BAC Sequence – LE_HBa0179E24

>C05HBa0179E24.1
AAGCTTAAGAGCTATTTTTTCTCCAAAATGTATAAAGGATCACTAAATGCTAGCTAATGTGACAAGAATTAATAAATAGATTACAAACTATTAAGGTTTA
TTTGTATTCTTATAAAATTTGACAAGTTAATGGTTTTTAACAAATATTAAATAAAATCTTGAAATTATTAAAAGGATATTCAAAAAATTTGCTTACATAT
ATTTAAGAAGTTATTATTGTAAAAAATGTTAGTTTTCTGAATATAATTATTATTATAATATTAATTTAAAGTTTATTATTATTACAATATGAGTTAAAGA
TTGATATAGAAATATATAAACTTCAAAAATTAAATCCGTCTTTGATGCTAAAATGAACTTTCACAATCACTCTTATCATAATCATCAATGTCTGCCACTA
CACAATTACTATAAAAGTTGTCAACCACCACCGTCCACCACCATATATCTATAAATCACCGTCAACCACCACCGTCCACCACCATATATCTATAAATCAC
CATCGATCATCACAAATTATCAACCATTACTATCACTAGATATATATACAATCAGAATCACCATCAATCACTATCACTTTCAACCATCATCACCAATCAC
TATTCGCTTCCAACTGACATTACTAATCACTACTACATCTAATCATTTTTACGATTAGAATTATATCACTATTGTCATTCATTATCACAAACAACTATGT
CAAGCAAGACCACCACTATCAACTACCATCATCGACAATTCACCAACACTACATTCATATACCAACAATCACCTCTACCATCTTAACTAATACAATATAC
CATCAGCCACTTATTTGAATCTTGAGATAATTTAAAATTAAAAATACGTCAAAAATATGATCAAATATCTTTCAATCTTGTGATCTTAAACATGTCAGGC
GCAAAAAAAATATTAAAAAGTTGCTAATTAAGGATGGGAACATCCCTTTTTTTAAAAAAAAAAAAAACTAAAAAAGATATAATTTGAAACAAAATAAATA
ATTAAGATATTTAAATATATGTAAAACTTTTCACTGTGAATAAATATACTTTAATTAAACACATTTAAAAAATACTTGAATGCTCCTACTTTTGGAAAAT
AGAAATATTATGACCACAAGAAAAGTTGTGTTCCTTTAAAAAAAAAAATCCAATTCGCCACAAATTGCAAAACATTTGTCATGTTATCAACACATGTTTG
AAATAATAATACCAAAACATAAATCCTTGCATCATTATGTTTTAAGTTAAAAGTAGATATGAGAAAAGGACTTGAAGATATTCTTAATTCATGTGTAACT
TGACAAATATATAAAGGTAGGCATCATTTGATAGAGATAGGATCACTAATCAACAAAATGTAGAAAAAAGTTGTAAAATTATTGTAAGTGGAGTTTCATT
TTACTGGCTGAAGAATGAATTTGAGGGCCACATTGAAAGTGCAAATAATTAAATCTACCATTATATATATACTTAATACAAACCAAAGTATATTTTATTT
AATAGGTAGCAGATTCTGAATTGTCATTAAGGAGTGTCAATAATTATAATAAAACTTTAATTATAGGGCTAGTAAAATGAAAACACGCGACCTTTAATTA
CTAGCTATACTAAACCTTTAACTTGATATATATATATATATTTATATATATAATTTTTCGATAAAATAGTATAACTTGAAAGTACTAAGATAAGGGTGGG
TCCGCCCCTTCATTTAATGCTAATTATAACCTCTATGTGGAACTTATTTTTATTATTCAGTGTTGAGTATTCGTATTTTGATCCATATAAAAATTGTTTC
TTACAAAAAAAAACTAATTATAATATATTTTTAAAAATTAAACTCTAAATTTTTAATCAAGTGTAGAATGTCATATTCATTTTAAAGGGTGCAAAATAAT
CAGAGCTTTTCTTTTTTTCATTATATTTATGATTTGTCAAAATGTATTATATATGGTTGTTGTGATAGGTACATAAGTTAGTGGGAAATCTACCATGATA
ATAAAGTAGGATTAACTAAGATTTATAGAAATATACACTTATGGTCAACAAATGTCTAGATAGTTCTTCCTCTTTTTTTTTTCTTTTATTGATAAGGAGA
TTTATTATTATAAAAATAAATTATTTTTTCCCCTCCATTATATGCCAACCACATTTGAAGTGTATATATTTAGTATAAACTATATATTTCTTTAACTAGT
TGATGGAAGTATTTAGAGTCGTAATTATCTCCCCTATTTTGTTTGCTTTTTCTTTTTCTTTAGTTTTTTAAGAGTTTCACCCCAAACTTTGTAGTAATTA
AATAATTGATATATTTATGTTATTTGAAGAAAAAAAATTAACACACCTATATTGAAATTTTGTATTCGTCTCGGATTTAAGTCAACAAATAATCTTTAGA
TGGTTAAAGGAACCTGATTTTGTTATTTACATGCAAAAATATAAAATAAAAAATAAAAAAGATTGAAGAAATCTTACCTAATTGGATACATGAGACAAAA
TCTGAATTAAGAATTAAAGGTCTTCTTTGTCATCTCTTTCACACACTAAGATAAGTCATTATCAATCAATTAATTGTTAGGATCACTTTAGCACACGTTA
ATTAGATATGATAAATATCGTGATTAATTCTTTAATTAACATATATTTTCAAAGTAAACCATAGGAAATACGGTTTGTTTGAAAAGGTCAGAAATTGATT
TTCCAAATACTCCTTTCATTTATTTTTACTCAACACGTTTCAATTCGTTTTAATATTGTCGATTTGACTAATCTTCAAAATTAAGTTATATTAGATCAAT
TCAAGACTTTAAATTTTTAATTTATATTACACATTTTGTGACGTGTACAGTTATGTAAGAATCCCTTTTTTTAAGGGATAATTGTATATAATAGCAAAAA
TAACCTAAAATAAATAGAGTAGCTACTGTTAGATTTAATTGTGCCCCATAGTAAACATTTGCCAAAGTTTGCCAGTCGCCTCTCTCCCAAAACCCTCGCT
CGTCACTCTCTCATTCTCGCTCGCCACTCTCCCTCTGCTCGCCTCTCTCGCTTTATACAGCAGAAGTGTATAAATTGTCTTTCTGTTTTGTATAAAATAA
GAGAAAATTGTATATACACATGCAAAAACATATATCTTTGTGATAAACACTTAATTATACAATTTACAAACATTTTACTTCGATTCAATTGTATACAAAT
GCAAATTTATATAAATATTGCAGCGAAAAAGGCCAGCAAATTATACAATTACAGTGAAATACAATTCTCTCTCGCTTTATACAACAAAAGTGTATTTGTT
TCTGTTTTTATATAAAAAGAGAGAAAAACATATGTCTTCTTCCTATACACTTATAATTATTCAATATAAAAACATTTTACTTCGATTCAATTGTATGCAA
AGCAAATTTTATAAACATATTGCAGCAAAATAGGCCAACGAATTATACAATTGTAGTGAAATAGGCCAGCGAATTATACAATTTCAGCGAAATAGGCCAG
CGAATTATACAATTTACGTGAGCGAATCATACAATTGTATATGTATAGCGAGGCCAGCGAATTATACAATTTAGGCCAGCAAATTATACAGTTGTATATG
TATAGCGATTTATACAATTATATATTTGCTATGGAGCACAATTATGCAAACTTTACTATAGCATACAAATATGAATTTTTTGTTTGCTATATGTGAAAGT
TGCCCTTTTTTTAATTGTTTCCTATGGATAAGCTTGCAATAAGATTTAATACGAAAAGAAACTTAGTACAAAATAAATGTATCACAAAAATTATCATTGT
ATCAGAATCTTAGAAGAAATTTAGTACAAAATTAATGTATCACAAAAATTATCATTGGATCAGAATCTTAGTGGGCCTAGAAAGAATGGCCCAGTGTTGC
AGGTAGGCCTTAAATAAACAAATACTGTTTAGCAATAGGAAACTTACATAAATATACTATAAATAAAAAATATTTATGATTTATTGTATTAATAATTTTT
TTCTCACTTGATCACTTTTAATATATTTATAATACACTTCTAATTCATATTACAAAGAATAATTTATTATTCACATATAATACAAGTTTTATTGATGAAT
CACACATTTTAATACACTTCTTACCAACCAAACATAATATATTTTAAAAACAGTTATATTACATATATATATTGCATACTTAATTTATTTTCATACATAT
TGCAGATCGAACATAGTATTGCTATAAATGACAATAAATAAAAAGTATCGCTGAGATCTGTAATTACTTATTAAAAGACACTCATCCAAATAATTTTTCC
TTTAGCGATCATCATCTATTGGGCTATTGGGCCACAATTCATGGATCCAATTTCTGCTGATAACTGGGCCATTGGGCCTCTATATATAGCAATGAGAATA
TAGTATGAATAACTTTCATAAAATACGCTAGTATATGTGTTAATTATTCGATGTATCGATATTTTTAATTAGTAATTACTATATCTTGTCAAAGTTACCT
TTCGATATATTTTATTTGTCTTTAAATACGATGTATTTATTTCTATATACATTTTATCTAGCAATTTTTTCTATGAAAAAGGTTAGCTGAAGATTCTTTC
ACAGACAAATGTCTATATTAACAAGGATTAGTTAATTACACATTACGACGGTCTTTTTAAAACAATCTCTTTATCTCAAAAAAATAATATTTTTTTCGTT
TAAAAAAGAATGATTCTATTTCTTTTTTAGTCTGTTTCACAAAGAATAATCCCTTTCTTTTTTTGGCAACTTTTTAACTTTAATTTTCTACAGTGACACG
TTTAAGACCACAAGATTAAATGACATTTTGATACATTTGATATAACTTTAATTTAGCACCACAAGTTTAATAAGTCGTGTTTCTTTTCTTAAACTTCATT
CCAAGTCAAACTAAGTCATCCTTTTTGAAATGAAGGGCAGTAATAAAAACAAGTCAGCACACACTCTATTCTTTTCAATTTCATTAAATATATTATTGTT
AGAAAAATAGTTTTACCAATTTCTTGTTCATATTTTGCTACTATCTAATATGCTCGATAGTAATGGAGTCAGAATTTTCACAAGTTTCCGATGAAAAAGC
TTAGGAGGAAATCTCCTTCGGTCCCTGTCATCGGGTAAACTCAAAAATAACAATGTAATTATATATATTTTTTTTAATTCATGTGATATTTTTTATTTAT
CATAGCCAATTTGACCAATTTTAGAAGTCATTAAATAAAAACAATTTACTCTTTGGAGTCACTTATGATTTGAGCTTAGGACTTCCATGCATGTTGGAGG
TCTCAAGTTCGAAACATCTTACTAGCGAAAGCAAAAAGTTTGTCTTATGATCGAGCTCGTTATACCGGACTTATCCAATACAAATTACTTTTATTTTATC
ACGTACACACTCAAAAAATAGTGTAACATACATTGACTTTTTTCTCTTGTACCAATAAAATTTAAAAAATTATTTTTAAATATTATTTAAATTTAATATA
ATATAAATCTTTAAAAATAAAAATATCATATAAATCGAGAACAATCGATATATGACTTTAACAATGTACAACACCTGAAATTAAAGGATCACAGATTCAC
TGTAAAAGTTTAGAAACCCAATACCAACAAGTTACTGATCATTATACAAGTTATATTATGAGTCTGAAAAATAAGCAGAAAAGGCAGATGATTATAAAAT
TGAGTAATTTTATTATTATTTATTTTATAGTATATAGTATATTGAGAACAAGATCTGCTATTTTAATTAATAAAAGGTATCAAATATGGGAGGCAAAGTC
TGTTTGTTTCTTAAATTCATCAAATATTTATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTAGTTTGTTTTTACTACTTTTTTTTTTCTAAAAAAAATAAAATTAAAGTTATATTGGATCCT
TTGGCCTTGTTTAGAAAAGGTTATATCATGACAAGTCATTTTCTAGTATATGTACAAAAGTAAACAAAAGCATGTGCATTTTTCTTCTAGTGGGAAAAGA
AGGGGTTTTGAATAGAAAACTATGGACTAAAAATAAACCCCTTCTACAATGGGAAAAACCATTGGATTATATTAGGTATTGGTCATGTATAAAAAAATAA
AAGTATAGTTTTTAAGAAGTTTTTTGCTTTTAGTCTAATAAATCGAGTTCATTTTATATGATCTTGTTTGACTATTGATTAAAAAAGATATTAGAAAAAA
AAATTTGGATAATGTATTAAAAAGGGTTATTAAAATTTGTAGTTTGAATTGACATATTATTTAATTGAATAATACATAAATATATCTTTTAACTTGACTT
AATTCAGTTGAATTTCTATATTTTCTAACTTTGAGTGTGGATAAGTACGCAATTAAACTCGTATAAAACTGAATCAATTGACACATTCGTTCTACATGAC
TATTTTGTGTCTTATGTGGTGTCCTAGATCACAATTTTGTATAATTATGTGATTGTCATGATGCATGTATTATGTCACATACGACGTTTGTGTCTACTTG
TTCGATGTTATACAAATTCGGATAAGTACCTATTTGTGCATATCCAAAGTTGAATGTATAAATATCAGCTGAAACCAAATTAAATAACATATTTGTGTAT
ATATGTATGTTTAATTCTGTTATATCTGACATTCAATTTTGAATATATATTTAAGTAGACACTTTTAAATCTGCTTAAATTTATATAATATTGAATAAGT
ACGTACACACTTTAATGATTGTATTTTTTTGAATTTGAAAATATTTAATAGGTGTTTGTATATGTAATTTTATTTCGTAATTTATAATTATAATGAAATC
AATTGGACTATACAAAATAATTACAAAAAGACATCAGTATTAAATAAACTATAACAAAAAAATTATATTCATAAACAATGAAACAGAAAATATTAGTATT
TTATTTTCTCCCTAAACCTTCCAAGCATATATATATTATTTAATTTCTAGAAACGGAAAACACCAAAAAGAAGTTAAAACTAACCGCAAAACAAGATAAA
ATAAGAATATTTTGCGATAATAAATAAAATAATTTTAAAATTAATCAATATTTCAAAAAAACTATATTAAAATTATTATTTTTATCTCACGTATTATAGC
TTAAAAAAAAGTAAAAGACAAGATAATACCCTTGTAAAGTCAAATTTTGTGGATGATTGGATTCAAAAGTGTATTTTAATATAGGCAATGACTTTTTTGT
TGACAATCTCTTTTACTTTAATTAACTTTATAAAATGGACGTTGTCACACACCCCATAAGTTTAATATTTTTTAATTAAAGGAATCAACCATTTTTTAAA
ACATGAATATCTTTGATGATGTATTTCTTGTTACATGTTAACATGTGTAATTTGTACTATTGACTTTTTCAAAAAAAAAATTGTTATAATATATTTTAAT
TGCTAAAATTTAATCATGGTGTTTATTTTAATATTTTTTTTTTAAAAAAAAGATAGAAATCATGTTGCTTCGAAGGAACAAATCAAATGAAATATTTATA
TTCTCAAGTTCATTATCTTTTTTGTTAAAATCAAATGAATTCGAGGCGTAAGTAGATGGATTGAGTTAAACTTAAATGGTAAAATATGAATGTGTTGGAT
TAAACTTGAGAGGATAAAAATGAATAGGTTATTGATTCGCCAAAAGGTTATTTGAGCTAAAATACTGATCAGAATTCAACTTGTTTAATTATTGTGTTTT
AATTTTTTTATAATTGTGTTTATATCTAATAAAACTTTTTTTCTCTATTATAACACTAAATAACATATCAAATAAATAGAAAATCAACTATTTATCCATC
GAGCTATATTTTTATAAGCTAATTTTTAAGGCCTCTATTTAGAAACTAACCAAACACTAAGCTTGTAGTGTTAATTATTAAATTCTTGAGGAATCAAGTT
TACTTTTTAGATAAACCAATAACTTAGAGACAAACTACATGATAATATTTAGTAGTCTTTTAAGATTTGATCAGTACTTTGTGTAGTCCTCTTTATATTT
ATTTTCCCCTGTCTTTTTAATAAAATATTTAACATGATTAATCAGATTCGATGTTGATTTTGTTATTTTGTAAATTTTCACTAACACTCGATATGAAAGG
AAATTAAATTTAGCGTCATTACAAATAGTTTAAATAAATTTTGATAAGACTATTTAAGTTGGAATGAAAAATACAAAATGCTTGTTACGTGACAAAATTT
TCATATGTGCTAACTAGATTAAGATATTGTGTTATCAATAAATAAAATTCAAAAAATTAATAAAAATATAAATTTTTAGATTAAAATTTTGACTCTCCGT
AAAAAGTAAAAGAGTGATACATTAGAAGAGATTTGTGATTTTAAATATGATAGAGAAATAGTTGCAACTCATGATGACTACTTGCATTAGGCATATATCA
TATCTATATACTTTTATGATATGTCATTGTTTTTATTCAAATATGTGGCTCTTAAGTTACTTAATTGATTAAGCAAATTAAGACATCTTTTAATTGCATT
TGTTTACTTCAAATCAACAAGTTATCTTTCTTTGTTGATGCAAGTTTTGTGGATGAGGAACAACTTTGTACTAATTTGCTTATTTAAGAGCTTGCGTAAC
TTAAAGAATATCATGAAATGGCCCTTTTGGCTTCATGTTCAAAGAACTTCTAACATGTGGAATTATGAGGGAAACTAAAATTAATATCAGTCGGGTTTGA
AAAAGGATCGTAACTAAATGATAACTTTAGAAGTTTAAATAAATTGTATGTGATTTATTTTAAGATGATGACTCGATTCATTGAATGTATATGTATTTGC
GTGAGCCAATATATAAGAGCATTTCATGTTAGCAGGGTTCGGAAAAAAACTGCACCTGAAATGATAAACTTTATCAAATAGCATAATGATTAAAAGAATG
TGATCTTTCCATAATTAGAGAAAACTTAACATTAGGTTTCTATTTTATTCTTAATAAAATGATTTATAGTCACACAAATATTTAAGATTTATTTTAGATC
ACAAGTTTTAAAATATCAATCTTAGATCAAATAATACTACGTAAAGTAAGAGATAAGATATTGATTAAATAACAAATTAATTTAATTATTATTTATATAT
ATCCAGTAAATATTTTGAATATATAAATATAACTTTGTGTTGCATTAGTAGCTAGAATTTAGCTCCAAATAGAAAAGATATCTTTAATTTTAAAATATTA
AGCTGAATATATATTTTTGAAGTTAGTTATATAAAAAAAAAATTACACGTGTTTCGAGTCATAGACTTAAGGACATGAATCAAAAGTGAATTTTAAAATT
AGTTTCTAGAACTTTATGTATTAAGACTTTGATATTCTTAAATCCGATAATAGTTATTTACTATTGATTTTACATATTTTTTCAAAAAAAAAATTATAGA
TTCAAAAAATAATTTTACTATATCATTTTTTGAATATAAAAAATGCAATAACTTAAAAAATAATTATAATTAGTGATGAAGATAAATTAGAAATCAAGTG
TAAAATTATCTATTAATTTTATAAATTGAATAAGTATTGTTCGACATCCCAAAATAGAATAGTAATTATTATTAAACGGAAGGAGTAGAAGACAGAGGAT
TCAAGCGCTCACTTTTACTTGTTATGTTTATATTAAATTAAATAAATTTAAAAATTTAGTTAAACGGATTCTTGTAAACAAAACAATATGACAATAAAAT
ACTCAGTAAAATCTGAAAGGATAAAATATATACAAACCTTATCACTATCTCATAGAGTTAAATTAGCAAAATATATGACAAATAAAAATGAACAGGGAAA
ACCAAAAATATCTGTATACATTATATATCGACAAGTAAAATATCGACAAGTAGGAAACAGGATGTTACACGTGTCTTTCTCCTCAGTCAGATGCCACATA
AATAAATGAAAGCCCAATGGGCCCATCACAAGATGCCAATAAGTTGATGTTGATGGGCCGAGCAACGTGGCGGGGAACACATGGAGATAGTGGGCCCATT
TGGGCCCAATAAGTCGCTTTCAATTATTACTTTACAAAGGCTATGTGGATAAGCATGTAATTGGGGGCCCATAATTGATGAAGAAATTGGGCTTTTGTTT
TGACAAAATTGGGGAAGTGTCCAAAAGTGGAAGGGCCTATTTTTATTCAGGAAGTGTGTGTGATGTGACACGTATAAGGTCGTTTTCGTGGGACACCTAG
GAATGACAATGGGGCGGAACAGATGTAGAATGGGTTTAAAGTAATGTGAGGAGGGGAGGTTTTAAGGTCGTGCGGGACGGGGAGGGATGTGGGGTGGGTT
GAAGTGATATTTTTAGAAACTAATGCGGTGCAGGGCAGATTGTGGATCCACGTAGGTTCAAACTTAATTTTAACTTTTTACATGTTACAAGAATAGTAGA
GAATTATCTATTAAGATAGTTTATTTAAAGTTACTAAAATATTCAAGGCAGTAGATAAAAATGGTTTAATCAAAACTTATATAGTTTCTTACATGCTTCC
CGATTGACCTCTAAAAAATAAAATTTTAAGTCATTATCTATTAGATTAATACATCTTAATGTGAATATGAATCTACTTTTATTAATTTTCTTTGAAGTAT
TAAACATAATTTTTAAAAAAGGAAAATATTAAAAAAGTATTGCGGAACAGGGTAAAGATTTTGCGGGTCGAGCTCAATCCGCTCCCATTGCCATCTCTAA
GGACACCACTACCCACGTGCGTACGACATGTCACAAAGAAAGAAAACATTCTATACATCAAAGTTATTTGATAGCTGATTTTTAAATTGTCAACAATATA
TCATATAATACGATTCGTATTATTTGTATACACGAATAACTTATTTTTTTCTATCTATCAAGGGTCGTAATCAATACATAAGTACCTTAATTTTTTTTAT
CAACCAACCGAATAACCAAACTGTATTTCTTGGAGTAATGTAAAAACAAACTTATAGCCAAACGCCTCGAAAGAGTTTTGAAATTTGCGATTTAAGATAT
TTCTTGACGAGTGATTATAAATCACTTTATTAAGAATAAAACGAAATTCTAAAAGCAAATTATCTTCAATTATAGATTAGATTAACAAAAGAGTTTAATA
TTATCCTGCTTTATATCATTTTGGTTCTAAACTTCCCTTTTCTTTTCTTGACTAAATAAACTATTGTAAGGTGTCTAATAAAATTGGATGGACATTGGAC
TCATGTGTTTATTTGGACTCACATATATGTTACAACAAGAAAAGTTTTATGTGGGGGAAGCTTTTTGGATTGTGTATTTTGTAGTGCATTTTCGAAGGGT
CCAACACAGATTCGACAACAGTTTTGAAAACTCTAGAGCAACATAGTCTCAAACACTCAACACACAAAATTAGAAACATCAGGTGGTTGGTATCAGGTCC
TTGATTTGTTATGCCACTAGGCTTACATTTACGAAGAGTGTTAACATGTAGTTGTCACTAGTAATTGCTTCTAAAAAACATATTCAGCGGCAATTGAACT
ATTATTACCGTTGATTAATGCCGCTAAAGATGATTTTTTTGTGTAGTGAATACATCATTATCAATGTATATAGAAAGTAAAGAGGAAAAACCATAACCAG
AAGAATTGGGTGAGACAACTTAATTTGACTTGTTGAGCCATTTTTCATTGAAGAGATGATATGATGGATCCCAATACAAATAATAACAGTATGTGAAGGA
AAATTGTTGTACTAAATCCGTCCTGTCCTAGCCTTGGTGGACAGAGTTACCTGGTACATGTTGTTAGTGGGAGGTGCCAGGTACCCCGTGGAATTAGTCG
AGGTGCAAAGAAAGAAAAAGGACTTCTCTTTCTCTTCTCCATTTCTGTTCTATCCATAACGGGTTGTACTGATCGCCTCAAAACTTCAACAGAATTTGAT
ATCAGCTTGATGAGCTCATAGAGTTTTTAAGACTTCTAAGGATACTCCACATGAACGTCGAAATAATGAATAGTATTATGCCGGTTATAATGGCATACTT
GAGTCCAAGATTCACCAACAAGTTCACTAGAAGGCCAGCCAAGACAACACCAACAAAGTTTGCTGAAACAGCAGACCAGAAAGGCATGTCGAGCACAGAA
GCTATAATGGCTCCTGTCCAAGCTCCGGTTCCAGGAAACGGAACTGCCACAAAGAGCATTAAACCAAGCCATTGAAACTCTTTCACAGGACCTGCCTTGT
CTTTGGCCCTCTCAAATAACAAATCCAAAAGCTTCGATGCAGATTTGTTCGTTCCAGCAAGGAAAATTGCTAACTTCTTTAAGTAGAGCACAATGAAGGG
GACCGGAACCATGTTCCTACAGATTGAGCACCAGTTCTTGATCATTAGCAAACAGAAAATAAGACACACTCCAAGTGCTACCATTTCCACTCATGTCAGG
TTAACATGGTCAGTATAGCTTCTGAAGTCTAACTAATGTAAAACAATGGCTATAGAGCTTGTTTGATAGTTACTTAGGGTTTGTTTGGTAGAATGTATAG
ACGAGTATTCATAGAGTATAATTAGTAATGCTGAGATTATTTCTTATCGGTGTATTGATTGAAGTTTTGTCTTTAACCATACATAACCATGAATTAGTAA
CTCTTGTATTGCTAATATCATGATTTACTATGTATTAGTTATACACCCTATAATACTGGATATGTGGATGGGATGTATAACTAATACATGTTATACACCC
CACAACTAATACAGGTATTGTTTTCTCTAATACATCCTACCAAACGACCCCTCAGTCATTGGGACACATTCTTCACCTTCATGTTTTTCACAGGCATCAA
ACTTCCAAAAATTATGTTCTCGTCAATGCAACAACAACTTGATTATCAGGTGACAATAGTCAAATCGGATTCAATTGTCAACTGTCCCTATAGAAAACAG
