTTAGTGAAATGGAAAAGTGTGATGCTAAGCAAAGAAAAAGGGGGACTGGGTATTAGAAATTTGAGAATCCAAAACAAGAGCCT
TTTGATGAAGTGGTTGTGGAGATATACTGGTGAGGAAGGAACCCTGTGGAAGGAGGTGATAGTGGCAAAGTATGGGGAATTGAACCCATGGTGTACAGAG
ATAGTGTCAGAACCCTATGGATGGGGAGTATGGAGGACAATCAGAGCTTTATGGAACTCTATGGAAGAAAATGTGTTGCTCAAAGTTGGAAATGGCAAAA
AGATTAAGTTTTGGAGAGATGGATGGATTGATCAAGTTCCTCTAAGTGAGTCATTCCCAGATCTTTTCTCAATCTGCAACAACCCTGAAGCCAGAGTATG
TGAATGCTGGACAACTCAAGGCTGGGGCCTATCTTTCAGAAGGCTATTGAATGATTGGGAAGTAGATAGAGTGGCTTCTTTCCTAGAAAAATTGGGGGGA
ACCAATCTAGTAACAATGCACCAGATAAAATTATTTGGAAGCACAACAGGGATGGCAGATTCACAATAGTGCTTACAAGAAAGGCATACAAGTTGGGGTT
AGAGGCTACTATCATCACTGGAAGAGTATTTGGAGAGGACTGATCCCTACCAAAGTGAAATGCTTCACTTGGTTAGTCATCAAAAGGACCTGCTTAACTC
AAGAAGTGCTGCAGAAGAAAGGAAAGCAACTAGTCCCTAGGTGTTTTCTATGCAATTTGACTGGGGGAAAAACGAACACCTATTTTTACATTGCAAATTC
ACTACACAGATCTGGGTGATGTTCCTCAATATCACATGCTGTAGCTGGACTATGCCAGAACACACCTCTGATCTTTTTAAATGTTGGATCAGAAGGGGGG
GGGGGGGTTGCAAGACTCAAAAGAAGTGGTGGAGGCTAATACCATCATGTATATGGTAGTCAGTGTGGAAGGAAAGGAATGAGAGATGTTTTGAAGATAG
ATCTAATTCCATTCACAAAGTAAAATGGAATTGTTTGGTATCTTTACTTTTTTGGTGTAAAAAGCTCTGTATAGAAGATGTAGATCAAATTATAGAATTA
TTAGGGAGCTTTTAATTTTGGTTAGGGCTGTAAATTTTTTGAAGGTGGCCAGCATGTCCTTAATGCTGAAGAATACAACTTTACCGATGTTAAAAAAAAA
GAGAATATAGGTAGATAGATGTGGCAGTCACTTAACCATTCAGCGCTGTATATTAACTTTAACACAGTGCGGGTTATGGTCTTTCCTTTTTCTTTGCAAA
TCCTATTTTGTGGACTATCTAATTGAATAGTGATGAAGTCTCGTGAGAGGTAACCTTACACTCAAACTAGATTTTATAGAAGTCTACCCGACATCCCCTA
CAACGGGAATGAATGGACTGTCTCTTTGTTGTTCCTGCTAATTAAGATTGTTGATAATTAGCATAAGAGAATCAAATTGATTCGTTAGGGTTTACACTCT
ACCCATATCACTCGCAATATCCTGATGATTTTGCAGCAATTGAACAATATGAAACAATGTTTGCATCGGATGTTGTTCTTGTATAATGCTTTAGCCTTAG
TCCGAGCTAGCAATAGACTTTGCAGACCAAAGAGGTTAAGTAATCTCAGATCAAGCTATTTCAAGAGGAGATCACATAGTTGTACATTTTAATCCATGTC
GCACGTCATTATACCTTTGATCCACGAACTGCAAATGCAGTGAAGTTGCCCCCAGAAGCAGAATCTTTAATGTCGTACAACTTCACAGTTGTAATTGTAG
GTGTTGAAAAAGTAGAGAGGGTGGAGAAAATGGGTTTCTCGACTATTTGTTTGCTAGTCATTTTACCCCTTTTTTTAATCAAATAACTAAACAAAGAATA
GAAGTAAACCAACTCAAGCAAAATAGGGAATACAAAATCAACTCAAAATTTTGGGAGAGACAAAAGAGAGAAGTAAAGTAGATATGAAGAATAAATGAGC
AATACCGAGTTCCCAAAGATGTTGAGGGGATTGAATGAAGCTGAAGATCTTGAGGACTCTAGTAGAGGTCAAAGAAATTACCAGCAGGATTCTAGGAAAA
TAAGTTTTCAAAGAAGAGGTGCGTATGATACATTAGGCAATTCTTACATTGGAAAGAGAGAGAATGTTGAAGTGCTATATAAGATAGAACACAAATTCTC
ATGCTTTTGGGCTCAATGATGGCATAGGCTAAGAGTCAAATCTGTGGGGTCTATCAGGCCAAAACGTACAATACATGTCATGGGATTGGGTTATGACGCT
AGGCCACTTGAGAAGTAGCTGTTGGGATTACTGAGAAAGACACATTATGGAGAAGCATTATAGTGGAAATACATGGGAGATTAAATTACAGATGCTTCTT
GTGTGTGGTAATGAACTTGTGTGGTCTTAACATCTTGAAAAGGTGGTTAGACAACTGTGGCACTTATTTACCATATTCAGGGGCACAAACTGGACCATGC
CACAAAGGGCAAGTCAGGCTATAGAAAGCTGGAACAATGAAGGCAGTGGTAGTACAGACCAAAGCAGATGGAAAATTGTCCCAGCAGTGATTTGGTGGAC
CATAAGGAATAAGAGAAATATGAGGTGCTTTGAGAGTGTTAGTAATCCTTTACACAGGATTAAAATGAACTGCACAATCACTTTTTGCTATTGGTGCAGT
TTGGAGTATGTAGATGATCCTATAGCTGTTAGAGATATCCTAGGTCCTTTGTATGATGAAGTAGGATCTAGTTTAGTTTTGTTTTAAGTACATGCAACTG
TATGTAGCTCCATGATGTAAATTTGGGACCCCACCCTTTAGTGCTGAAGATTAATACACAAAACTGTTACCGTTGTCAAAAAAACATCTTGGAAAGGAAT
AATTAAGGGAGGGCAAATTCGTTATAGTGTGGGTGAGCAGTGAGCTCATGAGGAATGATAATGAGATATATCGAATGTTAGTTTCTAAAGGATCATTTAT
AAGTGGGAGGAAAGTTGGGACTAATTTTAAAGAGAATACGAGTTGAGAGCATGAGAGGGGTGAGGATATGACCATTTGGAGGGATCTCGCTTCTAGAATG
TTATGCATTCTTGACATGGTTTGCCTTTGAAAAACAGTTTTGACGCAGATATTTCATGTAAAAGAAGTAGAATAATGGTGACTTTATGTTGTATGTGCAA
AGAGTATGGACAAGATACAGCGTATCTACCAGTACACTGCAGGGTTGAAGTACAGCTGTGGAAGCTAGCTAATCTTCTAGTTGTTTATCAGCAGTTGGGT
GTTTGCGCAGATTGTGCTGGCATAATTGCAAGCTGGAAGTTACAAAAGAGCGCGAGAGAGGACATAGGCTAGGAAGGCAGTACGTGTTTACCTTTTCTGG
ACAAGATAGAATGAGTTAGCAGATTGCTTCATAGCATACATCATGATATGAAAAATATTAGAAAATAATTTTAATTGTATTAAATACTTTTGGTGTAATT
GTAAAGAGATAATTCTTTTTCGTATTATTTACTGGCCTAATTTGATAGATGGGTGAAATATGACATGTAACCTTATGTTGTATACTTTTTCCATTTTCTC
AGTGCGTTAAAAAAACTGAGTATATGACCTATCAAAAACAAAGAAAATCAGTTTCAACGGTACAAGTTATAACTGTTCAGCAGGCTTCTTTGAAGCAATC
CATTCAGTTTAACAGAAATGGTCTCATTCCATTTTAGTTAATGAAATATGAGTCTTCATTCTCAGAAAATAGGAGTCTTCCCCTTCTCAATTTCTGTTTA
AAATCTTCTCAAGTTAACTCTATCTCAAAACACAGTCGTTTATGCATTCTTATTTTGTGCTTATTTGTTTGCTTTCAGAAATTTCAGAAGACGAAGCAGA
AAATCTATTGCAAGAGGCTATTCAAGAGAAGTTTGCTGTGTTTGGTGATGTATGATAGTTACTTAAATAGTTAATTTTCCATTATCATGTCAGTGACTTC
TGCTTTTCAATAGTGTTAGTTAATAATTGGTATAGAGATAGGTTAGGAGTATTTACGGAGACTAGAAGCTTTTGGGCAGAAAAGCCCCGGGTGGAATAGC
TGAGCTAGCAAAGGACATGGCCATGTCTTCTCTATAAGTTGCCTTCTGGGAAAGAAAAGTTGATTGATTTTTTCACATGAATAGTGATGAGGTAGAATGG
