BAC Sequence – LE_HBa0233O20

>C03HBa0233O20.1
TCAAATAATGCGGAACTTCTTCCCTAACCAATTAAGGAGAGAGGGATAATATCGACCAAAAAGCACGTCTATCCTTTACTCAAATTGGGTGTGAATCAGC
CCCCTTTTGGTATGAATTTTCAGCTCCTTCCTGGGCTCTATGTGGGTCCAATCTTCCTCCTCTTGGACTTGGACTGGAACCATGAAATAAGTGTAACACT
TGGCCCACTCTTAACCATAATTTTTGGATTTTTCTTCAACAATGAGCATCTTATTGGGCTCATCCCTGCAAACTTCATCCACGTAAGCATCTTTTTGATT
TCCCACTCAAACCCGACAACCCTTAATGGAGGTATGAATCCATGAATGCTATTGCTCCACCTTCTTCATCAGGAAAAAAAATGGACGCCTACTACCAACT
ACCAAGTGCTTATCTTGCTCTGCAGTTCTTCAATCAGTTTTGCTGTTCAATTATCTCTAAGGAACTTCTCTTTCAAACAATCCTACTGAACGATTTGAAT
TAGATTCCTTTGTCAAGCAGAAGGACAAAAAAAGTTTTAAATTATAAAAATGATAAAATTAATGATCAACAATCTGGTCCTAGAAATGCCAAGAATGAGC
GGTTCAAAGAGTGGCTGATTTCTGTTAATGACCAACTATCTTTGTCAAGTTTAAGGTGCTATCTATGTATTCTGCTAAAATAAAAATAGAACATTTCAAT
GATTGGGAGGTTCAAAGAGTGGCTGATTTCCTAAACAAACTTGATCAATTTCCTGGGGTTCAAGCTGGTGAAGATCATTAATGGTGGCAGGGTAACTCCC
AGGGCATTTTTAAGGTCAATGCTGCTTATAAAATTATGTATCAGTCCAACCACCAGATAGCAAACTGGCCATGGAAGCAGATTTGGAGGATAAAAGTTCC
CACGAGGTATTAATTTTTGAATGGTTACTAGCAAAGGAGGTCACTTTAACAGTGGACAACTTGATGAGCAGAGGTATGACACCATGCTCAAGATGCTTCC
TGTGTCAAGAAACAGATCTATTCTGCACTATGTATACACAACTCATTTGTGGAGAACCATCCTAAACCTTAAGGGGTCGTTTGGTGTGATAGATAAAAAG
AATTAATCACATGATAAATTTTGCGTATCCTAGGTCACTAATCTCCTTAAGGTTTAGGATGGTTCTTTAGCAATAAAAATTAATCCCGAATAACTAATCT
CAACATAACTTATCCTAGTATGGCTTATTCCAGCATAACTTGTATTCAAATCAAACGACCCCTAAGGTTATAGCATGGACAATGCTGAGCAAGATAACAA
ATGCTGAGAGGGAACATATTCACATGCTAAGGATAGGAGTAGATGGAGAATTTCCCAGCTTGTATCTGGTGGACAATTTGGTAGGGGAGGAATTCCAGAT
TTTTTGATAGCTAAGATAATAATATGCTGAAGATCAAGTTCAACTTCATCTTACTGCTATGTTTTTGGTGTAGTCAGATTTACTCTAATGATACTGTGGT
TGTGTCTATCATAGATGTTCTAAATTCTTATAGCTAGCGAGGGAAGACACTAGAGCTCTATTTAAATATGGTTTCAGTACTACCCAAGTATTGTTTTGAT
ACTTGATATGATAAAAAGTTACTGATTTTTTTAAAAAAATGAATCAGCGTCCTAGTGCGATTAGAACTGAATGATGTGAGAATATTTCTTACTAGATAAG
TGGTTTGGGCTTGGGACGTCTCAAGTTCAAAACCCATTGCCCCAGCAAAGGCAAGGGGTTTGCCTTTTGGGTCGAGCTCGTTGTAACGGGCTTGCCTAGT
GCTGGTTACTTCTCCTGTGTTGTTTGCGAGCTATTGCATAGGAGCAGAGGTTTTACCCTGTGCACACCCAAAGGGTAGCAGCTGCGGGTTTCCCTTATCA
TAAAAACACAAAAAATATTTCTTACTAGATAATAGTGTTGAACGTTTGCCATGTTTATTGCCTTCTTGAAATGGTTTTACATATTTGGGTGATAATGATT
TCGCAAAACTTTAATGACTCTCAGTTGCTCAGGCATCTTATGATAAGAAACTAATTAAATGTTAAGATGAGATTGGTGCTGAACTGCTGATGAAAGGGTA
AAGAGTATTGACCTTTCGGTGTGTCTCTACGTTCTTTGTATGCATTCCAGGTGGAAGGCATGCGAAAGCCATGTATTGGTTCTTTGGATAAAAGCAAGCC
AAAGGAGATCAAATGGGAATCTTTTCCCCATCGCCTATTCTTTGCTCGTGAGCATACAGCTACCTGGGGTCCGGGTGGGGTTGCTTTTCTTCACCCTGAA
TGCAACAGTGATGAAAAAGCTTACTTGTGCCTATATAGGATAACGTATGTCATTCTTTCCTTTATCTGAAATGTTTCTTCTTTCATGGTAATTAGGAGTT
TGTCATTTTGTTGGCATTTTTTAATAAAGACCTTCGACTCTTGGTGATTTAGAATTATAATATTCTTTTTTTCTTTTTACAGGCTTGAGCAATTTAATGA
TGTTTTACTTCAAGAGAATACTTCAAGCTTTGACATGAATTACCCTTTGTTTGACATGACTGACTTACAATCTATTGAAGAAAGAAAATGTGTTCCAGTG
GAGGCTGTCAAGGTGTGATTTTATGCACTCTGTATTGTTCTCATGAGTATTATTCTCTTCACTCCCGTATTAATGGTTCAAAAACTAAGATTCAAATGGG
CATAAAAACATTGGTAGCATAAGATATAACCATATATTTTCTGCTAATTAGTCACTAATAAAACTCAAGGCTGTGATGGATGGAAAATTTTATACCGTCC
GTGAAGGATAAGTATATCGGAAGAAGATTGTGGTTGGTTGATACTTGACAGCTAGCTAAATAAAGTTGAAGTATTGATGAATCCCTTAGTATGCAATTCA
TGAGGATGTTCTCTCCCTGGCATCCGTCAGCTTATGCCTGTATTAATGAATTAACCATGTACGGATAAGGGTGAGATTTCGTACAATAACAACTTATCGA
TAGTGATCCCACAAGTGTATGCGGACTTTACCATACCTTGTAAGGAAGATAGATTGTTCCCGATAGACCCTCGACTCAAGAAAACCATTTCAAAAATTAA
TTGAACTATTCACCTCATCAAAAAGGAACTGAAAGGACTGATATGGGAGAGAAGGGGAAGATATGACCTTGTTGATCTGTTGAATAATAAGTAGCCAAGC
AATATAGAAATAATAGAATCATCAGTTCTCAGGGATGATCATTCGAAGACTAGTAAATCCTAGGAAGGAAACCATGAATTTGTCCCCAGATAAGCTCAAT
AGGTGGTCAACAAGAATACTATATCTTTGGTTAAGTAAAGTCATTATGCGAAAAAAAATATACCGTGTAAAGATAAATTTATGCAACTCCAGATGTCCGT
TATTTTGTTAGAAACAGCAAACATAAGTTTCTCTTGTATCTTAAGTTTGTTACCTCTGCCAAGAAATTTCGAGCCTCTAATAAGTTGCAACATCATTTTT
TCTATTTATTTTTCCATTTTCTTAATAAACAAAATCCTTTACCTGAGCAAAATCTGAGCCTGAATGTTTACTCTCTGGGGGTGTTGAACAGTTTGATAAG
TTCCATTCTTTTTTAGTTTTTCAGTGTGAAATTTAGTGAACCCCGAATTTGCCAAACAACTTATTTATATTTAAATGACATGAAACCAAGGGAGCAGAAT
AGTAACAAATGACGAATATTGTCTACCCCAGTTGATTTAGGATTGAGGAAGTTGATTGATTAATAGTAGAAGATGACGAGTATTGCTTTAAAAAAGAATG
TAAGAATCTTAGTAACAGGATAGAATAGTTTTTATCCTATCCTAGTAGTGTTCATTCTTACCCCCTGCCCCAGACCGTCTGGTCTGGTCTGGTCTTGACA
TAACGCTGAGCTTGATGATTGTTCTCATTGTATGATTTTGTTTTGACTTTCATGTAGAATGGCTGGTACCATAATGTGCTTTACCTGGGAAAGGAGAATG
GTATTCCTATTTTGACAATGACGTAAGCATGTTGCCTTTAATTTTGTATGCTCTTTTCATTTATGTATTTTCTTGTCCAACTGAATCTCACTCATCACTT
TTCTGCTTCTCTATCAGATGCCAACTGTCAGATGTTGATAACTTCAAATCAGGTAAAGTAGGTATGTGCAAACCATCTAAAGAATATGCCAACACTCTGA
TTAGAGGTTTGGTAGAAGGGAAGCAGTTATCAGAAGAGGAAGCCACCACTTACATACAAGAAGCAGCTAGCAGAGCATTGTAACTGCCCTATCCTGCTTG
TTTGTTTGTACAGTTGACAATTATGTGAGTATAATGCCTAGCAACATATGAACCAGAAATGTTTTTGTGCCATATTTTTTGCGGAAGCAACTTCTTCCTA
TTTGGTCAGGGTGTATATAACTTGTTGGATCGACGTAAATTTTTCTGATTCCTTCTTTCAACTGCAATATTTTTGGCTAAGCAGTTGAAATGTATTTTGC
CCACAAACTACTCTGATCATGTCCATTGAATGTGGCAGTTAGTAGCTGATCCCAGTATTTGTGAATGAATGTGCGTCATTGTGTTGTTTAGAAACTTGCA
AGAGCAGTTCAAATAGACAGTTTTTGATATTCAATTATGGCACAGTTCTGCATCAGCAGAGAAAAACTTTCAAAATGAAGAGACTACTGAAGGCCTCAAT
TTAACCATAACGTAAATAATAGTGTTGAGAATGAATTCTTGTTCTACTGGTTCAAATAAAATTTTTTGATTATACAGTTGAATAGAAGGAAGAAGGAAAA