GATTGACCAACAAGTCTCAAGGAACTAAAGTTACATCTCTTTTCAAGAATTAGCTACTCATCAAAACACTACCTTTCACTCTCATATAAAGATTATAGCT
TCTGAAGTCTAAACTACCAAAAAACAATCATTAATAGACATCATTTTCACAGTAATTGATACTCCAATTACCAGTAAATAACAACTCGATCTTGCTTGTA
TATACATTTTTAAATAACATCTGAAGTACCAGTAGCCATATTCAAAGTTACAGCACGACAATACTCCTTTTAATTGCAAGCAACATATTTCATGCTGCAT
AGTTCATAAAACACACTTGAACTTGGCCTGAGTTAGCAAGTAAATACTCCAACTTTCAGTATAGACATCTAGACACCTCAATTCGTTTCCACCCTCAATC
GAATACTCCAACATACAAAATGACCATCTATACACCTCCAATATGTACGTGCCACATCAACATCGATTGTCCACAAGACACAATGGGAACGAGTTGGATT
GTTTAGTTATCAGTCGAGACTATATATGCACTTTCAAAATTGGAGTGCTACTTGCCAGTTGAGACCAAGTTCGAGCGTATGTTTATTATGTCTAATTCAA
ACTACAGAACAGCAAGTAAAAGAATACTTCCGAGGATGAAACAAAACATTCAATTCAAGGACTGTAGCAAAATGCAATCTTCCATTCAAATTACTGAATT
TAAAGAGAAACTGAAAAACTTACCCAAGAACAGATAAAACAGTCAACACACTAGGCTTAAGTTGTAACCAATAACCAACAGGAATTGCCCCACGAAGCTC
AATAACAGGAAGTGTAGCTAAAGCAAACACAACAGCCTCATCAGGCCATCCTGAACTCCTCAAAGCATTAGCAACTTTTACACCAAAACCTGAAGCCCGA
ATAGAGTCAGCAGCAGCAGCTTTAGCATCCCCAGAAACTGCAAACAAACCAACAGACACAGACGCCCATAACAACACCCAAAACAAGAATTTCAATGGTT
TTTCATCATTAGCCAGTAAACCCTCTTCTTCTTCAATTACTTCAAGAAAACTATCAGAAGAAGAAGCTCTAATTAACCTTTGAACACGACCCAGATGGCT
AAAAGTTTGTAATATTGGAAAAGATTGAGTCTTTAATTGAATTTTTGGATTTTGATGCAAGAAAGAATGAATCTTGGGGAATGAGAAAGATGGGTTAGTG
TTTCTATAAGAGAAAGTCCATAGCTGTGGAGAGTGGGATAAAGAAATAGCCATTTTGGGATGAAAAATGTACTGTAAAGTGTAAAATACAGAGATTTTAG
CTCATTTCTTTACACTATTGAGGTGCATTTTCATGGTGAATAATGAACAAAAGGAGGAGAATTTAGGATTTGGTATTTTGATAGGGTTTTGAAGATTTTA
AGCATAGGAAATATCATTAGGGGGGAGTAAACTATGTACAATCGATTTTTTTTTTTACGGAATTAATATTTTAAAAAGTCGCTCAATTAATTTAATTATT
TTAATATTTTTTTTTGGATGTTCACATGATATTCATTAGGACAAAAGAGTTTACATAAATCTACTTGATAATCTATGTAATGTATATATTGATTTAGAGT
CTAGTAGTCAACTCATTTTTGTGCCCCCTAATAAGCTAACATCAACAATTATTGAAGAAACAATTAGTACAAAATTTTTTAAGTAAAGGGTTATACTAGA
TGAGTGTCTCCCCTATGAGATACACCTATTTTTTTTTTTGTCTATGAAGAAGAAGAATGATTTTAGGAGTATGTATATTATTTATCTATTAAGTTTATAT
ATATTCATGTTGTGATTATATTAAATTTGAATTTACTTTTAAAAAAAATTCAAGTTGATGTAGGTCTTTTTTAAAAAATAACTTTGTATTTATAACTCAA
ATTCAAAATATTTAGTTGAAAATGAATGAATTTATCACGCGAATATAATTTTTGTTAATTTTAAAAAATCTCACCAACCAAAACTCAAGAACACTTAAAA
TGTTAAAAAAAGAAACACAAATCATCTTAATTAGTCAAATTCAAATCTTAAATACATTCTTTTTAAGATTTAAATATGTATCTAAATTTTCTTAATGTAT
AAATTTATATTTAAAATTTAAATTTAATAATCTCAATAAAAACAAATGAACTTCAACTGTTAATAATATATCTTTATTTAAAATAACCTTTATAGTTATA
CACAACTTTTACCATAAATAATCAAATATTCCATGAATCTAAATAAATCTATACTATTTCAGCATTTTTTAGGTTTCTAACGTAATTTCCTTTTTAATTT
ATTTCAAAAAAACTCGACAAGCTTATTTAATACAATTTACATCTTTAATATGATTTACGAATCGTACGAAAGAATAAATAGTCGAAGACTCCAAAAGCGA
TTAGAACCCAAAATCATGGGCCGCAAGAGAGAGAGAAGCCACTTCAATCGCCACGCACCGTACTCCTTCCCCAAGCGCCGCCGTCCAACACCGATCACCG
ACGATCCATTGCCGGTGCCGGAAGACAACTCATCGACCAACAAGCAACAGCCGGCTACTGTGGTGGTTATTGGTGTTCCTTCTGAATGCTCTGTGCTCGA
CATTAAATCTCGTTTTGAGATTTACGGATCCATCTCTCGAACTCGTATGGACCCTAATGGTCTTGCTCATATCACTTACCGTTCTAATGATTTTGCTCAA
TCTGCTGTTGAAGCTGCCGAAGATTCATCTTTTCCCATTACTCTCCACTCCAAGCCTGTACGTCCCTTTCTCCTCTTTTTTTCTAATATCTTCTAATTGT
GGAAATTTGTGTCAAGTTTGCTTCTTTTTGTGTTAATTTCACCTGGGTCTGTTAGATGTTTGCAAAATTGAGTCTTTGTTTGCAAATTTGAGTTTTTGAA
TTTGTTATTTATTGGCATCTTAGGGTGTGCCTAGTGGTCATTAATGTAGTTGAGAGCGGTGAGATCTTAGGTTCAAATCTCAGCATGGAGATAATAAAAA
CTAGGTGGTTGGTTCATCGTCCTAGCTTTGGTGAGCAGAGTTAACCGGTAGTAGTGATTGTTTCCATCAGTCCTAGCTTTGGTGGACAAAGTTACCTAGT
AGTGGGAAGTGACAAGTATCCGTATGAAAGTTGGTAGTGGGAAGTGACAAGTATCCGTATGAAAGTTGCTAGTGGAAGGTGGCACGTATCCCGTGTGAAA
GTTACTAGTGGAAGGTGGCACGTATCCCATGTGAAAGTTGCTAATGGGAGGTGGCAAGTATCCCGTGTGAAATTAGTCAGCCGGATATCACGGTCATAAA
AAAGTTGTCATTTTTGGAATTTGAAATTGAATTTGGACATAATTTTCTTGGGAAAAAATTGAAGTTATGTGAGTGGAAGTCTCAAAAATTCAAAAATTTG
GGAACTTGAAATAGTTGAAGATTAGATTATAGTTTCATGATCAAACGGATATTTGAAGATAAAATTTCAAAAACTAGTCCCAAAATCTATGGTCAAACGC
TAGCTAAATTCTTGGTCATAGCTCGGCCAAGAATTTTGGCATGTGGGTGTTACTTTAGCTGGTATAATTGATTTAAATTATATAGATGGGCAATGTAAGG
TTGTAGCATGTATACACAGACAATCTATATAATTTTTGCACAATCAAGGTAGAGTAACACATTGTAGCATGTTAAATTCCATCCAAGATGTATTTTTTAA
AGTAAAATTAAGAGCTCATGTATTGCGGCATTACTTTTGTTGGGGATGACAGGTTCAGGTAATATGGGCAACTGACCATGCATCGCAGTGGAAAGAAGGT
GTGATGAGAAAGGATGAACTATCCACATCAACGGTTGCATCAAAGCTAGTTAAAGCAGAAGTGCCACTAAGTAGGCACGGAAGAAGTAATCGACTGGGAT
CAGCAATTGTGAACCCCAGAGATGAGGATAATGATAATGCTGGCGGTAATGTTCGTGCACATGTTAGTACAAGGCTGGTTGAGCCTTACAAGGGTAGGGA
AATCGTTGCCTATGATGATATTTTGTAACTTATGGTCGTTGTTTGAGGGATTGCCTCACTTGTAACATTAGCTATATGGCTTTAGGTAAATGTTGAGTTT
TTATTGCAGATTAGTTGGGTGAGTTCAGTTCTAGTTCTTCTTTCAATAAGGTTCCTATCTTGTTTGTTTTTCTTCTCTGTGGAATACTAGCACTAAAAAA
CGATCATGTACGTAAATTGTTTTTTTTTTCATTTGAGTATGTAATTCATGTAGGCTTCTCTCTTAGCAAATAAGATGCTGGTCCTTGATTTTGTTGAGAA
GATAGATGTTTCTACACTTTAGTTCCTCAATACTTGTACTTGCAGCATACTGCGTGGAAGAAGTTTGCTGCGTTGATGAGTTTTCACATTACATTTTTAG
GCTTCTCCTACACAAAGGGGTATGTAGAAGAATCTTCTTTTTCTGATGGCTTTTAGCTTGTGTAATATATAGAAGGCAGCCACATAATCTTGTTGAGCTA
ATTCACCCTGTGTTAACTATCTTTTCTGGTAAGTACTGATGACACATTTGAAACCTTCTTGTTGACTGTTTTGGAGACATGTATGGGTTATGAGAGTTGA
GCATGATGTCTGTAAATGTTGATCAGATGTTTGTGGATGATGTTATTGTCTCGATTTTGAACAGTTTTTACTAGTAATAATGTATTACATTGATATTGAG
TGGTTAGAGAGTTGGAGCATTGTATTTTGTTCTTTAAAGATGATGCTTGATTACAGGTTTCTTGTAGTTTGGTGTAGGCCTCCTCACCCTGCTTCTTGCT
TTGTCGCTAATTTGGTAAATACCTTTCTTATCCATAGGAAGAAATGTCATTTTGTTTCAAGCATAAGTGATTTATAATCTTTCAATGTTTTCTTCCATAA
AATCCTGCCGCAGCAGTACCAATTTAGCTGGGAAGGTTCATGCAAGATAACTTGAAAAGAGGAATATTTTACCTTACTGTCTCTGTTCTGCTATAGATTT
GCTATTTATGTTTTGCAGAATTTTACATAAGAATGATTTGCACTAACATCAATTAGAAGGTATCACTGTTCATCCTTTGCTCATTAGGTGTGATCGTCGT
AAGGCATTCTCTGGGAATGAACTAGAGAATCAGAGTTAAGAAGAGCTTCAAGGTAACTAGTATCAAATCATACTTAACCTGTAAGACATATGAGGTATGT
TGCTTGGACTCTTCAAAAATGTCAACGGTGCGTGTTGGATTCGCCAAAAGTAGTGTATTTTTGGAGAATCCAACATGGGTGCGGCATCAAAAGTGAAGAC
TGAGGGATGACATAGATGTTGATAAACTACTTTTGACCTTGTTGGGAGGATTGTACAGTTAATGGAACTCATGGGCAAGANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAGTATGTAATTCATGTA
GGCTTCTCTCTTAGCAAATAAGATGCTGGTCCTTGATTTTGTTGAGAAGATAGATGTTTCTACACTTTAGTTCCTCAATACTTGTACTTGCAGCATACTG
CGTGGAAGAAGTTTGCTGCGTTGATGAGTTTTCACATTACATTTTTAGGCTTCTCCTACACAAAGGGGTATGTAGAAGAATCTTCTTTTTCTGATGGCTT
TTAGCTTGTGTAATATATAGAAGGCAGCCACATAATCTTGTTGAGCTAATTCACCCTGTGTTAACTATCTTTTCTGGTAAGTACTGATGACACATTTGAA
ACCTTCTTGTTGACTGTTTTGGAGACATGTATGGGTTATGAGAGTTGAGCATGATGTCTGTAAATGTTGATCAGATGTTTGTGGATGATGTTATTGTCTC
GATTTTGAACAGTTTTTACTAGTAATAATGTATTACATTGATATTGAGTGGTTAGAGAGTTGGAGCACTGAGAGATCCCCTCATAATTTCCCCAAAGCGT
AACCATGTGTGAATAAATTTTGAGCTAGTAGGGTTGCAGCCACGAGTAAGTCTTCCCTTGTTATTGTGTAGCCAGAATGCCGCAAAACTTCCATGCCTAA
GCGAACTGTTGAGAGTACGTTTCGATTTCTGACTGTGTTAGCCTGGAAGTGCTTGTCCCAACCTTGTTTCTGAGCATGAACGCCCGCAAGCCAACATGTT
AGTTGAAGCATCAGGGCGATTAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCGTCTCAAATCTTCATTGAATTGTATACAGGATGTGACTTTCTGAGATGATAACTATTAGTTGAGTGATCAACC
ATATTAGAAATCAAATATCATACTCATCTAACGTCTCAAATAATTTTCGTTGAATTGTATATAGGATGTAGCTCAGGAATATGGGGTTCAATCGATGCCA
ACGTTCGTGTTGATAAGGAAAGGGAAGGTTGTTGACAAGATTGTGGGAGCAGATAAAGATGGACTAAAGATGAAAATTGAGAAACATAAAGCTATGTTCA
TGTAAGAAAATTAAACCTAAGTGTGCAACAAATTTAAGCAGAGTTTGATGGAATGACACTTTCCATGTAGAATAAGACTTCATATCTTTTATCACATTTT
GATTGAGAGAACACAGCACATTATTGTAAACTTCACATTCAAGAAGCTGACTAAAGCACTAATGTTACACATTTGCTTGGTTTGAGCAAGTGTATTTATT
CTGAGTTTTGTGTTCTTATAATGTCTTTTTCCAAATCCAACATCCTATAGTCATACCGTGAATTTAGAATTTGAACTTTATGAGCTCAGGCGGTTCAAAA
TCGAATCAAACTGATAACTCGAATCAACAATAAGTTATTGATTTATAATGATAATGGATTATTGATTTAGCGATTTTGATAATCGTTTTAACTTTTTTAT
TATCGAGTTATTGGTTGTTAGAGGTTTTTTCTTAATGGTTAACTGATACTCGATAGTAAATTAATAAATTATATTTATACCATTCGGTATATCAACATAA
TTAGGGTTTAGTTTCTTATTATTTTTGATTATTGGGTTATTTTACAATATGTTAGTGTTTGCTTTTGAGCACTTTGCAATCTGTCAGCTGATCATATGTA
TGGTTCATTTGGTTTGTCACATTTCTGTAAAGTGATTTTTTTATGTGTCAAATCTTACCGTTTAAATCAATAATCGAACTGATAACAATCAATAACCACC
GATAAATCAATAAAAGATAAGCTAATATCTTAATGATTCTGTAGTAGCTTAACACTGAGAGATCCCCTCATAATTTCCCCAAAGCGTAACCATGTGTGAA
TAAATTTTGAGCTAGTAGGGTTGCAGCCACGAGTAAGTCTTCCCTTGTTATTGTGTAGCCAGAATGCCGCAAAACTTCCATGCCTAAGCGAACTGTTGAG
AGTACGTTTCGATTTCTGACTGTGTTAGCCTGGAAGTGCTTGTCCCAACCTTGTTTCTGAGCATGAACGCCCGCAAGCCAACATGTTAGTTGAAGCATCA
GGGCGATTAGCAGCATGATATCAAAACGCTCTGAGCTGCTCGTTCGGCTATGGCGTAGGCCTAGTCCGTAGGCAGGACTTTTCAAGTCTCGGAAGGTTTC
TTCAATCTGCATTCGCTTCGAATAGATATTAACAAGTTGTTTGGGTGTTCGAATTTCAACAGGTAAGTTAGTTGCTAGAATCCATGGCTCCTTTGCCGAC
GCTGAGTAGATTTTAGGTGACGGGTGGTGACAATGAGTCCGTGTCGAGCGCTGATTTTTTCGGCCTTTAGAGCGAGATTTATACAATAGAATTTGGCATG
AGATTGGATTGCTTTTAGTCAGCCTCTTATAGCCTAAAGTCTTTGAGTGACTAGATGACATATCATGTAAGTTGCTGATAGGTTTCCAGTTTTCCGCTCC
TAGGTCTGCATATTGTACTTTTCCTCTTACTCGACTTAACCAGTACCAACCCAGCTTCTCAACGGATTTATACCATGGCACTTTAAAGCCAGCATCACTG
ACAATGAGCGGTGTGGTGTTACTCGGTAGAATGCTCGCAAGGTCGGCTAGAAATTGGTCATGAGCTTTCTTTGAACATTGCTCTGAAAGCGGGAACGCTT
TCTCATAAAGAGTAACAGAACGACCGTGTAGTGCGACTGAAGCTCGCAATACCATAAGCCGTTTTTGCTCACGGATATCAGACCAGTCAACAAGTACAAT
GGGCATCGTATTGCCCGAACAGATAAAGCTAGCATGCCAACGGTATACAGCGAGTCGCTCTTTGTGGAGGTGACGATTACCTAACAATCGGTCGATTCGT
TTGATGTTATGTTTTGTTCTCGCTTTGGTTGGCAGGTTACGGCCAAGTTCGGTAAGAGTGAGAGTTTTACAGTCAAGTAAGGCGTGGCAAGCCAACGTTA
AGCTGTTGAGTCGTTTTAAGTGTAATTCGGGGCAGAATTGGTAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATTTTGTTGTCTGATTATTGATTTTT
GGCGAAACCATTTGATCATATGACAAGATGTGTATCTACCTTAACTTAATGATTTTGATAAAAATCATTAGGGGATTCATCAGAGCTTAACATATGATCT
ACAAATTGATAATCATTAAGTTAAATCGATAAATATCAAAATGGGACTGAACTGCTGATATGCAACCCTAGTTCAACGTACCACTAACCTTACTAATCAT
TTGCATTATTGGGTTCAAAATTTAATATTGTTACATATTTAGCATATTTTTAACACAAAAACAAAGTCTGAGTCAAAATTACTGAATTCGTCTAAATGCA
TTACTCATACTTCATCTGCTTCAATTCGTTTGTTTGGTTTTATTTAGACATGTAATTTAAGAAAGCAAAAAACACTTTTAAATACTATAGTCTAAAACTA
AAGATATGTCAAATCTATCAAAATATTCTTTAATATATTTTGTGATCTTAAAGATGCTACATGAAAATTTGAGATTAACGAATTACCCCCCCCCCAAAAA
AACACTTTTTTAAATCGATTAATAAAGAAAATTAAGACAAATAAATTGAAACGAGAAAAAATTATGATTCCTCATTCCTTCCCAGCCCCTCAAACCTCAT
AAATATAGAAGTTGTTGGACCTTTTTTATACAATATTGTTGTACAAACAAAAATGAGAAATGCAACTTTTCCATTTAAAATGTGATAGGATAANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACTTT
AAAGCCAGCATCACTGACAATGAGCGGTGTGGTGTTACTCGGTAGAATGCTCGCAAGGTCGGCTAGAAATTGGTCATGAGCTTTCTTTGAACATTGCTCT
GAAAGCGGGAACGCTTTCTCATAAAGAGTAACAGAACGACCGTGTAGTGCGACTGAAGCTCGCAATACCATAAGCCGTTTTTGCTCACGGATATCAGACC
AGTCAACAAGTACAATGGGCATCGTATTGCCCGAACAGATAAAGCTAGCATGCCAACGGTATACAGCGAGTCGCTCTTTGTGGAGGTGACGATTACCTAA
CAATCGGTCGATTCGTTTGATGTTATGTTTTGTTCTCGCTTTGGTTGGCAGGTTACGGCCAAGTTCGGTAAGAGTGAGAGTTTTACAGTCAAGTAAGGCG
TGGCAAGCCAACGTTAAGCTGTTGAGTCGTTTTAAGTGTAATTCGGGGCAGAATTGGTAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATTTTGTTGT
CTGATTATTGATTTTTGGCGAAACCATTTGATCATATGACAAGATGTGTATCTACCTTAACTTAATGATTTTGATAAAAATCATTAGGGGATTCATCAGG
TTGGAGCATTGTATTTTGTTCTTTAAAGATGATGCTTGATTACAGGTTTCTTGTAGTTTGGTGTAGGCCTCCTCACCCTGCTTCTTGCTTTGTCGCTAAT
TTGGTAAATACCTTTCTTATCCATAGGAAGAAATGTCATTTTGTTTCAAGCATAAGTGATTTATAATCTTTCAATGTTTTCTTCCATAAAATCCTGCCGC
AGCAGTACCAATTTAGCTGGGAAGGTTCATGCAAGATAACTTGAAAAGAGGAATATTTTACCTTACTGTCTCTGTTCTGCTATAGATTTGCTATTTATGT
TTTGCAGAATTTTACATAAGAATGATTTGCACTAACATCAATTAGAAGGTATCACTGTTCATCCTTTGCTCATTAGGTGTGATCGTCGTAAGGCATTCTC
TGGGAATGAACTAGAGAATCAGAGTTAAGAAGAGCTTCAAGGTAACTAGTATCAAATCATACTTAACCTGTAAGACATATGAGGTATGTTGCTTGGACTC
TTCAAAAATGTCAACGGTGCGTGTTGGATTCGCCAAAAGTAGTGTATTTTTGGAGAATCCAACATGGGTGCGGCATCAAAAGTGAAGACTGAGGGATGAC
ATAGATGTTGATAAACTACTTTTGACCTTGTTGGGAGGATTGTACAGTTAATGGAACTCATGGGCAAGATGTACTTGTATTGATTGTTCTTTTTAGAGAT
TCACCAGCCAATACGTTTTGAGTTATAGGCCAATCTATGTTTTTAGTGAATGAAATCATCTTGTTTAGAAGTCAAATATGAGCCTCGTAAATATTCATAA
CTGAATTTGAAATTCTTTCATCTGTTTTGGGATATAATAAATGTACTTGAGGGGATATATCATAGAGAATTCAGAATTATTGACAAAAATCATATCTTTC
ACATATAACTTTAGAACGTACTTGTACAAAAATTTGTCAAGGTCTAGAAAGTAAACACAACTGTTATCTATGGAGAAAGGAGAAAAAAACAAAACTCTCT
ACAACAAATAGGTCTAGTGTTGTACCATTTCTCTGCAGCAGTAACAACACAGCATGATGACTAAGAAGTAGTCATCATTCTAAACTGATACGTCGCATCT
TGCAGACGAGGTTAGCAGTAGGAAGATCAAGCTGATTCCCAGAATCTGACTTTATAAGATCCTTGAGCTGATCTTTAGGTGTTGAAAAACATGTCTGGAA
TGTAGCAAGACATGTAGGAATTGGCATTGATAGAGCTGATAGTACATTGCTTAGATACTCGATATCAACAGAGAGTTGTTGTGCTCCACGATCTGTTATA
TACTGGATCCCTCGAAGCTGTTCCATGTAAAGTGCCGTGGCACCTTCAGCAACCTTTTCAAAAACAGAGGCAAAGGAAATAACTGTGAGAAGAAACACAC
TTGGAGACGTGGATTCGTAGAAAGAAAAAAGAAAGCACTCTGCAAAAGTAGTTCCTAATCAAAACTCCGCCTCTACATGGTGGTGTTGCTGACCAGGTGG
AATAAAGCTCAGTTGATAGCATACTTGTAGGTAAATGCTTAACACTTGATTACAAAATATATAACTAAAACATATATACCTTGAACATCCATTCAGTTGC
AAAGTACTGGGCTTCATCAGCATTGGGATCGCTGTTGGAAATATTCTCTACAAGTGGCTCTAGTTGTTGGGGTAACGTAAGGAGATATTCACCAACGCCA
GTCACATAAGATTGTGGGTATGAACTGAAGGTTGGGAGGGGCCTTAGACTATGTTCTTCAACAGATGACCATATGGGCAGCCGTGACAGATCATTGAACT
GCTGCCGTATTTTTGAAATAAGAACATCGTAAACAAGCTCATTGACTGCGTCTGAGAAAGCTGTAACTCGTTGTGATGCTACTGGAAGTGCATGGAACCT
GGGATCTTTAGACTGCAGAAGGCACAAAAAAGACGACGTCAAAGTGAGATCAAATTTTCATTGTAGAAGATTGGCAAGGATGCATTGAAGGAATAGAATT
GCTAAGGAACTCAAAAAAAAAAAGCCAAAACTTCCACATATGTGTAACTATTGTGGGAGCCACTGACCTGCTCCAATAAATTAAGAAGCTTCCGAGCCTT
TTCAGGAATATCCACCAGTCTCACAGCTGCCACATCCAAGGCAGCTTTTCGAGCCACAGATAATTGCCCATTTCCATCATCATTGACTATATCTGGCTTG
TTCTGATCAATACTTGACCCAAAAACTGAGAAAGAGAGGCTTGTACTCAACCTAGCAAGAGTAGCCTTGAGGGAAGCTTCAAAGACTGAAGATCTGCTGG
TTAAACAATCAGCAACAGTAAGGATCTGCAATGCACCTTGAACAAATGACCACTCCTCCTCACTTGATGTGAAGTCAACTTTACGTGCATTTGAAGCTGT
TTCCCTTCTTTCTGATCCTGCATCTTTCTTTGTACTAATAGCATCCACATCCAGTCCACAAACAGCTCTCAGTGATTTTACATTCTCCTGCAAAGTGGAA
ATATACTGTAGCATGACATCATCCAGCACGAGAATTAACTCATCCACCTCAGAGCCACCAGTAAAGTTGATGCATCTTTCAACTGCTGCCTCAAGAAGCA
AAATGACTTGTGGAATTGACTCTTCCATCCTTCGTACAGTTTCACTAAGTTCAACTCCCTGGACTCCCACAAGAGTAACAGCAGCTCCTCTGAGATCAAG
TCCTGCAATCTCACTAGAGAGAACTGCACGCTCCATCTGTCCATATCTAGATCACAAATTTAAAAGCATTTAGGATACACATACTTGATACTGAAAAGCA
GATAACCTTGCAATTACGCTCCAGATCCTCCAATGGCACCAGACGAAGTACTTGAAAAACATGCTGAACAGTCTAACAAAACCACCAAAACCACCCAACA
CGTTATCTTTACATGTAAATAGTCAATACTTCTGATTGTACCAGGATGATGATATTTAAGCAGGAAACCTCAAGTTAATTTACCTACAAGTTGATACTTA
CAAATTACAACCAGCTCCACCTATGCTTCATCTAGCATAAAGGTCAAGGATGTGAGAGAAAACAGAGTGATGTAATATCGCATATCACAAGATACTGAGT