AAAAAGGGGAAGGTTTTTGTTGATCAGAAACCAGTCGAAATTTCATAGATGGAAGAAGGATGTGCTAGATCAAGATACATTTTGATGTATGAAAAACAAG
GTTTAAGTAAACAAAAGTAGAAAGAGATGCATCACAATGACTTGCTGTACATGGTCTTCATTTTACTTTTTTCTACTTAGAAAAGAGTTGTCTTAGGCAT
GACATTTCAACTTAGGAATAATCCAACAGTCCGTAGAATTGTTTGAGTATAAAAACTATTACAAGTGCTCAGTCAAGTAGAATGGGCTAAATTTTTAGAG
CCTTATTTCTTGGAAATTCAAAATCTGCTTACCCTGCTTCTGCAAACAAAAAATAAAAACTGGTTACTGATTCTCACTTGTCATCTAACTATTTTCTTCT
TGTTTTGAAGATCAAATGTTTTATCTTCTACCCCTTTCTACTTTTGAAAAGTAGAAACTTTTATGAACTCCCCTTTCTATTGTCTGCATTTTCCTTTTTT
CCCCTCTTTTTCTTCTGATTTGGGGGTGATTATGTTGTCATTGAATGTACGAATGCTAAAGTCTGATATTGGCTGTTCTGTTATGTAGGTACAGAAAGAT
CATCAAGCCATAGATATTCTTTTAGCTGAAATAGATATATATGAACTATTTGCTTTCAATCATTGCAAGGGAAGGAAGGTCAAGCTTGCTCTTTGTGAAG
GTACCCTTGTCATTTATTGTAGAATCCTGCATAATTCATATGAAAATCGTTCAGTTTGACCATCTGACTATCTACGTATCCAGTGTTGATTTTGTCTAGG
TTTCCCTGTTCTTTTGGAAAGTTTCAAACTTTTTTTTATTAGTTTATCTTTATTTGAGGAAATTCATGAGTGTTAATCATCATACCAGAGCTTGACGAGA
GAATGCAAGATTTGAAAAATGAGCTGCAATCTTTTGAGGGTGAGGGGTCTGATGAAAGCCATAGGACAAAGGCTGTAGATGCACTGAAAAGGATGGAGAA
CTGGAACCTGTTTAGTGAATCTTATGAGGTATCTTACTTTTGCTAAGTCGTATTCAGTAACTTCTATGAGAAGGCTAAACTATTGTTGCTGTTTTGATAT
TGTTCTTTTGTCCGAAAAAAATTGCCGTTGCTTGTAGTTGCATTGTTTCTTTCACATGGGATGATGATAATACATAAGAATGATATTGAATATCAGTGAT
CAAAAACCTGGTCATGCAGGACTACAAAAATTATACAGTTGCTCGTGACACTTTCCTTGCACATTTGGGGGCAACCTTATGGGGGTCAATGAGACACATC
ATTTCTCCATCACTTGCTGATGGGGCATTCCACTACTATGAGAAAATCTCTTTTCAGTTATTCTTTATCACACAGGAGGTATGATGTTAATTTAAATTAA
ACTAACGATATTGCTTTGTACTTACATAATCTGTGTGTTTGTGCAGAAATTTAGAAATATTAAGCAGTTACCTGTTGACCTCAAAACTATCATGAATGGT
CTTTCATCATTGGTCCTATCTTCTCAGGAAGTGATGTTCAGTCCGCACATGTAAGCATTTGGTTCATTCTCTTATTCATTGGTCCTTCCAGATACATATT
GTTCTCTATATATGTCTCAAGCCAAATGTAGGTTAGTTATATGTTGAGTTGTAAAGGTAAAAGTGTTAAATACAGATATTGTATTGAATGATTATCCGCT
TAAGTGTATATTTTATTTCTGCTTCATGGATTTAGCTTACTCTCGTCTTTAATTATGTGTTCTTGTTCTAAATATACCCTCTGGATACGTGCCCCTATTT
ATTTTAGTCTGTTATGTTTCACAGGTTGCCGCTGTCAGAGGATCCTGCTTTAGCTATGGCGTTTTCAGTAGCCCGGAGAGCGGCAGCTGTTCCCCTGTTG
CTTGTGAATGGAACGTATAGGAAAACGGTTCGTTCCTATCTGGATTCCTCCATTCTCCAACATCAGTTGCAGAGATTGAATGATCATGGTTCTTTGAAAG
GTGAGCTTTTGTGATCACAAGTTTATAGTAGTGCTTGTTGAGGTAGAAAAAACACACGGCCAACTCTCCTTAAGTCCGACATCATTTGAGAGGGAAAGAA
GAGACATCGAGGGTGATTAATTAGAAAATCGAAGTCTTTGTTTTCCTCCCTGTAGATTTATATTCGGGGTGGGCTGGAGGATAATGAGTAAATCTTATAT
GGATATTAATTATCTTAGTAGTCATTTGTTTTTTTCCAACTTGTACTTTAAGGGGTCGTTTTTTCTGAGGATAAGGGGTAATAATCCCAGGATAAAATGC
TTATTTCACCCTGTGTTCATTTAGGGGTATTAGTTAGCCCCGAGATTATTTCTTCCGCCATTTGTACTATAATGATGGGATAAGTTATCCCATATATATG
ATGGGATATCCGATCCCATGGGATAACTTTGTCTATCCAATCCCCCATGCCAAACAACCCTCAACAAAATATGGTTATTCTTTGTCCATTCTTAGTTCTT
ATAACCATTTGAAGTGAAATGAATTCTAGATATGCTTGTGTACAAAGTTATTAGTATGTAACAATATGAAGATTTTGAAGGTGAATAAGGCCTCATTTTT
GTTTATTAAAGTTGAGACATCTGTACATATCTGATTATTATGATGTATATTAAGATTTGAGATGTTTGAAACTAGATATACATCTTAATATTAAGATGTT
TATTAAAATATGAATACTAAATAATTAAGATGGTTTATTTTCTCTACGTCTGAATGCAAAAAATCTTGTCTCTGTTAAAAAAATAATAAATATAATATAA
AATACTAATTTATTTAATACCATATTTTGAAAATATTACATGGTGGTCCATAGTTGCAATAACTTATGGTGGTGGTTAGTGGTGCTGTTGGTTGATGGAG
TTGATACGTTGTTAGCCTATAAAGTGGCGGAGCCAAAACTTTGATTAAGGGGTGTCAAAATATAAAGAAGTAAAACTGTGTAGAAGTCAAGGAGTGTTAA
TATGTAATATATATTACATAAAAAATATTTTTACTCTAGCTACACAGTGTAATTTCTGACAAAGGGGTGTCAGTCGACACCGGCTCTGCAACTGAGCCTA
TAGGGGTGGAACTACAGTGTCAGCTCCGTCTATCACTCTGTCAGAGTCGAAGGTTAACTTCAGCTAGATTATCTGTAAGGAGAAAGCAAGAAGGAGCAGC
GTCAGTCACACTGACATATTGGTTAATAACCTCAACCACAGCTTTATACCTGGAACAAGCATATGTAAGAAGTCATGCAGTTCAGAAATCATCAACAATA
ACTTCTTTCAATCAACTAAGCAAATTCATGTATGAAAATTGTATTCAAGTTGTTTGAATAATCACATCGTTATCTATTGGGAGGATCCCTAGGATCGAGT
ATACTTTCTGACACTATGGATTTACCATAGCCGTCTTACTACCCCGTCAGTTAGGTTCCCTTCTGGAGGGTCTTTATAGTTTATACAACATTAGTTTTTC
TTACCAGGTGCACCAGGTCTAACAATCCCAACATTAGATAACAATGAAACTGACAAAGTTAACTTCCTGATATAGTTTATTCATAATTCCACATATATTT
ATATTCTTCTTGTGTCATCTTTGAATCCAACAATATATAATAACTCGGAAATAGCATAAATTCAAGAATATTTATTTTTTATTTTTTTTGAGAATGGTAA
CAGTTATATATCCACAGATATACTACAACAAAATATGTAGCCCCCCTTCAAAAGTATTACAACTTACAGCTTGAACTTCTATCTCTTGTTCCTTAAACAG
TCTAATACGTCAAAAATATCTTCTGTTTGAGCTATTAATTTCTGTTTACACCAAAAATAAAACAGAGCTAAACAATTTTTTTAGAACTCCTGCAAGTTGC
TCCGGCTTGTCTTCAAAACATCTCCTATCCTTTCTTTCAACATTGTCTACAAATGCATGTAGGGATCTTCCATCTTTCTTCCTTTTTTTTGATAACCGAA
AAAACCGTCTGTGACCCGCCCTTTGGACCAATCACAGCCTTCTAAACTCGGTGGATTATGGGCCAGCCCCTCTACCCTTCTCCACTTAAATACCGTACCT
CGCTTTGCATGGTGTGGCTTGAACCTGCGACCTAAGCCACAAATCCTCCACCTTTTGCCACTCAAGCTACGCCTTGGGGGCCATCTTCTTTCCTTTTTGA