ATTTTGAGCCCAGGTATTTAGACTCATCAATTAAGTGTAATCTACTGTCACGATACAAAATTCTTTGGTTTTCTCAACTCATTTGAATATGGTATAAAAT
GATGATACTAAATAGTACACAATGATCTATAAACCATGAAGAATAAGGAACAAATAATCCACCCCAACAATCCAGCCATCAACTTGAGCAATATCACCGC
GATTTTAGTTTAGCATGCCCTGTTGATCCTAGATGCTTGTGTAATTGATTCCTGTGGGGAGAAGCAGATAATTAGATATGAACAAGAGGAAATATAAACT
CATTAGTCAAAATAATGATTGATGACTGAGCCTGCATCCAGACCTGGAATCGAATTCTTCCCCACATGTATCACACAAGTTGCTAGAAGATTTCGATTTT
CCCTGAATTCAAATGAAACTGTGTTACAACACATAATTCCAAATCTTGGTTTCATTCACAACCACATCACAAGACAACTAGTATAAGGTTCTTAAAAGAT
TCACTTGAAACAGGAGGAGTAGATAACTGTGGAAATGGAGTTGTAAATTCTCAAAAATTAACGAAGAGTGTGGATACGAAAAAGAGATTGACATCAAACT
AGACAGGATTATCTTATTTGAGTACCTTTTGTTTCCTTCCTTTGGGTGCATCTTTGGTTGTATCTTTTGATTTGTTGTTTTTGTCTTTCTTTGTGGTAGT
TTTCTTGTTTGTATCTTGGCTGGGAACTTTTTCACTGTTTCCTGAAGAAACATCATCTCCTTTGTGATCATTTGCAGTTTCTGCTGGAGACTGGGATGAC
AGCCCCTGGCAAACTGAACTATCATTTTTTGCACTATTTATCTCGACGCCAGTATCAACTTCATTCACATGAGATCCTACATCTCCTCCTCTTGCTTCAT
CTTCTTGTTCTTCTTCTTTTTGTGGTCTCCTGTTTCTTTGTTTCTTGCCACCCCTATTTCTCCTAGTACTTCTAAGATTATTATATTCCATGAAGTCCAT
TTCATCATTACTAGCTTCGTTCTTTGCTGAAGTTTGACGACTATGGCCTGGAACTGCATTCTTCCTACTTTTGCGGCCAGATATCATAGCTTCAAGTACA
CTAGCTTCATCATCATCTAATCCAAGTTCATCAGCCACCCCCTTTATATCACTGGCACTTTGATAATTAGTGGTTTCATCTTCATCGCTACTCTGAACCT
CATCATCCTCGAGCTCATCTTCTTGAATTCGTGTACTACCTTCTAAATGCTCTGCTAACTCATTCACACCATCATCAGCAGATAAATCAGTTGTTCTATC
AGCATCAGCTACATTTAGTTCCTCACTTTCCCCATCCTCCACCACCTCACTGTATTCATCATCTTCCTCATCAAAAGCTTCTCTCAAAGCTGCCACCTTC
TCCTTATGCTTCTTGGACTGCTCATGATTTTTCCACTGTTTCTCGCTCTTGAACTTCTTCGAACACACAACACAGTATAATTCATTCTCATCTGCCTTCT
TTCTCTCGTGCTCATCCGATTCCTCCTCAATTCCATCATCTGCTAACTCCTCTGCTTTCGTCCACTCAGGCTCTACGTAATTTCTTGCTCTCTCAGCCTT
CTCTCTCTCCAGCTCCTTCTTTCTCTTGCGTTCCTCTTCCTTTTTCTTCTCCATTTCCTCGTTCCTCTTCATCTGCATGTCAATCACTCTCTTATCTCTC
TTTTTCACAAACTCTGCTAATCCTCTAACAGTCTCATTGTATTCCCTTCGCGCCTTTTTCCTCAGCTTCTTGTTCTCATCCTCCATCACCCTCCTCGACT
TTCTATTAGGTCCCGCCATCACATCATACTGATCTGCCCAACAAAAGTCCATCACAGTAACGAATCCTAACCAATAGCTATAAAATGCAGTCACCTGAGC
ATAAGGACTCTCCAAATTTCCCATTAGAGGAGCTTCTTTTGGCAAATCTGTACCTAACTTCCTCGCGAAATTTAAATCGTGTTGGTAGATTTTCTCGAAA
AGATCACCATACACCTTGTAAAATCCCTTCCCTTTATCTGAATATCCAGAATACACTGAATTTGAAAAGAAGGAGAACAGGTCGGGGACAGAACCAGAGT
TAGACGAATTCCCTGGACCGGAATTAGAGAAGAGTATCTGAGAACGGTGTGAATCGTACCAAGCCCGCTCCCGTGCGTCCGACAAAACTTCATAGGCATT
CACGAGCTCCTGGAATGCAGCTGTTGCTTCGGATTCCGGCACGCCGGATCGAACCAGCTTGTCAGGGTGGCGTTGCAGCGCAAGCTTTCTGTAAGCGGAC
CTGATCTCATCGGCGGTGCAGTCACGGCTCACGCCGAGGACCTCGTATAGGCACCTTTTCTCCGACGACGACGCCATAATCGCCGGGAAGAAAGATTAGG
TTTCTTTCCTCTTGTTTGGGGATTTTTAGGGTTTTTCGATGGGGAAAAATAGGAGATTAGTCACTTAGGGGCTGTTTGGCTGGAAATAGTAATGGTGCCG
TGTTTAGAACGGACTCTAAAACATGGTATATATATATTTTAGGCAAACGAAAAAATCCATTAATGAGTAATGTAGCAAAAATAAGTTCAATTGAGAGGCA
TGAGTTTTTGTTCAGTGACTATTAATGGAGCAAAATCGTATTTGCAAAATTACAAAATCAAATTCGATTAGAATCAGGATTAGGAAATTTATTTATAAAC
GTGAATAAAACAGATATCAAATACCAACTCCTAAATAACTTAAGTTAAACTCTTGGTTTAATTTATTTCCTACTTACATATACTAAAATATTGAAATTAA
TTGTTTTATAGAAAAAATAATAGAATAGCTAATTTCACGCCAGATTATTGGATCCAAAAAACCATACAATACCTTATTTAATCATATGCCTATTGTCGAG
TACTGAGTATAAGTAGTATGTATTTATGAAAATATTGGAATCTAAATTAAAAATTTAACCAAAATTATTTTAAAACGTTATTTGAAAAGAATTCAAACAT
AAGTAATTTAAAAACATCCTTCATATAAAATTATGCTTCAATAAAATGTAATGTCTATGTGGAAAACATGATAATAAATCATGAAGGGGTTCGTTATGAA
TGATTTTCGATTAGTAAACGCATACTGCAATTAATTACCTAAACATAAAGCGTGTACAAATAATACAAAGAGATAAAAGAATTAAGTTAAAAAAGGTATT
GGTGGAAAAAAAAAAAAGTTGAATAGGGTTAGCTAAGGTAAGAGCTATAAAGATCTGTCATGTGAATACGTAAAGTGTATTTAAAATGTGACGAAAAAAT
ATTGATAAGGTAAACACACATAAAAGAAAAATGACGAAAATATTTTTATAGACTCTTGAATGAAGACAGAGACGTGAATATTGTGATGGAAGAGTTATCG
CAATCTGAAGTCGTGAAATTTTGGCTATTGTAGGTGCATAGTGGGAGTGTCATAGTATTGTTTGCAGATGACATAATATTAATTAGTAATACAAATTGGA
GTTAACAATATAATGAAAGCTTTAAAACATATCCTAGAATCTAAAAGTTTAATTCAAGTCGGACTAAATGCAAATTTAGTAACATAACACAGAAAACAAA
AGTAGAAGTGAAGATTGACACACAACTTATACCAAAAAGAGAAAGTTTCAAGTATGTTGACTCTATAATCAAAGGTACTTTTTTTCGAAACAAATCGAAT
ATCAATTAACACTTAATATATTTAATATGTCTAGCATTATTTTATTTATTTATTTCTTGTTAAATGGCATTTTTTTTGTTTTAGTCTTGACAACGTGAAG
TTTCTAAAGAGATTTTATGGAAATGTTTGGAGTTTAGAGATGTACGTATGACTTCTATTAAGATCATTAATCACATGTATTATAGAGCTATGTGTCACGG
ACTTTTTGATTCGGACTAAGTTCCGTGCGGCACTAGACGGTTTACTCACGACTCTTGCACGTTCTTGCAAACTCTAGTAAGCCTAAAACTCAGATCGCTA
AGAAAATAAGAAGTAAGACAGAACTTTGGAAGAAGGAACTTCTATTACTTGAAAATAATTGGATGCTTTACAAGTAAAGTAATCTACTATTTATACTACT
CTAATGCTGCCTAAGAGTTAGTAAATAAACTATACAAGTTCCTAAGACTATGCCTACAAGACAAGCTTCTAAGTCTTCCAAAAAGGACTCCTAGATGCTC
CTAGTCTGCCCCATGATCTCCACAAGCCTCTCAAAGACTTGTAACTTCTGTAACAGCCGCCCCACTAACTGTTGTAACAGTTGAAACTGCTGTAACTGCT
GCCTCTTCAGCTGCTGCAGGCCTCCTTGGCTGCTGACCTGCGTGGTCAGCCTGCTCCCCTGCGCCTGCTGCGCCTGCTGGCTGCCTCGTTGGGTGGCGTT
CGGCCTGAATGGATGGCGGGACGTCACAATCTCCCCCACCCCATGATGCGACGACCGCGACGCACTGCTGCAAGAACTCCTGAATTTTGCCTTTGAACTG
CCACAAGTCTTCGTACTTCTCCCATGTGGCTTCCTCCGGAGTTTGTCCCTTCCAATGTACGAGAAACATGGCACTGGCCTGTTGTCCTCGTTTCCGCTTG
GCTTGGTAATCTATGATAGCTTCAATCTCACGATTATGCGAGGCAGTAACGGTGATAGGGGCCCGTTGTGATTTGTTCCGGCTGGGATCGTCCTTGTCCT
CATGATAAGGCTTAAGGACGCTGGCATGAAAGACCGGGTGGATTTTGAAGTGTGGAGGTAACTCCAATCTGTATGAAATCTTACCCACCTTGGCAACAAT
TTTGAACGGACCCTCATATTTCCGCACCAGGTTGTGATGCATGCCTCTAAGCGCCTTAAACTGCCTCGGATTAAACTTTACCAAAACCATATCACCTTCT