AGTCATTATTCCTAAAAACACTTCCATAAAAGAAATGAAAGAAGAATCAACGGACCCATATTGCTACCCTCATCAAAAGCACTAAATTTTGCAACTCAGT
CACCTAGAAGAGAACGAACTTCTCCAACTCAATAATCTCCAACTTGAAAGGACTACGGCTATGTATACAACTTACGTGATGATGATATTCAACTCAATAA
TACAAGACTTGAAAGGACTAAGGCTATATATACTACTTACATGATGATGGTACTCAACTCAATCACACCACAAAAATGCGTTTCAATCAAATAAAAGACC
TTCGCATGAGAGCCAGTGTACTGCTCCTCAAGAGAAAGCACCAAGAAAAATGAAAAGAAAAAAATTGGTATCTGGACAAGGGGATGCCATATGCAGCAGG
AAAAAAATGTGAATTTGAGAAGTCAAAAGGGATAAACAAGAATATTTGCTTTTTGTATGCTTACCGCCTTTTGAAAAATTCATAAGGAAGGTACACTGCC
TTCAGAGCATCCAGAAAAACTTGAGGATCGGCATCTGAAAACAGGTGTTGAATGTTCCTAGCAAAGCTCCCTGTTGTATTATGAAGTTCAATAAGGGCTT
CCAAATGTTTAGTCTGAATCTTGGCACCTTTTGGCAAATCTCCATTTGAAATGTCAATTATACCTGAAAGTCAATGCAAAATCTGAGGCAGAATGGATGG
AAAACATCCAAGAACTTTGTTATCCAGGTATAGCGATAGTGACATCCAAAAACAACAAAATAGGGAAATTAGAGCTGAATCTTGCATGCATAAATTGGTG
ATAGTGACATCCATGGTTGATTTGCACGCTCAAAACTTCAATTTCAACAATCCATGTATATGACTAGTTTAAGCCATTTATATGCTTGTGAACTAGTTGG
ACACCAATTCTTCAGAATGTTTGATGAAACAGAGAAGGCAACATCATAACAGAAAGATCAGAAAACACGATAAACTTATGCTTAGATGAAACTACATGCA
ACTGTGAAAGAGAACAAGAAGTTATTCAGATCATGGTTCTCAAAAACTCCTAAAGAATAATAAAACCTCACCTTTCGCCAAGGTTTTTGTCTCAGTCACG
GCATCCCCAATGGCAAGATTGATCTGTGATGCAAAACTCACACCAATAGTTGACATTGCTTCATTTAGTAGGCTTGGTACAAGAGTTCTGTATTCTTCTG
GAAAGGCAAACATACACCTGCAACAAAAATATCTATTGTTCACTAGAGGATCATTAAATGGAGATATCAGGTTGTCTCCTCATTTTTATTACGATTTCAG
ATATCAATTTTCCACGTGTATTTACTCTAGTTCCTGCCACTTCAAGATACCGTGAGCAATGAGAAGCACACCTAAGCACTTTCATGACTGCAATGAAGTA
CCACTTAACTGAAATGAAACTCCCAACCTGCAATGCACCTAAGTTTCAGTACTTAGGTGCGCCTGGTGCCTCAAGGAAGCCTTTAAAGACATTGTTTAAA
CCCTGGACCTCCAGGTTCTTACTCTAACGCCTAAACCCAGCCAACAACTCGTTTTGGGACGTTTATCCATTTCATTATAGTAATCTTTTTATTTCCTAAG
TTGTACTCGAATAAGAACCAATATCGAGATGTCAGTCTAGAATATAAGAATGCTTAATCAGTAACCTCAATTAAGACAAAATTAAAAAATCTGAAAGCAA
GAGAGCATATGACTTCCAATCTCTAGGAGGAAAACAAAGTAGATTTTTCTTTCTTTTTTCATGAAAAAGTACCAAGTGAGTTAGCTGGCCCGACATAAGT
TGGTCCACAGTTCAAAACTCTGGAGAATATAGCTTTCCCTCTACCCTGCTTTTACATAAATTCCAGGCAACTAGTCAGTGGCAGGGTTCTAACCCGTGAC
ATGCGCCCCATTCACACGTCTCACATTGTGTCCTTCCACTGAACCAAAGTCCTAGGCGCAAAACTAAGTAGAATTATCTAAGAAAAAGTTGCAGAAAAGC
TATTCGTACCACTTCCACTCCTGTTCAAGATAAAGCAACAATTCATCGTAGAAACTAGTCAGCCAACTTGAGAATGATATCATGGACGGTTGAAAATCCT
GAGAATTTGATAGTCTATCCATTTCACTTTTTTCATTGGCAACTTTATTGGCCTGCTGCCTCAAGTCAAAATCTTCCCAAAGCCGCTTTATTGGCTTAAG
GTGGACCATGGTGTAGTGCATCTCTAACGACTTGAATCTCCCAATTCTCAGAAGAATCGCACGCATTTCTTGGGCAACATCAACCTACAAAATAGCAACA
AGCGTTTATTACAGTTCTCTTAAAGATTTATGATGCAAGAATGCATTCATTTAAAAACATACAATATAACCTTTAGAAAAGGATTACAAAGGAGAAAGAG
AGCTAAAGTAACCTTTCGATTGCTTAGAGCATCTGTCAGTCGAGGTTGGACAACTGAGTCTAGTCTGTCTTCTAAAACTTCTAGTTGCCTCCTAATATTG
GCAAATTCAGCAACCTGAAATTGCAAAAGACTTAATAAAGCAAGAACTATTTCACTGCACATACCACACACATTGGCATGCTATGTAAAAACAAGCAAGT
CGAAACTCACCTCTCCAACGGCAGACAAACAGTGCCTCATATTAGCCAGAGTTTCTGCAGCTCGTGGAAGGTCACCACTAGCAAATACCTCCTCCACTGT
TGAGCTTAATTGAGTTAAACCAGCAGCATCCTTCAAACCAGAAAATTCAAGTATTTCGAAGTCATAAAATCAGAAAATTAGCATGAAACTGGAATAATTG
CTAGTGTTAAATACAGTGAATGATTTCATCTAGAGTTATGAAAATATTACCTGCAATGTCTCATATGCAGCTTCCATTCTCCGCTTGACCGTATCAACTT
TTGCTAATGTAGCTACAGATTCAGCAGATGATCCCTCAGCCTGTGCAAAGGAATCAAAGTTATGAGATAGGAAATGTGTCATTGCTTTAATTTCAGTGAA
GCAAATGATGCAATAACAGAAAATGTAAAAATGTAGGGGAAAGAGAGAGAACTTTTTTAAGTTTTTGGAGGATGGCAGAGAGAGAGGAGCGAAGGGAGAG
AGCATCGTCACGAAGGCGGATGACATCTCGATTAGCGCGGGGGACACGGAGGAGTGCGGCGGAGCTTTGCTCCTCCAGGGAAGCGGCGATCTCTTCAGAC
ACCATCTGAAGCTTCATTTCCAGATCTATCAAGTGTTTGTCCAGTGGATCCTGTGGATGCCGTGACTGGCACGCTGAGTTTATCCATTTTTTCGGATCAA
ATTTCTCGTCGGAGAAGGAACTCAGATCCACCATCATCGTTGCCGCCGATCACTGGTAATCGCCTTTGCTTTGCTTAGACAACGTCTCAAACCACCACAT
TTAGGACCTGTTTGGAAAGTGAATTTTTTTGCTTTGAATTTCTGTTATATTTGTTTCACTAATATTTTACCTTGCGAGTTATTTATTTTTATTTAACTTT
TAATAAATTATTTTTTTAACAAATATTCTTATAATTTGATGACATCAATATTTTTATTAAACATATACTTCATGTTCATAAATTTTTATTAAAATTTAAT
AAATTATTTTCTTATCAAATACTTTTATAATTCGATGATATTAATATTTTGTTAAACGTATATTTCATGTTCATATAAATTATGCACTTTAGATTTTATG
ATTATTTTAATTAAAATATACTATTTTAAAAAATATTATAAGATTAATTATTTTTAATTTAAACAATTAATTTTTTTTAATTTAATATTATCTTGTGATT
CTATAGTGCAATTAAATAGTATATAATTATTGAAAATTCTAAAAAATATTTTTTATTTTGATTAACTAATTAAATTGAAATATATTCGGATTTAATAATA
TAAGTGATATATTATCTCTAAATCCTATTCAAATTTAGAGAGTTTCAACACTTTTCGCTTTATTTTATGTTTCTATAAGAATTCGATTGCAGATAAATTA
AGTTTAGTTATTTAAATATTGAGATATTTTTAAGGATATCGATAATTTAAAAATAAAATTAATAATTAGTTTTTAGGTAGAAAGAAACTTCTATTTGATA
AAATTTAAAATTAAATATAGATTTACAAATAATTCTCTCTCTTTTTAAGATTATCATAAATCATCTCATTTACTGCAAAATCAAAGTTGATAAAAGTACA
TGATTGATGGAAGAAACCGAAAGAATTAAAAGCAGAGAAGAAGAAGAAGAAGAAATATGGAGCTGGGGAGCAGGAACAGAGGGACAATTAGGAACAGGAG
AACTCCAAGATGAACACAAACCTCAACTCATTCATTCTCTTTCTTCTTTTGGTCCTATTTCTCATATCTCTTGTGGTGGAGCTCATGTCATTGCCCTTAC
CCCTGGTATGATCTTTTAATCTACTCTCAGAACTTATATTCTTGATGGGGTTTATGGTTTTTCAGTAAAGATGACATCTTTTTTCGTGTGAGATTCGAAT
TTGTGTATTTATGTGGTTTTTACTTGATGGGGTTTGAGTTTTCTTTTTTTGGTTTGGGATTAGGAGGAGGGGAAATAATTACAGGATGGAGAATCGAATT
CTTATCGATATGATGAATGTTCATGTATACAACTAACTGAGCTACTAAGATTTCTCGTGTTTTAAGGTTTTGCAGTAAAGTTGACACCTTTTTTGTGTGA
GATTCAATCTGTGTATTTTCTACTTGATAGGGTTTAAGTTTTATTTTGGAGGGTGGGGTTAGGAGAAGGGAAAATGGGGAAAGAAATACATAGTAGAGAA
TCGAACCCTTACCAACAAGGTGAAAGTTCATGTATCCAACTAATTGAGCTACTAAGATATAGCAGGGTTTAAGGTTTTGGAGTTAAGTTGATACCTTTTT
CATGTGAGATTTCATGAAAATATATTGACTTTTTAAAGAAGGAAAAATGAAAACTTTGACAGTGTCTCGCGGTTAAGATGACACCTTTTCGGTGTGAGAT
TCAAATTCAATGGGACGAAAGAATGAAAACATTGATAGGGTTTCGCAGTAAGGACGACGCAGTATTTGGAGTTGAGCTTCAATCGAAATATTATATCAGA
AAAAAGTAAGAAGAGATCTTGATGGGGTTCTGAAGTAAAAATGGTACCATCTTGATGTGAGCATCAATGGAAATATTGTGACTTATTTGTTTTAATAAAA
AGGAAAATACTTGATGGTGTTTAGATGAACTTCCACAGAAAGAGAAACAGAAAAAGAACAAGCTTGTTGGGTAAAGATATCATCTTTGGTGTGAGATTCA
GTAGAAAGATTTTTACTTTTCAAAGTAAAAACATTTTTGTTGGGGGTTTTGCAGGTGGAAGAGTGCTAACTTGGGGGAGAGGTACTTCAGGTCAGTTGGG
ACATGGGGAGATGGTTAACTGCTTACACCCAAAGTCAGTAGAGTATTTGGAAGGTATCTTCATTACACATGCTTCTGCTGGATGGAATCACTCAGGATTT
GTTTCAGGTTTCATTCTCTCTGCTTCAGCTATCAATCTAATGTGATATTTGGATTGTTATTTTTCGTGCTATCACTTTTTTGGTTCCAAAATACTTTATT
TCAAGTTACTCAGTTGGTCGTATTTGAATATTATTAATTATATTGTAATTGGAAGTCCATGCATTGAGATTCCAATTATGTTTCATGAGATTTCAGTTAT
GTTTTCCTATGTTTTCTCCACTGTCGTAATTCCTTTTTCAAAACTACTTTGATTTATTTCACTTGAGCCGAGGGTCTTTTGGAACTGATGTGGGATTACA
TTGGATATGTTGTTGTTGTTGAGCTTCCCAAGTTAAAGTTAACTCCTTCACGCTTAGGGTACATTGAAATGTGCAGATACTACAGCAGAAATTTGTATAT
CCTTGTTCGAAGCCATCTTTGTGCACTAGGTTACTCGTAAAGGTCTTTTCCTGATGATACTGAAAGCTTTTGGGAAACAGATGATATGAAATTTTCCGTC
ACCATTAATAGGAAAAAAAAGATGATATGAACTTTTGAAACTACTTGTTGGTTTAGTATATTCCTGAATGTTTTATGTTCTCTTGCTGCAATTTGAAGAA
TTGTGGTATATCACTGGAGAAATCTTGTTTAATTGATTACCTGTTTTAATTTGCCTTTGAGTGTAAATGTTCTACAATTACCAGATACTGGTTACGTATT
CACTTGTGGAGATGGTTCATTTGGTCAGCTTGGGCATGAGGATTATATCTCAAGATGTTCTCCTGCACAAGTGTTGCACTTCAAGGCTAGGCATGTCGAG
CAAATTGCTTGTGGTATGCGTCATTCACTTGTATTACTAAAAGGTAAAGCAGGCTGAGTATTGCACTTTTTGTCTATCCGGTTATATTAACATTGTAACA
CTGTTGCTGCTTTCGGAGAACGCTGTGTGCTGGATCTCTGTTCTCATTTGTATAACTGGCCATAGTTTTGTCATATTCCATAATAGTGTGATAGTGCTTT
GAAGCTTCTCTTAAAACTCTCGCTAATCACTATATGGGTTATTGCCATGAGCTTGAAATGAAATCAAATTGTTTTGAGTTGTGACTAGTCACAGCAATCA
GGCCTTTTAACATTAGAACTCCAGATATTACTGCATGGTTGCCAATAGTTTCTTTATTCTCATTGTGACAACAAAACTACAATTAATTCAGTGTGAAATT
CTGCGTTCTCTCTTACAGTTGTGGAAAACGGAGTTCTTTAGCTACTTCTCTACTAAAATTAACATCTGATCTGCACCATCATATCATTAAGCTGGTTTTA
TGAGATATGTCACAAATATCATAATCCAGTAAGAATAATATAAATGAATTCTGTGTGTCATAGTTAACGACACAATTCAAGAACAGATTACTCGTTATCG
TACATTACTTAATAATTTCTATATATCTGGTCTCATATCAGGCAATCACCTTGTTTGGATAGAAAAAGCAGGTTGATTGCTTGTTCATACACTTTTCACT
ACATAAGCATGTACATTGAATTTGTTGAAGCTGATTTTTCACTCCAATCAACTTCTTAGGAGATACAGAGGATCTTATATACGGATTTGGTTCCGGAAAA
CGTGGTCAACTTGGTATATCTGATGACAAACTGAAGTCAGTTAGCACTCCTCAGGTTACTTTGGGTTTTGAAAATGTCAAAATCAGGAGTGTCACTGCAA
ATGGAGATCACAGCGCAGCAATATCCAGTAAGTTTTAAGTGCTCTTATGTAATCTAATACAAATGATACTGGTCCAACCTCTATCTGGTCTCAGCATTCG
CTACTTGGTGGTTGTAGCTTCGTCCCGTTAATAAATGATAATCTTATCAAGTTGGTAATACTGTCACCTGTTATATATTGCTAAGTTTTTTTACCTTTTT
TTAAAAAAGTGAATGGACATTTATATATATGGGGAAGATCATTTCATGGAGCCCCAGATGTGTATACTCCCCGCCGTGTTACTGCAGACTTATTATTCAG
CCAAGTCGCTTTAGGGTGGAACCATGCTCTTGTATTGACAGGTATGTTAGGCTTTAGATCTCAATTATTACCAACTTAATAATACATGAAGGGAATATTA
CAAGGTATATAAAAATATAATATGTCCTCTTTTACCATTTTCATAGGTGATGGGGAAGTATACATGCTTGGCAGGTACAATTATAATGTTCCTACCGGTG
CTCAAAAAGCCAATGGGATGAATCATATATCTGGTAATGATCTTCAATTACCTTTCTGTGTAAACTTTTGTAAAATTTTACGGATTTTTCGTCTTTTTCT
CCTGCTTCTTCAGATTGGATTCTCACAATGGATGGTCTTCTCTCTTAACTTGACTGAATCCTTGTATGAAAGAAGTAGATTACCTCTCTTAATTAAGTTG
AAAGGTGAAAATGATGCTAAAAACACTTTAAACTAAACTTCTCATAAAATCATGTGTTTCTATGTGGTCATGAGTTGTCATACTGACCATCCATTTGTAA
ATCCCTGTTTTGCCCGATACCTGCTTTCTAGCTTGTTTTGGTAATGCATCATTCTGTTGAGGGTCTATCGGAAACAACCTCTCTAACCCACTAAAGTAGT
GGTAAGGTTTGGGTACATCCTATCTTCCTCAGTCCCCACTTATGGAACTACACCGAAATGTTGTTGTTGTTCTTTTGCCCGATTAATTGACCTCTATAAG
TAATAAACATATAAGAGAAACAAAAATACTCATGCGAAGCAGCACTCTGGTGGCTTTTTCGCTATATGCTTTGGCACCAAACTACAGAACAGTACTGGCT
GCTGTATTTCATCAAATGCAATGACATTAAAAGAGGGGAAAAGTAGTTTTCCAAATATATGATGGAAAGAATATCAGATTCATTCAGAAGCTCAATAGAA
GAGCTAAGGTTACCTGTGTCTAGTTAATATTTGAAGAGGAAAAAACATTGGAATTTTTAACCTGAAATAGAAAGAATTATTGGTAAAGGACCCCAAATCC
CAGCTGAAACAAAATATTCACTATTTCATCCCATCTGTCCTCGCCTTTGTGGATAGAGTTACTTGATACTCGTTGATGGTGGGAGGTGACAAGTATCCCG
TGGTATCAGTCCAATAATAATTTGGCCAAGTCAACCCTCCTAAACATAATGTGAAACTTCACTTATTGGACGTGAACTTGCAATTCTCACCCACTGAAAT
GTCTTTTGGAAATGTTGTCAAATTGATAATCTATGATTTTTGCTATTTGATGGTGTATTCAGTCAGCCAATCAGGTCTCAATCACAAACTAGTTGGGATC
GGCTATATGAATCTTCCATATCTATTCCATTTGAATAGGTCCGTTTCATTTCACTACCAGTAATAGTTTTTAGGCAAATTCAGGGTCCTCTACATCTAAC
GCTTATTCTTATCCACACCAACTGTAAGGTAACAACAATTAAGCCTAATTATTTAATGGCTTACTCTATCTGAATTTTCAAATCATATTGTATTAAGTAT
CTGCCTGTGGCTCCATTTGCACAGAAGATGAAGGTGTCCTGCAAAGAGTCCTCGACTTCAATAGTACAAAGGTTGTCCAAATTGGTGCAGGAGCTGAGCA
TTCTGCCGTGGTAACAGGTGAGAATCTGATGTTAAAGTTTACACATAACAAACCATCAATTGCATATTCACTTCTGTACTATTTTAACATTTCAACAGAT
GACGGATCAGTAATGACATGGGGTTGGGGTGAACACGGTCAGCTTGGTTTAGGAGATACAAACGATCAAACTGGCCCTCGTGCTGTAAGTTTACGCAATG
AACCATCCAGGAAACCATGTGTTGGTAGAGTTTACTGTGGCAGTGGTTTTACATTTGTTATCAGGACGTATACTGTGAAGTCCAGTTTCTAATATAGCAA
TGTTCAGGATTTGGAATGTAATTGTTCACTATGTTGCTTATCAAAATAATCAATTGTTGCAAGCAATGTCAATCAATGTACAATCTCTGTATGAAACATT
TCTCCTCTAAAATTAGCAATAAACCAGCTGAATACAACAGCATATCTACTGTAATCCCATGAGTGAGGTTGGTAGGTTGTACGCAGACCTTACCTATACC
TCCATGGGCTGTTTCGTAGACTCTCGTCTCAAACAAGCCAGCTAAATGTGTACAGTAAATAGATAAGGAAACATGATACAGAAAAGAATATCACTGCCTT
GAAAGAATAATTGATCCAAATTTAGCTCAGATATTTTGAACACGTGCTCACTTTATATGGCTGGGGATCAGATTCTATACCAGTTGTGTGGCAAAGAATG
GAATGAAACTACAAAATTCAATGATGGAACCTACCATTACAATGTCAATCAGATTCTTTCGTGACATTTGCTGCTTGGGAGTAATTACAAAACAACAACA
CATAGTATCAAGTTTCTAATCTATCAGTTCCTACAGTAACTTTTCTGCGACTTGCCGTTATGTGACAATGAGAACATTATTTTCATGACCATTGTTGTGA
ACAACGGGCCTCAAATGATCAACCTTCCATATGCCATCAACAATGAATTTGATCTGCAACAAAAGAATGAGATGATGGCAACGACTTCAAAGTTCAAAAT
ACGATATAATATTTAAAGTATAAGTTCATATATCACATTACAAGGGGTTACACACACCTCATAGATGCCCGGGTACAACTTTAAACTTACAGAAAAAACA
CCAGTGCGCAATTTCTCCATCTTCCTCTGCAAGTCAATACAACATATCATTCTATTAACCAAGGACAAGAAGCCCATTGAAACTATTACCACAAAATATG
TTTTGTTTTTTTGTGAAAGCGGATGTATAGAACTGCAGAGTTTTCAATATTAAGAGATATAAGTGGGTTAAAATACTGTTAAACAAACGACTCTTTGGCT
ATTGTACAGAATATTGTGTAGTAACTGGGAGAAGCCACATACACTCAAGGACGGCCAGTTGAACACCATTAGCTAGATAATTATATAGTGTATATAGGTT
AACTATACTTTTTGTACATATTTATTAAATCCTGAACACCCTTAGTAAAGTTAGTGGTTTTGGCTACTTCCAAATTAAGTTACAGAAACAGATGCTTAAC
ACCAACAACAAAAAATGCTCACGTTTGTACTTTCTAACTATTTGTCAGTAAAATGTTGCCTCCTATTCCTTATTACATATGGGGAAGTAAAATTGAACCT
GTGTTGTCCATCCATCAAATGAGCCTGTTAGAAGAACCTCTGAGGCAGAGTTATGCCAAACAATCTGAGTAGTACGAAGAAGCTGTAAAGCTTTGCTAGC
ACTGTCAATCTTCTTCTGCTTCCTTGCCAACAACTTCTCTGCATCACTGAAAGAATAGGGTGTGAGGATTCAGTATTGGTGGGTATATAGAATAAAATGA
ATAATAAAGGAATGAGAAATGATACAGACGTCAATGTTAACGCAACTTTTCCCTCCAGTATTGCAAGTTTTGCACGTATGGACCGCAATCTCTTTTGAGC
ATTTATGACGTCATTCTCCTGGAACTCCCGTGCATCAGAAAGCTTCTGCAAATCACTAGGGGATCTTCCAAGAACCTGAGAAAACAAGATTTCAGTGATA
TGAGTGTCATCGCGCAAAAATACCAACAGATAGAATGCATATATTTTGGAATTTCAAAGAATTTCCAAATTAAACCGGTGGCAGGTGAAATGAAATTTGC
TGTTAGATCATTTTCTATTCTTTGGGAGAGGATGTGGGAGTACAAGGAATAACTACCATCCTATAATGTTATTGAGTTCAAATCCACAGGAAAATCTCTG
GTAGGAATAAATTCCCTGTGCTCTGAGAAATACAGTAAGAAAATATCTTGAGGTAGAGCAATACTGAGCAGATTTAAACATTTAACAAAAGTGAGCGACA
TTGATGGTTTGGGTTGGAAGAATTGCATTACAGCTAGTCAAATCCCCCATGATACAGAATGAAATAGAACATAAAAGCTATAATAGTAGGAAAATTAACA
TTAAGATGCATGACTAATGAAAGATGCAATTCTGAACAAACAGGAGATGCAGATTTCTACCTCCTTTGAATTGACCTCTAGGCTCTTGGATCTCAGCGAG
TTAAGTGTTGAGGATAGCTCAAGCTCTAAATGCTGAAGACGAGTACTTATATCATTATGGTTGTTATATATCCATCTTTCCGGAGTTCCGTAACTATTCT
CTTTGACGGTAAATACATCATGTCTTGAAGTTTCAGTTTTACCTCCATTTGGTCTCTTATCAAAATCTACCTCACCAACTGTACATGGAAGGGGTCAAAT
TGAGGCTACAAACTATGAATATGATTAGATTCAGGGAAGCAAATACCTTCAAACTCGGTGCCTTCGGGGCATGCACGTTGAGTGCTCCATGATCTCCACA
TATCTGGCGTGTATTGATGGTTAAGCTGACCTGCTGAATCACTTAAACCGCCTTTAGTGGGGCTACTTGTCGTGAGGCTTCCATTTTTTCCCAGGTCAGT
CCTGTATGGAGCTCTACCTGTAGTAGTGGTTCCAGAGCTTGTGTCATCAATGTTATCCCTACTTGAATGATTAGCTCCATATCCATATTTGCTAGTATTA
ATACCAAGAGATGAGATTCTCTCTTTCTCTAATCGGTTCAATATCCCTTCAATCCCTTCAATTGCGCTATCTTCCTCAACCACAGCTTCTCTAATACAAA
GGCAAAGGAAAGTAAGATACTAAAGCAATTAACAAAATTTTTACATAAACCCAACGTAATCCACGATGAATGGCAAGTAAATTGGATCACAATAAACACT
TGGAAACAAAGAATCCTGCTTATAGCTTCTATTTTTGGCTCAAAGTAAAAGTTTCTCTACTAATAGCAAAATCTTTCAAGTGACAAACACTATTCTTTAT
CAACAAGAACCAAGATAAACAAATGGACAAAAGAGAGGAAACATGATACGGAACAAGCATAAGCACATTTTGCAGGAGGAACTTCACAGTGGTCTAGCAG
AGGAGGAAGTTGGCTAAAAAGAATCCCCAAACAAAAAATCAGAACCAGAATCACTTTCTTGATATTTTTAAACACAGGAAGCACTTAACAAATTTTCAGA
TAACAACAACATACCCAGTGTAATCACACAAAGTCATAGTGTACGCATACGTTACCACTACTTAGAGTTAGAAAGGTTGTTTCTGATACACCCTCAGCTC
GTGAAATGAAACAGTCTATAGGTAAAGAAATAACATAAATGAAGACAGTCATGGCAAAACACTACATCCAATCTGAGAAATCATCCTAAGCAATTGTCAT
AACAAGATACAACGATAATCAAAGTGTAAGAAAAACACAAACAATAACCAAACTCAAAGGACAACGCACAACGAACTAACCTACCTCCTACACTAATATG