CTGCATTGCCATCCTTGTTCCAGCAGTTTAACTATCCTTTTATGTTCCCTGGCCTCACCCACTTGGTCCTCTGCAGATAAATGAGTATCTTCCGCAACTG
GAATGTGCAAACTTCCTATAGTATCTTTGTAATAGCCTCCCCGTTAGCTTTGTTTTCCGGGGAGGCACTACATCAGTCATCAGTTTTCCATGTATGTAGA
ATGTTTCTGATTAGCCTCCTTTTTATGCCACAATTTAGCCCCCTAACATTCCAAGGCACAAATTCAAGAGTAATTAGTATGTAAACTCATGGTAAAAGTG
ATTTAGTACATTTCAAATATTTAATCATATTCTCGCTTGTCCATGAGAAAAATGAACTTTTGGATTAATCATTTCAATGCAAAATACAAATAAAAAACAT
GCTATAGTTGAAAATTGACTGTACTTCCGCTGAAATAGCTGAAACCTTGCTTCCAATAATTATGTTGCAAAATTCCAATAATCTAAATTCACGACATAAT
ATTTAGATCTTATTTATCCCAAAAACTCATGATTTATTTAAAGACCACCACCACCACCATTACTGTTTCAACCTAAATTTTTAGCTTAAGAACATGATAT
CTTCAATCTTTATTAACAGGTTATGATGTGGAACTTTGAATTTACAAGAAAGTTATTATCCCCTAATTTTGATACCAAATTCAGCTTTTAGGTTGTCTTC
CCAAAGTTGGAACTCTTAAAAGAAAATTTCAGATTTTATTTAATCCTAAAAAATCCCAGTTGTTAATACTACTTCTCCTAACCAGAGGATGAATTCATGG
TGAATATGTATGTCAAGAATTTGTAAAAGCAATCTCAAAAAGGAAAGACCGAACTTGTAAAAGTCAAGAATGGAGAGAAGTGGTTGGGTGTCCTCAATTC
TGATTGTCTCTGCTATCCTCTTCATTTCCCCCCTTCTCTCTTCTGTATATCTCCTTTCCTCTCTTTTTTTCCCTTCTGAAAATCACTGCTGTTGGACAGC
TTGGTTTGAAACCAGCAGTGCTACTTCTTTTTTTTTTTTTGGATGAAGTCCAAAGATTTCATTAGAAGGCATAAGAAGATGCTGGGCAAAAAATTACACC
AAAAGAAGGGGTCTGCTTCTGTACGAGAATTTACTAATAACTTAAGAGCAGACATAGTCCAAAATAAGTTCAATAGTGGTTACGGGGGTCTGCTTTAAGA
AGACCAAACAGTTTTATTTGTTGACTGCTTCTTCTCCTTTTTTCAAAAGCTGCAGCCTTTTCTCTCTCTCTCTCTCTCGCTCTCTCTCTCTCTCTCTCGA
TTACTATTTAAAATCATTATGGAGGTGGTTTTTAACTTAGGACTTAAGTTGTTTAATGGCTTGAGGTTGGTATTTTAATTGGTTAGTTGTTTTAAATGGG
CAAAGCCCAATTCTTTAAGTCATTATATGGTGATGGTGATTGAAAATAGTAGTTAATGGTGGGGGCGGCTGATAATTGTGGTGGATCATTATTGTAGCTT
ATGGTTGTGGAGACGACAAATAATGGTGGTTGATGGTGGTGATTGTCAATAGTGATTGGTGGTTGTTATGATATAGTGGTGGGTGGTGATCATTGTAATG
GTGGCTAGTGGCAGTGTCAGTTTATTGTGATGATTGGGGGCAGTGGTAGTTGATAAAGGTGGACAATCATGATGATTAACAATGAAAATGGATGAAGTAG
CGGTGAAATGCCATCTTTACAGAATATATGAAGCATAGCATCTAGTGATATTAATTTTTTATTATAGATCTCAACTATTCAACTATATTCAGATCCGTTA
AGTGGTTGTAAAAGAAAAAGTACAAAAGCACTTAATGATTAAGATTCAAATCTAAAAACACACACACATAATGGTTGACTTAGATCTAAAGGATTAAGAC
TTGATTAGACCTTCAGTAGCTGCAAACGAGGCTTAAGAACAATTATATAATCTTGTTATTTGTTTTATGTGATGGTTCAAGAGCCTTTAAATGCTCATTC
ATGTCTGCAATCCTCTCCGCCCTCTCTTCTTTTGGGTTTTAAGCTGGTTAGGGCTTGTGTTTTGCAAATTATAGTGCTTTGATTTCCTTCATACTGCAGG
TTCACATGCACATAGCAGATCTACCCTTGAAGTCCCTATCTTTTGGTTTATTCATAGTGATCCCTTGTTAGTTGACAAGCATTATCAAGCCAAAGCGCTT
TCCGATATGGTCATTGTGGTGCAGTCAGAAGAGCCATCATGGGAGAGTCATTTGCAGTGTAATGGGCGGTCTCTCCTGTGGGATTTAAGGTTATTATTTT
AATGCTTTTAAGATGAGTTTGGATTAAATATTGCAACTTATTACATACATTTTCTTTTTTATTCATTTACCTTTAAGAATTTGTAAAAGCTTTTACTTTT
AGATGCTGTAGGCTTATATTTTGCTAGTTTTTTTTACAGAAAATAAGCTAGTGGGCTTCTAGAGATGTTCTGTAGTTCCTCACTTGAAACTAAGCACATA
TTATGGGCTGAAAATGATAAGGAAATTTGTTGGTGGAAAGATCTGAGTGGTGATGGCCTAGCAAGCATGCAAAATATGGAAGGTGAAAGTGATAATTTTG
ATGAAAAGAGGAAAAAAATAATAATAGCTCTAGAGCACTACTCCTTGAGCCCTTAGGGATTACATGAGAAGGTAGAATTGCATGGCTTCGTGATAAAGCA
TTCTTGTTTAAGAAAATTAAGCATAAGCATGGTTTTATTCTTGATTCCCTGACCCATTCTACTTCATAAAGGATTTCACATACCGACTAGAGATGAACTT
TATTATGTACGGTCTTTAGTCCGAGCAAACACAAATGACCGACTATGACTAAACTTCACAAGGTTAAAAGTTGCTATTTCTGATGAGATCTTCTGATTGA
AATTTAAGGTAATGGGAGAGAAGGCATGCGACAGATAACTAAGTTAAGCTACAGACTGGGTTCTACCTTCTAAAAAAAAAGAAGCTATAGACTGGGTTCT
CACTATACGCCGGTACCTGCTTAATGCGGGTACATTTTCTTTATTTTGAAATTGGGAGGTAGAAAATAAAGTACTTCTAATAAGACTCCAGCTATGTTAA
AGTTCCTTTTTTTGGTGGTTGGGGGTGGGGGGTGGGGGGTTGAATTGTTGCAGGAGTTTCTCTCTGTAACTCTTTTATCTTTAGTAATCTTGTGCAATGC
ATCATGCATATTTTCTCTTATCACATGTCAAGACTGAAGCATTACTCATGACACTCGTATTACTATAATCAGCTCATCTTTGATCTCAATAGATCGATTC
CACCTAACTACTTGGGTCGGCTATATATATCCTCTCCATCAATTCCTCTTCATTCAGGTCAATTTCATTCCAACATTAGTAGAAAAATTTCTTTTAAAGC
AAACAAGGTATTCTCTAAGACTACATTTCCTGACTCTCACACTTATCTTGACACTAACATACGGTCTTTAGTTAGACATAAAAGGCTCGTGGAAAATACT
AGACCTAATATAGGCATACAACAACAATAAACTCTTAATACTCAATGGTTTCACATGTATGGATTCCTTTCCTTGTATTGTGTTCTTAGTTAATTCCGGG
TTGATTTAGAGATACAGTTGATCTTTTGAATTTGAGACAACTTACCTCCATGTGATTTCAGGTTTGTTGTTCTTTCTTTAGCTTACCTGAATTCTCATCT
CAAAAGAACTCTATTTTGAGTGGGATTTGATGGTTTTTTAAGATATTGTGGAAATGGACAATGCTGATCTGGCATTTGCTTTCTCATCTGTTATACAGGA
AGCCTGTTAAAGCTGCTTTGGCTGCCGTGTCAGAACATCTAGCAGGAATGCTTCCCCTTCATCTTGTTTATAGTCAAGCCCATGAAACTGCAATTGAGGT
ATTGGAAGACATGAATGTGAATCTTACAATGATCTCACTCTGACAATAGAGACTTGTAACTTATTTAGGTTAGGTGTCTATAGACTTGTAACCTGAAAGT
TTCTAATTTCTTGCATGTAATTAACTTCTTCTGAGGGCTTGCTAACTTCTTGAGCGTCTCATGCACTTCTCCTCTGCAATTTTTTTCTTCTTGCTTGACA
AATTATTTCTTTTGGTAGTGAGGTAGGATAAGCTCTCCATAAACAAGAACACTATTCAAGAGAAATTTTTTTCTCTTTGCCTCCTTGGAACCCAACTTTT