TCATAGTTGGTGGGACGACGCTTGCGGTCGGCGAACTTCTTCATCCTCCTTGCCGCCTTGCTCAAATAAGATTTGGCAAGGTCGAGTTGCTCCTCCCAAC
CCTTGGCAAGGTTGTAAGCGCCCAAACTCTTCCCTTCGAACAATGTTGGCAATGAGTGCGGAGTTTGGGGTTGCTGGCCCGTTGCTAACTCGAACGGTGT
GCGCCCTGTAGATTCACTCCTCTGCAAATTATAAGAAAATTGCGCCATGTCTAGGAGCTTAGCCCAATCCTTCTGATGTGCACTAACATAGTGCCTTAAA
TAGCATTCCAACAAGGCGTTGACACGTTCAGTTTGGCCATCAGTTTGGGGGTGGAAACTGGTGGAAAAGTGAAGTTTTGAACCAAGAATCTCAAAGAGTT
CACTCCAAAAGTTCCCTGTGAAACGAGGATCCCGATCACTAATGATGAACCTCGGCAGCCCCCAATACTTCACAACATTCTTAAAGAACAATTGTGCAGC
TTCCTTAGCAGTACAACCGGCTGTGGCAGGCATGAATGTAGCATATTTGGAAAATCTATCCACTACGACCATAATAGTGCCAAACCCGTTTGACTTCGGC
AAAGAAGTAATGAAGTCCATAGATATGCTCTCCCATGGACGATCAGCTATGGGTAACGGCTCCAACAGCCCTCCTGGTTGCCTTTGCTCTATCTTGTCTT
GCTGGCACACTAGACAAGTCTGCACGTACTGCTCAATCTCTTCCCGCATACGTGGCCAGAAATAGAAGGCCTCCACTAACGCCCTCGTTCTCTTCTGTCC
CGGATGCCCAGCCCACGGAGTGTCGTGGCTTTCTTTGATAATACGCCGCCTGATGAACCCGAACTTTGGTACATAGATCCTCCGGCCAGTGGTAAGCAAG
AATCCGTCTTCTACCCAAAACCGTTTGGTTTGGCCTTGAGCAGCTAGCTCCATAATCTTCTTGGCTTCCGGATCGCGTTGCATACCGTCTTTGATTGCGC
CTTGGAATTCACTACGGACTGAGGAGATGGCCGCTAACTCAGTCTTTCTGCTCAATGCATCGGCTACCACATTGCCCCTTCCTGGTTTGTACTCCAAGTT
GTAGTCAAATTCAGCTAAGAAATCCTGCCAACGAGCCTGCTTTGGTGTGATCTTCTTCTGCGACTGAAAATAGCTAGTGGCAACATTGTCAGTTTTTACT
ACAAATTTGGAGCCTAGTAGATAATGCCTCCATGTGCGTAGACAATGCACAATGGCTGTCATCTCCTTCTCCTGCACAGTGTACCGTCGTTCCGCTTCAT
TCAGTTTTCGGCTTTCGAATGCTATGGGGTGCTTCTCCTGCATCAAGACTCCCCCAATGGCAAAATCAGAAGCATCCGTATGGATTTCGAAGGTCTTAGT
GAAATCAGGCAGCATCAAGACTGGCTCTTTAGTAACCGCAGCCTTAAGACCCTCGAACGCTTCCTCGCACTCCACGCTCCACAACCAAGGCCTGTTCTTC
TTCAGCAGCTCGGTCAGTGGTGCAGCAATAGCGGAGTACCCGCTGATGAACCTGCGATAATAATTAGCAAGTCCAAGAAAAGAACGTAGCTCGGTCATTT
TTGTAGGCGCTTCCCAATCTTGGATCGCCTTTACCTTTGCCTCGTCCATACGAAGCTCACCTTGGCTGATCACATGGCCCAAGAAATGTATCTTTGGTTG
GGCGAACTCGCACTTCTCCCGCTTGACATAGAGCTGATTTTCCCGCAAAACTTTGAAGACCTTCTTCAAGTGCTCTACATGCTCCTGCAAAGTGCTACTA
TAGACGACTATGTCATCTAAGTACACCACTACGAACTGGTCCAAGTAGGGATGCAAAATCTCGTTCATCAGCGTGCAAAATGTGGCAGGTGCGTTGGTTA
AGCCGAAGGGCATCACCAACCATTCGAATGCTCCATACCTGGTCACACATGCTGTCTTTGGCTCATCCCCTTCTGCAATGCGCACTTGATAGTAGCCTTT
CCGGAGGTCCATCTTGGTGAAGTATTTGGCCTCTCCAAGACGATCGAACAAATCTGCGATCAGTGGGATTGGATACTTGTTCCGGATTGTGATCTTGTTG
AGCGCCCTGTAGTCAATGCATAAACGCATCGATCCGTCTTTCTTCTTCTGAAACAGCACTGGCGCTCCATAGGGTGCCTTTGATGGACGAATATGACCGG
CTTCGAGGAGCTCTTTCAATTGCTTCCTCAGTTCTTCTAATTCGGGCGGAGCCATGCGATAAGGTGCAAGCGCAGGTGGCTTGGCTCCTGCCTCCAACTC
AATCATGTGATCTACCTCGCGCCTTGGAGGTAGTGTCTTCGGCAGCTCCTCCGGCATCACATCACTGTTTTCCTGCAAAACAGATTCTATAATAGGTGGC
AGTGGCTGCATAGCACCATGGTCTTCACTCGAACTTGCGATGGTGGCTAAAAAGGTTGGCGCTCCTTTCTTCAGGCCCTTCACAATCTGCATGGCCGACA
GTTGAGCATATCCGTCTTTCTTCGGCACCCTAATAAGAGGCACCATACAAGACCCTTCCCCCTCCATCACCATGAGTTGTTGAAGGTAGGGATCGATCAT
CGTGTGGCAACGTTGAAAGAATTCCTGCCCAAGAATGACATCGGATATATCCAAAGGAGCTACGGTAAAGTTTGTCTTACCCTTCCACCGTCCTAAAGTG
ATGCCGACCCCATGAGCAATTCCACACACGGGAGTTGGTGGGGCATTGACCGTCTTGAGGCGATTGTTACTTGGAACAATTTTCAGTCCCAATTTCTCTG
CCGCCGCCTTGGTCATGATGTTAGCCTCAGCCCCGGAATCTACCATGGCCCGAACTGCTTGCCCATTGATGGAGATATCCACATATTGTGTGCTGAAATC
CCCCGGGTTGTCAGCCTGCTTTGCTATGGCACCACAGATTCCAACCATGCCCAATTGAGTGGTGTCTGCCGGTTTCGCCTTGTCTTGTGCCTCCTTTTCC
TTCTGCTCACGGACGATGGCACCAAGGCTCTTCATCTCTGGGCACCTAGCGTAACCATGTGGTCCGCCACATATATAGCACCCGTCTCCTCTACTGGACT
GCGTCCGCTTCTCCGAGAACTTTCGGCGTTCGAACCGTTTGCCATCGGACTTGGGTGTGTCTTGCTGCTTGGGTTGTGCCGACGGTTCTCTGCCTCGGCC
ACGGTCTCCCCCACCTTTAGCTTGACTGCCCTTTGCCTCCCTGCCCTTTGCCTTGTCCAAACGATCGTGTTTGAAGTCTGTCAAGGTCTCGGCTTGAGTG
ATGGCCTCATCGATGGTTTTTACTTGACGCCGCTCTAACTCGGTCCTCGCCCAATTCTGCAGCCCGTCCATGAAGGTGAACAGCATGTCATCTTCCGTGA
GTTGGGGAATCTGGAGGGTCAAGATTGTGAACTCCTTCACATAGGCCCTAATACTTCCCGTCTGCTTCAACTCCCGAAGTTTGCGCTTCATCTCATAAAC
AGCATTGTTGGGGAAGAAAGCTTTCTTGAATTCCTCAAGGAATTGTTCCCATGTGTCGATGGTGCGTGTGCCCCTCTTGATCTCGGCATCTTTGCGTTTC
CACCACAACATGGCTACGTCGGAAAGATACAACACGGCAGTGTTGATCTTGCTTGCATCGCTCCTGACCCGATTACACCTGAAATAATTTTCCAAGTGCC
ATAAGAAATTGCCTACCTCTAGGGCGTCTCGGACACCCTTAAATGTTGGTGGCTTGGGAACCTCGACCCTGGTCTCCCTCTCCTGGCCAAGTGATGCTGT
TGCTGCAACCTCCCTCTCTTCTTCGAGGGCTACTACCTTGTTCTTCAGGGTCTGGATCATTGTGGTGGCATCCAACAACCTGAACTCCAAGGAGGTAATG
GACTCCTTCAACTCCAATTCAGTCCGCTTGCGTAGATCCAACTCCTTCCGGATGATGTTAACTTCTTCAAGGGAATTTTCTTCAAGGTTTTTAACATCGC
TGTCCAAACCATTCAAGCGCTGCCCCAAAATCTCAACAGCAAGTCTTGCCCTCTCAATGCTGGCAATCCATTCATGTCCAACAGTGACGTCTATAACGTC
GTCGCTGACGTCGTCTTCACTTTCCACATCTGTATTCTCCTGGAAAGATGTTTGTCCGTCGCCTGGTGGAGGATCATTTGTTGGCAGACCGCTTGATGGT
AAACCTCCTGGTGGAACACTGCCTGATGGCAGGTCGCCCGAGGGGACACTGCCAGATGGCAGGTCGCCTGGTGGAAGACTGCCTGCTGGCAGGTCGCCCG
GTGGAGGGTTGGGCAGACTGGGTTCATTGCCCTTCTTGTTCTTTCCCTTTTTGTTCTTCTTTCCTCCCTGAACGTTGGGGGTGCCGCCACCGTTTCCTCC
GTTCGTCATTTTCCTACGATAAACCAATGCTCTGATACCAACTGTCACGGACTTTTTGATTCGGACTAAGTTCCGTGCGGCACTAGACGGTTTACTCACG
ACTCTTGCACGTTCTTGCAAACTCTAGTAAGCCTAAAACTCAGATCGCTAAGAAAATAAGAAGTAAGACAGAACTTTGGAAGAAGGAACTTCTATTACTT
GAAAATAATTGGATGCTTTACAAGTAAAGTAATCTACTATTTATACTACTCTAATGCTGCCTAAGAGTTAGTAAATAAACTATACAAGTTCCTAAGACTA
TGCCTACAAGACAAGCTTCTAAGTCTTCCAAAAAGGACTCCTAGATGCTCCTAGTCTGCCCCATGATCTCCACAAGCCTCTCAAAGACTTGTAACTTCTG
TAACAGCCGCCCCACTAACTGTTGTAACAGTTGAAACTGCTGTAACTGCTGCCTCTTCAGCTGCTGCAGGCCTCCTTGGCTGCTGACCTGCGTGGTCAGC