TGTCCTCCATAACCACCAATCTAAGGTCATGTCCACGATAAGTTGTAGCAACTGCATGTCATGTCTAATCACCTCTCCACAATATTGCTTTGCTCTATCT
CTACCTCTTTTGAAATCATCCCTTGCCAACCTCTCACACCTCCGCACGGGGGCATCCGTGCATCTCCTCTGCACATGCCCAAACCATCTCAGCCTTGATT
CCATCATATTCTCCTCTATTGAAGCCACTCCTACCTTGTCCAAATATCTTCATTGCTAATTTTGTCTCTCCTAGTAAGTAGTATGCTCACACATCCACCT
AAGCATCCTCATCGCCGACATCTTCTGAAGGTGGAGTTCTATATTGGCTAACACTCCACTCCCATACAACATGACCAGTCTAACCACCGCTTAGTAGAAC
TTGCCTTAAAATTTTGGTGGCACCTTCTTATCACAGGATTCCAGATACAATAAACAATCCATGATGAATGGCAAACAAATTGAATCACAATAAATACTTA
AAAACAAAGAAACCTTCAAATAACTCTATTGGCTCAAAGTAAAAGATTTTGCACTAATAGCAAAATCCTTAGACACACTATTCTTAATCAACAAGAACCA
AGATAAACAAATAGAAGAAACACGATAACAACATACCAAGTGAAACCCACAAAGTGAAATCCGGGGAGGATAGAGTGTAAGCATGCCTTACCATTACCTA
AAGGGAATGTTTTTGAAAGGCCCTCGACTCAAACAAATCAAAGCAGTAAAAGGAAAAACATGACAGTTAATATCAAAGCAGTGCAGAGCAGATATGCAAG
AAACCATAAAAACAATAACGTGCAGTCACCTAAACACAATAGACCACACATAAACAGAAGCACAATTTGCAAAGAGGGAACCTCACAGTGATCTACCAGA
GGAGGAAGCTGGCTGAGAAGAATCCCCAGATGAAAAATCAGAACCAGAATCACTTTCTTGATATTTCTCAACTCTCCTTCGTAACTCCTCAATATCAAAA
TCCATTTCCTCAGCCTCAAAGGGTTCCTCTTCCGAGTCCCAACCAAATGAATACCATCCACCCCTATTCCTAATAGCCTCAATCAAATCAAATCTTCCTG
CTTTTTCCAAATCTTTTCTAGTAGGAAATGCATCTGGATTCTGAGACTTCTCCATAAAGGCTAAAATTTCAGCCTCTAACTTCATATCACCTTCACTTTG
CGACCCTTCTCCACAACAACAACAACATACACTATGCTCTTCTTTTCCCTTTCTAATTAGCTCAACAAACTTCAAAGAACACATCTTTTTACCCAAAACA
AGTTCACAACCCCCAGATTTTCTCCAAAAATCAACTGTTTTTCTTGAGTTTAGGACAAAAATTTTACAAGGGGTAGCAGGTAAACTCAAAAAAGAGCAAA
AATTATAAGGTCTTGCAAATTGGGTCAATACCATCGTTCAGGCATTTCTTCAAACAAATGGTGAACAAAACATATCCCAATAAACTCAAAACAAGAAAGA
GAACAATGCAGCAGTAGAAGAAACAGCGTAAAATGCAAACAATTGATAGAGTTGATAACAGTGAACAACACAGTTTGTATATTGAAAAAAAAAAACTCTT
TCCCCACAGTTCCCAAACAACACTATGTGAGCTACCCAAGATCCCAAGTCTGACCAATATTTTCAAGATTTGGTTTTTCTAAGGGTAAGGCCAATGTCTC
TCAGTATAATATGGAGATTGGAGAAGGGAACAAGTGAAAATAACACCTTGACATATAGATTTTTTTTCGTTCGATATTTATATTAGAGTTTCGATTAATC
CAAATTTAACTCATATAAGGCTTCATTTGAGGAGAGGCATTTTCTACAAAAGATTTTCTCGATATCCACAACTTGAGCGTTGAAAGAGTTCTAGACCAAC
ACACTACATATTTATATTAGAGTCGGACTAATTCAAATTTAAGTCACATAAAACTCCAGTCGAGGAGAAGCACTTACGGCAAAAGATTTTTTCGAAATTC
ACAAATCGAGCCTCGAAAAAGTCTGAGACTATCAAAAATAATCTCATCCACTACATCATCGTCTTTAATTGGACTTTGCTATTTATTTGGATTTAGATAG
TGGTTAGCTTTATGGTTACTTACTAATTTGGGGAAAATTCTAAAGCACATTTCTTTATTATCTAAAAGGGCTTAGAAAACATTTTTTGAAAAAAAATCTT
GCATATATAATGTTATATGGATTATGTTAAAATGTAGCATTAGAAAAATAATTCTTGTTTGGTCATATAAGGGGAAAAAAAAGAGTTTTACACCCTATAA
CATTATAGAGTTCTAATTATATATTATATAAATATTTTTAAAATAATTACATTGCATAACAAAACTTCTCTTGATTTTCAATTTCAACATTTTTATTTTT
TGCAATTTTCTCTCCCTTTTGTCTTATTTATCACACTACTTTAAAATAGAGAAAAAATTGATAATTTTTTATAATTTGTGGGATATTTGTATTTGTTAAA
AAAATTTAAACTATATGATTAACTAAATTTCAAACTTTATATCAATGTGATACCATATCACATATATTTAAAATATAAAATATTTAATTTGGATGTTCAC
AATACATGGGCCCAAAAGATTTGATTTGATCCATCAACTCATTAGCAAGGGCTAAAGGCAAAAGGATGAACCTAATAAGTAGTTCTTTTATAAGAATATT
TCTTAATTATTAATTTCAAACTTTTTAATTATTATCTCTGTCCTTTTTATTTGTCCACTTTTAAATTGACACATTTTATAAGAAAATAATTAATGATGTA
GTAAATTTACCGTTTTACCCTTATTAATTATGAAGTGGATGAAAAGTTCTACATTTCTCAAAGTAATTAGACATTTATTTGAGGATATACTAAGTAAAAA
ATAATTAATTAAAGATAACTATAAAAAGAAAAAGTGAGCAAGTAAAAAGAGACACGAAAAGTTTTATATAATCAGTTTAAGATTTTGTAGTCGAGTAGTA
TTGGTAGCACCAACATGTAATGTTAATATTTGTGTTTCTATCCGATCACGATAAAAATAATGAAAACATTTCTTATGAACTCGTTAAGAATGATTCCAAT
CCAATTCATGATGAGTACAAGGTTGATTCAAAAGATCTAAGTAAGTCTTAAGTCTCACTATCTATTGACTCGTTAAGTGAAGTTGAAAAAAAAAGCAAAT
TACAATTTAATAATTTGTCTACCAACTAATAAATGTAAAAATAACAAAGAATTAAATATTTTATTAGCATGCCACCCGAATTTTCTATATAATAATGAAA
AACATGTGATTATTAATAATAATAATAATAATAATAATAATAAAATCTTCACCGACATTGCCACAAATAGGTGGAATCACAATCATTGCTTTAAAAAGTA
GAAAAATGTACTAATCCTAATATACAATAAAATTTTATATTAGGTATTTTATAAAGTGAATATTTGCGCAATATAAGAAATTACTATTTATTCTAATAAT
AAATAATAATAATAATCCACAATAATTGAAAGTCTTTAATTTACTTTTTAAAGTAAATATTTGACAACAACAAATTTATCCATTTTACTTATAGACTCCA
AAACTAAAAAGGGAAGTTTTATCATCTATATATGTCCATTAGATAGTTAGGAATACAAGTACAGTATATTTTTTTATTTTTTCAACACAAAATGTTTTAA
AAAATAGTTATTGGAATTAATAATTTAATGGCAGGGACTTTCCAATTTTGTCTTAATAAGAAATATGTATATTTAACGTAATTTAGTGGATTATTTTCGA
TGAAATGGCTATTTTTGTTTTTAGTTGTTTCTTGTTTGATAGCAGCTTACATAAAGTGGAATATATTCTTTTTATTTATCTTAGTTTTGATAGATAGAGT
TATCTGATAGATGATATTTCGTAAAATTAGTCGAGATACGTGAAAGTTGGCCTGGATATTAAATAATATATATAAACGATGGAATTCATAAATAATCTTT
TAAAGTTGGAATTAATTTTTCACTTATACATTTCAATTAGAATTTCGTTGTGTTATTTTGATATTTTTTGTTGACACATTGCGCGCGCTACATCATTTTT
TCGTGTGTGAGGATTGGAGAGTGCTTCTTCTTTTTAGTCATATAAAAATATTACTTCCTCCGTTTCCCTATTTCACGTGACATGTTTAAGACCATAAGAT
TAAAGGATATTTTGGTACATTTGATATCAATAAAAGCGCCTTCAAAATTACCACAAATGAAGTGTAATACCAATTAAAGCCCATTTGCGACTTGTTGGAT
CAAATTGGTCCACACCAAATGGGATGCTACAGGCCCAATGGACAAAAATCCTAGGCCCATTACTAGAAAGCCCATCTATTACTTGTTGGGCCTCTTGGAT
TGTTGGCCCACTTTGCATGGAGGAATAAGGTCAATGTCTTTAAGACTATTATGAAAAAGCAAAATATTCATTGTGTCACGTAAATTGGGACATAGAAGTA
TGAAGATGGAGATACCATCATTTAAAAGATGGTGACAAAAGCAAAAGTCCAAAATCGATCAATATATTTACGCGATTTCAATTAGGATTAATCATTGATA
CACGCGGATACAATGTAATTTGTTACCATTTGAACAAAAAATCTCACTATAGATTATTACCCCATCTATTCTAATTTATATGACACTCTCTTTTTAGTCA
GTGCTATAAAGAATGATACATTTATATATTCGTTAGTAACCATTTTAACTTTAAAATACTCATTTTTTTTCTTAATAAGATGGTTTATAGTCACACAAAC
ATTTATTACTTATTTTAACTGCAACTTTCAAAAGTTTTTTTTTATATTAAATATCTTCCAAATTAAATAACATCACATAAATTGAGACGATAAGTATAAA
GAATAAGCTGACATTTCCCCTAAATTTTGATAGAATAAGCTGAAGCCATCAATTGGGCTGTTTTGTGTCAAATGAAAAAAAATTGGATAGTTGGGCCTAA
TTGAAAATAAACCTCTTTTGGTTATCGATATGAATATTGTCTTTGGCAGAGCAAAAACTTCGTTTAAAGAGTGTTAAAATATAAAAAGTAAAATCACATA
AAAGTTAAAGAATGTCAATATGTAAAATTAACACCGTAAATATACATAATTATTTTTTTACCAGCTACTCAATAAAATTTTTCAATAAAGAAGTGTTGAT
CGATACTCCTTAAATATATTGTACTATGTCTATGTATAACCTTGAAGATGTATATAATAACAACAAAATAACACAAAATAGCAATTTTAGTGCAAAAATT
ATTACTAAAACTACTAAGAAAAATAGCCCACTATATGTTGATTGAATGTTGTTGATCACCAATTCACTATTATGTCAATGGGATTATGGATTGGTTAATT
GTAATTTCTCTAATTTGGGTTGTAAATTGAAGTTCCAAGTGTTTCAACGTGACATTCAACATCGTGGTATAGTAATTTAAAATTAAGAAAAATAATTGTA
TTCAATCAAAAATAATTACAATCGCTAACTACGTATAAAAAATATATATACATACACTATGTATAAAATGTGCATATTATATGTATACTTTTGTGGGGTA
TTATTTGTTTGATGTTTCTCTTACAATTAAATATTTTTCATATACTGAAAGTCAACTATGCACTATTCCAAATACGTCAAATTAATCAATTTATTTTTTT
CTTGGAAAAAGGGATAATTTCATTGACCTTTTTACCGGATATGCTTTATAATATTTTTTTTTATTTACGATATTACGTCTATTTTTATTATTATTATTAT
TTTTTTTTTTGTAATTATTGTTTAAACATTTGAAAATAAATATACAGATACGACTTAACAAATTTACCTTTCTTTATATCAATTTCTTCATATATGTATA
TTATTATTAAAGAGTGACAAATTTATCAAATCATAATAATTTATATTCATTTTAAATTGATTAAAAAATTGTTTACAAAACAAAAATCAAGGTCAGAAAT
ATTGGTGTAATTCATAAACCACAAATATTATAGAACATGATCTTTAGATAACTCTTTGAAATTATAAAATTAAAAAAAGGGAAAAAAGATTTTTTAATAT
ATAGAGATAAACTTTGATTATGATACTTCATATATGAATAATAGTAATAATACTATATAGTGTTTTATTTTATTTTTTGCCTTGACTGGTGTGCCTAATT
TGGATAATATGTATCCATGGGAAATATATCATAAAATTCAATGATATGGTGGGCTACTTACTACACTTGCATACTACGTAAAATTTAACTTAATAATTAG
TATACAATTGATACAAGTTAGCTCTTACCATTATACATAATAATATTCTTAAATTATTCTTCCCAAGATTTGAACTATCCATTATTTCAATTTGAAGATA
TTTGCTTTGAGTATTAATCAATTATAATAAATGAGAGAATAAAATGTAAAGTGGACTACAGTATTATTATACTATTTCTACATTCTAGAGATGACAGCTA
TATAATAGTATGGAGCAAAAATACAAATGTTTGTTTCGTTCCAAAGTTGATGTATAATGGGACAAATGTCATTTCTGTCTGGCATTGGAATATATTTTTC
ATAGTGAAGGAAAAATAGAAAATAAGATTAAAATGATTTAGATATGTAAAAAATATATGATAATGTGTTAGCGAGAAAGTATAAGAGGTTGAGTATAACA
CGTAGAGAATATGTGGAGGGGTGGGGTGATATGATATAATTTTAACTGATCGACGGATGACATAACCCTAGATAGGAAAGCATGGAGGTTGATCATGGAT
TAGGATAGTCATATGTTGTCGTACTTCGAGTAGTATAATTTAGGTGTTGCATAGTTTTTCTCTCTTCAATTACTTAGATATATGCTAGTTTATAATACAA
TATAAATCTTATCAAATTTTGATGCGTCCAAATACATCTAGATACATATATCTTGAAATATACATGGTAAAAATTATGTGTAATTTGTTCAAGATATATT
TTATCCAGATGAATTTACAAGTATGTGAATACATAGACAAATCTTGTTCAACACTCTTCTATGTATTTGGAGTTTATAGACAAATCTCGACCGTTCGTCT
TCCTCTTTTTCTTTTTCAGTATATATGATTGCAAAACAATGTGTCTAAGTGTATAAAAATATATATTTAAGTGTGTTAGACATAAAATTTGATATAAAAT
TATTAATTAGTGATATAAAATGTGATCATTTCAAACTATAGGTAAATGTAATATTCGAACTATAGGGAAATTATTAAATAACATACATGTGTAATTAAAT
AGTTTCTCTTTCTTTCTAATTACTTGGTCAACATAATTTTTCAAAATAATTTTCTTTATTATTCTCTATCTTTTTCAAATATGTTTTGAGATATTTTACT
TGAGAATCGTTATCACTCTATTTTCACATAATAGGGTTATGTTATATATACACATTATTAACCTTTTTATTTTCACATAATAGATTCAAAATCTACGAAC
ACATTATTTTACAAAGTATACTAAATATTTTATTATTGTTAGTTAATCAATGTAGATACATTATTACAAAAATATTTTTACTTGTTATTATTACACGAGC
TATTTATTTATATTTCCTAATGTTCTTTTACTTTTTCAGTATTTGAAAACTTATGTTTTTGTTTTTATTAATCTTCAATAATATATTAGATATTTTACCT
TCAATGTTACTTATTTATGAAATTATTTTGCAAGAACTAGAGACAACATACCAATTAATATGAATATTTTGACAAAATACCTATGTTAGCTATTTTTTTG
AAAAAGTGTAAAATATATGAAATTAAATAAAAACGAGGAAAGGAACATATTTAGTTGTAACAGCATTTTTAAATTTCCAATGGCAAAAATAGTGATATAT
GCAACTCTTCAAATAAATAAATGATTTAAGTTACAACAACCCACAATATCAAATAATTTTTATTTTCGTTGTTAGTATGCATATCTTTTGGACTTAAACT
TTGTTATTTTTTAAAAATAACATTAAAAAGGAAATATTAAATTTTTTCCATGTTTTATTACGTATTATATTAAATATAGTATGTTTAATTTAAAAAATTA
AGAGATAATTTATTAATTATGTCTATTTTACTTTTATTATTAAATATTACTGTCTTCGTTTCATATTAGTTGATCATCTTTTTAAAAATAATTGTCTTAA
TATCAGTTGACCACCTTACAAAATTAAGAAAGTATTAATTCTATTGTTTCTATATTACCCTTACAATTAGTTCCTTTTAAAAGTGTTCATATTTATTTGT
GAAAATTCAAAAAAAAAAAGTTAATAAATGAATTAGTTAAATTATTTTTCTTATTTCTATTTTTTTAGTATGTTTGTAAAAAAGAAAAATGATCTAACCA
ATATAGAAGAGATGATATTCAATTTTCAATTAGTTCAAGTTTCAAAGTCCTTAGTTTTTTTTTCTTGATTTTAGTTGGCACTCGTGATTCCTAACTCTAA
TCTTCACTAATAATTGGTCTACTTATTTATTACTTTATCCAATACACGCTCCTAAAGAAATTATAAGTATTATATTTAAAAAAAAATGTAACAAGAAATT
TATTCATTTTTTTGAATATAATAAATATTATATTTTGAAAAATGTAACAAGAAATTGGCTATAATTGATGATGACGATAAATTAAGAATTAAGTATAAAA
TTATTTATTAATTTCATAAAGTAAAAAAAAATATTATTAGACATTCTAAAATAGTACACGGAGAAAGTATTAGTTCATGAATCTTTTCTTTGTTATTGTC
AACTTTTTTTTTGGTGCTTTTATTAGTTTTTATTTCACAATTAACTTTTTGATTCAAGTCCTTTAGTTCTAACCACAGTGTCTGTTTCTTGAGAATATTA
CAGGAATAATGTTTTATATGTATATTAGTAAATCGCAATAACGATAATAATAATAATAATAATAATATACACAATGAAATTTGAAAAAAATAATATATAT
ACATAATTTTATTTAAAAATATAAAAGTTATTTTTAATAGATTGTTGCGATCTTACTTATGACAATTGATCGATTTAATCTCACGTATTTATAATAGTAA
ATCAAAATTACTTTTAAGATGAAGAAAGAAACAATACACGAGTTCACAAAATTTATTGTGTGTCCTTAAAGAAATTCAATCCGGTCATTATACTGAGATT
GTAGAATATTTCATTCTATGATAAAATAGATATACCTTTTTAAAAAAACAACGGTACCTCACATTTCAATGGTGAACTCAAAAATCAACAGCTAGTGAAA
TCACAAAAAAACCTCTTCTTAATTAACCTTTTAAGTCAATTGTCAAAATCAAGCGAGCAAACAACAACAACGACACTCTACTCTTAAATTTTCTAATATA
TATATAAGAATAAAACTTTTAATTTTTCTACTTATAATTAAAAAAAAAAACTTTTATTTTCTCTTCACTTAATTATCCACATTTCTCAATTACTCAAAAT
CCACTATTTGAATTAAGAAGTAACACCTAATATATAGTTTCTAAATATAATTATAAAGATAAAGTGGTGATAAATATGAGTCTACCTTACTCAACACACG
TAAGCCACACAATAATTTTATCTTGTACCTTTCATAAGTCTAAAAATCATATACGCCATTTATTTCTCACAATAATGCATGTAATTGTCTCATCAAAATA
AAGTTTTCTTTTTGTCTATAAATACCAAGAAATGAAGAAATCATCAATTAAAGAAAAAAAAAATTGTACTAGTGTATAGTTATTATATTTATATAATAAC
TCCTAGCTAGTTATTATTATAATTAAGAAGAAGAGAAGGAAGATATACTACTATATATTATTATCATTATGGAGGACAAAAAAAATAACAATTCTTCAAT
GTCCTTCCCCTTGCCGGAAAATGGTGTCTCCGATGAGGAAAAACAGACCTCCGGTAGTGATTCTCCGGCCAAAACACGCCGGAGAAAACCCGGGGGATGG
AGAGCTATGCCTTATGTTCTAGGTGATTATTATCGATCTTTCGTTCAAAAGCTTCTATCTCTTTTTTTTTTCTTCTTCTATAATAATACTGATATATGTA
TCAACTTAAATGTATGTTCTCAGTTATAAAACTTCGCACATTTTTCGAGTATTTAATTTTATGCCTATAATTTCTCCCATCAACTCAAGTATGTATAGTG
TCTATATAGCTCAAATAAATTATTTTGCCAAAAAAGTTACAGTATATAAATAATTAATATTATTTTTTTCCGTAAATAAAAATTATTGAATCACCTGAAT
AGTTAGGTGTATTAACTCCACACAAGTTTTGCATTTTTCTCTTTATCGTTTAATTAAAATTTCTGACTTTTAAGTTGAGATAAGTACTTTGTCCATCAAG
ATTTAAATAAATAATTTTTTTTATAAAAAATTCTTGTGAATCTTGCTCACGTAGTTTATTATATCGATATGATCTCGATAATCAGCTTGATTTCTCATAA
TTCATAACATATTTATTACTTCTCATTACACAACAAGTATTTTATCCATCGAATTTACACATATTTTGATCTTCTTGTAAATCTTGCTCACGCTATTAAT
ATCAACATAATTTATAATAATTAAGCTTGAATTAATCATAATTCATACGTCTAAGCATCTAATTTTTTATTTTTTTTTTGTATTACATAGAAAAATTTCA
AAATGACAGCTAATAAAATGTTTATTTAAATGTGTACGTTTGTTCTTATTGTAGGTGAAATTAATGTTGAGTTATTAATATGTTTTTATTATTATATTCT
TTTTGCAGGAAATGAGACATTTGAGAGATTGGCATCAATAGGGTTAATAGCAAATTTCATGCAATTTTTATTACAAGTATTTCATTTGGACCAAGTTTCT
GCCTCCAATGTTCTTAATATATGGTCTGGTGTTACTAATTTCATACCATTAATTGGTGCTTTTATTTCCGATGCATATATTGGTCGATTTTGGACTATTG
CTTCTGCCTCCATTTTCGAAATGATGGTACGGTTATTTTTTTTGTCTCAATTTATAGTGTACAGTTCGAATTTCAAGAATCAAATGGTTTAAATTTGATT
TTTTAAAACTTAGATATGAAACTTTTAAGTTTTTTTGAAATCAAATTTTTATATTAGAAACTTCGTAAAAAGTAAATTAAGTTACACTTATATTGAAGAA
TTAGAAATAATTATAAAATACATAGATAAATTACAATTAACATATCAATATAAATTGAAACGAAATGAATAATATTTACTTTTGCTTTTGCGTGCGGCTT
TGTCAGAAGATAAGGGTACATACCACGCAAGTCATACACAATGTGTCCATTTCCCCAAAAAAACAAAAAAAAAAGTTTGCAATTATTGCAACTATTAAAA
GTATATGCTTTCCATTTTAGGTTTGAGATATGATAATGATGATATATTTATATTCTTTTAATTGAAATTTGAATAAATTTATTTTTTATTATAAATTTTT
TAAATTATTAATCATTGTAAACATTATATACCCATTTTTTTAATAAAATTTAAACTGTTTAATTCTAAAAAAATAAAAAAGTATCACATAAATTAAAATA
AAAATAAAATTAATTTTAATACGCGATGGCAAGTTAGCTATTATTATTATTATTGTTGTTGTTGTTGTTATTATTATTATTACATAAATAGACTAGTCTA
GACAACATGATATTTATTCCATCTCTATCAAAATCATAAATTAATATGAAATGCCTATTCAATCAATATTTATAAATAGTATGGTATAATTTCACATATT
ATTTGACAGGGAATGTTGACATTAACCATGATACCTTGGTTACCTAAGCTACACCCTCCTCCTTGCAAATTGGGCCAACAATGCAAAAAGCCCAACAAAT
CACAAATGGGCTTTTTAGTAATGGGCTTGGGCTTTTTATCCATTGGATCTGCTGGAATAAGGCCTTGTAGTATCCCATTTGGTGTAGACCAATTTGACTC
AACAACAGATGAAGGAAGAAAAGGGATTGCTAGTTTCTTCAACTGGTATTACACTTCTTTTACATTGGTTTTGATAATCGCAGTCACACTTGTTGTGTAT
ATACAAGATTCAGTGAGCTGGGTGCTCGGATTCGGTATCCCTACGATACTCATTTTCTTGTCTATCGTTTTATTTTTCATCGGGACTAAAGTCTACGTTC
ATGTCAAGCCTCAAGGAAGTGTATTCTCGAGCTTCATTCAAGTTTTTGTAGCGTCTTATAAGAAACGCAACCTAAAGCTCCCTGATGAACGTGAGAGTAA
CGTGACGGTCTTTTATGATCCTCTGTTACCTCAAGGGTCTATTGTGAACAAACTCCCTTTAACCCATAAGCACAGGTAATAACAGTAAATGCAGTTTTGG
CTTTAAGTCACCCATTTTATAGAGTCGCTCCATTAACCATGAACATTTCTCTATCTACTCATCAGGTGGTTGAATAAAGCAGCGATAGTGATGAAGGATG
AAGTGAACAGAGACGGCGATTGTACAAACAAATGGAGATTATGCAGTATCCAGCAAATCGAAGAAGTGAAATGTGTACTCAAAATAATCCCAATTTGGTC
TGCAGGGGTTATCTGTTTCACAGCAATGGCACAACAGGGCACATTCACAATCTCACAAGCTCTAAAAATGGATCGTCATCTCGGCCCTAATTTCCAGATC
CCACCAGGTTCCCTCTCTGTAATATCGATGATCACAGTTGGGATATGGTTACCAGTCTACGATAGACTCATCGTGCCATCGCTTACAAAAGTAACACGAA
TAGAAGGTGGGATCACATTGCTACATAGAATTGGAATTGGAATCGCATTTTCGATTCTGTCAATGGTCGTAGCTGGGATAACTGAAAAAATGAGAAGAAA
TTCCGCCATAACTCACAATAGCCCTGATGGGATCGCACCAGTTACAGTAATGAGGTTAGCTCCTCAACTAGTGTTAATGGGATTCGCGGAGGCGTTCAAC