AAGATCTAAGAAGTTTGTCATACTTTTATGTTTCTAATTATTTTCTTAATTTGTTTCATTCTTGTGAGAGACCAATAGATTTTAGTGAATGCTTTCTTCT
ACTTGTGATTCTGTTGAAGCTTATATGTGACTTCCATTAAATTAATATTTCTGTGTCATTTCCAGGTACCCCTTCCAAAGAATGTATTAATAAAAATGCA
ATAAAAATAATAAGAGAATACTTCATACTCTTGTATGTGTTACTGTACTTGATGCTTTTCCTTGAGACAGAAGTGATAACATGTGTCTGGTTTAACGTGT
TACATTGAGATAAAACGCTGGTAATTTAAGTCTGGTTTCTCCAAGTCACCTCTGTTCGTCTCATTACACTTTAAACAGGACTGGATCTGGTCAGTTGGAT
GCAATCCTCTATCCATCACTTCCCAAGGCTGGCATATCTCCAAATTCCATTCAGACACTGTTGCTCGAAGCTATGTATTGACAGCACTTGAAGAGTCTGT
TCAATTGGTCAATTCGGCTATTCATCGCCTTGTTATGGAGCGGACATGTATCCTTTATGAATGTTCTACTTTCATAACTACAAGTAAAAGATTGTTTTGA
TTGCACAATTTGTCACTTTTGTGAGTTGTCTAATTGAATATATTTCCTGAGAAGGTTTTGCAAGTTGTCTTCAGCAGAGTGCATAAAAGATTTATTTCTC
TGTTTGAATGCTGACTGTCATTGCGAATACTTCTTTGGTATTAGCCGTCTCATGACATGGGACTTATCTCAATATTTGAATATGGAAATGTCTGTCTAAA
ATTTCCAGTTGGTCAATAGGTCCTTTGGGTTAATAGATTTTAGCGCTTCTTTTTTGTTGGTCTGGATAGTGGACCACTAGTTTCATACTTTCTTCATTAG
TTGCTGATGTTTTTTCATATAAGTTTGGTAATTGGGCTGTTATCAGATTTTCTCCGTGGATCCTTAATCTGGAACAGCAGAACAGACTTTTAAGCTCTTT
AAAACCCACGAGCGCGAGTTGGTGAACAAATACAACTATGTTGTTAGCTTGTGGAGAAGAGTAAGTTCTTTACAGTTTTCACCAATCCTTAAATAAGTAC
ACAAATATTTTTGCCAAACACTTGTTACACTATCTTTTTTCCAGATAAATAACGCTTGGTGCATTATCATTTTAAGCTTGATAGAATGATTTGTTTCTTA
TTTCAATCTAATTGATCTGCATGAAACATTTCCTGACCAATTTATTCCATGTTATGGGTCCCTCGCAGATTTCAACTGTCAGTGGGGAACTGCGTTATCT
GGATGCCTTGAGACTTCTCTATACCTTAGAGGATGCATCAAAAGGGTTAGCATCTGACATTTGTTATGTTGCTGATATTGTGAAAATCATCACTAGACAC
CCTTATTGTTGGTGTTGCACTTTTACATGTGCAACCAATTTGAGATAATAGAATACGGTCTTTCACTGCATTTAGAAGTGTTAAGCAACTTCCATTTGGC
ATCCAAAAGTTCTTCCCATTTCACTGTAACATGTGTTTAATAAATTTGTTTGCTAAAAGTCTCCTCCTATGCAGGTTTGTAAATTATGTCGATACAACTC
TAGCAAGTCTCCATCCAGTACATTGCACCCGTCGAAGAGAAGTTAAGGTCGAGTTTGACATGACAACAATACCTGCTTTCCTCGTTGTTTTCTTCGTTCT
TTGGTTTGTGCTAAAGCCTAGAAGAGCCAAGCCCAAGATCAACTGAGAGTTTCGTGGTTGGCATGCCTTGAAAATGCGTGTTAAACTTAGTTTCCTCAAG
CATGATTTCCCCTGCTGGGGAACTCTGTTGAGCCAATAGAGCTGTCTTACGCAACACTGGACTAGAAAGCATAGGCAAGATAGGTAGAATAGCTAGGTCA
AAATCATAGTGTCTTTGCTTTGTAAATTTTCACCTCCCAGTATTATTACAGCTGAGATTTTGCTCGGGATCATCAAGTCTTATTTTTTCTTGTTAGTAAC
TATTGTAATTGTGCTCAGTGCATGCCTTAATACTGTGTACATCTCAACAAATGATATCATTGGTTACAATTTACAATAGCAATGTGAACTTTACTCCATT
TAAGATGATAGCAAAGGCTGCCTGATGCAGTCCATGTTGGCTCCTAAGAAGAGCCCTTAATGTAACTGGAGGAAAATACTCACCATTCTTTGCTTTTGGG
TAAAATTAACTAGTTAATGCAGTTTATCAGTGTCCACTTTTTCCTATGTCCTATTTGATAATTTCTTAAATTGTTAGAGTACATGGATTGAACTCTCCGG
ATTCAGTCTTACACGTCTCTCTTGAACGTTTATTGTTCCCATTTGATAATGTTATTTCAGCCATAGCTAATCTAGATTTTTTTTCAGTTCCCAGTGATAG
AAAAAGAAGGTTCAAAGATATTGAGTCTACGATAAGTAACCGTAGCTTTCCTTGTTTGGATATTTGTTTTTCCAACTAATAATACTAAACAGATTTAACT
TCTATACATTGATAAGATAACATCTTACATGATTAACGAAATTTGAGGTTGGAACATGATACTGTAAATAGTACCAACATGACTTAGAGAGCTGTGTCTT
CAATAGATTTCCCTCCAATGTGGAGAACACATTAACATAACATAGTAATTGGTATACGATTTCCTATACAGAGACATGATCAACAAGCTCACGCCCCTTG
GTCTCAACTGGAAAGAGCAGAACACTAATTGCTGATAAAATAACAACCACTTCAAATAAAATGATTGCAGCCATCTGGTGGCAACCTCTAACCAATTGCA
CTGCAACTATAGGAGAGACCATCCCTGCAATTCTCCCCACAGCACTTGCAACTCCACAACCAGTTGATCTAACTGAGGTTGGATAAATCTGCAGAAAATA
GATCAAAATGACACTTAGGCCTCCTAACATAAAATTCTGTCATTTGTCTGAAGAGTTTGTTCCAATCTACAACTTTAGATGGGAATTTACTAAAATGTCA
GATTAAATGTTTAAAACCTTTATATTCATACTTCAAACAAGGCTATGACAGGAGTAGCTTGATCCTCTCACCCTACCAAAGGTTCCTCAGCCATCAAAGA
AGAACAGGTAGAACAGGCCAAGAGAACCTCAAAGCTAAAAGAGCTTGGAAATTGGACTAATCTACGTTTATTCCTCATTACAACCTGAAAACTCAATGTA
TTTACCTGAAGAAGATCCACTATGATATTGATAGTTTATTTATATATAAAAAGGCAAATGGTTCTTAAATTGTGACAAAATTGCTAAAACTGATCAGCTT
TAGTAACCATGTTCAGTCTTCTCTTTAGAACTCTATGCTAATACAATCAAGTATCTGTAAAATACGTGCAACAGCTTCAATAAACAAGGGAGCCAGCCCT
AATGTCCTAAAATCAATTCGGTTTGCAAGTCAATACACCCATAAAAAAAAAGTCGATGCGCATAAAGATTCATCCAGTAAACAGTTTGAGATTCCCAGTA
ATGAACATAAATGTTGTTTGCCACGTCAAACAAATAAAACACAGTTCCAGTGGAAAAAAAAAACTCTTACAAAGTCAAACTTTTAATATGTGAAAGGTAG
AAGTTCAAAATTCTCTGTTCAATTGAATACATGAAACACAAGGAATATCTATCTATCAAGTTTAGACTGGTAGGGATCAAAATAAGTTGACATGTCAAGA
CATTGAACAAGTCAGAACAATGAAGCTAAGAAAGATAGAAGGTAAAGAGTGACACTCACCTCTGGACAATAAACACCAGCAAGGGTGAAGGTCCCTATGA
ACCAGATACGAGCTCCAAATAGCAATGCTGTTGTTAATGCCTCATTCTGAGGTACAACAAGCGGAAAAAGGAATAGGGACCCGAAGATATACATCAGTGC
CATTGAATATTTCCGACCAACTTTCTCCACCACTACAGCTGAAATAAGAAGCCCAGGAAGCTCTGGAAGACAAAGAATAACTTAGATTTACAAATTGTAA
TTAAGTCTAATGGGAGCTGAGATGAAATAATTGAATCGCAATTTGACACAAGAAAATGAAAGAAAAAGTACCAGCAAGGCTAGTGATGAACACGTCTGTA
TAGAGGCTTGAATCATTTTTCACATGCAAAGCAACTGAGAAGCATCTATTTTCCCCAGCACTAAACTGTGATGTCAGCAATATAATGCCATAATAGGCAA