CTGCTCCCCTGCGCCTGCTGCGCCTGCTGGCTGCCTCGTTGGGTGGCGTTCGGCCTGAATGGATGGCGGGACGTCACATATGGCTCACATAAAAATAATT
AGGTGATTCAAATGCTTTTCGAATATGATACAATTACATAAAAATTTAACACCTAATCATCTCTTAATAGACAAAATGGCACAATACATTCAGAAAAGTG
TAGTAATTTATATATTTTGCATGTGATATAGTATTAATTGGTGAAATATACAATGAAATTAATGATCATAGATTTAAAGTTTGAAAACATACCCTAATTT
TTTACTTTTCAAGAAAAAATTTGAGATTAAACTAGACTGAATAAACTACTTGAAATACAAATTTAAATAAACTACTTGAAATACAAATTTAATAATGTGA
CACATTTCGTAAAGGTGGAAGTGAAAAATCAGCACAATTTCAAATATATTAGATGTCAATTAGCAGTTCATGCATACCCTTCTCATGACATTATTTGTTA
TTAATTTAATTTTGAAAATAGATTTAATGATATTTTAATCTTAACAACATAGTTTAGTCACAAAAAACCATAGGATATTTCAAATAAAACACATCATTAT
TATTATGTAAGGTCAAAAATTATTTTATTTGTATTAATTTATATGATATTTTTTATTTTTAAAAAATTAAATAATTTAAATTTAATTAAAAAAATTAATT
TTTTTAAAATAAAATTTATGATATTATAAATTAACATAATTAATAATTCAAAATATTCGATATATAATTTTTTTAATCTCAAATTAAAAAAATGCAACAT
AAACTTACACCGCAGGCGACTTGCTCCGTCCATCATCTTCGTCATGTCAAAGCTGCCATTTTCTCATTTTCCTTATGCTTCTTGGACTGCTCGTGATTTC
TCCATTGTTTCTCACTCTTGAACTTCTTCCCACACACCACACAGTACAATTCCTCCTCTTCGTCCTCCTCCTCCGACTCCTCCTCTTCGATGCCTCCATC
TTGTAATTCCTCTGTTCTCGTCCACTCAGGCTCTACGTAATTTCTTGCTCTCTCAGCCTTCTCTCTTTCCAATTCCTCCATTCTCTTGCGTCCTTCTTCA
TTTTTCTTCTCAAGTTCCTCATTCCTCTTCATCTGCATCTCAATCACTCTCCTATCTCTCCTTCTAACAAACTCCGCTAATCCTCTAACAGTCACATTGT
AATCCCTTTTCGCCTTTTTCCTCAGCTTCTTGTTAATATCTTCCATCATCCGTCTGGAATTTCTGTCCGATGCCAAAGTCGATTTGTACACATCTGACTG
ACAAAAATCATTCACAGTAGCGAATCCTAACCAATAGTTATAGAATGCCGTAACCTGAGCATAAGGACTCTGCATATTTCCCATAATAGGAGCTTCTTCT
GGCAAATTTGTACCTAACTTCCTAGCCAAATTCAACTCACGGTGGTAGATTTTCTCGAAGAGATCACCGTACACCTTGTAGAATCCTTTCCTCTCATCGG
AATATCCAGAATACACTGAATTTGAAAAGAAGGAGGACAGATCGGGAACGGAACCGGAGTAATTAGACGAATTCTTTGGATCGGAATTGGAGAAGAGTAT
CTGATAGGCAGAGCGCTGGGAATCGTACGAAGCACGCTCCTGCGCGTCTGAGAGAACGTCGTAAGCGTTCACAAGCTCCTGAAATATAGCGGTTGCTTCA
AATTCCGGCACGCCGGATCGGACGAGCTTGTCAGGATGGCGTTGCAGTGCGAGCTTCCTGAAAGCCGACCTGATCTCGTTCGGGGTGCAGTCGCAGTTCA
CGCCGAGGACCTCGTAAAAGCATCTTTTCTCCGACGACAATGCCGTTATCCCCGGGAAAGAAAGAGAAGTAGGTTTAGGTTGGTCTGTTAGGGGCTGTTT
GGCTGCAAACGGCAATGGTACCTTCTTGAGAACAGACTCCAACAGCCATGACCAAAACATGGTTGTATAGTTTATAAACGAAAAAATCCAATACCAAAAA
AAATAAAAAATAAAAAATAAAGAGGCAAGAGGTATTACTCGATGACTTAAATTTTCACTATAAGAAAAATTTAATGGAGCAATCGTATTTATAATAATAA
CACTACAAAATAAAATTTGATTAGGATTAGGATTAAGAAATTTAGTACAAACCAAATTGGATTAGAATCACAATTAAGAAATTTATTCCAATATAATATA
TCAAATACCAACTCCTAAATAACTTTGGTTAAACTCTTGATTTAATTTATCTCCTATTAGAAATATACTAAAATAATGAAATTAATTCTTCATATTTTAA
AGAACAGAATAGCTAATTTAATAATAAATGACTATTCGATACCGAATACCAAACAATACCTTACCGTCTAGTACTTGGTATGAGTAGTATAATTACTGAT
AAAATAATATAACTCCTCGATTATTCGATTTTATACTTTATTTTGCAAAATAGAATTTTGAAAAGTTCAGAATTTGGATTAAAAAAAAAAGCTCAACAAA
ATTATTCAAAAAGAATTCAACATAAATTATTTGAAAACATCCCATAATAGTATAAAGTTTTGCTTCAAATCAAATATTTCAAGAAAATAAAATGTATTGT
AGGTTTGGAAAACAAAATAAAAATAGTAAAGGGGTATGTCATATGTTATAAACAACTTTCGATTGATATACACCTACATTATAATGGAACTAATTGCCTA
AATATAAATCTATACAAATAATATAAAAAGTAAAGAGAAAAATGGTTTGGCGGGGAAAAAAATTGGAGTTCTATGTTCGAGTGTCAATTGGAGTTTGATT
TTTTTCTTAAATTTATCAAGTCCAAAAAATAATAAATTTCTAAATTTAAAAGCAATTTAAGTATAAACCTTTCATTATTATTTATTACTATAAAAAAGAG
GTTGAATAAGCAAACAACATTTCATTAACATGATTGCTTGCTTATTTAGATTTTAAATAAAATTGAGATTACGTCTATTAATTTGCAATTGTATTTGCTT
ATACATATTTACGTAGCAAAAACTACTGTGGCTACTTGAATATTGTCCATTTACATTCTAGGATCGATGAATATTTGCAATTTCTTCCATTTGTTAATTT
TAGAATTTGTATGGCTTTCAAATTCTAATTGATATTACTATTTTACCGCAATACTTATATTAATTGACATAATTATATGTTTTATTAAAATAATTTGAAA
TGAGTAATTAATGTCGAGGGTAAAATATGATAAGAAAAAATGAAAAACTTTGATATGCTAACTATATAATTTTAAATAAATACTCCATTAATTAAGAAAT
TTTGTTTTTTAATTATTTCATTTTCTATCTTACATAGAATAATATATAATTTTTTATAATTTATACATATATTAATTATGTATATTTTTAAATTTACAGT
ATCAAAAAAATCATACTAAATAAGTACTATTTAAAATATAGAAAATACGCCTATGATTTAAATTTAAATTTTTGATTTAATTATCCAAAATTCTATCATA
GTTTATTGTTATTAATTAATAACTAAGAAATACATTTGCTTATTATTTCTCAAATTCTCTTATATTCATAAATCCTCTTTGATTGCTAATGTTAAGTAGT
TCGTTGATATTATTAGTAGAAAATAAAGAAATGTTATTGTGTTTTAAGAAATAAAAAATATCATGAATAAAAATTATAAATATCAAATAAGGGAAAATTG
TATAAAATAGAAAATTATTAATTAAAATAAAATGTTATAATCACAGTTCCATTTAATAATAATTCGTAGCAAATATTTTGTCATTCGCCTATCTCTCGAA
TATCTCGCTTGCCATTTTCTCTCGCGTCTCTTACTTTATACAAACACAAATATATAAATTATGTTTATATTTGTATAAAACGAGAGAAAACTATATTTAC
ACATACAAATGCACATCTTTTTTTCGCCACTCTCTCACTCACGTCACTTTATATAGCACAAATATATAAATTGTGTTTGTATTTGTATAAAACGAAAGAA
GACTACATATACAAATACATATACATATCTTTTTGTTCTATACACTTATAATTATACAATATAAATTTTCACCTGCCCATTTCTCTTTTTCCTTTTTCTT
TGTTCGTTTTATACAAACACAGATTAGACAAAAAAATACTTTCTTATTTGTACACAGATTCCAAATATATACTTAATACAATTGATCAGTTTATATAAGT
GTACCAAAATATACATATTAATAGCCATAAAAAAATTGTAAATTTCATTGTAAAGCGCAATTATGCAAACTATAACTATAACATATAAGTATGATTTATA
TGTTTGCTAAAACTAAAATTTTTTACTTTTCTAATAAGACTAACTTTCACATATAGCAAACACAAATTTTATATTTGTATGTTATAACAAAGTTTGCATA
ATTGTGCTCCATAATATATTTATAATTCGCCATACATACACAGAGGAACCAAGAAAACAGTTGTATACAAATCCATTGTATAATTTGTGCACGTATAAAA
TGAGAAAGAGAAAAAAATAAAAGAAAACTGGGCAGAGAAATATTTGTATTGTATAATTATAAATGTATAGGACGAAAAATATATTTATTTGCAAGTGTAT
ATACAATTTTCTCTCGCTTTATACAAACAAATACGATTTATACATTTCATTTCTATTTGTATAAGTGATAGAGGCGAGGATGACGAGTGAGATTTGAAAG
AGTGGCGAGAGGGGAACGAAAATACATGTATATATACAATTTTTTCTCGCTTTATCCAAATAAAAATACATTTTATACACTTGTGTTTGTATAAAAGTAA