ATACTTGGACAGATTGAATTTTACAATAAGGAATTCCCCGAAAACATGAGCAGTGTGGCTAATTCTCTGTTTTCATGTACTGTTGCTGGTGCAAGTTACC
TAAGCAGTTTGCTAGTGAACGTTTTGCATAACACTACGGGAGGAAATGGGCATCTAGATTGGTTAACGAATGATATTAATAAGGGTCGAATAGACTATTA
CTACTATCTTATCGCGGGGTTAGGTGTGTTGAACTTGTTCTATTTTCTATACGTTGCTAGTCGATATGAGTATAAGACTAGAGTAGTGATCGATGATGAT
CGAATTAAGGGTTATGGTGATGATCATGAACTTCATGACATGAAGTATTAAGGGATTTGTGGTTGATAAGTTTCATAATTGTAACTAGTACTTGATTAAC
ATATTGGTTAAAGAATAAGAGATGTATGTACACATATAAGAATAAGATATGGTTTTTTTTCTCTCTTTGTATTGGACTTGTGTTTATTGGTTTTTTCTTT
TCTTTTTCTACTCTCATTATTATTGATGAAGGGACTCAACTCAATGAAGGCCTAACATATTTTGGTTAACTTCTTGTATCAACTCTCCATTAAGTTGGAT
CAAGTAAAAATTTTGTTATTTTATGGAATGAATTAGAGTATCGAAATTCAAAGATATACATTATCTTGGTCTGAAGTAGTAATTTTACGAGTGGGATTTA
AGAGAGATGGCGTGTGTACATAGCCTTACTTTTTCATTCTAAATGTAAAAGGGATATTTTTGATAGGCGATTGGCTCAAGTAATATATATATATATAGTG
ACAAAGAAGTCATACCGAAAACAATGAAGAAGAGAATAGTAGAAACATATTACATGATTTTTTTCATTCATTTTCTATTTAATCAACTCAGTGAGAAAAC
ACATGATGAATAATAAATTCTCATCGAAATATTAAAAAGCTTCCTAATTTTTATCCGACGTATAAAAGCACTAATATTATTTCCTTTCGCCCATTCAAGT
AAAATATCTATAAAAATAGCTACTAAATATTTTTCGATGGGAAATTTTAACAAGAAAATAGTAATTCTTTTAGTAATGGCCACAACAATTGTTTGATTTG
ATCTTTTTGCTTTGCAATGCTGATCGCTCATTTCACATCATGACTCACTTTATGATAAGAATATTCTAAGTTTAGAAATATTAACTTTACTTAAGTTTTA
TGACTAAATTGTATTATTAAGTACTCAATTTAGTAAAAACAAAAACATACGTAAAAGATTTCGAATTTCTCAAACTTATACCCACCCTTCACTAAATAAT
AACTTCTCATCTTAATTAGGATGTCCTTGGTATCGAGAAAAATATATTTTTGAAAAATAAGCGAGTTATTTTTATTTTATTTATTGGCCCTTGAATAATA
TTATCCTAAAAATATTTTATATAATCTGGTTTTTAAAACTTCAAATACAGAGGCAATAAATTTAAACTAAAAATATAAGCTACCAAAACAATAATTTTTT
ATTTTTTATTTTTACAAAATAATAAAATAAAAGAAGAGAGATTCGATTTTGTTTTCAAACGTAATTGTCTTATTCCTTGTTCCTATATGTTGACAAATAG
TTTTCACACTTGAATAAATACGTTAAGATAAAAATAAAAATAAAAATTCATAATTCTCTAACCATTATGAGTTATGGTGCAGTAGTGGAACTATTTCAAA
CCCTTCATTAAAGGTTTCAAGTTCGAACCCTAAGTGTAAAGAAAATCACGTAGGGAACACCACTCTCGAATAGACATCTGCAATCTTCATTAAAGGTTTC
AAGTTCGAACCCTGGGTATAAAAAAAAATCACGTTGGAAACACCACTCTCGAATAAACATCTGCAATGCATGATTAAAATTTAATCGAAACTTAAATGCG
GACACCAGACAGAATAAAAAATAACTCAGACCTTGGCCAAGAACAACTTGCCAAATACTTTTTTATTTTATTTTTAAGAAAGTAATATTTTAACGCAAGG
AAATTGAATTCCAACTTTTTGTCCATAGGAAAATTGTAATTCAAGGAAAAGAAAACGAATTATTTACATTTTTATTTGATGATTAATAGAGACAAAATGA
AAGCTAATCAATCAGTTAGTTACATAGAAATTCAAAAGATTTTCCTGTTTTTAAGGGATTCAATTTTAATGAACAAAGCTTTGATTTACTCCTAAAAATC
ATATAAATATTATTTTAAATCACATTTCAATACAAACATGCAAGAACCTTAGATATTAAGTAATAATATAAACATTAACTAAGAGCACTTTAATTTTTCA
TTTTGTGGTCAGTATTTAATAAAATTTGACTAATCTAGAGTTACATCGTATAAGGCCATTCGAAGAAAGCTAAAAGATTTTTTCATACGAAGAATTCAAA
TTAAAACTTAGTGTCATCCATTAAACAACTTCTTTCTGTTCGATATTAAGACACAACAAATAATAAACGTTAATTAAGAAATAAAATTGTGTTTGATCTT
CTGTCAACTTTAATTTTTTAACATAATAATAAACGTTTGATCCTAACATATCGTCATGAAATCGTAATGCTTTGATTTTAAAGGAAAGATGTATTTTTGT
TTATTTCATTTGGCATTGATGGTAATTCCAAATATATTCTTCCCACTAAGTTTTTCACTTATAATTCTCGTGCCGCCCCACTTTATGAACTAACCAATAA
AAATGAAATAATTTTTTTCTAGTGGCTTAATTAGCTTTCATAGTTTCATTTATTTTGGACCACTGATAATGAAATCTTTAAAACTTTTTGACTAAAAATA
ATCTATTTTAAAAAAAATATATATACATGTCAAAATATCAAATTCCAGTAAGTGGTTTTTTTTTTAGTATTTTAATTTTCTTGAAAAATTGACAATTATA
TATATATATATATGATTGGGTTAATTAGGACTGCACATGATGAGACTTATTATTGCTACGTTGTTTTCGAATTTTAATGACAAAGATTGATGTTACATAA
CATCTTTTTATATATTTGGGACTAGGGGCAAAGTTGGAATAAATTCGATAAATTTAATAATTTTGATTCGTACGTATTATTAATTTAGAACATTTCAATA
AAGAATTGTAATTTCAAATTTGGACTTCACTTCTCTTTGTGTGTATGAGTGATCAAGTTAATTAAATAGTGATTTGTCTGTTAATTAAGAAAAAAAGGAA
ATTTATTGTATAAATAGAAACATCGTATAAATTTAATAAATTTGAAAAAATCTCTTTATTAGGATATTTTTTCATTAGTAAAATTCAAAATAATAATGAC
AATGATTGTGTTTGTATCTTTTCATTTTCTTAAAACGACCACACCATAAAAGATGGAATTTATGAAATCAAGTTAATTAAATGGTGATTTCTTTGACCAG
AGTTTTCACATATTATACTTGTTTTTATTTTATTTATTTTTTATTGTCATATCGTGTAAAATTCATTAAGAGAGAAAATTTTCGTTATAAAAGTTTCTCC
ATTAGAATAGTTTGAATTTGAAATATCCTAATTTATTTAATAAATGATCATATTCATTTCATTACACACCTTTTAATGTGTATAACTAACTTGTAACATA
ACTTTATAATGTAAAATTGTTTACGCTATCAATATAATTGAACTTTAGCGTAATAGAAAAAAAAATATTATTCTTGTTTGTGAAATTAAAGGGAAATTAT
TAACCTTTATCCTTTAGCTGTTATTACATGCGTAATTACATGTGTTTTTGTGACAAAGGCCTAAAGGAACTAAGAAGAAAGCCCACCAAAAGAATATAGG
CCCAAATGAGATTATTTGCCTCGGTCCAAGCAAGAAAATGCTCAAGGTGTCACACAATGTTTTCAAAAATGTTTTTTGGGACGAATCTCGAGGCGGGGCG
TGTAAAACATGCTCCAGGGCGCAAATTAAAGACATAGTTTTATAGGATGTAAGTCTTAAAATTTGGGACGTAAACTCCAAGTATGCATCCCCTATGTGAT
TAATATTCATATTTTCAGAATTTTCGCTAATAGAGATTGTTTGAGGCCTGATTACCAAAATAACGATTTAGTTTGTCTATTAATTATCAAACGTAGCAAC
AACTTCTTGGGGGCATAGGAATGAAGTAGCTCTCTCGTACGCCCCTTGTCTTTGAAATTCACTCTATATCATTAAATTTGTGGGCAAGACAAGTACTAGA
ATTCAACTAGTGTTCGAATCAACTGAAAAATCATATCGATCGAGTAAAGTTTGTGATTATTGCAATAAGACAGATATGTTGAATATAGCTTGAAACTCCT
ATCGTTTTGTCATGACTCGCATGTTATCATTGTATATTGACACAATTAAATGCATCTACTTTATATATGTTTCCCTTTAGCAAATATAAGAAGAATTAGA
ATATGTACTTTGAATGATTGCCACTTAACTGCATCAAGTGCTTCATGGACTTCACGTAAACACAATAACAATATATCTAATGTAATCTCACGAGTACGAC
TTGGAGATTTACATAAACATAACGATAAAAAAAAGAGGTATTCATTAAAAGGGATCACGAAAGCAAAATATCTTTTGCTCAACCCCTCTCTCTCTCTATA
TTAAAATATTCACTAAATATCTATAAATTTTTAACTGTGATTTATAAATTATAAACTCCAATCATAAATAGGATAACAATTTGCATGAAGGTCAAACAAT
TCTATTATGTCATTAAAAGCAAGTAAAAAAAAAATAATACCTTAAGAGCCTGTTTGGCTCAGCTTAAAAGCTGGTCAAACTGACTTAAAAGCTGATTTTT
GACTTATTTAGCTGTTTGACAATACTCTTATTTTAAGTCAAAAGTTAAAAGCTGGGGTAGGGGTACTTTTTTTTTTTTAGCTTATAAGCTGTTTTAAGTT
GACCACATTTTTATCTTTTTGTGCTTAATATTTTTATACAATCTCCAAATTACCCATATAACCCTAACATTTTTTTCTTCTATTTTTCCCTTTTCACACG
TTTGACATAACAACTTCACCAAAAGTACTTTTTTAAAGCTGCTTTTATTAAGCCCATCCAAACGGGCCCTAAGACTGCAGATAATTTCCTCAAAAATTTG
GATAATGAACGTTACACGTTAAGCTCCATACATTTCTTAACAGCTTTATTCAATTAAATTAATAACGCCTATAAATCTTAAAATATTTTCTCCATAATGA
AGAAAATTATAGCCACTGTAATTAAAGTTTTTATTTCTTAAACACAATTAAATGTTAACAACAAATTATAAGTTGAAAACTGACGAGAATTTCTTTTTTA
AATTGTAAAAAAAAAAGTAAATATAATTATGTCTCTTAAAAGCTAAACCAAATCAATGGATATAAAAGATATTTAATTTACTTTAATTTTAATAATTAAA
AAATAAATAAATAAATTTAATTTTAATTCTTTATATCAAAATCGATTCAAAACAAACCACTAACGAAGACACGTGAATACCTTTACCTCATCAGGCCCGT
GACACCCATTGAGATTTTTTTTATTGATAAAACTATTTGTGCAAAGCTGATTGGTCTTTCCATATAGTATTCAACACCTAAGTTTGCAAAATCCTAACAC
AAATCTTGACGTCTTACAAAACAAATTCCGCGATAAATGAATCATGATGTAGTGATGAGATTATACATTCGTTAGTCAGAGTTAAAGTTTGAATTTTGAA
TAAGATTTTTTTTAAAAATTGAGAACGTTACTCTTAAATAAGCCTTGTTATATGCCATCCAAATTTAGTCGAGGCTCTAATGCAGACTTTCACATGAAAA
AGTTAAAAAAAGAACAAATCCCGCCAATAACAACTCTACAAGATTTCTTCCTTATAAACCATCGAACCTCATTCCCCATTCCACATCCCTTGACCATCTC
ATCCCTTGCCAATTGCCACCTTCGAAGTCGTTTACGTATCTTATTTTCGTAATATTTTGCTAGAATATATATCAATATTATTTGGATGATAGTTTTTTTA
CCTTACCTATTAAACATTATTAAGTATAAAAGCACTATTTTGTTTTTCTTGATTTACATGATCTATTTTAAATTTTACGAGTTAAATTTTTTAATTTTAG
TGATAAATCAAGGATTTTTTTAATGGAAAAATTGTATATAATAGCAAACTAATAACCTAAAATAAATGGAGTAGCTAGGGTTTGATTTCGTTGTGCTCCA
TAGCAAACGTTTGCAAAATATTGTCAGGCGCCTCTCTCCTAAATATCTCGCTCGCCACTCTCCTCCAATCTCTCGCTCGCTTCCTCACTTTTTATTCAAA
TACAAGTGTATAAAAATTGTTTATAATTGTATAAATCAGAGAAAATTGTATAAATACATATATTTTCGTTCCCCTCTCTCCCCTCTTCCAGATCTCGCTC
GCCACCCTCGCCTTTCCCACTTATACAAACAAAAGCGAAATGTATAAATTGCGTTTCTGTTTGTATAAAGCGTGAGAAAATTGTATATACACATGCAAGT
ATATTTCGTCCTATATACCTATAATTATACAATAAAAATACTCCCCTGCCCAGTTTCTTTTGCCTTTCTCTCTTTCTCGTTTTATACAATTTTCAATTGT
ATCTATTTCTCTCTTTCTCGTTTTATACAAATCGATTCAATTGTATATTCCTTATTAATTCTCTTTTGTCTTTATCTCTTTCTCATTTTATACAAATTCA
AATTGTATATAAATCGTTCTATACACTTATAATAATACAATTCATTTTATACACTTCGTTTTTATATAGTTCTCTGCCCAAGTGTATTTCTCTTTCTTGT
TTTATACACTTAAATTAAACAATTTGCTTCAACTGTATATGTATAACGAATTATATAGTTTCTATGTTTGTTATGTAGCGCAATTATGCAAACTTTGCTA
TAGTATACAAATATGATTTTTTTATGGGAAAATTGTATATAATAGCAAACCAATAACCTAAAACAAATGGAATAGCTAGGGTTTGATTTAATTGTGCTCC
ATAACAAACGTTAGCTAAAATTTGCCAGCGTCTCTCTCCCAGAAATCTCGCTCGCCACTCTCCATTCTCGCTCGCCTCTCTCGCTTTATACACAGAAGTG
TATAATTCTGTTTCTGTTTTGTATAAAGCGAGAGAAAATTGTATATACACATGCAAAAATATATATCTTCGTATTATACACTTAATTATATAATTTACAA
ACATTTTACTTCAAATATTGCAGAGAAAAAGGCAACGAATTATACAATTGCGAATTATACAATTGCAGTGAAATACAATTTTATCTAGCTTTATACAACA
GAAGTGTATATATTGTGTTTCTGTTTTTGTATAAAGCGAGAGAAAAACATATATCTTCTTGCTATACACTTATAATTATGCAATATACATACATTTTAAT
TCGATTCAACTGTATGCAAAACAAATTTTATAAAAATATTGCAGCGAAATAGGCCGCGAATTATACAATTGCAGTGAAATAGGATAGCGAATTATACAAT
TGCAGCGAAATAGGCTAGCGAATTATACAATTTAGGCCAGCGAATTATACAATTTTGGCCAGCGAATTATACAATTGTATATGTATAGCGAATTATACAG
TTTTATGTTTGCTATGGAGCGCAATTATGCAAATTTTGCTATAACATACAAATATAAATTTTTTGTTTGTTATATGTGAAAATTGCCCATTTTTTATTTA
CTATACGTGAAATTTGCTTTTTTATTTATTTATTATGTATTTAGAAATTATGTATTACAAATATTTTAGAAAGATTATAATTTTTTTTTATTTCTCGAAA
TATTTAAAAGATGTATAAATACTTGCTTAATAAAGCCAGGGTTAACTTAACATAAACCTCAGGAAGTGAAACCCTATAAAACCCAAAACGGTAATCACTC
ACACAAATTCTCACTTGCTTTGCTTCAGCAAACCAAAAAATGTCACCTCCATCAACTTCTCAAGTGCAACTCGCCATAGCAGCACTCTTCGGAGCTTCTG
TGATGGCTATCGCCGGCTTCTTCCTCCATAAGCGCAGCGTCGATGAAATTCTCGATCGCCTCATCAAGCTTCGCCGGAAACATCAACTCAGTTATCCTAT
TTCCGATTCCGAGCCGGAAGAGTTTGATTTCAATGAAGATGAGATTGAGAATGTTAAAACTAGGAATGTTTATACCAGTAACTTATCGACTTCGATTGAT
AATATTGATGATGACGATGATTATGATGATAATGGTGGTAATGTGTTGGGAAGTTACAGAGTTTCGTCGTCAATGCCTAATGTTCGTGTTTCGAATGAGT
GGTTGAATGAGGATTCGAGTTTAAATCGGACTGATAAGATACTATTGTCGAATTCCACGGAGAGGCTTAATTTGGTTCCTTCCAGTTCATTTTCTCCTAG
AAACAAAAGCAAGAGTGGTACGTGCTTTGAACTCGAGTGCTTTTGAATTTTTATTTGTGTGATAGATAGCCAGTGTAAGACGAACTAATTTATGAGAATA
TGTTCGGATGAGATGGATTGAGACAGGTAATATTTGAGGTGAAGATAGATTTTTGTGAGTATTAATTATATATTCTATACTTTGTCATATTGCAGGTGAA
GAAAGAGCTTTGAGTAGCTTGAATCCGTCGATGCGAATGGAATCTGTTGGGAAGCCAATGACTTCGAAACTTCCAGCTGATTCTGTAGTTGAAGGTGTTG
GCAACTCTAATGAGGACAAAGACGAGTTTGCTGTTGCTGCAGAGGATGTTGTTTACTCTTATGAAAATGTAACATTTTTGAACTGCTCAAATGTGAATTC
TGATATGCTTCTGCCATTTTTCTGTACATATATGCATATCCAAATATAATCTTATCTAGCTTTCTCTTCCTTACAGCCAGTGGTGTTTTAGCGTTTACAT
ATTCAATTACTGACATTTAATGTTGATTAATAAATCCTGAAGTTCTAGGTATATGAATGTGAAGTTACACTTCACTGGATTTATAGGAGTAGTGTTTTTT
TATAGGTAAAGTAATTTTATTCACAAAGCACCACAATGCCAATGGGGCACTGAGTGTATTCAAGAAGTATATCATTGTTGTTTTGTATCAAAGCGTTAAG
TTTGTTTCTAACTCTCTGAATTTAGGTAGTATCTCAGGTGTGTGTTTCATGTTGTTAAAATAAGAGAAAATAAGAATGTCAAATCATTCTCTATACTGTG
TGGCATGTGTGCATCAGTGCATGATGATGAGAATTGTTTAATGTATTTGTTAAAACAAAACAAGAGGAAGAGAAAGAAAAGACTGCATATGGTATATGTC
ATACTGACCAAATTGCTATATTTGCTGCTTCCAACCAACCTAGCATTCTCTCCAATTTCTGAATGCTTCTGAGCGTTCTACTAATTATTTCTTCCTCCCA
TGGATATTTAGAGTCTCTCATCTCGACTGATCAAATGTTGAATTGCATGTCATTAATTTCACAAACATTTGATGATTATTTTATTCAGCTTATTGACTTA
AGGTAGTGCAGCTGCATCAGATTGCTATCCTCCCACCAGCCACTATGGTTTTATGATTAGGACAGTTAGATATTTTAAAACTGAAATCGCTCATGAAGTT
ACTTCTTTTGCTCCCATTACTTTGTAGGATATTGGTCCAACCGAAGAAGAATTTTCTGTTTCTGCCTTGACTGAAAGTCATATTCATCTTCAGCATAAAA
CAGCCGTACCTGAGGCAAGATCTAACATAGATCATGCAGTTGGAGAGGTAGACAAAGCATCTATGCACATTGTGGAAAATGATCCCAGTTTCTTCAACAA
CATTTTGCCCCTGCCTGCTACAACACATGGTATTCTCATCTTCTTGTTCTCTACAAGTTTTAGAAGACCATATCCTCTAGCAAGTGTTGCTTATGAATAT
CTCATATTAAATTATTTTCCTTGATAATCATGTCAATGATCTCTAAAAATGAATTAGAATTGTTACCTTTGGCTAATAGGTCATTACCTCTCTTAGAATA
ACTCAAATTCTTAGATCAGAACCCTGATTTGTGAAAAGAACTTGTCTGTCCCTTTACTCTTAATATACATACCAGGGCTTATGTGATCGCGGAACCCCTG
CTACTATTGTGGAGCCAGATGAGTCGGGCTCTTGTCGCCATCACAGTCCTTGCTTTGTAATTGTGGACGAGGCTCTGTAAGCTGAGGTCTTACATTGCGA
TCACGAAGTTGTTAATCCTGCATCCTCGATTCCTCTTTTCCGTGTTTGCAGCCTTGCTCCCTGTGATCACTATTGTACTATGTCCAATTCTAAACTGATC
CGAACAAGGCTGAACCCCCACGGGACTCATACCAACAAGTGATTAACAATTTAGGCAACATATAAATGCATTTGTTACATGGCTTGGTGCACAAAAACAT
AAATTGGGAGTGGATGGTGGGTTGTTGTGATGCATTCTCATGCAATATTTTTTTGGTATACTAATGAGGGATGTGTCAACCACTACTAGTGAGATCCCTC
AAATTTAAGAAAGTTTGTGTTATTGTGATCTTATTCATACTTAATATTATTCTTTCAATTGCTATCATTTCTTCTGCAGATCCTGGAAACGTCGAGGAGG
AAGAAGTACTGAAGTTGATCCGTGAATGTTTAGATTTGAGAGAGAAGTATGTTTACAGGGAAGAAATTGCTCCATGGATGAAAGAGACAATAAGTGAATC
AAAAGCGTCAGATAAGAAACATGATCCATTTAGCTTTGGCCACTTTGAAGCATCTTCTGTGAGTTGTGATCCTCAACTCATTTATGACCGTAAAGGGTTT
GATTTTTAGGTTGCCGTATTCTCAGTATCTCAAAGTATGGATGTTGTCTCAAGCACAATTTCTAATAATAATACTTCTTGGATTGCACACAGCACCATTT
TAAGATGGAGGACGGAGTTGTACGTGTTTATGCTAGTGAAAACGGTATGCTTGGTTTCAAAAGTGGAGCACATTTGATTGGATGTTGTAGTTTGACATTG
TTTCATCATTAATTCTTGTCTTCCTTCTTCATGGGATCTTCACATCCTACCTTGCATGTTGTAGATACGGAAGAGCTGTTTCCTGTTGCTAGTGCAACAA
CATTTTTCACTGATATGCACCATGTCCTCAAAGTAATGGCTGTAGGAAATGTTCGTTCTTATTGTCATCATCGTTTGAGATTTCTCGAGGAGGTGACGGG
TTTGGCAATTCTCTTTAATTTCCCCCCCTTTTGTCCAATTTTGTTGTTATTGCATGTTATCTTGATATTGTACCACCTGTTAGTTCTCTTTTTTTTTTTC
ATAGCATTTTCTTGATATGGTACAGAAATTTCGCCTCCATTTGCTCGTAAATGCTGACCGGGAATTTCTGGCTCAAAAAAGTGCTCCTCATCGTGATTTT
TACAATATCAGAAAGGTTGATACTCATGTGCATCATTCTGCTTGCATGAATCAGAAGCATCTTCTGCGGTTCATCAAGTCGAAACTGAGAAAAGAACCTG
ATGAGGTAGGAAAATTATTGCTTCCAGGGAATATGCTTTCACTTGCAGATTTCTTAGGGTATGTCGGCATGCCTGTTCTTTTGGCCTTAATCACATGACT
CTTCACTAAACAGGTAGTCATATTTCGGGATGGACAATATCTTACACTGAAGGAAGTCTTTGAGAGTTTGGACTTGACAGGGTTTGCATTAACCTTCCCC
TGCTCTCTTTTGTTTTTCTGCATAAGTTCTAATATTCTGCTATCTGTGCCCAGGGTGGGAGGTCCACTATTTATTCTCTCTCTTCTAAGCACTTTATTTG
CAGGTATGATATGAATGTTGATCTATTGGACGTACATGCTGATAAGAGTACATTTCACCGGTTTGACAAATTCAATCTCAAATATAATCCATGCGGACAA
AGCAGACTCAGAGAAATCTTTTTAAAGCAAGACAACCTTATCCAAGGTGTGTCTCTTGAAAACACAACTCCTAACAGTGAATTACCTATCCTACAGAGTT
GTCATTTGACATCACCAATTCTAACTTATTTTCTTCAATTTTATCCTGAATCTCCTGTAACACAACTGTCATAATTAAAGCATATGATATGAATTTTATT
TGGTTCCATTGAACACATTCTGCAGCAGTTAACTTTTGTTTTTGTTCAATTAAAAATCTCTGCAGCGAGTAATTTTATTTGGAACTTCCATCAAGGCAAC
TGTTGCCATACTGTTAAAGCTGCACTTTCTTTTCTGTTGACAGTTGCTTGATGACACCTAATTATTCTTTCGGTAACAGTCCACAATAAATTTCTTCGTT
TTCCAAATATTGTCTTATTCAGGACGCTTCTTGGCTGAAGTCACTAAGGAAGTCTTGCAAGATCTTGAAGCAAGCAAATACCAGGTACAACAACATGCCT
TAATCAGTATTATAACGACTTAAGCATGTGCAACTCTTTTTTGTTAACATGAAATGTGTATATTTTCTTAAAAAAGCTGAAGGGATAATGCACAAGTACC
CCCTTAATCTATGCCAGAAATCTCAGAGACACTTATACTATACTAAGGGGGTAATAGGACCACAATATAGTATAAGTGTGTCTCTGAGATTTCGGACATA
GGTTGAGAGGGTATTTGTGCTTTTTCCCAAGCTGAATATAATACCATTTTACTCATTCAGTTGTTGCCCCAGTTTTCCTGAAATTACTGAACAATGATCA
ACTCTGCATACTTCTTGATAAATAGAAGAATATTACATAAATGCTGTGAGACTACTAAAAGTCTTACTTCGCTTGACCTTGTAGATGGGAGAGCTTACTG
TCATTGATTTTGAAAGGATACTGCCAATTGTCAATATCATTTGTGCTCTGATTATCTTGATTTGAACTTGACCTAATAAGAGCTTACCATTTGCAAGAGC
CCAAACTGCTGCAATTATGCCTCATTGAAGTGTGATCCCCATATCTAACAACAACTTGTTGAAAGGATTGGATGACCAAACTTGAAAACATGTTGGCTGT