ATGAATTTCCAAAATAAACCACCCACATGAGGAGGGTAATTCGTAGTAATTGTGGGGATAAAAGCATCAGGGATGAAGACAATCCTGTCTTAAAATTGAA
GATTTTGTTGGCTCTCGGCCTAAGCAATTTCTGTTCCTCATCCAGCTCTATCACTTGATCAGAAACAAGCATCCCAGGGGGAAGTTTTGTCTGATTAACA
ACAGCTATTTTCCTCAAAATATCATGTGCATCAGTTATTCTACCTTCGGCACATAGATATCTAGGAGACTCTACAGTAAAAATGTACAAGAGAAAAGCTG
CAAATGATGGTATAGACGATAAAGCCAATAACCATCTCCAACCTAGTCTTGGCATGATAATCTGCAAGAAATACCAAGCAAGTTGCACTAAGTTTTTCAA
ATATTACAAATATAGTAAGATATAGACTCTTCTTTGTTTTCATTTTTTTCATTAATTACTAACTGTTTGGGAGCACTACAAACTGTCAACAATAAAAAAC
TACAGAAAATGATATCCGATGAAGTGATAATAATCAAGTAAGACAATTCTTAGTTATAACCTAATCATTCTCTACTGAAGACTACATAACCACAAAATGT
GTGGGAGCAAGTGACCAAGCACAGCTTATCTGGTTCATCACCTTCTATGCACTTACAGTCGTCTATGTTCTGGTTCAGCTCCTCGAATTCTAGGGCAGTC
AGACCAATTTAGGAGAATTGTTCTATGTTTTCTGGGGTGAAACTTTTCTAACCCCCCCCCCCTCCCTCCCTCCCCATGTTGTTTCTTTGAATTAAGTTCT
ATTTGGGATTTGAGACCTGCCTTTTCTTTAGGGGTATAGACGATGAAGCCAATAGTTCATTGGTGACACATAGGTGTTTAGTCCTATTGAGACAATAGAA
CAATTTAACTAGAAGTTTTTAGAGAACTCCAAAACTTCTAGTTAAATTGTTCTGTTGTCTCAATAGGACTAAACACCTATCTATCACCAATGAATCACGG
TTATTGGCCGCACTCTCAAAGAAGAACTGAAATTACAGATATAAGTAGAACCGTTAATAGAAAATACTTCAAATAAATCAAAGATGAAAGAAGTGAAATG
CATGTACCATGTATATATAAATGTGTGTATATCAATGTTACCTTTCTCAAAAAAAAAAAAAAAAGTGTGTATATCTCATTTGTTTAAGCAAACCCTTCAA
AAAAATGCAATCAGGTATTGACAAGTTATTGTTTTATATGGATAGTCTTTGAAAGCAAAGAGTTCCATTCAGAATGTGCTTATACCTTGGTTCCAAAATC
TCTTAAATCTTACTTGACACATGGATATTAATGGTTAAGTATCAATGAGGCACCGCAAAGGCGTACTGTCAATTATTCATATTTAGAAGAAGATGAAAAT
TAACAGTGGAAAGAAATCAGACTTTTGTGACTCGAGATTGTTCCTTTTTCCTGTTATTCTCTGTTTAGCTTCTATTGACTTCCACAGAGTATTAGATGAG
TCACACGATCATCCTATTCCTATTTCACTGATTAAAAAGAGAGATGTTTATTCCACTTTATACTTTGGAGAAGTTTAATATTCACTTTATTATGCACAAA
TTGGATCTTATTCACGTATAAACGTTTTCCTACATACATTTGAGAGTCGTTACTGAGACATCTTAATCTAAGACATTGTCTATACATGAAGGATCTGCCA
CATACAGATGATAGGCCTGTAGTCATTTTGGAGGTCTGTACATATATATAGCGGAAAGTAACAAGATGGGTCCTAAGACCTGCTATTCCATCCTAATTGA
AGCTCATCTGAGCACAAGTTCAGCTTGTATCTATTACATCTTGTCTTCTTTTGCAGCAAAGCATATTTTCACTAATCTTGCTCCTCCTCTACACGAACGC
CATTATTTTTTATGGGAGTAACTCCTTCATGTTGTCTGCTCTTATTTGCAAGCTAGAATCACATTTTGCTATGAAAGACTTGGGGCCCCTGATTTTTTCC
CTCGGCGTGCAGTTCATCATGACAAGGATGGCCTTTTTCTTAGTCAGCAAAGTATGCTACTTCCATACTTCAACGCACAAAATATTCCAGCTGCTCGGGC
TCATCCCACTCCCCTAAAAAAAGCATCAGCTTCATGGCTTGGGTGGTACCCCAGTTGATCCCTACGAATATTACAGCATTGTTGATGCACTTCTGTGCCA
AACATTGACTCGACCAGAAATCTCCCATGCAGTGAACTTGTTTTGCCATTCATGCAGTGAACTTGTTTTCCCATTCATGCAGTGAACTTGTTTTGCCATT
TAAGCAGCATCTTACTTCGCTACATTGTTGGAACTTCACACCTAAGCCTGCGCATTTCTGCTCAATCCTCTCTTAACTTGGTCGGCTTCTCTGATGCAGA
TTGGGCTGGTTGTCCCATCATTAGGCACTCTACTACTGGCATTTGTGTTTTCTCTGGTAATCAAAGAAGCAACACAGTGTAGCCAAGTCAAGTGCCAAAG
CTGAATATCGCTCGTTGGTCTCTTTAGCTGCCGACTTAACTTGGATCAGTTACTTATTGTGAGACATTGGCATTTCCCTGCCTCAACCCCCCATGTTGTT
CACATACAGCATTAGTGCCTTGCATGTATCAGCTAATCCAGTGTTGCACACTCGTATGAAGCATGTCGAGCTTGATTACCATTTTATCCGCGAGAAAGTT
ATCTAGGGAGCTATGGTGATCAAGTTTGTTCAGTTGCATCAGCACATTGCCAACATTTTTTCACCAAACCACTGCCCAAACATCGTTTCAGCTACTTCGG
GCCAAGCTTGGTGTTACTGCTCATCCCACCACCAGCTTGAGAGGGGATGTACGACAACCAGGTTAATTAGCGATTCTCTAGTCTAAACCTAACAATTAAC
ATGTACGTGTAAGAGAGCTGGAAGGATTGGTATATATACAATCCTTGTAGAACACAATTATCAAGCAGCCAAAAGGACTCCTCTGCATGTCAATCTGTAT
GTATATAGTCCAACATAGTAGCATGTAATGGACAAGAATTAGATATAGAAAAACACAAGTTACAGTGTCTTCTAATTCTTATTTTATTTACAAATTATAT
CTTGTTAAAATCCCCATAAGAGGAGAACGATTTCACAATAGAAAGCCAGTACATAAGAACAGCTAAAGGACGTACCAGCTTCCACTTTTTTTTTTTTTTT
GTAAGGTAAAATACACAAGCAAAGGATGTACCATAGCCAATAAAGCCTCAAGTATTGTTCCAACTGTCCAAAAAGTTGAATAGATAACCATCCACATGCC
CCTATTTCGAGAAGGCACGAATTCTAGAAACCAAGATCCATATACAGGCCCACCACCCAGACCGGTTCCAACCAGCATACGAAGAATGAGCAGTGATATA
TAGTTTGGAGAAAAGGAACTCAGAAATGCAGATACGGTTGTCACTATTGCCACAATCAGAAGACTTTTCCTGGTGATGGAAAATGAAAGTGTATAATCAT
CCATGACAACTTAAACCAAACAACAATTAAGCAATCTACAGACTCAAATATGATCATTCACAATTCACCCAATCTAAAAAGAAAAACACAAACATAAACT
TTTTCAATAAATATTAAAAAAGGTTAAATAGGCTTGCCGTCTTCCATAGTTGTCAGCAAGAATTCCCCAAAAGTAAGCTCCAATAAGCATGCCAGCAAAC
ACAACAGTAGTAATAAGAGTTTCTTGTGTAGAAGAAAGCCCCCATTGAGACTTAACAGCTGGTCCAATAAAAGAAAGAATCATAACTTCAACAGCATCCA
CCATTGATCCAAGACCCGCATAACACAACACCAAATACTGGAATTTGCCAAAACCCAGAGCTGTAAGAGCTTCGTCCAGTGTGTACACATGTTCATCTTC
CTCCTCCACCTGCTGCTGTTGCGGTGCCATCTCCAGCCCGTCAATTTCGGGTCAATGAATAGATCGATGATTTGAAGCAAATTAACAGGTAAAATATGGG
TTTTCTTCATAAATTTAGGATCTTGCCTCCATGTGAGCTGAAATAAACACAATTATACTTTTTCTCACCTCCTTTATCACATTAATCTTCTCTTCCTCAC
GTCTCTTTCTGTTCAAATCAGAGAAGGAGAAATCTGATCAACATAGTGTGGTAACAACTTGTGGGTGATAAAGACTTGTCGTTGGTTCAAAGTTTTGGCC