GAGGGAGCGATCGAGAGATGAAGCGAGAGAAGGAGAGTGACAAACGAGAATTTGAGGGAGAGAGGTGATTGGCAAACAGTTTGTTACATGACACAATTAA
ATAAAAGTGTGGTTATAACATTTTTTGTCATTGTATACAATTTTCCCTTCTAATAATAATGATTGGCCCCGTGCGGAGCACATGCTTTCCCTTTTCTAGT
ATTTAAAAAAAAAAAACTTCCACGGTATAAATATTACAACCTATTTATTTATTTAAGATGATAAATAAATCTATAAACATTTAAATTTTTGTACAACTAA
ATAAAAATAAATATTATAACCTATTTATTTAAGACTGATTAATAAATATACAAACATAATTTTTTTTTAAAACTAAATAAATATATTCAAGATCTGAAAT
ATTAAAAAGTTCCTTTTGTTTTTCTCCTAAATTTCGTATGAAGCTAAATCGGGCAGGTACTTTAATAACTTGACCCATTCGTAGCGGAAAACAAACGACA
CCGCATTACATCCAGCTTTAAAACATTTTCGGGGCAGCGACTCGGATCCTTACTGTGTCTCAGCTGACATTTCAAGCGACTGTAAACCCTAGCGTAAATT
TGTCGATCTGCGAAGAGGATAAGCCTGAGGAGGAAGGTGCCGATCAGATCGAATCGGATCAACAATGGCCATGGCTGCGTTGAGGCGTGAGGGAAGGCGT
TTCGCCACACCTCTGATTTCTCCCAATCCTGCCACTGTTTTTCGTTCTTCAATCATTCCTTCTGAGTTAGTTTTCTTCCAATCCTACACTCTTATCATGG
TTTTTTTTATTGTATGTGTCGAATCTGTTGTCAGTAATGACTCGCATTGATTCTTTGTAGCTATCTCGTTAAGTCAATCTGGCTCTGTCGTTTTTGTTGT
GATTAGATATGGAATGTATATTAGTGATTCGTAGAGTTGATCCCAGATAATTTAGGACTGAGGGGAAATGAATTGATTGATGGCTCTATTTTTTGTTTTG
TTTTGTTGTAATGGTGGTGCCTGCGCTCGTTTTGCCGTGGAATTTGAACCTTGGTTCCCCAAGGTTGCCATGTTGATTTTTCAATCGCTGGGCCACCACT
AGATGGCAATTGCTTTGTTTTGTACAGGAGCACATTTATCAATGATGAAGCCTCTAGCAATTTAGGGTTGAAATCACCTCATGAGTTTTGGACAACAATT
TTTATATCTCTATGAGGTTAATTATTCAGTTGGTGAAGTAATTTGGTTTGAGGAATTAGTAACATTCGTGTTGTTATCTTTGACAAGGGGGAGTTTCTCC
TTTTCTCTTCAGTTAAGGGAGGTAGCTTGCTTTTTATTCAATCTAATAGCAGGACAAACGCTAAAAGGTTGTTTCTGCTTCTCCTTTTCTTCCCAAAGTG
GTCTGCAGTTCTAAATCCTAAGAATTGATGGTTTATGTTGTTAAAGCTTGTATGAAGTCCACTGGATTTCGATTTGTTGGTGAAATGGTTATATATATAT
ATTTTCAGATTTAAGAAAATATTACTAGTTATTTGGGCAGAAAGTAATAGGTTGCTTTAAATTTTGACCCTATATAGATTTGTAATTGACATGATCTGAG
CTTGGAGAGTGATTTTGGATCTTGGAAGAAGTACAGAGTTCAGAGGTTTTTGAAACAGAAGTTGTAGCGAGAACAATGTAGAAAAATAGATGTAGTTCAA
CTAATGTCTATAAATTGTGATTTTTTTTGAATGGATTATGGGGGTTGCTGCACTGACATGAAATTTGTTCCATGGGCCTGTATGTTCAACAGGAGACTGA
TGATCTCCCTATCTGCATTTATAACAGGCTCATGCTCATCATCTTGGCTTATATTAATATATATTATTATCCATTAGCTTTTTTCAAAAAAATTATGTTC
TATTTTGTAGTGTTTCTACCTTTTTAATGACCTACCTTTATATGCAGGGAACCAGTCTTGTCAGGAGTTCGATGTATTTCAACTCAAGTTGGTAAGAGTC
AGCCGTAATCATTTGATGCACCCCATTTTCCTTTGCCTCTCCTATATTCTCGTGATCTTCTCTACCAATTTTCTTGTTGCTACATTAAGTGTTCACATTG
AGCATTCCCTTGGGCAGTCAGAAACCGGATGAAGAGTGTCAAAAATATTCAGAAGATTACGAAGGCTATGAAGATGGTTGCTGCTTCAAAGCTCAGAGCT
ATTCAAACTAGAGCTGAAAATTCACGCGGCCTATGGCAGCCATTTACTGCCCTTCTTGGTGACACTCCTAGTAAGTTCATGATTAGATTGTTTGGATCTA
ACCAAATTCTTGAATCAGTTGTGAGAGAAATGGTGGAAGGATAGGGATGGATCATATTATGAGAATGCTATTCCCAGAATATTTTGAGTTGACATACTTG
ATAAATGTGGGAAAATGATAAAATGAAATTGTTTGCCTCTCTCTGCCTCTTGATTTTCAGTCCAATGTCAATGTTCTATGTATTTGATGCAACAACTGAA
TAATTATCTTGTGGAAATGTGTGTCGTTGATGAGACTTTGTGAGATATCTTTAGTTGCTCCGGAGTTTGTAATTTGATGCAGTCAACATTAAGCAGTCAA
TTAGATTTCAATATATGGCTGGTAACATCTGTAATGTTTGCTTCAGGTATTGATGTCAAGAAGAATGTTATTGTTACCATTTCCGCAGACAAAGGTCTTT
GTGGTGGAATCAATTCTACATCTGTCAAGATAAGCAGGGCTATGCATAAGTTGAATTCTGGTATAATGCTAGATTGTTTAATCTTAAGTATATCTATTCT
TGAGGAATTAGTTCATTATTGCTTTATTTGTAATTGCTAGGTCCTGATAAGGAAAATAAGTATGTTGTCTTGGGGGAAAAGGCAAAGGCTCAGCTGGTGC
GAGATTCGAAAAAGGACATTGAGCTGGTCATGACTGAGTTGCAGAAAAATCCTCTTAACTACACACAGGTTATGATGCCTTAAATCTTCTTTCTTACTAC
TTTGTTTGAAGCACACCCACTATTTTTTTTAATTGTTGCCAGCTATTTGCTGAAGTTGATGCTGCTGTAGGCTCACTCTCTGGTACATGGATTTTTTTGT
TGCCTTAGCGTAGCCTTGTCGCTGGTGTGAAATGGGTGATGGTACTTTGTGCATGATATTGAAAATACAGGCAAATTAGCAAGAGACTTGATGTACATTT
ATTGGAGCTTACACACAAACATTGCATGTACCTGTATCGGATACTTGCACACCGCCTTTTTTTAGGATACTTGCACACCACCTTTTTTTAGGATACTTGC
ACACACCTTAACTTAACCAGATCATTAGCTGAGTCCATGTAGTATAGGCTCACATTTTTTTTGTTAGATCTGTTCATGAATCTGTGATATAATTTATGTA
TTGCATTTTGTTACAGAAATAGTAGATATTGGAAAGCTGTCTTACTCTTCTTTATTTTTGTTTCCAGAATGTCAACTTTGGCAGATTTACATTTTTGTTA
GCTTTACTCTTGTAAAAACAAACTTGCCTTTTCTTCAAAAAAACATGTGCAAAAAGCAAACAGTTTGATTGCATTGTTGCAACTTTAAATTTCTGTGTAT
TAATTGAAAATCTTATAGTGGCTGCAATACTTGTGCACTGAAAAAATATAGCAACAACTATTTATATTGATTTCTATAACCTTTTCCTTCTACTGATTTA
TGCCATTCCTCTTGTAGGTTTCTGTGATGGCAGATGACATCTTGAAGAATGTTGAATTTGATGCACTGAGGATTGTGTATAATAAATTCCAGTCAGTTGT
CTCATTTTTGCCAACAGTGTCCACTGTACTATCTCCTGAGGTGCCTAAACTGAAAGATCTTGTTGTTCACTATGTTTCTTTCTATTGTGAGTGTCTGTTT
CTTGGAACAAGTCCTTTGTGGTTTAATGTAGGTTGTGGAGAGGGAAGCTGAATCTGGTGGAAAGCTTGGAGATTTGGATTTATATGAAATTGAAGGTGCT
GAGACAAAGGGTGAAGTTCTTCAGAACCTAACTGAATTTCAATTCTCATGCGTAAGTTTCGCCTTCTTAGTGTTAGAATCCTCTAATAAGCTTGTTGTTT
GATCTTCAGACTTCTAAGTACTGATTTGGTAGTGGGAGAATGAAATCAGTCTTCAGATAATTATATTGACTGCTAATAAAATGATTTCTTTCAAGGTGAT
GAATATGATGTTCTAAAATTGGGTAAATGGCAATCTGTCTTTTCCAGATGATGTACAATGCAGTTCTAGAGAACGCTACTAGTGAGCAAGGAGCAAGAAT
GTCTGCCATGGATAGTTCCAGCAGAAATGCTGGTGACATGCTTGATCGTCTCACTCTTACTTACAACAGGTCTTACTTTTCACCCTGTCCCTATCACACA
CATTTGCACTGCCAAGCTCTCATAGATGCATACTTTGTTTACCTCAGATGATTGTTTAATTATGAGGATAACTTATATTATTGATAGTTGATCAGCTCTT
TGTTGTCTGTCATTTAACCAGTCTTCTTCTAATTTTTCTGTGAACCAGAACCCGTCAAGCATCTATCACCACAGAGTTGATTGAGATCATATCAGGAGCA
TCAGCACTGGAGGGTTAATTGGACATGCTACTCTGCTTTTATTTGACGGAGACAATAAATGATGTGTAGGTTTTCTTAGCACCTTGTGGTGACCAATTAT
CAGTTTTGATTATGAATAATTACCAGGTTAACTTTATTTCTGGGAAAAAAATTTGTTTCTCTGTTGCAAAATCGTCAGAAATGCCATTTGAGCTGTTCTC
TTTCGTTCTTTGTTGTACCGGGCTTGAATGGCCGTAACTTGTTCAAGAATATTTTCTTGAAAAGCTCTTTGCCTTTATATTCATGTTTTTTGGCTTGTAA