CAAAGTTAGACTAGGATAATTAACTAGGGACAGGGAGAATTTGACACAAATGGCTTCTTTTCTGGAATGGCGTATGATTCAACTGTTGTTTGCAAATATA
TGACTTCTGCTGACCGAATATTTCCTCTAATCTTTATCTCTTTGCCATGACAAGCTGTTCATGAGAAATTGGTTCTGTTATCGAAGTCTAATTTTGTTGC
TGTACTCAGAAGCACCAGATTCATAATTGTCGATCTGTTGATGTGCAACTTCTTGTTTATCCGGGAATTTCCCGGGGCTTCATGCTGATTTGAAATTATT
GTTTGTTTTTGTGATTAGAAAAATCTTTAGTTTTTGTTTGTATCTTAAGTTTTTTTGATTACTACTGGGGTATGAGTCCCAGTCTCTCATGGTCTGTCCC
AGTTTCATTGACCACTAAAACACTGCATGTGACTGTAGTTCTTGCAACTTGTGAGGATGCCCCGTTTGATTGGCGTAGGCAGTTTGTAGCCCTCAAGAAT
GAAAACTGCTTCCAATATGTATGGGTACTTAATAATACTTTTAAGATATAATATGTAGCTATCACATTAGCCTTTGCCTCCTGTTTTTTAATTCTAGGCT
CTGATTGTCAATATACACCTTATTTGCGGAGTACTTCTATCATATTTCAGTATGGGGACAATTTGCCGTTATAATGTATGACAATCCTTTCTTCTTGAAC
AGTTGGCTGAATACAGAATCTCCATCTATGGAAGGAAACAAAGTGAATGGGATACACTGGCTAGCTGGTTTGTGAACAATGAACTTTATAGCCAAAATGC
AGTATGGTTGATTCAGGTGGGTTTTATGCTGATCATGTTATATTTGTGTAAATGAAGCCTTTTTTTTTCATTTTATATTCTCGTAATACTTTTCTTTTGG
GCTACTTTCTTCACCACCTTCATTACCTACATAAATATGATAAATTACATGAGGATTATACATTTCTAAGAAGTTATAGAATTCTTACCTACAACAAATA
TGATACATTACATGAGGATTGCACATTTCTAAAAAGTTAGAGAATTCTTAGCTACGAATACTTGAATAAACATGTATAGGACCTCCCATCACTTTCTCTT
TCCTATTTTGCCTTGCGGACACATTGCTCTTCATATCACTGCCAGACTCATCCCTTGCTTTGAAGACTGTCCTATTTGTTACACATTTCTGTCCTCACGT
TTCAATATAGAAATGTGTTGGGTGGGTGGGGCATGTTCTAGAAGTTTCTCTAGATGACATTGATATTATTTTAAAGTATAAGCTATTTTTGAAGTGCTTA
AGTGGAGGACCCAATGGTTGATGCTGGTAGCATGTTAATGGTGACCAACTGAGAGCATGGTTTGCTTAGTATGTGATGTCGGTTTGATTGGTTCAGACAT
GATTTTGGAATATTCAGGAACTTGCTCGATAAAGTGAGCACCAAAATAGACTTCAAATGCTGAATGAGACAAACTTTCCCTTCCCCATATGGGAATCTGG
GTGAGGGAAAGAGGAAGAGGTAAGGAGGAAAGTAAACGGATGTTTGGTGGATAAATGATGGGGCCGCTGCTTTGCCCCCGTGCTTCTAGTTTACGTCTTA
GTGCAGCAAGTTCTAAGTTCTACTTGAATGTAATAGTTAATCGCAAATCAGTTCTCCTAGTTAATTTAGATCCTTTCAGTGATTATATCGGTATAGTTGC
TTATGGATATATGATGCATTTCTCACTTTTACACTTTGCAGCTCCCTCGGTTATACAATGTGTACAGGAGTATGGGAACTGTCACGTCCTTCCAGAATAT
TCTAGATAATGTGTTTATTCCACTATTTGAGGTCACAGTTGATCCAAAGTCTCATCCTCATTTGCATCTGTTTTTAATGCAGGTATGTTTCCTTTCTAAT
CTTTATAGTTACGTTGTTTACCCTAAACACCAAAGCTATATTTTGAAATTTTCTGATTTCTCTTTTATAATCTGTCGATTTCAATTTTGTGCACTGCAGC
CAATAAACAGCATTTCCTTTGCCCCTCATTTCTTACTTTTATCTAATTTTTTTTGTTCTTATCTGCTACAAATTGTTTTCCATGGAGTTAGTCCAATATA
ACATTTGATATGGACCTGGCTTACTGCAACCTTTCAATATGAATCTTGGGAACAAGAGTTTTAATGAGTGCAGCTATGGAAGTACATATATCTTTCTAAT
GAAGGCGGCCATCATTTTCTATGTTTCTTGTTATTCACTGCTAGAATGCCGTCATACAGGAACCAATTTATTCAATACATTCTGTGCATGCGTAGTATTA
GAAAATTTTAGCCAATTGAAGTAGCCTAAAGTTTTATTATTTCGGGGACAGGTAGTAGGTTTTGACATGGTTGATGATGAAAGTAAACCAGAGAGACGTC
CTACCAAGCACATGCCGAAGCCCGATGAATGGACAAATCAGTTCAATCCAGCATTTTCTTATTATGCGTATTACTGTTATGCGAACTTGTATACACTCAA
CAAGGTCAGTGGTGCTTCATGATCCCAAATATTTGCAGGCTCTTACATCTGCAATGTACTCATCAAATTTTTATCTTCCTTTGCTGTCTAATTTTGTTCC
AGAAAAATTATCTATAACAGTAGGTGGTTTAATTGAAGTTCCTTAAAATCAGAAGTCAGAACTGAAGAAAGTGACTGTCCTAGCGGTGAAGCATATGCAG
ATTTAATCTATTGAATAAATTTTGTTAATACCAAAACTTCTTGTTGAAAAGTCAAGAAATAAGTGAGAGAAATTTGAATCCAATTTGACTAAGACATTTA
GTGAATGCATGTACAGGACATTTATATTCCCAGATGGTCACTCTTCATTACCTGCATTCTTTTGTCCTATTTTACTATCCCCTTTTTCTTTTCATCTCTT
TTCTCATTCTTCTTTCTCTCTGTTTCAAATTTGTCCATGAGCAGACTACATTCTGTGTTATTCATTCCTTCTCAATAAAAATAATAAATGTTCAAGATAT
CACGGGTTTGAATCCTGCCGACCAAAGCTTGATATTTAAGCGGAGAAGGGTAGAAGAGGGGCGATCAATTATCCGCTAGGTTTTGGAGCATGGCCAGTCG
CCTCAGTGATTTCTTGGTTATAAAAAAATAAAAATAGAATAAATCTTGTCATTAAATTGATACTGCAAGAGACGTTTAAATTATTTTATTTTCTGGACAG
TTTCAGGATAAATAATTCCAATCAAGTTCTTTCAAATTAAAGTTGGTTATTCAGTAACTTAACAAAGACTAGGAGTTTAGGTCAAGCTCATAATGGGCTA
CCTAATGAAGATACCAGTGGCCAAGAGCCTTGAGGCTTTCTTTGCTTCAACCACACATACATTGAAGTTCCCACTTCCCCCCACATGAGTTCTAAAAGAA
ATTTTACTGCCCCCATCCACAAAATTCGTTTGTGTGCAACAATTCCTTAACAATCTTAGCTAGAAGCTGAAAAAATAAACGCCTCCACTTTTGAAGGAAA
TTTTATAACTTTATCATGTGATGTTTACCAACCTCTTTTTTAGTATTTATGTTTGCTAGCATATATTGAGCTTCTTCCTGTCTACCATCACCCTTTTCTC
CGTGTAAGGTAGAGGACATCTTTTCTAAAAGATTGTGTGGATTGTTGTCTTTCTTTCCAGAGCAAGATTGTATCTTATGTACTTATTATTTCTTATGTCC
TTAGCTTCGTGAATCAAAAGGGTTGCCAACAATCAGATTAAGACCACACTGCGGGGAGGTTAGTGTTTGCTTCAGCTGATCTTTTAGTTAGCTACAGACA
AGTGCCCCAAATTTATGCTCTCATGTTCATACAGGCGGGTGATGTTGATCATTTAGCTGCCGGATTTCTTTTATGTCATAACATTTCTCATGGAATCAAT
TTGCGGAAGACCCCTGTACTGCATTATCTTTACTACCTTGCTCAGGTACTTCTCCTCATTACCTTCACCTCATTAACTGATATGCCAGTGAGCTTTGTTT
AGATGTATTTTTGAATTACCTGCAATTAGATGACATTACTAAATCATTTGTGGGGTGGTCTAAGGAAGATTGTATTACACATGCGTACAGTGGAAGGGCT
GTAATGTCCTATGAGGTGCTTGTTGAAGTTTATGAAGCATTGCTAATATGATTAAGTTCAAAATATTGAGGCTGTAAAAGAGGGATTCACACACTGGATT
GAGAACCATAATGAGGAAAAATGATAAGAAAAACGTACGGGCAATTTAACGTAATAGTATTGTATACTAGCTGTCAATCAAAGTGTCAAATTATATAGAG
TAAGCAAGTTTATCCATAGAACATTGAAATAGAAAATGTTTCTCTAGAAGAGCTCCCTAACTGTTTTTGATGTATTGTATGTCCACTTTGTTGCATATTT
CCCAGCAGTTCTGCATCTAGCTTTGGCTTCTTGAACAAATCTAATACTCTTTTTTATTGATATACACTAAGATGGCAGTAGGTGTGCAATTCAACTACAT
TTTGTTTATTCAGTATGCAGCATGTTTTATATGTACAATAACTTCCCATAAATTTGGTCCATCCGATGATTTGATTCATTATCATGTTACATTGTAACCC
TTCCTCTATCTATTCACTTTATATTGTCATTGTTTCTGTAAAACTATTCAGGTTGGACTGGCAATGTCTCCCCTGAGCAATAATTCACTTTTCCTTGACT
ATAATCGGAACCCATTCCTTATGTTCTTCCACCGTGGCATGAACGTTTCACTCTCTACTGATGATCCCTTGCAAATCCACTTGACAAAAGAGCCCCTTGT
GGAAGAATACAGTGTTGCAGCTAAGGTCAGTCCCTTTTTTTTTTCTAATCAGTAAAATATCCACATGTCCTTAACCAACTTATATTTTTTCAGGTATGGA
AGCTGAGCTCTTGTGACCTTTGTGAGATAGCTAGGAATTCAGTCTATCAGTCAGGATTCAATCATGCAGACAAGGTGAGCGATTGCAGCATTCAGGCCAA
ATTTATATGCAACTCCCTTATAAATCTTGTGTGTGGCCTAACTAGTGTTTCTTTGGTTGAAAAATCACAAATTTACTGGTAATTATAACATTATAACCGT
GGTTTCTCATAGTTCTGGTTCTTGAACTTCGTTGTTTGTGAACATCTACAGTGGTGTTGATGACTTCATTTTGTTTCCGCTTGTGTCAAATATCACATCT
CTGAGAAACTTGTATATTGTTACCTAGCCCGGAGGTTGACGGCGTTGAAATACTAGTAACATAGGCTTAGAGGTTAATGGAAGCGCTTGAGATGCAACTT
ACTGCATCCGAACATATTATGAGAAGGAGGTTTAGCTTATTCATGGGTAAGGGGTATTCTAGAGAGCACTTTGTAACCCCAATGCTAATTTTACTTCCTA
TGGTAAATGTTGCAGAGACATTGGCTTGGCAATAAATACTACAAGAGAGGCCCTCAAGGAAACGATATTCACAAAACAAATGTACCCAATACGAGGATTT
CCTTCAGACATGAGGTGAACTTTGCTTGTGCTCCCTTTTATCTTTTATCTCCCTAAGATGATAACTTGCAAGATGTTAGTGTTCTTGGAACTCTGAAAGT
TGCTCGTGTAGAAAATCAGAGTAACTAATATAAAATGACGCATGATATACTGCAGACATGGAAGGAAGAGATGCAGTATGTTTACAGAGGAAAAACAATC
CTTCCCGAAGATGTAGAACATTGATCAAAATGGCATCAACAATCTGTATCCTCGCAGGGGAAACATCATGATTCAGGTACCATCCTTCTTCTTCACAAAT
TGTTCCCAAAAAGAATGACGAGTAGTGTGTTGACGTTGCTCACTGATTTCATTTGCTTGCACAGATATACAGAAATAAGGCTCCTGGAGTGGCGAGGTTT
AAGAACAACGTTAAATATTGCTGGTTAATTTATGCTTCGGTGGAAGCATATGTTATCATGGTGCAAATTTAGTGCCTTCATTTCTAGTTGTACTAAATCT
TCACTTGGTGGAGGTTTAGGCAAAATCATAAGAATGTAACTGGCTCATTGCTGCAATATTCTTGTAGTAACACCAGGTTTATACTAAGCTGAAGCAATCT
TTATGCAATGTCTTGTGGATCTATTATGCTTTTTTATTCTCTTTCATTGTAGTATTTAGCATCCACATTGCGTTAACGTGAGTTGCAATTTCAGTGCAAG
TAGTATTAGAAGTTGGAATTTTCACTAATTAAAGAAAACTAAGTCAGAGAAATTTGTAGAGGCAACACAAAAGAGTTATCGACAAATGGTAGGTTTAGAG
AGAGTATTTAAAGTGTGTAAAGCTAATGATGTGAAGCATGAAACATGCGTAAAATTGAGATTTGATACTCAAAGTATCAGCAAGAGGTAATGGGGGTGAT
CGATGATGATGTCACACATTATATTGGTGTGGTATGAATGAAGCAGAGATTTGCATCTTGCGTTTTGTGTGACATTAAAGTACCACTGCAACTTGAAACT
AAGTTTTATAGAGTGGTTGTAAGATTTGACTTTGTTGATGAAGTGAAGTGTTAGTTAGTCAAGAACTCCAAGTTATGAAAACCCAAGTGGCGAAATGAGG
ATATTGAGATAGATGCGCATGCATACTAGGAAAGATGATTAGGAATGAGAATATTTGAAACGAAGTGGGAGTGAATGTCTTGTTGGATAAAATAAGTGAA
AGAAGACTAAGATAGTTTGAATGTGAAGAGCAAATGTGCAAATGCCTTCGTTAAAAGGTTGGACATAGAGGGATTAATTAAGACACTGGTATTGCCGAAG
AAGTACCGAGGATATGTGATTAGGAAGGATATGTCAATCTTTAATGTATCGAGTACATGACCCTATATATAAGGATATAAAGGTTGTCAATAAGAGTAGA
ATATTAGTAGGTAGTTGAGAGTTGTCTTATTACTAGCTCATTCATGTCTTTAACTGAGTGGAAGTATAGACTACATATCGATTACAGTATTAGCATATAC
ATGTCGTATTTGATTTCATCTATGGTTTATTGTATTTTGATTCCTTACGTAGTTGCTCCATTCTACTTTACTATTAGTGATAAAACCTAAATACGCTTTA
CCATTCTCAAATCTCACTTTATGAGATTTTTCTAGGATAGTTATATATCATATTTGTTCGTTTTTTTAGACGAGCTGCAATAAGTTGGACCAAGCTATTA
AGAAAATAGATTAATGATCCAATCAAACTTAAATAAATTAGACGAACTATATTTTTATGGGGTAATTTTACCGTCCGCCGTACTCTTGGCCCATTTTCAT
TTTATTCCTAAAAAAAAAATTAAAAAAAATAATTTTTGTTACTTAAGAGGAAAGTGGAAAAATCAGTCCACTCTGTCAAGAACCCCAAAATTCTTTCTCC
TTAAACTCCAAGTCTTCCCGCCGCTTCACTTCACTTCTCAAACCCTCCACAACTCCGCCGTTCACGGCGGCGGCATAATCCCTTCAGTTTCTCCTCGTCT
GCTTTATTTTCATCTTCCGATGGAGGCCACGGCGGCGTCTGAAACCTCCGATGGACCTGTTTTGAACGTGATCAACAAACGCCTCCGTGCCCTCCGCAAG
AAATACAACCGCATTCTACAGATGGAAGAGTCTCTCGCTAATGGGAAAACACTTAACAAGGAGCAAGAAGAAACTTTCCGCTCAAAACCCAGTGTTGTTG
CTGCCATAGACGAGCTTGAGAAGCTTCGTCAGCCACTTGCTGCTGCTGTAACGGAAGAAATCAACCTTGCTACTCAACACCATCTCGTCTCTGCTGCGGA
TTCCCCAGATGAGAAATTAGCTGGAAAAGGCGATAATAGTTGTGTTGAGGTTGAGGATTTGCTTAACATTATTTATTTTGGTAGCATGTTTGCTCATGCG
AATTGGGGGAAAAATGACTTTGTTTCAACTATGTGGAAAAGGGCTATGCATGAGAGGGCTTGTTGTTTGAACTATGATTGCATGCCGGAAGATGAGTCGA
CGGATGTGATTGATATGTTGTCGGAGAAGGACTTGGATTTGATCTCTATGCTTAGTGAGCTACTCATTTGTCGTCCTGTTAACTCTACTTTGTCACACAA
GCACGCCCTTCAAGCTTGTATTGAGCATGCCAAGCTGTGGATAACAAAGTCTGATCAGCTCATTGTGCCAGAATCAGATGCTACTTGTGAGTGCAAAGTT
TACTCCTTTCATCCCATTTTATATCGTCGTTGTTACTGTTTTCGTAAATATTTTGATTTGCTGCACTTGAGTTGTGTCTCTCTTTGTCCACTAGGTAGGG
TAAGGTCTCCATATACCCTACACTCCCCAGACCCCATTTGTGGGGTTACACGGGGTATATAGTTGTTATTTATGGATGAAAGGATAGCTTGATAGTGAAA
AAGTTCAATATTTCATCAAAGTTTTGAACTTTGTACAGTTGCAATAATATATTTGTATTCTTTAAAGTTGTATAGAAATGAGATAATGTTAGTCATTTTG
GGACATGAAAACAAATGTGGTATAGATTAAAAAGGAGGGACTGTACTAATAGCAATATCCCCTTTTTAGTTAAGACTGAGGTGATCATTTCTATATACTT
ATATTTTTGTTTCGTTGCAGATGCTGGTTTGAGATCTAAGTTGAACAAGATCATGTCTTCGTTCTATTTTACAACGGAACCTGTTTTTAGAGTGGAACAG
ACTGTTGCTGAGTATGAGTCTTATCAGGTGCCAGTAGAAGAGACGGTTTTGCCGGTCAATGCAACTGGGCAGGTGGAGAGTTCAGTTGAGCGCTATCATG
AGAAGGTAAATGCTACTTTGGTCTACCTCTTAGATAGAATATCCAAGAAAATGTAACTTGTTGACTTTTACGATGATTACCCATGTTTTCTTTTGCTATT
TCCCAATAGTATTATAGTAAACATAGAAGTTATGTGATGTTGAATTAGGCCCTATACTGATTCTGCGTACTCTAGAACACACTTCAGCACAATGCTAAAA
TTTGTACTTCACATGCCCAAACCTTCACTTCTTTTTGGTTTGTGGAAATAGAAGACTTTTATGTGGTTTTTTTTAGGCCAATCTTTTGACTGCTCAGGTT
TTTGGGACCTGATCCTTGCTAATAGGTTGCGTGCTTCTCCCCTCTTTTGATTTTATTTGGGGTTGGTATTTAGGACTTGTACCTTTGACAGAGCACACCT
TCCTTTATTTTGCTAAAATAATGGTCGTTTGTGTTATTATTTGTGTGATAAAGAGTTCATGAACTTTATTGGTGAATGGTGTAGATTTTTCTGCGGTACT
TCTATTGTGGGTGAAAAATTGAGGCTTTTGTTAGTTTAGGTACCAAGAATAATATCTTGAACAATAGTAGATATATAGTGAAATAACAAAGATTACTGTA
GTTGCTAATTAGAAGTGATTGTTAAACACTGTTTTTAAGTATAAGAGTTATTTGATACCATCAACTAAACCACATAACCCAGTGTATTAACAAATGGTAG
CCATACATTTGGGGTGACATGGACTAGGGTTGAAAATGACTGGGTTGTATAGCCTGGACTGCATTTGGCAAGATAAATGATGTATTTACTTTTGTGGAAA
ATGTTCCATTTTTTGTTCTAGATTGGTTTTGGTGTTTGGCTCTGTACAAAGGTAGGTCTTAAAGGCTTGTGAGTGGTGTCTTGGTGATAATTGTATCAAT
ATTCTTAATGTAACAAAGCAAATGACATGGATTAAGAGTGAAGTTGGTAGAAGAGGAAAATAAATTATATCCTTCAATGACGCAAGTCATGTATGCTCCA
GTTTTGGACTCTAGCTTAAATAAATTAGGTGAGCATATCTGCTCCAGCCTTGTAGTGTTTACCATTTATGGACTAATAGTATTTTTCCTTTTGGTTTATG
TGCTACTCTCTTTGCCCTAAATTAACTATCCTACACCCTGATGTGTTGTCTTCATATCTGTACCTTTCTATATTCCCTTCAATAATTTTAGATAGGAGTT
AATGTTATTCTAAGGCTTGTTTTGAGATCCGCTGGGGTGGTTCGTGTTATTGCATTTTTCTTCTGTCATTAATAAACAATGTAGTTATTTGGTGCAAAAG
GGGAAAACATAGTACATCTCCGAGGTTTTAGAAGGGACCAAATTAAAATTTGTGATTCGATTCCCACAGGTGCGTTACAACATAAGTTCCAGATAAAAGC
AATCAAAAGCATGAATTGACGAGAACATTAGGATACCATATAAACAATGGATGCAGTCCTTCTCTAAAGAAGGATGATACCCACTATGAACAATGTTATC
CGTACACATCATAAACATGGGAAGTCCTCATAAGACAATTCGCGAGTTTCATAAAATATAAAATTGCTTCAACCATGCTCGCTTTTTGCTAAAATCGATC
TATATATTAGTAAGAGAGTAAATCCTAATGTCTTTTTATAATGTGGAGTCTGGGCCAGCTTGTAAGCACTTCAACTATGAGAAGTTTCAATTGTTAGTGA
AAATGTCTGACGAAGAGCACCAATTTGAATCAAAAGCAGATGCCGGAGCTTCCAAAACTTACCCTCAACAAGCTGGTACTATTCGGAAGAACGGTTACAT
TGTAATCAAAGCTCGTCCTTGCAAGGTTGTGGAAGTCTCCACTTCCAAGACTGGCAAGCATGGACACGCCAAATGTCACTTTGTAGCAATTGACATTTTC
ACTGGCAAGAAACTTGAGGATATTGTTCCCTCTTCGCACAATTGTGATGTCCCCCATGTTAATCGTACAGATTACCAGCTTATTGACATCTCCGAGGATG
AATTTGTGAGTCTCCTCACTGACAGTGGTAATACTAAGGATGACCTGAGGCTTCCAACAGATGAGAATCTTCTCTCACTGATCAAGGATGGATTCGCGGA
GGGCAAAGACCTTGTTGTGTCTGTCATGTCTTCCATGGGAGAGGAACAGATTAATGCACTGAAGGATATTGGTCCCAAGTAAGATGTGACCAAGGGAGAG
AAGGGACATGACGGTACCAGCTTGTTCAAGAACATCTACTTCTACTTAGTGTTCTTGATACGCAAGCCCCCAATTTCTATTTGATCCTATATCCATAGTC
CTTGAGTTAGATTGTTGTTCTAATATTTGTTGGAATTTATCTGATTACTTTAAACGTTTTCAAATCTCCTTGTTCGATGAGTTTAGTGGGTCATTTGCTA
GAGTATATTAGAAGTAATAATTCATTAACTTTCTGTATTAATAGTATTCTGTTTGGTACATCTTTGCAGTAGTTATACGCTCTAAAATAAAAATTATGCA
ATGTGTGCTTTTTTCATAAAAAAAAACAAACTATTCCATCAGGCAACAATACCTGGTATCTCCTTCTAACAGAGAAGAAATCATCTAGTTTTTTCTTGCC
TCAGCTTGGATTTGACCTTGGACCTCATGATTCTTCTCCCTAGTGGTCAAAAATTTTATTAAGGGTGTTCAAGATTTAATATATACATATGAAAAATAAA
TTGACCTATATACTTTGTATAATTTGTTATATACATAATATAAATTTTTCGACGGAGGGCATTCGACTGGCCACCTGTCACTACATGTGGCTATGCCACT
GCTTCTCCCGCATCATCCACTTCTAGACCAAACCCTTGGGTTGCAAGTGATAGAGTATATCATGAGAAGGGAAAACATTAACTGCTGAAAATGCTTTTCT
TTTTTCCTGCCTCTTTAATTGCTGCTCCTTTGTAAAAGATAACAAGTTACTTCTTGTTTACTATCTTCTGCTGTAATCAATCTTCCTGACCAATTAAGAC
ACCAAAGGCTGCCTGTGAGACTTCCCTGTTCCTTCTTCATCTTTATCTAGGCCAAAACCCATTTTGAGTTCCAACTCAAAGTATGTATTTCTCTCTCTCT
TTCTTGCTTTAGTAATTTGTTGGGATATTCGAATACGCCTGGTGTTTTGATATATGTGGATAATTAGCTTTATTTAGGAATTTGCCCATGAAACAGTGAA
TTCGGGATTCTGCAATTTATTAATCTGAGATCTTTCCTTCTTTTTGAGGTTTCTTACGAAGAAGCTATCCCTTCTGTACATTTCTTGGTTCTCAAGTCTT
GGAGAAGGATCATTTTCTTGTTTCTATTTGGTTAATTGGCCTTTAAATTTGGTCCTTATGGAGTTCCTCTCAAATTTATCAATAAAGTGTATTTTTAATG
CAAATCCTGAAGCAACCTGAACTTGGTTTAAAGTTTATTTTGTCTCTCTTTCTAGAAAGTTAGCTTATTCTCTTTGCACTTGTTTTGGAATAAGTTCCTG
AAGTGATACTACAACATAAGCTATAGTTTAACTAGCTGCATTTATCTGTTTCTGATTAGCTGCAATAAGGTTTAAGGTTGTGGATCTCTCACGTGCGCGC
ACAGGCGTGCACCGGGACAAATGCCTTTTGGTCATTGATAGATACATTTCTTTGTTTTTAGTTCAGTTTTTCATTTTGTAATCATTTCCCTGAAGTGTAA
TGCTCTATTATGACCTCTTTAATTGAATGATGTTGTGCCTTGATCTCCACCTTCCCCTTCCCCCCTCCTTTCAAACAGATAACAGAACTAAATAAACAAA
CTTGTGTTTTTTGTTATTCCATTTCTGTTACTATTTAGTGTTTCCTGTACTTCGACTATAATATTATTCTGTAGTAACGACTGTTCCTTCTATTAGTATG
CTTTGTCATGCTTTCTTCAGCATTTTGTCTCGTCTTCTTCTCTCCTATTGTTTTCTCTTTTCGAAATGCTTTTACTTGAGCTGAAAGTCTATCGGAAACA
ACCTCTCTATCATCCAAGGTAGAGGTAAGGACTGCACAAACACTACCCTCCCTAGATCACGCTTGTGGAATTGACACTGGTATGCTGTTGGTGTTTGTTG