ACTTTGGTCCGTGAAAATAGAGCATGCGATTTTTTAACCAAACTAAGTCATTATATAAAATAATTTATCAAAGTAATATATTTTTCTAAAATTTTACAAA
ATTACTATAAATGTATTTCACGTTTTAGAGTATATTTTATTTTTAAAAAACTAACAGCATTAGGTTGATATACGTTACTGTAAGTAACGTTTTACTTTTA
AAACGTTATTTTCAGTATCGTTTTACTCCTAAAACGTTACTGTGAGTAACGTTTTAGGAGTAAAATGTTACTGTGAGTAACGTATATCAATCTGACGCCA
TCGACTTTTAAAAAATAAAATATATCCTAAAACGTTACTGTGAAATACGTTTATACTAGTTTTGTAAAATTTTAGAAAAACATATTATTTTTGTGAATGA
CTTTATATAATGACTTACTTTGGTTAAAACCTCAATAAAAAGTGATGGCATATTATATTGAGATACTTAAAATTATGATCAAAATTTCAGGGACATATAA
AATATACTAATGAAAAATATAGAATTCAAAAGATAAATGTCTTTACTTCTCACGTAGAACAAAACATGATAAAAGGAAAAGAGGGTCCATCGTAATGACA
AGTAACAAACTTCAAATGTTACGAGAAGAATAAGATTACAAAGGTCTGGGCTCAAAACCTGCACAATTATAAAAGCAAGGGGTGAATACCAACAAAATGG
TACTTAGAAAACAACCTAATAAATCTAGCTATAAATTCAATACCTCTTACACTCCAATCGAACCTTCTCAAACTGCAACCTGCACATAAATCAACCCAAC
CTAGCAATTTTATTATACATTGCTCACAAGACCCAATATCCACAATTCAATAGTCATAAACAACAATCAGTCGAATCAAGTAAGTTAACTTCAATGTCAA
GTAGTTCGGTCACACACAACAAGCACATCAATCTCAAGTAGGGCTGGCAAGGGGATGGGGAAGGGGACTGGGGGACGGGGGACGGGACGGGACGGGGGAC
GGGGGACGGGGGACGGGGAGAGGGGATTTGATACGGGATCGGGATTAGGGGGACAAAAATAGGTCCCATCCTGTCCAACTATATATACGGGATCAAAGGG
GGACTTTTTTTAAAAAAATTCTTATATATTTGTATTGAAATTATACGTCTTTAGCTAATAAATTTTAAATTTAATTTTTGATTTTCAAATATCAACATAA
ATTTTCAAATTTAAAGTTTCAATTTTAAAATTTCAAGATTTATGTTTCAAATTTCAAGTTTCAACTTTAAAGTTTTAAATTTCAAATTTGAGAAGTTTAA
ATTTGTAATTTAAAATATTTTAAAGTAATGTAAATTGTAAACTTTAAATTAAGTATTTAAAGTTAGTTTAGTACTTAAGTATATATTTAATTGTATATAT
TAAAATTAAAATGCAAAACAATAATTGTATAAAAAAAACTTGAACAAAAGTTAAAACCTTCAAATTTATTCAATAAAACTTAGAAGTTACAATGAACAAA
TATTAGTGGAGTAATTAATCTACGCAGCCACCTTCTAGGAAGGGTTCTATTTCAATAAGTTCTCATACGTAAAACTAATATTTGTTACAGATATTAGATG
AGTAACTAATTTTACGCAGCCACCTTCTAGGAAGGGTTCTGTTTCAATTAGTTTTCGAATGTAATCTAAAAATATTTGTTTTCTCCATTAAAATTTAATT
CTAATTGTCGCATCATATCGATGGTGATATCCTCCGGTGTTGGCAAACTTGCTAGAAATTCTTGTGCCTCTAATTCATCATCATTGCATTCAATTTGTGT
TTTGCTCCAACTTGCTTGTTTTTTACTTAACTTTGGCAAATTGTTATTCCTTCTTTCAGCATTGCACCAGTCTCTAAATAAAACTGTTGTTTCCAAACTG
TCTTCCGCCAATGAATGTCTATGATCACCAATTTGAAACCTTGCCGCACTGAAAGCAGTCTCTGATGCAACTGATGAAGCTTGAATAGCTAGAACATCAC
GAACCATTTTGCTCAAAGATGGAAATGCATCGCTTCACCTACTCCACCATCCTAATAAATCTTCATTGGCATCTTTGATTTCCAACAGTTTGTTGAAGCT
CGTGGTTTGTTGAAAAATAAAATATAAATTTTATGAAACGAATGTACCAAACGTCTGCATTAATTGCAGACGTTAAACTGTTGTTGAAGCTTGTGGTTTG
TTGTAACTTGTAATTTGAAACTCCAACCAATACTTGATAACAAATGTGAGATAATATAATTATATTTATTGATATAATATGAAATTTTCAAATTTCAAAT
TTAAATATATGAATTATAATAATATGAGAATTAAAATGGAATAGAAATTAAGATTGACACTTGAGAGTCGAGAGTTGAGAGGATATAGAAAATAGATGAG
AGAAATGAGAATAGATGATTTTGTAAGAAATAGTAGGGGATAAGTCTATTTATAATATTAAAAACGGGTTAAAGTATAATTATTATAACCTGAGGGTTTA
AAAAAAAATTTAAAAGTAGGGTGTGGTAGGGGATGTTTGGGAACACAAAAAGGGGCAAAAATCCGTTAGGAGGGGGGGGGGGCACTAGATGTTTCCCCAA
CGGATCAAAACGGTAAAAATTTTTAAAATTTTAAAAAAAAAAAAAAGAAGAGAGGATCCCGCGAATCGGCCGGTTCAATCGGGTCGGATCGACCGGGACG
CAGGAGTGGGACCGGTCAAGTGAATCGGCCCCTGACCGGCCCCCTCATCCCCCACCCCTTAAACCCCCTAAACCCTAGGGGACGAGACGGGCTCGAATCG
GGGCGGGGCAGGACGCGGGTCGGGGTGAGACATCCCGGTCCCCCTGCCACCCCTAATCTCAAGTAACAAGCAAGTCATACATAAGCAACAAATTCATCTA
GTCATAATAATCAATCTCTTGCCGAAATCATTTCTCATCAGCACAATATCACTAGTTAGAACCATTTTCCATCGGCTTTATATTAAATCACTAGTTAAAA
TCATTTTTCATCGGCTTTATATCAAGTCATTAGGCAGAATCATTTCTCATTAGATTTATAAACACTTCCCGGAAATGACCTCGACATCACAACACTCGCC
GACAAGGACTTCAACATCATAGCACTTGTCGGTAAAGATCTCGGTAACATAGAGCATCACATGTCTTATCAAAGTGCTCACAAACAATGCACACAAGCAA
TATCACACTACACGAAAGAGATAACAATCCACACGATTCAAATTCACATTCACACTTACAAGCATTTTATCAATCAATCAATAAGGGTGAGACAATTCAC
ATCATCATGTTCAGCCTTTTTCATTTTAACCTTTCTTATTCATTTAGATGTATCAAGTGGACAATTAAAACCCTCACCTCATCCTCATTACTCCAAATAC
ACAAGCAACGAAGGAGGTACACAAATCCTACTAGAATACAAGATTTAGGAGATCACTTGTCTTTGATCAGTCAATATTCACTCCAAAAGGTGAGTCATTT
TTCCGAATCACTTCCAAACACACACAATATATACAGTATACACAAGCCATTATTCACAATAAATTTTCAAAAACAACAACACTCACATCAAATTTCTTTA
AAAGTGGGTCAATCAACATAAAATTCAATTTCGAAAGGAAGATTTAAATCCAAAATTCAATACTTGAAAACATTACTCAAGGCTTTAAGAACTCTTTAGG
AAAAATAATTTCGAAAAAAGGACTTAAAATCAATTCAAAACTCCATTTTAAGTAAGAACCTGAGTTCTTAAAAAACCTCATCATATTCACCAAATTAAAA
TCTCATATGTTGATTTAAAACCCATAAATAATCAAAGGAAAATGAGAGTTTAGGATTATAGAAGTTTACCCATTAGTAGAAGAAAACCTTTCTAAAATCG
TCACCAGGAGTTCCTAATCTCAAAAATGAATAATGAGGCTTAAATCCTGAAAATGACAGGTCAAAACCCTCTTTAAGTCTCGCAAAAGCAATCAAAGGTT
TGCTTGAGCGAACTCCGCCAAAATCTCCTACATCGAAAAAGGGAACGACCTTCACTAAAGTGAAGGTCGCTTTAGAGACAAGTCTGTTGCTTAAGCTGAG
GTTGCTTAAGCGACAAGACCTTCACTAAAGCAAGGCCTGCAGCACTAGAAAACACAGCCAACTCTCCAAACATCAAAAGGACCCTCAAAATTTGTTTGGT