GTTGAAATGTAGGCCCTTCCGTCAAGTTTCTTCCCTATGTGAGATATTCTGGTCCACTGTATGGACGTTGATAGTGTTTCTAAATCTAATCTGGTTCTAT
CAGCCTAAAAAATTGGCTATGGAACATTTTTCAACCATGTGTAGCTTATATTGGTACACTTGCAAAGGTACCTTATTTCTTCAGAATGGAAATGCATTTA
GGTGATTGTTATCTCCTGAAAGATGCTTAAGTTGGTTTTACTCATCCAATATGGATGGAGTCTGTACCCTAGATTTCTCATCTCGAATGCTGCCTTGGAA
TTTATCATGGGCAATATTTTTGTATTCCATTGTTCAAAATTTTGCAAATATTAGAAGAATATTAATGCTCAGTTACTGCTGAAATACAAGTGCATCAGTT
TAGTTTAGGTTTTCTTTTCAGCTCAACAGCAGTGATGATGAGCTCTTGCCATTATTTTTTACGAGAAACCATGCTACAATCTATTGTTGCAAAATCTTTG
ATAAGGATCTAGAGATTATTACATTTTATCTGCTGCAGATAACTATGTTATATTATCTTTTCTGCTACACAATTGTCACAGAAGTGTTTCATTGTTAATG
TTGCCTTCATTGTAATGTTACTGTAGGCGAATGTGTGTTTTTGGCTTTCATAGCCCTATTCATGAACAAGCACAACATGGATGGTAATTTGGACCCCCTT
TTCCTCTCCATACCCTCTTAACCCTCCTAGAATGCCCCGATCATTTCATTGTGTTTTTTTTTTATAGAAATAATTTGAAGATTCTCAAAGAACTAACCGG
GACTTGGAATTGTGATATGCTTGTAACTTATGTGATAATTCGGTACAGGAGCAGCCAAACTCCTCTTGTTAGTACCTTTAAAGATTGTTTACTTTGTTAG
ATGCTTATAGCCGGCTAAGAAACTGCTTTCTTTATAGTCTATTCAAGTCTAAATAGTACTGTAATTTGTTAGTTACTTAGGCTTAGTCTTGGTGATCTGT
TTAAAATATCAGCTGTATACCAATGATCTCTTAGTACAGGAAAAAGCAACCAAGATATTTCTTGAAAGCTAGTGTCAAACTCAATTAAGAGGGGTGAACA
TAACCCTTGATATTTTTATCTGTCAAAATAATCATGTTGTCAATTCTTATTTGTTTCTTGTATCAATGGAACAATAAGTTTTGGAAACATTTTTGATGCA
AGATGGAATTATCTCTACTAACTCTTTGTCAATTAGCAAAAAGAAGTGAATGGTAATGGTCCCTTTTGTCTTGCTAGGTTCTTTACAACCCATGAGAGGA
ATGCCTAGTTACTAGCTACATCCCCACTACGTGACAACATGTCTTTAACTTCACCTTTATAGGCCCTTTTTTTTTTTAATTCTTTGAGTGTCTCTTGGTA
GGAAAGGAGAACACGTTTTACATGTTATTTTCTATATATTTTTCTGAGTGTTTGGTAAGTAAATAGAAAATAACGTGAGCATTTAAGTCGTATAGGTTAA
TGGTAAGAGTTTTTAAAAATTGTCAATGTAATATAACGTGTTATAAGTAGTACGTTATTATTATTTTGTCCAGGTTGCAAATATGCAACTACCTTTTAAA
AGTGATTTTATTGTGATATTTTTAGAACTGTCTATTAATATTGCTAATATAGCTTCAATCCCTTGTAAATAATATATCTCTCTCTAAAAATTCAAATACA
AATACCAAATCATTAAATTCAGTAGTGGCTGTGGGTTTTACCTGTTACTCTCATTATTTTTTTTCCCTTCTAAGACAGTCAGTTTCTCATGATAACCACT
AGTGCTCCATGTGAATCATGTTCTTTTAAAGGTTTAAGTACTTTACAAAATTTTCAGTAGCTATTTGATATTCATATTAAAATCGAATTTATTTAATTTA
TGACAAATCTAAATAAAGACCATGGTTCCAACTAAGTTGACATCTCAACTCCACCCTCACCCCTCAACAAACCCCCCAAAATAAAATAAATAGATCAAAT
AACTATTATAATATACACAAATTAATAAAAAGTTAGCCGTTGGATATTTTGAAATACACATGATATAAAAGTATTCCAAAATCACATGGTTCTCATGACC
TTTTAGTTATATATATATATATATATTCCTATGTTATACTGTTGAACTTTAAATAGTTTAAAAATAGGATATTAAATGAAAATAGAGACGGACAGACCTG
GTCTTTTGGATTGACAATTACAAGAATGTGACATTACATTTACATTATTTCATCTTCAAATAGTTGAACAAGTTTTGTTTTCAAATATTGACATTGGTTG
AAAAATACATAAAACTCAAAACTTGAGTCGAAGTCATTTTTCCAAGCTATCTACTGTTATATTTTTAAGGGCATTATAATTTATTGTAATTGAGAATGTA
TCGCGGATAAATCACAATGGTATGGTAGGTGAACCAAAGTTGTATTATATTTTACATCCTAGTAAATTTGATAAAAGTAATCTTCCAATTAATTACATAA
TCTTCCAATTAATTATCATCCATCTCCATTTGGCTATAAAAATAAAAGACCACTTTCCTTATGTTTTGAAGGAAAAAACAAGAGACTTTTGTTATAATAA
CTAAAAAAAAATAACATATTTTTTGTCCAATTGGAAAATTTTCTTTACTGTAAAAACCTGCGCCTTTGTGTGTAGATAATGGGGCAAAATGAGAGGAGGA
CCCAAATCTCCAACAAATGCCCCAGCACATGCCTGCTCTAATCTTGTGTGACCCTTTTCTCACCAACCTCTGAAAAAGAGTGAGCTTTTTTCTTTATCTT
CAACACCCCCAAATCATTTTTCAAGATTACAGTCCCTTACTTTATAGTGGTGGCTGAGTTCGGTGAAGTTTTCTGGTGAAATTGGTTAGTTTTTTATTGG
TGGGGTTTGGACTTCACATGCGTCTTTGAAATGGGTTGTCTTTAGATTCTTTTGCTTTTTTTTTTTTAATTGGGAAAAATTGATTCTTTTTTATTGATGC
GTCGTGCGCTGCAGAAAGGGTGTTTTTGCGTATGTTTTTTCAGGGATTGAGGTTGTTGCTCGTGGTTATTGAATATGGCTTGTGATTGTTCGTAAAGTTT
ACAGGTTTGACAAGTCGTATTTGGTCTTTCTGGATATTGCCGCTCTTCAGAAAAATTGAATAGTTTTGGATATTGATTGTTTGATTAAAGAGTAATCTTT
CCTCATTTGGTGATTTTTCGCTTTTTCTTTCCCATTTGCATTAGGGTTCTTGGCTATAGCTCCTCAAGAACAGAACTTTTTTTCCTTTCTACAGAACCTA
GATAAGTTTTTCTTTGTTTCACTTGGAGAAATTGAGGCAATCCTAGCTTTTCTTCACACCCTTTTGAATCAAAGCACAGAGGTTTAGTGTTAACTTCCTG
TTCATTGTGATTTCTCTGGCACTTATCTTGTCTTAGCATTGGAGTAGTTTTTGCCTTTGCCGAAGATGATTCTAACAGGTAGATTCCGGCTGTAGAGCTA
GGTTAGTATAGCTGCTGTGAGGATTGCAGTGAACATGGATATTTGGGTTGTGGCTGCAGCTGCTGGTGCTGGTTATGTAGCCCAGCATTGGAAGAACCTC
TTAAGAAGCCGGCATGATTTGTTAGAATCATCTCCTGGTAGTCCTAGTTTTGTACGAAATGATTCATTAACGCGTATGCATCAAGTCTCGGATAAGAATT
GTTCCTCTCCTGTGGAGACACCGAGAAAGAAACTAGATGAGTGTGCTGCAGAAAGATTGGCTTTCCATGATCCAGAAGTGGCTTGCTCCAGCAGTTTGGC
TGATGAAAGATTAGGGATGTTGTGTGATTCTGATGATTTCCATTTGAACTCTGGGCTGCCGTGTGGTAAAGAACTTCAAGGAGATCAGGGTGGAAGCATA
TGTGGTAACATCAATGAACTGGGATATGAGTCATCACTCCCCCCATCTACTGCTGAATTGACATTTTCTTATGGTACTTCAAGGAAAAAGAGCAACCTTC
GGAGTAGACGAAAAATTGGGCATCTTATAAAGCCTCTGAATTCTCTTGAAAGTTGTCTCATGGCTCAATTATACAAGGAACATGGTGATGTTGAAGACCA
TATTTTCAGTTCAAACTCTTCACCATGGACTCCAACTGCGAGGCCTTTTGTAGTTACTGACGGGAGCAAAATTATAAGCAGGGCTAGTTCTAATTCTATT
AATGCCCCAAGAAGTGCTGGACATCAAAAGCAGCAGGATAATTTTTCACAAATGAATACTGTATCGGGAGTCCCTCAACTACCTAGTGTTGGATCCATGG
AGCTCCTCAGGAAAGGCAAGGTGAAGGATCAGTCCAGCAGATTTAGTGATTCCATTGGAATGAACAATGAGAGAAAAAGCAGTTTGCAAGGTACTTTTTT
CTGTTTGGAGTCTGATTTTGTCATGCTTTCCTTGGTAAAATTTAATGAAATAGATACGTATTATATTCCAATATATTGAACACTGGAATAGGAGCATTCT
AGGAAGTGTTCAAAAACTGTAGGGGATGTAGCTCCAGATAGTTCCATCAGGATATTATTCTAGTGCAAACCTGTGCAAGTGATAGTTAACTAAACTCTCA
CATAATGGAACTCATGACTGATTCATCCCTTTACCTGCAACAGTTGATGGAACAAAAATAATTTGTACATTTTTTACCTTAGTGTCATGTCTGTTTCTTT
CTTTTGAACTTCTACTTGAGATACTAAGACTTTACAAACTCTCTACTGTCCATGGCATTCCTGCTAATGGCACAATGAGTGAATACTACTTGTTTACTAA
CTTCTAAGTTTCTTTTCTTTTTGGAAAGAAATACTAACATCTCCTATAATCCCACCCTTTTATGTTTCTCTTGAATCAGGATCATCTCATCGTGTGCTTC