CTTACTATCTTCTCTGGGAACACTGATTTCACCATCTGAGAAAAGTATGGAAAAACTTATTAACCGTCAATGCTGAATATTTTATCTTTATTTGTTAGAG
GTAGAAGGTAAACTACACACTGTCTCTTCTCCTAACCACTGATTTCACCATCAGAGAATGATAATTTATTGACTCTTGACCATCGTTTGGGCAGCACTAT
CTGAAAAAAGAATATTTTAGTCTTTCCCTATGTGTTTGTTGAAAATTTTGATGTCTTATGTTGTTTTTCATCTATTCACTACTTCTGATATATTAATGTG
TAAATGCTAGAATTTTATCAATAGTTGTGCTTTTAAATTCTTGTCTCGAGATATGATGTGACACTTGTGTGTTTTAGTAATGGTAGTAACTCGTCAACTG
ACTCTGCATAGGTCCACATTTTTAGCACTTCTTTTCTGTTTTATATAGTCACTTTAGAAATCCTAGCTGTAGTAGCTTCTGTTCCTGCATAATCCAACTT
CAAATATTTATTTGTTTTCCAGGGTGGAGAACATGTAAATTCTCAAGCTGATAAATCTAGCGAAATTCACGATAGCTCTGCAAAAGATATCAACCAGGTA
TGCATGTGTACTTCTCGGAGAATGCTTTCTCAAGTTGAATGTTGTTATTCACAAGATACCATAAAAGGCTATAAATGTTTAACTTTTTTTCCAATATAAA
AATTACTTTGATGGGGAACAGGAGAACTTGTCCGAGCAACATGCTGCACCAGAAGAAGTTGGACATGAGGGAGAAGGTGTTGAGGATCCGAAGGATGCAA
ATGTTGATAATCAACAATCGAATCCCCGGAGGTCCCATCAGCATTTCAGGGGTAATCGAGGTGGTGGAGGCCGTCGTGGATACAACAATGGCCGTGGAGG
CCGTGGTAGAGGACGGTCTTACCATGATGACCACAACCCATACTATGATCAACCTGGTAATTATTACCCCAGGAATTATCCTAATTATCGGGGAAGGGGT
GGTAGGGGTAGCCGTGGTGGTGGGAATTATAGCTACTATGCTTCAGGTGATCAAGCTGGAAATGTCCCCGCCTTTTCATGATTGTTTAGGTGAAGCAGCA
TATGCTATACCTTTTTTGTTGGAAGCTGATAACGCTATTTCCCCGTTAACCTGAAGCACTAAATGTGTCAAAACTGTTTTGCTTGTGTTAAGTCCTCTAC
CAGAATAGCATTAAAAAGGGTCAAGTGTAGTGTCTTCTTTTGAACTTCACAACTTGTTAGATCAATTTTGAGTCTCCATTACTAGTTTTATCTCAAGTGA
AATTGTATGATAATGTCTGCTGTATTCTGAGTGACTAAAAGTTGCCTGCTGTTATATATCATCCAGAAGGCCGCGATTTTTATGCAGATGTGCTATTTGA
GATGACGCTAAATCTTACCTTACTAATCTTAGTAAACGGAGCGACAGTTTTTGAATGGAATGGTTAATACCTCACTTGTGCTATATGGGTAAAATATTGA
AGTCCTATACAAGCATGTGTGTTAATGACATTTTAAATTTTTCTGGAGATTCTTTCTTGCTGGTTTGGAAAGTATCCAAAATTTATTGAGCTATGTCAAT
ATTGAAGAAAATCAAGATAATAGGATGATTTTATATTATGACTTTGATTTGTCAAAATGAAATAATATAAGAAATGGTGTGACATAAATTTTATAAAATA
AAGCTGTGACACTCTTTTGTAGGGTTGTGTATCTTGTCGGTTTGATTTTGAAATTTATCGATTTGTATTTATGCTAAACAGTTATGGAAATGTAAAGATA
TCAATTTATTGGTTAGTGATCAAAATTTTTCATTTAGAATTACTAATGGATAATTAGCAGTAGCCAGTAGTCACTCATGATAGAATTTTTCTTTGATAGT
CCATTATTACATAAAACACTTAATAAAATTCACCGACTCAAAAGGAATCCTCATAACAATCAAGCTAGTTTCGATATGAACTATAAAGAGAAATCATTAT
AGAACTATTAAAGAAAATCATTAATGAGCATGAGACCATTACTATTAAAAAATTTACATTGCAGATTATAGAATTTCAATATTGCAAGCGTATTTTACTA
ACTCACTTATTGTAATGAGAAGATAACAAAAAAAAAAATTTAAGTAAGGAAACCAATCATTTGAACCTTACTTTAGTAAAACAAAGACTTAAAGTAAGGG
AACCAACCATTTGTATCTTAATTTAGACTCTTGGAGAATGATGTTCAATATAACTCACCAGCGTGGAAACAATGACAACAAATCAATCACTGATGTCGCA
ACTTTCGAATATTATTATGAAATATTGTGTGTCGATTATAAAGTCAATATAAAGAGTTTGAAGACTAAAGTGTAAACCCTAAAGAGTAAAAGTGTCTAAG
GCCTTAAGTGATATAAATGTAATTAATTAAACTTCTTATCGGGTTATCGGGACACCCGATTAGAAATATGGAATAATCGAGGTCCGAATGGATAAGTCGA
TAAGAAGTTTATGGTAAGTTGAGATCCAAACCCTTTAACCATTAACTGGAACTATCGATCCAATAACTAGATTACTGGTTAGAGTTATCGATTTCGATTC
GATTTTGAACTATCCTACTCCTCTGCCATGTCTTGATGACTAATGTCAAAGGAACAAAGACAGCCACATTTAGCCCACATAAAATGAAAGATACTATAAA
CAACAATAATAACAATATGTTTAATGTAGTTCGATAAAGATTGGGGTTTCATTTCGCCACTCTATTTCAATAGCAACGACAATGTATTTAGTATAGTTTG
ATAAAGATGACGTTTGATCACCTACTCTATTTTAATACAGTGTATAACATCTTCGTTAATTATCATTACCTTGGATAGATCTAAGGTACTTAAAACTTTC
TCAAAATGACTTATGTATTTATTATCACTTTCATATCTATTTCAAAATCACGTTAACACTCTAAATATTCAATCTAAATTATTCTTACCAATATTTAGAT
ATGCAATAATAATTCCGCCTACGTTACTGACTTAACACTCTAAATATTCAATCTAAATTATTCTTACCAATATCATGATAAAATGAAATTTTATTTCAGA
TTAATTTTATACCACAATATCTCTTAATTTTCACTCACTTTTTAAATCACTATACCATCCATTTGATGCACTTCAAAATAAATTATTCCTTTTTGCTTTT
CGATAATCAAAACATAATTATTTTCATTTAGTCAATAAAGTGTATCAACTTGTTTAAGATGTCACTTATATATATTTTATAAATGGTGTTGGAAATATAT
ATAAAATGTTTAATTATGCTGATGGAGAATAAACCATCACTTTAATATTTGAGTAATTTAATAAATTAGTACTTTTAGATGTCATGAATGGTGCATAAAA
GTAAAATGCATCAAACATCTTTGAGATCATATCTTAAAAATAAAGAAATGACAAGATAATAAAAGTTTAATAATATGTACGTCAGCTTTATTTAGAGATT
TCAAATTTGAGTCTTGAATATAGAGAAAATATCATTGAAGGTGTCATCCTTAAAATAAATCTTATAGTCTGCAATTCAAATTTAATCAGTACTTCAATAT
AAATATCAAACACGAAATAAAAGTTAAAAAAATAAAAAATTAATTTTTTTTTCAAAATTAATAGACAGAGAACAAGAAAAAAGTTATGCTAGCTAGCAGC
ATATAATGAACGGTAATTAAAATTCAGCTGCAAAAGTTTTTTTTTTTTTTACTGCGGAAGAATCCTACTTTTAATCTTGTCTTGAAAATAAAGATCATTT
TTAGGTGTTTAATTATTTTTAAAATTTATACAAATAAAGAGGAATATCACTTAAAAAGAAAATTAAATTAGATATTTATTTTATTGTATCAACAATTAGT
ATAGATGTATATTCATCTCGAATACATAGTTATATATTATCTATATGCAAATATACATTATTTATATGATAATGATACATGATATATTGCATATACATAT
GACTATTTTATGTAAAATATTTTTTGTTGTTGATACATATTGATAAGTAATTCGAAGTCAACCACTATATATCGTACGAAAGTCCTATGTGTAACCATGT
ATAACCTTATAATTTATTTACGTTTTTATTGAGCTAAGGTCGATCAAAAATAACTTTTTTTTATTCTGAATAAAGATAAGGATCGTGTATATATATCAAT
CTTCTTTGATAAGGCGATCTTTAATATGTCACATGGAAAGCTGAAACTAAAAAGTTGTTAAAAAAATAATATTTTTTTTTAAAAATAGATTAAAAAAAAG
TATGATAAATAAATCGAAATGGAAAAAATAATTTTTTTTAGGGCTTGATTAGATGGAGGAGAGTTGATGAAATGTGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCCAATCACACAACAAATCA
AGAGGTGTCAAGTCATTACTTTCAACTCTTCAACAAAATGCATGATCCATTTAAATTTTTTGAAAGATACAAACAAATTGGTAATCATCATTTTACTTTA
TTGTAACATGTTGTAGAGCCCGTTTTGATTAGTTGACTGTAAATAGTTGATAAGCTTAAGTGCTGACAATTATTTTAAGTGTTGAAATTAATTATGTAGA
TAAATAGTTACGTATTTAGATAAAAGTGACGAAACTAGTAACCACTTTGAATCTTTAAAAGATACAAACAAATGGTAAATTATCATATGGTACTAATCAT
TTGCCTTGTTTCTAGTAGGTTGTTATTGACTTCACAGCTACATGGTGTGGTCCTTGCAGAAACATGGACCCAATTATCAATGACTTTGCTGCCAAATATA
CAAATGTTGAGTTTGTCAAGATTGATGTTGATGAACTAGTTGTATGACTTCTTAAACTTCACAATCCTTTTCTTTTTTCGAGTTTAAGTTCTATAAATTG
ACGTGTTTACACAATCAGGATCACTTATAAGATAATTATAGGAGAACCTATATAATAAACGTTACAATTTGGTAAAAATAATAGAAGTTAATAACGTTAG
TGTGTATATCTTAAATCCTTTTCCATGATAGTAATTTTACTCGAATCTTGGACGATTGAAAACAGGATGTAGCTGAAAAATACGGGGTTCAAGCTATGCC
AACGTTCGTGTTGATGAAGAAAGGGGAGGTTGTTGACCAGATTGTGGGAGCAGATAAAGATGGACTAAAGATGAAAATTGAGAAACACAAAGGTAGCTTA
TACTAAGCAAACCAAAGGGAAAATGCAAAGCAATGACACTTCTTGTGTTTGAATAAAGTTCATGTGTTTGTGGAAATTTTGAAGTGGATGAGATCAGTCT
AGTGGTCTCAGTTATAATTTTTAAACTGATACAACTAGTTGTATATCCATATCAAGTTCTTCGTTACATTTATTTGAATAAGAAAATGCATCTTGTTTTC
GTGTTGATATGTCTGTTCTAAATGGCCAGAAAATTTAAAATTGGCTTGTTTGCCTCTGCGGACCAGATTGGATCATTACTAAGATCTTAACAAACGTCAA
TGAAAAATTTTGAATTTTTTTTCAGAATTTGGATCACCAAAAATCCATGAATTATAGCACATGAAAATTGACAAAATGAAAATTTACATGCTCTAGGGTT
TGTTTGACCTAGAAAAGGAGTCTGTTTGCCCATGGGGACCAAGTGACTCCATTGCTAAGGTCTTAACATACGTACATGAAAAGTTTTAGGAAAAAAATTA
GAATTCCAGACCACCAAAAAATGGGGTTTTACCTGCCTTAGAACTCGTTTGACCTTGAAAATGGTCTATTTACCCATGGGGACCATCTAACTCCATCGCT
AAGGTCTTAATGGACGTCAATAAAAAAATTTAAGTAAAAAAAATTGAAATTATGAATTTATAAAAATTTGGGCAAAAAAGAAGTCGGCATTTCGGATCAC
CAAAAAAGATCGTAGACTATGCACATGAAAATCGGCAAAATAAGGGGTTAACCTGCTCTGGTGCTCGTTTGACCTTCAAAATGGGTTGTTTTGGCCGACA
TGACCAACTGACTCCATAGAAGACGTATTAACAGACGTCCACAAAAAATTTGGGCAAAAGAGACGTCGAAATTCTGAATCACTAAATATCCATGGACTAT
AGTACACAAAAATCGGCAAAATGAGGAATTACATGCCTCGAGGCTTGTTTGACCTTCCTAATGGGTCATTTTTTGCCGTCAGGGCCAATTGGCTCTTTAG
ATAACGTCTTAACGTATGTCAACAAAAAAATTGAGCAAAAAGATATATCAAAATTCTGGATCACCGAAAATTCACGGACTATAGCACACGAAAATTGATA
AAAAAAAAAGGGGGTTTCACCTGCCCAGGGGCTCGTTTGACCTTGAAAATGGATCGTTTTGGTTATCAAGGCCAATTGACTCCATATCTAACATCTAAAC
AGACGTCTAACAAAAAAAATTGGGTAAAAAATAAATCGAAATTCCGGATCACCAAAAGATTGTGGACTACACACAAAAATCGGCAAAAGAAGGGTTTTAC
CTGCTCCGGAGCTCGATTGACCTTCAAATCAGATCGTTTTGACCGTCAGGACAGACTGGCTCCATATGTAACTTCTTAATGGACGTCCATAAAATATTTG
GACAAAAAAGACGTCAGAATTTCGAATCACCAAAATCCATTGATTATATAACACAAAAAGCATCAAAATTTACCTGATTCGGGGCTTGTTGACCTTGAAA
ATGGATCATTTTGGTCGTCAAGGCCAACTAGCTCCATAACTAACGTGTTAACGGACGTCCATAAAAAATTTAAGAAAAAAAGACATCGGAATTCTGAATC
ACTAAAAATCGATGGACTATAGCCACAATAATCAGCAAAATGGACGGTTTACCTGCTCAGGGGCTCGTTTGACCTTCAAAATGAGATGTTTTGTCTGTCA
ATCAAACTGACTCCATAGAAAACGACTTAATGGACGTCAATATAAATATTCGGCCAAAATAGTGTCGAAATTCCTGATCACCAAAAAAGATCGTGGACTA
TAACACATGAAAATCGGTAAAATGAGGTGTTTACCAGCTCTGGAGCTCGTATAACCTTCAAAATGGACTTTTTTGGCGTCAGGACCAACTGGCTCCATAG
ATAACGTCTTAATGAATTTCCATAAAAAAATTGGGCAAAATCGACGTCGAAATTTTGAATCACAAAAAATTGATGGATTATAGCACACAAAAATAGAAAA
TAAGGGGTTCACCTGCTTTGAGCCTTGTTAGACCTTCTTAATGGACCTTTTTGGTTGGTAGGGCCAAATAAATCCATACATAATGTCTTAAAAGACATCC
AAAAAAAATTAGACAAAAAAGACGCCAGAATTCTAGATCACCAAAAATCCATGGACTATAGCACACAAAAATCAATGGGAGTTTACCTGCTCAAGGGCTC
GTTTGACCTTGAGAATGGTTATTTTGGCTGTCAAGTTCAACTAGATACATAGCTTACGTTATAACGGATGTCATCGAAAAAATTGGGCAAAAAAGACATC
AGAATTCTGGATCACCAAAAAAGATCGTGCACTATAGCATACGAACATCAACAAAATGAGGGGTTTACCTACTCTAGGGCTCGTTTGACCTTCAAAATGG
GCCGTTTTGATCGTCAGGACCAACTGACTCTATAGTTAACGTCTTAACGGACGTTCACCAAAAAATTAGGCAAAAAATACATTGGAATTTCGAATCACCA
AAAATCCATGGATTATAGTACACGAAAGTCGGCAAAATGGGGTTTACATGCTTCAGGGCTCGTTTGACATTGAAAATTGGACATTTTGGACGTCACAACC
AATTGGACTTATCAGATGTCCATAAAAAAATTTAGCAAAAAAAGATGTCAAAATTTTGAATCACCAAAAATCCATGGACTATGCCCCACGAAAATCAGCA
AAATGGGCTATTTACCTGCTTAGTTGCTCGTTGACCTATAAAATGGATCGTTTTGACCGCCAGGGTCAACTAGCTTCATTTCTAACGTATTAACGGACAT
CCACAAAAACTTTAAGCAAAAAAAAAAAGGAATTCTGGATCATCAAAAATATCGTGGAATATGAACATGAAAATCAAAAAAATGAGGGGTTACCTGCTCT
GGGCTCGTCTGAATTCGGGATCACCAAAAATCCATGGACTATAGCACACGAAAATTGGTAAAATGAAGGGTTTTTTTTACTATCTCAGGGGCTTGTTTGA
CCTTGAAAATTGATCGTTTTGGCCGTAAGGGCCAACTAGCTCCATAGCTAACGTCTCAACGAATGTCCACAAAAAATTTGGACAAAAAAGATGTTGAAAT
TTCATATCACTAAAAAAAATTGTAGACTATAAATTACGAAAATTGGCAAAATGAGGGTTTACCTGCTTTTGAGCTCGTTTGACCTTCAAAATGGGTCATT
TTTTTGGCCCCATATATAACATCTTAATGAAAGTCCACAAACAATCTTGGCAAAATAGACGTCGAAATTCTGGATCATCGAATATCCATGGACTATAGCA
TATAAAAAATGGCCAAAATGAGGGTTTACTTGCTTCGGGGCCTGTTTGACCTTCTTAATGGTTCATTTTGGCCATCGGAGCCAATTTGATCCATAGATAA
CGTCTCAATGGATGTCCAAAAAAATTTGGACAAATAAAATTGGAATTTTGGATCACCATAAAGGATTGTAGACTATAACACATAGCTAACGTCTTAACAG
ACGTCCACGAAAAATTTGAGCAAAAAACACTTTGGTATGCTGGATCACCAAAAATTCATGGACTATAACACATGAAATTAGGCAAAATTGCGATTTACCT
TCTTAGTGGCTCGTTTGACCTTCAAAATGGGGTGTTTTGGCCGTCAGGGATTACAGGCTCCATAACTCGGTAAAATCTGTTTTTGCCTACTTTGGACTCA
TTTTCACTTGTAAATGCACCATTTTTCCCTATGGAACGATTTGACTCAATTTCTAATGTCTTAACAAACGTCCATAAAATTTTTTGGTCATTTTGTTTCA
TGATTTCCAGATATAAAAATCCATGGGTTATAGTACACATAAGTCGTAAAATATTTCTTTGCCTGTTTTGGAGCTCGTTTGAACTTTAAAACGCATCATT
TTCCCCTCAAGCGAATTGGTTCCATTTCTACGGGCATCCATGAAATTTTTTGACCATGTTATTTTGGGATTTCCAAATAAAAAAAAATTCATGGATTATA
GCACACGAAAATTGATAAAATCAGCTTTTGCCTGCTTTGGGTTTGAACTTGGAAATGCATCATTTTTCCCTTAAGGGACGAACTAGTTCAATTTCTGATG
TCTTAAGGGACGTCCATGAAAAACTTTGGCAATTATGTTATGAGATTTCCAGATCAAAAAAATACATGGGCTATATAGCATACGAAAATCGATAAAATCC
TCCTTTGCCTGCTTTGGAGCTCTTTTGAACTTGAAAATGCACTATTTTTCTCAACGAGACAAACTAGTCCATTTCTAAGGTCTTAATGGACGTCCATGAA
AAATTTCGGCTATTTTCTTTAGGAATTTTTTAGATCAAAACAAATTCATGGGCTATTGCACACGAAAATCAGTAAAATCTGCCTTTGTCTGCTTTGAGGC
TCGTTTGAACTTGAAAATATATAAAAAAAATTCTGCGGGATGAACTAGTTCCATTTCTAAGGTCTTAATGGACGTCCATGAATTTTTTTCTTGTTTTAGA
ATTCTTGGATAAAAAAAAATCCACAGGCTATAGCACACGAAATTAGTAATTTGCCTTTGCTGCTTTGAGACTCGTTTGAACTTGAAAATGCACAACTTTT
TTTCGCGGGATAAACAATTTCCATTTCTAAGGTCTTAATGGACAACCATGAAAATTTTTGGCCATTTTGTTTTGGGAATTCTGGATAAAAAAAATCCATG
GGCTATAGCACACAAAAATCGGTAAAATATGCCTATGCGTGCTTTGGAAATCGTTTGAACTTGAAAATACATCATTTTCCTCGCATGATGAACTGTTTCT
ATTTCTAAGGTCTTAACGAACGTACATGAATAGTATTGTCCATTTTGTGTCAGAATTTTTGGATAAAAAAAATTCATCGCACACGAAAATAGTTAAAATT
TGCCTTTGCATGCTTTGAGACATGTTTGAACTCAAAAATGCACCATTTTTCATCAAAAGACAAACTGTTCCATTTCTAATGTCTTAACGGACGTCCATGA
AAAAAATTCAGTCATTTTATTTCAGAATTCTGGTTTAAAAAAAAATCAAGGGGCTATAGCACATGAAAATCAATAAAATTTATCTTTGCTTACTTTGGGA
TTACGTTTGAACTTGAAAATTCATTATTTTTTCTCGTATGACGAACTAGTTCCATTTCTAATGTCTTAGCGGACGTCCATGAAAATTTACGACCATTTTG
TTTTGGGATTTCCAAATAAAAAAAGTTCATGGGTTGCATAGACAAGGACTTGACGAACGTCCATGAAAAAATTTGGTATTTTTGAAGGCGGAATCCGGAT
CACCCAAAAAATGGTGTGCTATAGCACACAAAAATTGTCGAAATGAGGGGTATGCTCGCTTCGGGGCTCGTATACCTTCCAAATGGGTCGGACAAGCCGT
GATGGCCAACCGTATGCATAGACAAGGTCTTGATGGACGTCCACGAAAAAATTTGGCATTTTTGACGTCGAAATCCGGATCACCCAAAAAATGGTGTGCT
ATAGCACACGAAAATCATCGAAATGATAAGTATGCTCACTTCGGGGCTCGTTTGACCTTCCAAATGGGTCGTACAAGCCGTGATGGCCAACCGTATGCAT
AGAAAAGGTCTTGAAAGACGTCCACGAAAAAATTTGGCATTTTTGACGTCGGAATCCAGATCACCCAAAAAATGGTGTGCTACAGCACACGAAAATCGTC
GAAATGAGGGGTATGCTCGCTTCGGGGCTTGTTTGACCTTCCAAATGGGTCGGACAAGCCGTGATGGCCAACCGTATGCATAGACAAGGTCTTAACGGAC
GTCCACGAAACAATTTGGCATTTTTGACGCCGGAATACGGATCACCCAAAAAATGGTGTGCTATAGCACACGAAAATCGTCGAAATGAGGGGTATGCTCG
CTTCGGGGATCGTTTGACCTTCCAAATGGGTCGGACAAGCCGTGATGGACAACCGTATGCATAGACAAGATCTTAACGGACGTCCACGAAAAATTTTAGC
ATTTTTTACGTCGGAATCCGGATCACCCAAAAAATGGTGTGCTATAGCACACGAAAATCGTCGAAATGAGGGGTATGCTCGCTTCGGGGATCGTTTGACC
TTCCTAATGGGTCGGACAAACCGTGATAGACAACCGTATGCATAGACAAGATCTTAACGGACGTCCACGAAAAATTTTAGCATTTTTTACGCGGAATCCG
GATCACCCAAAAAATGGTGTGCTATAGCACACAAAAATCGTCGAAATGAGGGGTATACTCGCTTCGGGGCTCGTTTGACCTTCCAAATGGGTCGACAAGC
CGTGATGGCCAACCGTATGCATAGACAAGGTCTTGACGGACGTCCACGAAAATTTTTGGCATTTTTAATGTAGGAATCCGGATCACCCAAAAAATGGTGT
GCTATAGCACACAAAAATCGTCGAAATGAGGGGTATGATCGCTTCGGGGCTCGTTTGACCTTCCAATAAGGTTGGACAAGCCGTGATGGCCAACCGTATG
CATAGACAAGGTCTTGACGGATGTCCACGAAAAAATTTGGCATTTTTGACGTCGAAATCCGAATCACCAAAAAAATGGTGTGCTATGCGAGCCTGCCACT
ACGCTCCTTTGTTACAGAATTAATGGTCAGAAACTTGCCTTTACAGCACACGAAAATCGTCGAAATAAGGGGTATGCTCGCTTCGGGGATCGTTTGACCC
AGACAAGACGTTATGGCCCACCGTATGCATAGACAAGGTCTTGACGGACGTCCACGAAAAAATTTGGCATTTTTGACGTCGGAATCTGGATCACCCAAAA
AATGGTGTGCTATAGCACACGAAAATCGTCGAAATAAGGGGCATGCTCGCTTCGGGGCTCATTTAACCTTCTAAATGGGTCGGACAAGCCGTGATGGCCA
ACCGTATGCATAGACAAGGTCTTGACGGACGTCCACGAAAAAATTTGGCATTTTTGACGTCGGAATCTGGATCAACCAAAAAATGGTGTGCTATAGCACA
CGAAAAACGTCGAAATGAGGGGTATGCTCGCTTCGGGGCTCGTTTGACCTTCCAAATGGGTCGGACAAGCCGTGATGGCCAACCGTATGCATAGACAAGG
TCTTGACAGACGTCTACGAAAAAATTTGGCATTTTTGATGTCGGAATCCGGATCACCCAAGAAATGGTGTGATATAGCACACGAAAATCGTCGAAATGAG
GGGTATGCTCTCTTTAGGGCTCGTTTGACCTTCCAAATGGGTCGTACAAGCCGTGATGGCCAACCGTATGCATAGACAAGGTCTTGACGGACGTCCATAC
AAAATTTTGGCATTTTTGACATCGGAAATCGGATCATCCAAAAAATGGTGTGCTATAGTACACGAAAATCGTCGAAATGAGGGGTATGCTTGCTTCGGGG
CTCATTTGACCTTCCAAATGGGTCAGACAAGTCGTGATGGCCAACCGTATGCATAGACAAGGTCTTTACAGACGTCCACAAAATTTTTTTGCATTTTTGA
CGTCGGAATCCAGATCACCCAAAAAATAGTGTGCTATAGCACATGAAAATCGTCGAAATGAGGGGTATGCTCGCTTCGGGGCTCGTTTGACCTTCCAAAT
GGGTCGGACAAGTCAAGATGGCCAACCGTATGCATAGACAAGGTCTTGACAGACGTCTACGAAAAAATTTGGCATTTTTGACGTCAGAATCCAGATCACC