GCCCAATAAACACAAATCACATGTGCATATCGGTTATGCTCAATGTTCCAAACTCAATGAAATTGTCAAATCACGAATCTGAAGTTCCTTAACGCGACAT
TCGTGAAAATCACAAGAACCTAACTCAATGCCCAATGTTCCAAACTCAATGAAATTGTCAAAACACGAATCTGAAGTTCCTTAACGCGACATTCGTGAAA
ATCACAAGAACCTAACTCAATGCCTAAAAGACTAAAACAAGCTAGGGAACTCTAAAAAAATTAACCGAGACCTTATCTAGGCCCAAAATCATTCTCTGAA
TCCAATCAAACTCTCAAAATTTTGGTTCGAGCATCCGAACCCCGAGTGACACCGAAAATCACTTTCTTAACAACTTAACCTTTCAAATTCAAAACTTATC
AAATTCTCAATTTTTAACTCAAAGTTTAAAATCAATTTTTCAAAACTCAATCATAGAAATTTGAGGGTCAATCACGGAAGGGAAAAATGATAAATTGACT
AAAATTTCCAAAATTGACTGAATGAATCATTTCATTACACTAGTCATAGTAAATGAAGTAATTGTGGTCGAGTTCAAAGGCTATTTTAGAATAATCTTTA
AAATAAAAGATAAAAAATTATTTTTCTTTAGAAAAAAATTGTTAGTGTAATACTTAGAGTTTATTAGAATTTATATTATGATTTAAAATGTAGATGTCAG
TTTTTGTTTGAAATATAACTTCATGCTTATTTTGTTATAATTTATGCTATTAAATATAAATTCGATCTTAGATGAAATTTAACTCATATCATGTAAACAT
ATGTGTGTGCTTTTTCAATCAATTGTATTCCATTAATGATTTGTACCTATTTATTGTTAATGTTTTTACACATAAATATGAGTGAAGTTACATTCATTAT
GTTTTGAAGTTGTATCATAGCGGGCCTTTATACGAAGGTGAAGAATCAAGATATGTGGGTGAATTAGTGAGGGATCGTTTAATTATTATATAGGAGATAT
TTTATATATGTATTAAAAGTTGTATTAGTTTTACTATACTTGCTAAAAGTTTTGTGTTAGGTATAAAAGTCAACATAACTTATATCATATTAATTGGTTT
GTAAGAATTTAAATGTTGTATAAAAGTTACTCATGTATTAATTTATACGGTGTTTGATTGCATTTTTTTAATTCCTACATAATTAATACCAACATAACTT
ATATAGAATCATGTATAAGGTTATGCATGATAGAAAGTGGAATAAGTTATGTGGATATAAGTTATACATATACTAAAATAACAAAATTACAGATGCACAC
TATTAATTTATTTTATTTTTTTAATTGAAAACTTTACTAATTTCTTGTGTATGTTTGTTGTTTTTATTTCTTTTTATATGTATAGACCATTTTTATTTCT
TTTAATTCTTTTAAATTGGAAACTTTCCTGTTTTCCTATTTTATATAAATTATTTTCGTTTCTTTTTATATACTTACCATTTTTATTTATGTATACAAAT
ATAAACATTTTTTAATATTATAAATTTGATTGTATATTTTTTGACGGCATATGCTAATCAAATATTAGCATTATATATCATTCAATATATTCCACATTTT
ATTAGCATGTATTACTATTTTATAAATAATATATGTTAATAATTAGAACAAGTTTAATATTCAATAATTAATAGTTAATGTATTGTAATATCTACATAAC
TGAATAACACTTGTTAGTAACTAATATTCACATAGTTAATATTTGTATAATTAAACTCAATATAACTAAATTTTACATAACTATATCTGCATAACTAATA
CATACATAACTAATACCTGCATAACTAATACCAGTAACGAAATGACTGTCTTGAGTGAATATGTGAATATTATATAATATTTTGAGATTAAAAACTATAT
TAAAGAATTAGGGTGTAGCCCGAATTGCAAATTTGATACTAGATCACCTAAACACTGCATCTAGGAGATATTAACAACTTTTAATAATGTTGGAGATCAC
TAAAAATGGAGCTATTCAAAACATTATTAGAGATGGTGAAGTAAATGAGGTAGGTGTATATCTAAATACTACCTTAAATGTTTCTTCTCTATCATATTCA
ACAATATCCAAATAATGGTTCATCAATTTCTAAAAATATTGATTACTCCTTTGATAAGAACCAGTGATAGTGATGCTTCTTAAAATAGTGAACTGACTGG
AGATTGACCATTATGAATGTGACATTCATCAGGAGTTAGTAGAGCTTACCATCTCCAACCACATTCTATTTTATTCAATATTCTCATATTTAGAAACTAA
AATAGAAAATTGAATCTTCAATTACATTTCAAAGAATTTTCTACTCTCTGTTTCCCTTTTTCATTGTTTTAATATTATTTCTATTATTATTTTATAATTA
ACATATTATTTTTCATATAAAGGTATTAATTAAATTTCAAATAATTCTTTTTAAATATAATATAATATTTTTAAAGATATGCTATTTAATATATACTACT
TTCATTCGAGATTAACAATATTTCAAATATACTTTTTCAATTTTCATCACTTTAAGTGATAATTTGATGTTATTATTAATTTTCATCATAAAGAATGCAC
AAAATTTAAATGATAAAATGGAAATTTTAATTTTAAAATACAATAAATAATATAATAATTTAAATACAAGATAATAATTTTTTTTAAAAATAGAGCAATA
ATTTAATAATTTGATAGGTCATTTTCAGAATTATCAATATTCAAAAAAAATTAATGTATGATCCAGAGAATTGTTGTACTTGTGATTACGATTGTTCTTG
TTGATTTCTTTTTTCAATTATTCGTAATTGTTCTTTAAAATAAATCTATTTTTTATTAAATAAAGAATTTTAAAAAAGTACATTATATGAAATATTATAT
GAGGTGATAATTTTGAAAAAAGAAGAATAAATTTATGTTGTGAAAAGAAAATGAAATAAAAATAATAATACGGAAAAGTGTCTAAAACACCTTTAGAATA
TTGGAAATGGTACAAATTACCATTTATCCACCTATTGGCTCCAAAATATCATTTCTACCCACCTATTTGCTCCAAAATACCCTTGTCATCCACATTTTGG
TTCAAAATTGACCATTTATTTAACGGTTTTAAATTTAAACTATTTAAATATTTTTTTAAATACGTGGCGCTAAACTGTTTGTTATAATTTAACTTATTAG
TATAATTTATAAATCAATCCACTACCCACCCATTACTAATTAAACCCCTCCAAATTAATAAATCCGTCACATTATTAGTGCAATAACATAAAAGCTACTG
TCAATTGAGTGTTTTTACAAATTTGAGGTGAAAATATCTATAACAGTAAATTATCATACATTCAAGTTTCTAAATAAAAATTACAGATAAACTTAAAAGT
CTGACTATGTTCATCTTAATTATTGTTACGCCTCAATTATGTGATGTTACTTCATAGGTAAATCTTTTTCAAAATAATATATAAGATGTTTTAAAACAAA
TCATAAATATTTATAAAATTATATTTTAATAGAAGTGCATCAATTAATTCGGGATGTATTACTTCTTTACCTTTAATCATAAATTTCTAATTCAATCTTG
AAAGAGAATCCTATTGAAAGTATCCTCTAAATAAGCGGCTCAACCTAAATTTAATTGGGGCTTCGGTTCGGACTTGAATAATTTTGGATGTCATTTTTAG
GAATCTATAATTACATCGTGTTTTAGTAGTATTTATGGCGATTTTGATATTATAATTGGATTATTAATTGGGTGCGGTTTAATTAGTAATGAGTGAGTAG
TGAGTTGATTTATAAATTATGTTAATAAATTAAATTATAACCAATAGTTTAACACCAAGTATTTTAAAAAATATTTAAAAAGTTTCATTTTTAAAAAAAA
AAAATAAATAAATGGTCAATTTTGAACCAAAAGGTGGATGATAAGGGTATTTTGGAGCCAAAAGGTAGATGAGAAGAGCATTTTGGAGTCAATAGGTTGG
TTGAGGGTAATTTTGTACCATTTTCAATACTTCAAGGATATTTTAGACCTTTTTTCGATAATAATATAATATCGAGGAGAGAGAATAATATTCTTTCTTA
GAGAGTAAAATAAAGAATTGAATTGAAGTTGATTGATTGAAAAATAGAGAATTCTATATTTGAAAAGTAACAGAGTGTACGGTTAGAGATGCACTTAAAG