TTTTCTGTCTTGGAATATCTGTGGGTATGATATCTTCTTTCTGGAAAAATAGAAAGGAAATGGATAAGTTAAATGAGATGCTGAGACAGTCTGAGAATTT
GGTTCAAGATCTACACGAGGAACTTGAAATGAAAGAATTATTAACTGTGAAAGAGCTTGCCACTGAAGATTGTGGGTCACAAGATGCACATAATGATTCA
TCCAATAATGGAGCTTTACAGGCGCCTTCCCCTAAAGGAGAGATGGATAAGTCGCCAACAAATTATGATGAAGACTGTCAAAGCCAGAAAACAGAGGAAG
AATCTAGGAGTAAAATTGAAGCAGAGCTTGAAGCTGAATTGGAGAGGTTAGAATTAACTATGAACTCGTCTAAATTGGAGGGGAAACTAGCAGAGCTACA
CGAGGTAATAATAATTTCTGATTTATTCATATCTATGCTTCTTCTTTTTTTTCCCGTGAAGCAACTCTAATATGCAATACATTTGCTTACTTGGATACTC
CATTCTTGAAAATACAATAGTCTTATCAGAGAAGTTAACTTAGTCACTATATGCACTTAAGCATTTTGGTTCAAGATCTACCAGTTGGTTGACTTTGACA
GCTTATGAACTTATGTTATTTAAGGAACCCTAGAGCTTATGGTTGGTAATAGATAAGCTTGATTAGTGTTTTATGGGTATACAGTGCTTGAATTTTCTCT
CACTTCCGTTATGTTTTTCGATCGGCTTTGATATGCGTTTCCTTGAGCAGTGGGTTTACCGGGAATACCTCTCTACCTCCCAAGGTACGGGTAAGGTCGC
TACATTCTACCCTCCCCAAACCCCACTTTTGGAGTCACCCTGGGTATGTTGTTATTGTTGTATAGTGCTTGAATTTTCTATTATAGTTGGCATTGGAAGT
AGGAGCTGAAGGACAATGGAAAAAGAATCGTATGCTAGAAATTAGAGTTCGGATATTGAAACTATTTCATAAGGTTAAATCAAGCATCGAAGGGTGTGGC
CTTGTGGACAATGAAGTAGGAAGAGAACCATGGCCTCAAGTTAAAGCCGAACAGAGGCAAAAGACACTAGGCGGTTCCTTCCCAACTGCCTAACTTTGGT
GGGATAGAAATCTGGTACCTGTGTTGGTGAAAAGTAACAAGTATTGGTGGAATATCTATGAAGCACGTTACAAACACTACAATGAAAAGTATGCCTCAAC
CCTAAGTTGGGTTTGCTATATGAATCCTTACTATCCATTTCGCTCCATTTAGATGCTTAACAAACCCTAAACTCGTTTAAACTTGTCTGTTATGCAAGAT
AGATACTTCCATCAGTTTTTGCTATTAGAAATAACTATTCAGGGGGATATCTGTTGCTTATTGATCTCTGGTGGGCATATTGCATATTGTTGCTGAGCTC
TTTAGTCTCTAATGCTTCTGTTAGTAGGATGTGTACCTTATAGTTTTAGTCATATGATCAGAAATAATGTCTTAATTGAACTTTATAAAAAAAATTGTTG
TTCTCTTAGCCATTATATCCTGGTGCTGTCTTCAAGTCCTCCCAATTTTTTCCTCTCGCAGCTCTCTTGATCTGGATAGTATAGGAGGTAGACAACTTTG
TTTCAGCTTATACTATGTCAGGAGGGCTCTTCTTTAGAAAGTTGAGAAAATTGTACGTCATGATGTTTCTGGCGAATAGGTTTCTGTGCTTTAATTTGCT
TTCTTTGTGTTGGAGATCTTCTTAATGTTTTCAAACCAGTTTTTTGTTGAATTTTTTGTCGGTCTATTATCAGTTATCAGTTACTATGGATTCTAACTTT
TCCAAGAATCAACAATCTCAATCTTCATCAAGTTGCTCTTTTCCTTGATCCTCCAATGAGGAAGTTTTGATGTCTTTATTAGGAAGACCATTAGGTTATG
CTTTGTAGGATCAGTATCATCCATATTTGTTTTCTAGAAGGAATCAACGTTTTTGTTTGAAGAATTCACAGGAGAGTCCCTCAGGAGAGACTTGGAAGTT
ATGACTGGTGCAACTCTTTTACATCCACTAGGAAATGAAAATGAATCTCATTGCTGTACAAATTAAGCTACACATGTATAAGTCATCTGCTATATTCGAG
AAGCTTTAACAAGTGTTCAATCTTTCGCAGCTTGATCCAGATTTTGTGACAGATCTAGCTAAGGGGGAGTTAAGAACTGAACTCTTTAATAGACAAGCCG
GAGGTCAACCTTATGCAGATCAGGATGGTAGCGGGACCTCAACTCCTCATCCTGCTAATTATGCCGTCTCACCTAGAGAGCTGACTTTGCGGCTGCACGA
AGTCCTCCAAACACAATTAGAAGACCGGGTCAAGGAGCTTGAGATGGCACTTCAGAACAGTGAAAGGAAAGTTCGTTATATGGAAGCAGAACTTGTAAGT
TCATGGAGGGACTCGTCAAATAGTGAAGGGGGTTCTTCTTCCACCCATGGTAGTCCTGTAACTAAAGTTGAACAACGTACAGCAGACCAGCCAATGACAA
TCAACTTACGCGGGGATGCTTTAGATGCATATAACGAGGCTTATAACGTGTTCACAAGGTTAAATTCAGAGGAGGAGGATGTTGCTGTTGCACCAGGAGT
TATGGACATCAACCATCAAGAGAACTCGCGTTCACGTGAGCATAACTTTGACTGGATTGAAAATGATAGGATGAATGATGAAAGTGATGATGAGATGGAA
AAGTTGTTAATTAGGCATATAGTGGAGAAAGCAAAGAAAGGTTCTCCAGCAGTTTTAAATGTGCAGAGAGCATTGTTCTCCCTTGATGATAATGAACATT
GATACATTCACAACATATAGATAGTGAAATCAGATTAAAGATTTTGCAGTTAGTTGACTGCTTTTCATGAACACAACTTATGTGCTTGTTTGCCTGTGTT
CTCACAGAAGATGCCTTCTTCTGACCCCCAAAGTCCCTGCCCCCGCCGACTCCCTTGTTATCATGTCACCAACTTCCTCGACCTTCCGGCGGGTCGGTGT
CAGCCCCCTGCCCCTAAGAAAATGGATAGACAATATCTAAATGAAAAACAGATATGACTTGAAAAAGGAGTTCAAAGGCAAAAAAAAAAGATCTATAAAC
ATTAAAAATAGGATAAATCATCTATATACACACCTTTTCTTATGTTATTTTTCATTATTCCCTACCTTTCTATTCTTATGTTATTTTTTATTATTTCCTA
CCCTTCTAAAATATTATATAGATTCCTTATTTCTCCCAATTTTTAACTCAATTTGATTTTCAAAATGATTCTCTTTCATGTCAAATGAAATATTACCTAC
TCAGCAAGTATTTTTCTCTTCTTTGCCACAACAAGGGCTCAACAACGAAGCTTATTTTTAACGTGTTATCTCTTACTATTGAATAGTTTTTCATGATTCT
CATTGAAAAATGAATCTGGATCATGGGATCTATCATCAAGCAACATGTAAATTAAACAATTCATATATATCATTTGTGTTTTTTGGTTTCAAATTTTCAT
ACTCTTTTTAGAATTTTCGATGATAAGGTAAATGCATATATATATTTTTTTTTAAAAGTAATATTTCTGCTTCTCTACATTATCGTTCATTATTTTTCCG
AAAAAACTACCTAATTACACATGCATTACTGCCATATATACTATATTTACCTTTAGTTTAAAATAATTAAAATTAAAATATTTAAATAGATACACAAATC
CCTTAAATTGATATTGAGGAGGAAGGAAGAAAGAGCGCTGGTGGACGTGCGGTGGGGGAGAAATGGCAAATATAGTAGAAATTTTTTACCCCTATTTAAG
GAGTTCTAATTTAAAATAATTATGTTATATCAATTTAAGGGATTTGTGTATTCATTTAAATATTTTAATATATATAAAATAAATATTAAAAATGGTAATA
TATGTAATTATTTTAAACTAAAGTTAAATATAATATATATATATGGTAGTAATGTATGCATAGTTATGTAGTTTTTTCGATAATTAATGACATGAGTCCT
TCATCTCTTATGACTCAAACACTTAACTTTTAGTCCCATTTTTTTTTAAGCCCAAGCTATCCCCAATCTCTCTATGTATGTATATATTTAGTATTGGCGC
ATGATATTAATTTATTAGGTTTCTCTATTAAGAAGAATCGGCAAACGTTTTAGACTTCAAAAGGTTAGCCGTCTCTCCCTTTTTCTTTTTGCTTTTCGAT
AATGATCGATCACAATATTTTTAATATATATATCTGATTTGTTTAAAATATATTGAATTCTCGTGAACGGTGGATTCTACATCCGTCATTGGTTCATGTA
GGCATGTTTTTGCAAATTATGGAGTTCAATTGTTTTTTACTTTTAAATTTGTCCAAATAAATTACTTTAGTTTTTTCCTCGGTGTTTTTATCATTTAAAC
TTTATTTTTGATGTTCAATTAAATCAAATAATATTTACTATATAAATATCGTTTTGTCTCAAATTAGTTGTTTTTTTAGAGTCAAAATTAATTGATCATC
GAAATGTATTACTTGATGCAATTCTTTCTCAATTTAACGAAAAACACATATAAATTTTTTTTTTTCAAAGATAGTTTAAACATGATACATTTATAATGGG
ACACATGGGTACAAATCTAAAAAAGTCAGATTAAAATTAAATAATAATCTTGAATTCGTATCTGTATATGATTTTGATTAATCAAGCTTTTAGTTCTCTC
GTGACTAGGTATGGAGGAGGAGAAGAAGACGATCCTCAATATGATTTCTAGTTTTTTCAAGCGCGGTAACAAGAAAGAAGAGGCATGTGTAGATACTACT