CAAAAAATGGTGTGCTATAGCACACGAAAATCGTCGAAATGAGGGGTAGGCTCGCTTCGGGGATCGTTTGACCTTCCAAATGGGTCAGACAAGCCGTGAT
GGCCAACCGTTTGCATAGACAAGGTCTTGATGGACGTCCACGAAATTTTTTTGCATTTTTGACGTCGGAATCCGGATCACCCAAAAAATGGTGTGCTACA
GCACACAAAAATCATTGAAATGAGGGGTATACTCACTTCGGGGCTCGTTTGACCTTCCAAATGGGTCGTACAAGCCGTGATGGCCAACCGGATGCATAGA
CAAGGTCTTGACGGACGTCCACAAAAAAAATTGACATTTTTGACGTCGGAATCCGGATCACCCAAAAAATGGTGTGCTATTGCACACGAAAATAATCGAA
ATGAGGGGTATGCTCGCTTCGGGGCTCGTTTGACCTTCCAAATGGGCCAGACAACCCGTGATGGACAACCGTATGCATATACAAGGTCTTGACGGACGTC
CACAAAAAAATTTGGCATTTTAAACGTCGGAATCAGGATCACCCAAAAAATGGTGTGCTATAGCACACGAAAATCGTAGAAATGAGGGGTATGCTCTCTT
CGGGGCTCGTTTGACCTTCCAAATGGGTCGGACAACCTGTGATGGCCAACCGTATGTATAGACAAGGTCTTGAAGGAAGTCCACGAAAAAATTTGGCATT
TTTGACGTCGGAATCCGGATCACCCAAAAAATGGTGTGCTATAGCACACGAAAATCATCGAAATGAGGGATATGCTCGCTTCGGGGCTCGTTTGACCTTC
CAAATGGGTCGGAAAACCCGTGATGGCACACCGTATACATAGAAAAGGTCTTGATGGAAGTCCTCGAAATAATTTGGCATTTTTGACATCGGAATCCGGA
TCACCCAAAAAATGGTGTGCTATAGCACACGAAAATCGTTGAAATGAGGGGTATGCTCTCTTTAGGGCTCGTTTGACCTTCCAAATGGGTCGTACAAGCC
GTGATGGCCAACCGTATGCATAGACAAGGTCTTGATGGACGTCCATAAAAAAATTTGGCATTTTTGACATCGGAAATCGGATCATCCAAAAAATGGTGTG
CTATAGCACACGAAAATCATCGAAATGAGGGGTATGCTTGCTTCGGGGCTCATTTGACTTTCCAAATGGGTCGGACAAGTCGTGATGGCCAACCGTATGC
ATAGACAAGGTCTTGACGTACGTCCACAAAAAAATTTGGCATTTTTGACGTCGGAATCCGGATCACACAAAAAATGGTGTGGTATAGCACACGAAAATCG
TCAAAATGAGGGGTATGCTCGCTTCGGGGCTCGTTTGACCTTCCAAATGGGTCGGACAAGCCGTGATGACTAACCGTATGCATAGACAAGGTCTTGACAG
ACGTCTACGAAAAAATTTGGCATTTTTGACGTCGGAATCCGGATCACCCAAAAAATGGTGTGCTATAGCACACGAAAATCGTCAAAATGAGGGGTATGCT
CTCTTTGGGGCTCGTTTGACCTTCCAAATGGGTCGAACAAGCCGTGATGGCCAACCGTATGCATAGATAAGGTCTTGGCGGACGTCCACGAAAAAATTTG
GCATTTTTGACGTCGGAATCCGGATCACCCAAAAAATAAAATGAGGGGTATGCTCGCTTCGGGGCTCGTTTGACCTTCCAAATGGGTCGGAGAAGCCGTG
ATGTCCAACCGTATGCATAGACAAGGTCTTGACGGACGTCCACGAAATTTTTTTGTATTTTTGACGTCGGAATCCGGATCACCCAAAAAATGGTGTGCTA
TAGCACACGAAAATCGTCGAAATGAGGGGTATGCTCGCTTCGGGACTCTTTTGACCTTCCAAATGGGTCGGACAAGCCGTGATGGCCAACCGTATGCATA
AACAAGGTCTTGACGGACGCCCATGAAAATTTTTTGCATTTTTGACGTCGAAATCAGATTACCCAAAAAATGGTGTGCTATAGCACACGAAAATTGTCGA
AATGAGGGGTATGCTCGCTTCGGGGATCGTTTGACCTTCTGGGTCGGACAAGATGTGATGGCCAACCGTATGTATAGAAAAGGTCTTGACGGACGTCTAC
GAAAAAATTTGGCATTTTTGACGCTGGAATCCGGATCACCCTAAAATGGTTGTGATATAGCACGCGAAAATCGTCGAAATGAGGGGTATGCGCGCTTCGG
GGCTCGTTTGACCTTCCAAATGGGTCGGACAAGGCGTGATGGCGAACCGTATGCATAAACAAGGTCTTGACGGACGTCCACAAAATTTTTTTATATTTTT
GACGTCGGAATCCGGATCACCCAAAAAATGGTGTGCTATAGCACACGAAAATCGTCGAAATGAGGGGTATGCTCGCTTCGGGACTCTTTTGACCTTCCTA
ATGGGTCGGACAAGCCGTGATGACCAACCTTATGTATAGACAAGGTCTTGACGGACGCCCACGAAAAAATTTGGCATTTTTGACGTCAAAATCCGGATCA
CCCAAAAAATGGTATGCTATAGCACACGAAAATTGTCGAAATGAGGGGTATGCTCGCTTCGGGGCTAGTTTGACCTTCCAAATGGGTCGGACAAGCCGTG
ATGGCCAACCGTATGCATAGACAAGGTCTTGAAGGACGTCCACGAAAAAATTTGGCATTTTTGACGTCGGAATTCGGATCACCCAAAAAATGGTGTGCTA
TAGGACACAAAAATCGTTGAAATGAGGGGTATGCTCGCTTCGGGGCTTGTTTGACCTTCCAAATGGGTCGGACAAGTTGTGATGGCCAACCGTATGCATA
GACAAGGTCTTGACGGATGTCCACGAAAAAATTTGGCATTTTTGACGTCGGAATTCGGATCACCCAAAAAATTGTGTGCTCAAGCACACGAAAATCGTCG
AAATGAGGGGTATGCTCGCTTCGGGGCTCGTTTGACCTTCCAAATGGGTCGGACAAGGCGTGATGGCCAACCGTATGCATAGACAAGGTCTTGACGAACG
TCCACGAAAAAATTTGGCATTTTTGACGTCGAAATTCGGATAACCCAAAAAATGGTGTGCTATAGCACACGAAAATTCTCGAAATGAGGGGTATGCTCGC
TTCGGGGCTCGTTTTACCTTCCAAATGGGTCGGACAAGCCGTGATGGCCAACTGTATACATAGACAAGGTCTTGACGGACGTCCACGAAAAAATTTGGCA
TTTTTTTACATCGGAATCCGGATCACCCAATAAATGGTGTGCTATATCACACGAAAAATTGATAAAAACAGTCTTTGCGTGCTTTGGAGCTCGTTTGAAC
TTGAAAATGTACCATTTTTTTATGCGGGACAAATTGTTTCTATTTCTACGATCTTAACAGACGTCCATGAAAAATTTTGGCCATTTTGTTTCATAATTTT
TGGATCCGACAAAATCAATGGGTTATAAAATATAAAAATTTGTAATATATATATTTGCGAGCTTTGAGGCTCATTTCAACTTTAAAATGCACTATTTTTA
CCCGCGTGACAAGTTGTTTACTTTTCTAAGATTTTAACGAAAGTAATGAAAAATATCGATCATTTTGTTTTGGGATTTCTGGATTAAAAAAAATTAATAG
GCTATAGATCACGAAAATCGATAAAATATGCCTTTGCTTGCTTTAGGGCTCATTTGAACTTGAAAATGCACTATTTTTACCGCAGATGAACTAGTTCCAT
TTATAAGGTCTTAAAAGACGTCTATGAAAATATTTTGGAAAGTTTATTTTGGGATTTCCGAATAAAATAAAATCATGGGCTATGTCACTTGAAAATCGGT
AAAATTAGCATTTACTACTTGAAATTCGTTTGAACTTGAAAATACATCATTTTTGCCCACGGAATAAACTGGTTCCATTTCTAAGGTCTTAACGAACATC
CATGGAAAATTTCAGCAATTTTTTTTGAGATTTTCGGATAAAAAATCAATGTGGTATAGCACACGAATATCAGTAAAATCTTCCTTTGCTCTTTTGAGGA
TCGTTTGAACTTGAAAATTCATTATTTTTTCCTATATGACGAACTATTATCATTACTATGGTCTTAACGACGTCCATGAAAAATTTGGGCCATTTTATTT
TGGGATTTCCAGATCACAAAAATCCATGGGCTATTGCACATGAAAATCAGTATAATTTGTCTTTGCCTGCTTTGGACTCGTTGGAACTTGAAAATGTACC
ATTTTCCCCACTTGACAAACTGGTTCAATTTCTAAGGTCTTAACGGTCGTCCATGAAAAAATTTCGATCATCTTATTTCGGCATTTATGGATCAAAAATC
CATGGCTATACTATACGAAAATTGTAAAATTTGTCTTTGCCTACTTTAGGACTCGTTTGAACTTGAAAATACACCATTTTCCCCCACGGTACGAACTCGT
TCCATTTCTAAGGTCTTAACAGACGTCCATGAAAAATTTCATTCATTTTGTTTTGGGATTTCTCGATAAAAAAAATCAATGTGCTTATAGCACATGAAAA
ATCTCCCTTTGCCTGCTTTGGAGCTCATTTGAACTTTAAAGTGCAACTTTTTTTACCCGAGGGATGATTTAGCCGAATGAAAATGAACGATTTTGGTCAT
TTTGTAGCTAAATTTTTTGATTTAAAAAATCCATGGGTTATAGCACACGAAAATCGGTGAAATCTCCGTTTGCCTGCTTTGGGGTTTGTTTTGAACTAGA
AAATGCACTATTTTTCCCCTCGAGATGAATTGGTTCCATTTTAAAGATCTAAACGGACGTCTATGAAAAATTTTGTTCATTTTGTTTCAGGATTACTTGA
CAAAAAAAATTAATGGGCTATAACTCACGAAAATTGGTAAAATCTCTCTTTGCCTATTTTGGGATTGTTTGAACTTGTAAAAGTACCATTTTCCATGCGA
AACAAACTTATTCCATTTCTAAGGTCTTAACGGACGTCCATGAAAATTCTTGGTCATTTTATTTTGATATTTTCGGATAAAAAAATCAATGAGCTATAGC
ACAAGAAAAATGGTAAAATATTTATTTGTGTGCTTTGGGCTCGTTTGAACTTGAAACTGGTTCAATTTCTAAGTTTTAACGAGCGTCAACGAAAAAAATT
TTCTATGTTTTTTCAAAATTTTCAAATTAAAAAATCATGGGGTATAGTGCACAAAAATTGGTAAAACATTTCTTTGTTTGCTTTGGAGCTCGTTTGAACT
TGAAAATGCAACACTTTTCCCGTGTTATGAACTGGTTCCTTTTCTAAGGTTTTAACAGACATCCATGAAAAGATATGACCGTTTTATTTGGGATATTTGT
ATCAAAAAAATTTGTCTTTGCCTAATTTGGGGTTCGTTTGAACTTGAAAATGCACTATTTTTCTCTACGGGATGAACTGATTCTATTTCAAAGGTTTTAA
TGGACATGAATGAAAATTTTAAACCATTTTGTTTTTCATGATTCTGGGATCAAAACAAAATTCATGCGCTATAGCACACAAAAATAAGTAAAATTTGTCT
TTGCCTGTTTTGTAAATCGTTTAAACTTGAAAATGCATCATTATTACCCGCGAGATGAACTAGTTTCATTTCTAAGGTTTTAACGAACGTCCATTAAAAA
ATTTGGCTATTTTATTTCACGATTTCGATATCAAAAAAATTCATGGGCTATATAGCACACAAAAATTGGTAACATCTGTCTTTGCCTGCTTTGGGGCTAG
TTTTAATTTTAAAATGCAATATTTTTCCTCAGGTGACGATGTGGTTCCTTTTCTAAGGTCTTAACAGCCCATGAAAAATTCTGACCATTTTATTTTGGGA
TTTATGGATTAAAAACTTCATAGGCTATAGCACATAAAAATCGGTAAAACTTGTGTTTGCGTGCTTTGAGATCGTTTAAACTTGAAAATGCACAATTTTT
CCCTTCGAGATTAATTGGTTCTATTTCAATGGTCTTAATGAACGTCTATGAAATTTATTGATCATTTATTTTCGTGACTTCTGGATCAAAAAAATATATA
GATAGCACACGAAAATTGGAAAAATCTACATTTGCCTGTTTTATGGATCGTTGCAACTTGAAAATGCATCATTTTTTCCTCGCGGGACGAACTAGTTCCA
TTTATAAGGTTTAAACGGACGTCCACAAAAAAGTTCAGCCATTTTATTTTGAAATTTTCGAATAAAAAAATTCATGGGTTATATCACACATAGATCAGTA
AAATCTGTGTTTGCTTGCTTTGGGACTCATTTGAACTTAAAAATGCACCATTTTTTTCTGTAGGACGAACTGGTTCCATTACTTATGTCTTAACAGACGT
CCATGAAAAATTTCAGCAATTCTACTTCGTGATTTTCGAATAAAAAAATTATGGGTTATAGCTCCTTAAAATCGGTAAATCAGTCATTTTATTTTGGGTT
ATAGCACACGAAAATTGGTAAAATATGTCTTTTACTTCTTCGGGCCTCGTTTGAACATGAAAATGCACTATTTTTTCCCGGGGGACAAATTTGTTTCATT
TCTAAGGTCTTAAAGGACGTCTATAAAAAAGTTTCGCCATTTTGGCACACAAAAATCGGTAAATTTTTCTTTTGCCTACTTTGAACTTGAAAATGCATAA
TTTTTTCTAACGGGACGAACTGGTTTCACTTCTAAGGTCTTAACAAACGTACATGAAAATTTTTTGGTCATTTTGTTTTGGAAGTTTCTGATCAAAAAAT
TTAATGGGCTATAACACATAAAATTAGTAAAATTTGTCTTTGCCTGGTTTGGAGCTTATTTGAAATTAAAAATGCACTATTTTTCCTAGCGAGACGAAGT
GGTTCAATTTTTGATGTCTTAATGAACGTCCATTAAAAATTTCAGCCATTTTGTTTCGTGATTTTCGAATCAAAAAAATCCATGGGCTACAACACATGAA
AATCAAAAAAATCTGCATTTGACTGCTTTGGGACTCGTTTTAACTTGAAAATGCACCATTTTTTTCTCTCTGACGAACTTGTTCCATTCCTAAGGTCTTA
ACGGACGTCCATGAAAAATTTTGGTCATTTTATTTTGGGATTTTTGAATAAGAAAAAACCATGGGTATAGTACATGAAAATCGATAAAAATCTGCCTTTG
CCTGCTTTGGGGCTTGTTTGAACTTAAAAATGCACTATTTTCCCCGCGGACGAACTGGTTCCATTTCTAAGGTCGTTACGGACATCCATAAAAAGTTTTG
ATAATTTTATTTTGGGATTTCTAGATCCAAAAAGTTCATGGGCTATATCACCGAAAATTGATAAAATTTGCCTTTGCTTTCTTTGGAGCTCGTTTGAACT
TGAAAATGCATCATCCCCCCCCCCCCCCCGGGACGAGCTGGTTCAATTTCTAAAGTTTAATTAATGCTAATGAAAAATTTCGGTCATTTTGTTTTGGGAT
TTTTGGGAAATTTTTTTATTGCCTATAGTATATGAAAATCGATAAAATCTGTTTATTCCTGCTTTGGGATCGTTTGAACTTGAAAATACATCATTTTTTC
CTCGCGAGACAAACTGACTCCATTTCTAAGATCATAATGAACATCCATGAAAAATCTCTGTCGTTTCATTTTTGGACATCCGGGTCAAAAAAATTCATGG
GCTATAGCATTCGAAAATTGATAAAATCTGCATTGCCCTTCTTGAGAGCTCATTTGAACATGAAAATGCACCATTTTTTCTCGCGGAACAAACTTTTTTC
CATTTCTAAGGTCTTAACACAAGTCTATGAAAAAATTATCATTTTGGCACACGAAAATCGATAAAATCTTTCTTTGCCTTTTTTGACTCGTTTGGACTTG
AAAATGCATATTTGTTTCCTCGCAAGACGAACTGGTTTCATTTCTAAGGTCTTAATGTACGTACATGAAAATTTTTATTCATTTTGTTCTGGGATTTCCG
GATAAAAAAATCCATGGGCTATAGCACAAAAAATTGGTAAAATATGTCTTTGCCTCCGTTGGGGCTCGTTTCAACTTGAAATGCATCATTTTTTCCCGTG
GAATGAACTAGTTCTATTTCTATGGTCTTAACAGACGTCTTTAAAAAGTTTCTTCTTTTTTATTTAGGAATTTATGGATCAAAAAATTTATAGGCTATAA
CACACGAAAATTGATAAAATTTGTCTTTGCTTGCTTTGTGGCTCGATTGAACTTGAAAATGCACCATATTCCCCGTGGAACGAACTGGTTCCATTTTTAT
GGTCTTATCGGAATTCTTTAAAAAATTTCGTCCATTTAATTTTTTGATTTCTGGATAAAAAAACATCATCGGCTATAGCATACGAAAATCGGTAAAATCT
GTCTTGCCTGTTTTTTGACTCGTTAGAACTTTAAAATGCACCATTTTTTCCCGGGGAGGAACTGTTTTCATTTCTAATGTCTTAATGGACGTCAATAAAA
TATTTTGGCCATTTTTTTGGGATTTCTTGATCAAAAATATTCTTGGGCAATAGCACATGAAAATTGATAATATTTATTTTTGCCTGCTTTGGGGCCCATT
TGAACTTGAAAATGCACCAATTTTTTCCGCGAGATGAACTGGTTCCATTTTCTAAGGTCTTAACGATCGTCTATGAAAATTTTCGGCCAATTTCTTTTGA
AATTTTGGGATCAAAAAAATCCATGGGCTATAGCAAATGAAAATTGGTAAAATAAGTCTTTGGTTGTTGTTGGAATTGTTTGAACTTGAAAATGTACCAT
TTTTTTGCGGGATGAACTGGTTCCATTTGTAAGGTATTAACAATGTCAATGAAAAATTTTGGCCACTTTGTTTCGCGATTTCTGGATCAAAAAAGATCCA
TGAGCTATAGCACATGAAAATCGGTAAAATCTACCTTTGCCTACTTTGGACAAGTTTGAACTTGAAAATGCACCATTTTTTCCAATGGGACGAACTAGTT
CCATTTCTAAGGTCTTAATGGGCGTCCATGAAAAATTTCGACCATTTTGTTTTAGGATTTTCGGATTAAAAAAATCTATGGACTATAACACACGAAAATT
GGTAAAATTTATCTTTGCCGACTTTGGGACTCGTTTGAACTTGAAATGTACTAATTTTTCCCGTGGGACGAATTGGTTCACTTTCTAAAGTCTTAACGGA
CGTTCATGAAAAATCTCGTCCATTTTATTTTGAAATTTCTAGACTAAAAAATACATAGATTATAGCACAAAAAAATTGATAAAATATGTCTTTGTCTACT
TTGGGGGTCGTTTGAACTTGAAAATGCATCATTTTCCCTGTGGGGCGAACTGGTTCATTTCTAAAGTCTTAACCAACATCCATAAGAAATTTTGGCGATC
TTGTTTCGGAATTTCTGAATCTAAAAAAATCAACGGGATGCAGCACACAAAAATCGATAAAATTTATCTTTTTCATAGGCTATATGCCTTTGCTTGCTTT
GGAGCACGTTTGAACTTGAAAATTCACTATTTCCCCCTAGCACATGAAAATTGAAAAAATGAGGGGTTACCTTCTTCGGGGCTCGCTTGACCTTGAAAAT
GGATCGTTTTGATCGTCATGGCTAACTAATTTCATAACTAACATCTTAACGGATGTCCACAAAAAATTTGTGCAAAAAAGACATCAAATTTCTAGATCAA
CTTAAATCCACAGAATAGCACACCAAAATCGGTAAACTTGGGGTTTACCTGCTCAAGGGCTCGTTTGACCTTCAAAACAGGTCGTTTTGAACGTCAGGGC
CAACTAGCTCCATAGATAAAATCTTAACGGACGTCCATGTAAATTTTCGTCAAAAATAACGTCGGCATTCGGGATCACAAAAAAAATGATGGACTATAGC
ACAAGAAAATGGCAAAATGAGAGGTTTACCTATTCCGAAGCTCGTCTGACCTTCAAAATGAACCGTTTTGGCCGTCAGAACCAAATGACTCCATAGACAA
CTCTTAATCGATGTCCACAAAATAATTGGGAAAATAGACGTCGTAATTCTGGATCACCAATAATTCATGGACTATAGCACATGAAAATCAGCAAAATGCG
ATTAACCTACTCCGAGTTCATTTGACCTTGAAAATTGGTCTATTTTCCCGTTGGGACCATCTGACTCCATTACTAATGTCTTAACGGATGTTTATGAAAA
AGTTCAGTAAAACAAAATCCAGAATTCTTGATCACCAAAAATCTATGAACTATAGCACATGAAAATCGACAAAATAGGGGTTTACCTACTTTGGGGATAG
TGTGACCTTGAAAATGGGTCTTTCTCTTGGAGACCAAATGGCTCCATTGTTAAGGTCTTAAAGGACGTCAAAGCAAAAAAATCAACAAAAAGAATTTGAA
GTTTTGTATCACCTAAAATCCATGGATTATAGACATCAAATCGGCAAAATAGAGATTAATTTGTTCTTGGTTCGTTAGACCTTAAAAATGGGTATGTTTG
CTCGTGGGGAACAATTGACTCCATTGCTAAGGTCTTAACAAACGTTCGTGAAAAATTTTGGCAAAAAAAAATCGAAATTCTACATCACCGAAAATTCATG
AACTATAGCACACAAAAATTAGAAAAAAATATGATATTTACCTGCTATAGTACTCGTTTGACCTTGAAAATGAGTCAGTTTGCCTGTGAAGACCAATTAG
ATCAACTTCTAAGGTCTTAACAAACGTCCAAAAAATATTTTCACAAAATAAATCAGAATTTTGAATCACCAAAAATCAATGGACTAGTACACAAAAATTG
ACAAAATAGGGGTATACCTGCTCTAGGGCTCGTTTGACTTTGAAGATGGATCGGTTTTCCTGTGGAGGCCAATTGGTTATGTTGCAAAGGTCCTAATAGA
CGTCCATGAAGTGTTTTGGCAAAAAAAAATTCAAAATTCAAATCACCAAAAATGTATGGACTATAACACACGAAAAATCAGCAAAATAAGGGTTTACATG
CTCTGGGATTTTTTGACATTGAAAATGGAATGGTTTGCCTGTGGGACCAACCGTCTCCATTGCTAAGGTCTTAATAAAGGTCCATGAAAATTTTTGACAA
AAAAATTTGAATATCTTGATCGCCAAAAATCCTTGGACTACAACACACGAAATTGACAAAATGAGGGGTTTACCTTCTATGGGCTTGTTTGACCTTGAGA
ATGGATCATTTTGTTCGTAGGAACCAATTGAATCCATTGCTAAGGTCTTATCGGACGTCCATGAAAAATCTCGGCAAAGCAAAATCTAAAGTTTCGGATC
ACCAAAAATCTATGACTATAATACAAGAAAATCAGCAAAATGAGGGTTTACTTGCTCTGGACTCGTTTTACCTTAAATATGGGTCGGTTTGCCCGTGGGG
ACCATCTGACTACATTGCTAAGGTTTTAAAGGACGTTTATGAATAATTTTAGCAAATAAAATCTAGAATTTCGGGTCACCAAAAATCCATGGACTATACA
AAATGAAGGCTTACATGCTCTCGGCTCGTTTGACCTCTAAAATTGGCGAGTTTGCACCTGGGGATCAATTGGTCTCCATTGATAAGGTTTTAACGAACGT
CCATGAAAAAATTCGCCAAAAAATATCGAATTTTGGATCACCAAAATCCATGAACTATAACACACGAAAATCGGCAAAATGAAGGTATACCTACTTTGGG
TTAGTTTGACCTTAAAAATGAACATGTTTTCTCAAGGGTATCAACTGACTCCATTCCTAAGGTCTTAATGAACGCCCATGAAAATATTAGGCAAAAAAAT
TCATAATTTTGAATCACCAAAAATTCATGAACTATAGCACAGAACGCTCCCCTACCGATGTATTTTTACATCCCACAGTTTCGACAGACCGCTTAGCCCC
GTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTA
CCACCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCTGGGCTGTTTATGATAATCGGTAAATTGAGATTTTATCTGCTTTGGGCTCATTT
GACCTTTAAAATGTGTCGTTTTGACTGTGGCGACAAACTCACTCCATTGTTAAGGTCTTAACGGACGTCCATTGAAAATATTAGCAAAAATTAATCGAGA
ATTTTGGATCACAAAAAATTCATCGACTACAACACATAAAAATGGATAAAACGGGGGTTTGCGTGCTCTAGGGCTCGTTTGACCTAGAAAATGGGCATGT
TTGCCCGTGGGGACCAAGTGTCTCCATTTCTAAGGACTTAACGGTTGTCCATGAAAAATTTTAACAAAAAAATCCAGAGTTCCGAATCACAAAAAAATCC
ATGAATTATAGCACACGATATCAGCAGTATAAGGGTTTACTTGATTTGGGGCTCGTTTGACCTTGAAAACAGACCAGTTTTCCCGTGGGGACCAACTGAG
TCCATTTCTAAAATCTTAACGGATGTCCATGAATACTTTTGGCAAAAAAAACTGAATTTTCGTATCACCCACACAAAAATCGACAAAATTGGGGTTTACC
TGCTCTAGGGCAATTTGACCTTGAAAATGGATCGAATTGTCTGTGACAACCAACTCGCTCCATTGTTAAGGTCTTAATGGATATCTATAAAAAAAATTGG
CAAAAAAAATTTCAGAATTCTGGATTTCTAAAATCTCATGGACTATAGTACACGAAAATCATCAAATGGGGGTTTACCTACACTGGAGATCATTTGATCT
TTAAAACGGACATGTTTGCCCGGGAGCAAATGGCTCCATTACTAAGGTATTAACAGACGTCTATGAAAAATTTTGGCAAAAAACAAATCCAAAATTTAGG
ATCACCAAAAATCTATGAATTATAGTACATGAAAATCAGCAAAATGGTGTTTACCTGCCCTGAGACTCGTTTGATCTTGAAAATTGGTCAGTTTGCCCGT
AGCGACCAATTGGCTCCATTTCTACGGTAATGATTTTGATTCTTTGAAAGATATAAGCAAATTTGTAATCATTTTTACAATATCACTCCATTTTAACCTA
TGTAGAGCTCGTTTGATTAGTTGATGGTAAATAGTTGATAAGCTT