ATGAAAAAAATCCTTTTTGAGGAGGAAAAGAAGTGAGATTGTAATGAACTTAATTTGAATGTAATAGTAACCAACTTTTCAACTATTATAAGAAGACTAG
AGTTCAAATTCAAATTCACAAACTAAATGCAACAACCCAATTAGCAACAGCCCAAACAAAAATATAGAAATATTGAACGTAAGAACTAGGGATTAATAGA
TGTTAGAAGGGAGATGAGAAGCTTAGAATCCAGAAAGAGATGAGAGTAAGAGACAACTTCTGTCACAATATGCATAAACACTTAATTCCAATTCATTTGT
CATTTTAACCAAAAGCTAATTAGATCGGGATTCCAAATAAAACACTCCAACAATTTATTCGGCACAATAATTTTAACTAAATATGTCTCCACCAATTCTA
GTCCAGGGGCCCTTATATATCCAACTTGGTTCACAACAGAGATAATCTTACAAACAATAAAAAGTAACATGTGGTAAAACTCAACCAGATCTTGAATTTT
ACAAGAATGTCATTAGTAAAAATAATTTAGAAGGAAGTCTACGGGATAACGAATATATATATATCGTTGTCTATTAGATATATATACTTTAAATCGCAAA
ATAATTACCATTTTTAAATTTCATAGAGAGTAAAAAAATATTACTAAACATAAAATATGATATTACTTATACGTAATTTAAAATATAAATTATTTATCTT
CTAATCATCTACCAAACGGACCATTATTACACATACTAGCTAGAGTAATATTACTATAGTTCTGTAAGTGAATGAAGACTAAAACTTACGAAATGAATAT
TTACTTATTGGAAGACAAAATACATATAAGAAGGGGAAAAAAAGCATTATAAAATGCATGTCTTTGTTTTCTCATTCCTACTAAATGTCTAAATTAGAAG
ACAAAATGCAACATCATAAGTAACAAAAGAATAATAGGAAAAATACCTAGGTATCCCTCGATCTATGTCCGAAATTTCAGAGACACACTTATATTATACT
AAGGTCCTATTAGCTCCTGAAGTTATTTTATAATTAATGTTCTATCCCTTTTCGGCCTATATGGCACTAGCTAGAAAAAAAATCGTGTTGGACCCACAAG
ATAGTGTTACGTAGACCGAAAAGGGATAATAAATTATTAATAAAATAAGTTCAGAGGTAATAGAATATTAATATAATATAAGTGTCTCTGAAATTTCAGA
CATAAATTAAGAGGGTACTTGTGCATTATTCCAGTTATCCCAAAAATAATATGAGAAACACATAAATTACTTCTTTATCTTTCCAACATGTTAACTGTGT
TACTGTCAATGACACTGTATCTTTTTAGTCGTAACACGTAGCAACTTTTTAGCCTTAATTTTTGTCCGCCCAATATTTCATTGAAATAATTCCTAATACT
TTACTAAAAAAATATGTTTATACTAATTCTGATTATCTTTTTTTTTTAAAAAAGTATTATTTTTGTTAATTGGTTTTTAAAAATGGATTACTTGGGTCAA
CACTTTCTTGTATTTTTCACTAAAAATCACCCTTGTTTACCAATTTTGAAATGAAAACGAAATTACATCAAGGTTTTAATTTATATGATTTTGAATCTGC
TAATGACCTTCCAAGACAGTCATTTTCGAATGCAGTTTTAGTTTTAGTCAAAATGAAGTGGCGTGAACAGTTTGTACAAGGCACCTTGACAACTACTACT
ATTATCACACAGCCACAAAGACAATTGGTGCTTATCGATCGATTCAGTTTGATTTTGTGTATTATTTGATTTTTAATTTTTCCTAGCCTCATATTCATGG
TAATTAAATCATTTTGTGGTCATTTGATCCTCCATCCTTTTTGTTGCATTGTTTCATTGTTTTCATACGCAATAAGGCTAAAATTATAGAAATTGTAATA
CAATTTTTTTAACTTTCTATATTTTTATTGTTTGTGTCAAGGTAGAGTTAAATTTTATCTAGTTGCTTATATCTGATCCGACTAGATCGTGTGCTTACTT
TTTTTTTTGGACCCCTTAATGAAAATCTTGACTCCGACACTAATTTCAACACTTTGAAGTTTATATCAACCGTTGACATTAATCAAGTCACTTTTAATCA
ACTAACTGAAATAGTTTCTTAATTAATCTTAAAAAAAGTAGAGAGATTAAATGTATGTTAAATAGTCAATTTAGTGATTTAAAGACATGATAATTGACAA
GAGGGAGATCCTTTGATAATAAGTACTTCCGATTTTAATTTTAAATTTGTAAATTTGAATTACTTCTATGAAACATAATAATTAATTAGACTATTTTTAA
GAGACTAGATTTATTCCCGTCTAGAACTACAGAGAGAAATAGTTTTTTCCTCGTGTAAGAAAAAGCAACACGTTGAGAGTTTTCCAACCATTCTAAAGCA
GTGACAAAAAAGTAGTCTGTTGTCATGTTAGTGTGTTTTGCCCAATCACACCTTTGATTTTTCACAAGTTTACTGAACCTTTTTAACTGTTACTGGTGAC
TAATTTACCAACTTCCTTTTCTTTTTGTTTTAAAAAAATGTTCATTTCTAGTTTCCTCTTTCTATCTATGAGGGGTATAGAAGAACTATGTCTGCTTTGC
GTATTACATCGTATTACCCAGAAGCAATTGCAAGAGCACATCTATATCACTGTAATATATAAAAAATTCCTTTAAAATGTTGATTTAAGTTACTATCCTT
CGTTAAAAGATCTCACTTCACAAAATTGAAAATTTAGTTATTAAAGCTTACCTTATTTTGAATTATGTATCTAAAGAACCTAATAATATATGAAACCTTT
TATTACTATACCCATTCATTAGAGTTTAGTTATTAGTTTTGTAAATAATAAATATGATAAAAGCCATATGTAAACAACAAGGATCTGGACAGCAGCCACA
GTTTCAATTAGATTAGGGGATTTTGCATCCATGCATAACTAAAAGATTTTGAGCCCCTTGTCTTCTGTGGGGTGAATCTGCATGTGGACACCTGGTAAAA
TTTGATTAAAGTAAAATAAAACACAGCCATAAATGGACATGTATACATACACATACTCTTCTATTATCACTAATCAGAATCTTAAATTCAAGAAGAAAAG
GAAATCAAAAGAAGATACAACACAAAATCAAACAGTTCCTTGTCATAACTTTCTCCCCTTTTTTCTATCTGAGCAAAGAAATTATGCCTCATAGATACAC
ATGCCAGACTTTGGAATCACTTCAGCTTAGCCTTTCCAAATCCTTTACTCTTGCCCTTTACTGCACCTACAGTTTCTCTTTCCATATCAATCTGTAGTCA
TGGGTTGACTAATGCAGCATCTGAAACGGGCTTTTCTGACCTTCGTCAAGATCTCTGTTTCTGCAGCCTCAAGCATTCTGACCACCTGAGAGAACGGAGG
TCTATTGTCAGGGTTACCATCCCAGCAGCAAGTCATGATTTCAGCTAGGACAGGTAAACAATCAGTGGGGATGGTTGGACGGACACCTTTGTTGACAACT
GCAAAAGCTGCCTGCACAGCAGTCATGTTCTGGAAGGGAAGCATCCCCGTTAGGAGCTCCCACAGAACAATGCCAAAACTATAAACATCAACTTTTTGTG
TGTACGGTCGGTGCTGGATCATCTCCCTGCAAATCACAGTAAAATGCACTCAAGTAGCCCACAACAGCACGTACAGGCTAAACCACAACTAGGAGCAATT
ATCACTCTTTTGCAACAGGAATAATGAAGGCATATTGCAAGAAGAAATAAAACAAGCAATTCAGAAAGCATTTCTAAGATGTGAATACTGCCAGAAAAAA
TAGCTAAATATGTAAATAGATAATTTTTCAAGGAAACAAGACAGGTTTCTTTTTCCAAATAACCAACCAATAATCAAATTTGAATATATTATAACTGGAT
GTGATTTCCAAGAGTGCCTACACATGCCAAGATACGAGCCTTATTCGTCATGAATATTGCAACTTGGCAAGTTCCCATCTATTTTCCTCAAGTCATGCAT
ACTACTCATCTACACACTACTCAGCCCTCGCACGGGAAATAATTGCATTGAAAAATCTTGGGCCATCACAGCGAAGTGGTCCATCTCAACTTGCAATAGC
ACACTTGTACATCACCAGAGACACTCTATACATCCATTCCAATCACAAGCCTTTTGACAACATCTTCAACTAGATGTCGGGAAATATTGTCCAATTGGAA
AAGAAACCTTCATCTATTGTATTTTTTTTTTTGACAAATGCAAGCTT