AGTGGTGTCAGTGCAGATACCACGAGTAGTATCGCATGTGTAGATGATACTACAGGTAGTATCGCGTGTGCAGATGATACTACTGATAGTATCGAGACAC
TGAAAGATGATGAAGAAGAAGAAGACGAATGGATCTTGCTCCTTGTTGAAAGGAGAGCGAATGTTCAACAAATATCAATTTTCTTGATTGTGCTTGGTAT
CGTGTTGATTTGTTTCAACTACTCTGATGTGGTGTTTACAATATTTGGCAAGGAAAGTGGTTACATTGTCTCCAGAACCCTTAACTTGGGGGCTGCATTT
GTTATTACTGTTACTGGTTTAATTGTTTGGGATAATACTGGGGAGAATTAAGCCCTTTAAACACTAGGTATTGTTTATCTTGTCAATGGTTCCTTAGTTT
ATATAGTATGTATGCTTTGAAAGAGAAGTTTGATCATTCTATGAGTTAATGTAATTGGTGTCTTGATTGCGAAAAATCCTCGAAATTTAACATTACCTCT
TCGTATTACATAAATATATCTTTTAACTTTGCTTCAAATCACATTTACGTCCTTCAATTTTGGGTGTGTACAAGTAGACACTTATAGTTGTATAAAGTTA
AACAAATAGACACATGTGTCCTACATGTTTTTTTGTGGTGTTCTACATGTATTTTGTCATGTAGGACTCATGTGTTTATTTATTTAAAAGTTGGATAATT
AAAGTGTCTGTTTGTGCATTATGAAAGTTGGAGGTCAAAATTAAAATTTGAAGTCAAGTTTAGGGTCCAACATATGTATTATGCCAAAAAGATTGATATA
CAAGGCATAATACATATATTAGACCATAAACTTGACTTTAAATTTTAACTTTACCCTTAAACTTTCATAGTGCACAAATAGGCACTTTAATCATCCCATC
TTTCAATAAATAAACACGTGATTCCTACCTGGCAAAATGCGCGAAATGCACGCATTCTGCGCGAGTGAAGGGTAATTTTCGAGGCCCACAAAAATAAAAA
AAAAATGTCGAAATGACAATTCTACCTTTAATGAATCTCTTTTATATTTATTAAAATTAATTTTAATTTTTTTTAGTTTCAAAATAACATGTAAGATATT
TTTTTAAAAAAAAAACGACATATAAAATGTTTAGTTAAAGTGTCTTATTTGTGCACTATGAAAGTTTGAGATCAAAGTTAAAATTTGAAGTCAAATTTAG
GGTTCAATATGTATATTATGCCAAAAATTTATATCATTAGCTCATTTAAAAGATAACTAAGATAATAACAAATAACTTTAGTTAATCAACATCAATAATA
ACTTTAGCTATGGAATATAGCTTTTACACACACGAGTGACTGAGTTGATATAACAAAGATATTCTATAAAGAAATTATGAATCTATTATGTATTCTCAAT
CGAATTTGTCACACCGAGCTTGAGGAGAAAAAAACTTGTATTTACAATGTGGCCCAATCATTGCTAAGTTTGGGCCGGACTCGTGGATTAGGCCAGCTAC
ACATATTCACAACTCGGGTCGGGTTTACCGTTTTGTTGCAATCTCACAAGATCCAACGTCAAAATTGGAAATACCCAAATTTTCCCAGACTATCAACTGA
ACACTGAAAATCCAAAAAATTGTTCTCGGAATCCGAAGTTTAATTCAATTTTAGGGTTCAGATGGATGAAAATTCAAAGCCCAGAAGCGTTCTTGATTCA
CTGGGTGAAGAAATAGTGAGAATTGTAACACCAGTCTCAATTTGTATGCTATTGGTGGTTATCCTTGTTTCAGTACTAAACAATGATTCAGATTCTTCAG
GTCCTTCATTTACCTCTATAGCTACAGTTGCCTATAGTGAGAGCAGCTCAGACTCAAACTGGGACAAATTGAAAGGTGCCCTTTTGAATGCTTTAGTCTT
TGTTGTTGTTGTCACTGCTGTTACATTCCTTTTGGTCTTACTTTTCTACTTCAGATGCACCAAATTCTTGAAATACTACATGGGTTTCTCGTCTTTTCTT
GTTTTGGGATTCATGGGTGGTGAAATATGTCTGTTCTTGATCGGAAAATTCAGGATTCCCATTGATTGCGTTACTTTTGCTTTGAGTTTGTTTAATTTCA
CTGTTGTTGGGGTTTTGGCTGTGTTTATGTCAAAGACGGCAATTATAATTACCCAAGGATATCTGGTTGTTATTGGAGTTTTGGTTGCCTATTGGTTTAC
ACTCTTGCCTGAATGGACGACTTGGGTGCTTTTGGTTGCAATGTCATTGTATGACCTTGCAGCTGTGTTGTTACCGGGTGGACCTCTAAGGCTACTTGTT
GAACTTGCAATATCTAGGGATGAAGATATCCCGGCTTTGGTTTATGAAGCTCGCCCCATTATTAATCCCGACTCAGTTCAAAGGGGTGCTGTTGTGCAAA
GGAGAGTTTGGAGAGAAAGAAGGGACAATGATATTGGCTCTGATGAAAATTTGGATTCTAGGTCTAACTTGAATTCAACTGTCTATTCTAGTTTGGAATC
AAGTACTGGTCTCGAAAGCCTTCCATCAATCGGCGAGAGGAATGCTGTTGATGTGGAGGATGGTGTTGATATGGAGGATGGTCAAGTTTCAAGTTCAGAT
TCTGAGCTGGCTGCACCGCTAATTCAGCATAGGATAAATGTCCGAATGAATTTACAGGAAGGGTCAAGTGATGATTTTGCACTTGAAGGGATTGGTTTGG
GATCGTCAGGTGCTATTAAGCTGGGGCTAGGAGACTTCATATTCTACAGTGTATTAGTTGCCAGGGCTGCGATGTATGATTTCATGACAGTTTATGCATG
TTATCTTGCTATTATAGCTGGTCTTGGTATCACTCTGATGCTTCTTGCATTTTATCAGAAAGCTTTGCCTGCTCTTCCTGTGTCCGTTCTGCTAGGTGTC
TTATTTTATTTGTTAACTCGGCTATTGCTTGAGACCTTTGTTGTACAATGTTCGATAAACCTGTTGATGTTTTAGGAGCATGATTTCCTCGTTGACAATG
TATTACTTTCAATTAATGATATTTCTCCCGCATATCTGTTATAACATCTTTTTTTATTGTTTGGACCATGCTCCAAGTTGGCCAAACTGCAACTCTTGAT
CGACTAGTTGTAGCAGGCAAAAATTGTCTGTGAAATAAAAGGGAAGCAGGTAGTGATTCAAGATGTCTTCTTCAAGATGTCTGAAATGAAGAAGTGCCAC
TCAATGGATATACGAGCTAGCTGCACTAGAAAATCATTAACACCGCACCAATAGGTTGGCATATAGCTTATGCCTTTTATAGTGGTGCATGCATATCATA
GAAAAACCAATTATAGTTGGCTCATGACATTAACTATCGTTATTATTGCCCACATGCAGAGTGACCAATAACCTAAAGCAGGAAAGAAATTGATTTTAGG
AAAGCACAAGGTGACAGGGACAGTGCTCAAGTAATTGTGAGTCAAGCTATATAGAGAGGGAGGGATGAGAAAGTGAAGTATGGCTGAAATGATTATAGTT
CTTTCTGCACAATTTTTCTTGAATTTAGTGAGACCCACAAATATGTACTATAGCTATAAAGTGTGTTTTCTATTTTTTATTGAATCAGTCATAGAAATGA
CTGATATCTTCGATCTAGGAAAAATGATCTTGGGTGATCTTTTTTGTTTCAGTCAGATGCAGTTTTACAGTTTCATTAACAGGGAGACACATTTCTGTAA
TCTAACTAAATGTTGTCTTTCATGATTGACCTTCACAAACACAAAAGTGGAACAAAATTACAACATTGATCATCATCGTGTCTATTTTGCCTTCACTGTG
TTACTTCTGAGACATATACTGTACTCAAATTGCTTGAGTGCCTTTGACAATTTTTAGGGTAAGTTCCTTCTTTTTGTTGCAGAGGAATGTGCTTCCAACT
GGCTGACCATGACTTTGGGGTGTGAAAAATAGCTCTTTTATCATTAAAATGTCAGCAGAAAGTATTGTTTATTCTATAGTTAAAGTAAGTTTTGAGTCTT
GATCGTCTGTTTGAGACAACATGGCCATTGGTAATGTACCTAACCACTATGCTAGGGAAGTAATTTGATTCATTTGACAGAATGGAAATACAAAATTAAG
AGAACGATGCTCTTTGAAAGCCACAGTCATTGGATCTATAACTTTGGCTCGAAACCACGACTGGAACATTAAGCGCTTAAGAAATCTTAGTCCTTAGTTT
CCTTATTGCGAAAAAGGTAATATGGAAACTGGACAATTATTTGACACTTCTGCCAAAAAAAAATCCATGAAGTTAGTAGGAGTGATTTCATGTATAATAC
GTGTGGGGGGGGGGGGGGGGGGAGGGGAAGAGGAGAATATTAAGGGACATAAAGATAAATGCCAAAGAAAATCTGAAGTCTCTGAAGCTAGAGTTGGCAT
CTTATGTAAGCTCTGCCTCACATTCTTTTCAAATTGATTATGTCTATTCATTACACTATTTGTCCTTTATACTTGTGAGTTGTGATTGCTTAAACAGATA
AGTGTTAGATTTTATTGTTATTTGACACTACTGAAAGTAAGGTTACTGAGAGAAACATGTATTTATTGTATAACTCATCTGAGTAACTACAGTTGCCTGT
AATGACCAAGTTTCTGTTGACTTGTAATTTGTTTGAAAAAGGATCATGATGTGTCAAGTACAATGGAGTGATTGAACATGAGTCCACCTGATCATTGGTT
ACGTGTTCTGATTAGTTAAAGATTATGAGGTTTTGTTTTCGTTACTGAAAATACTTCCAACAGTGTCTTTTCATGCTCAGGAGGTTTAATTTCTAACTTC
ACTTGTTCTTTCTTGTTTAGGAAAATCACCTTATCAGAATAGTTGGTGTTGTTTGGTAATCGGTAGTTATACAAAGATCAATTATAATGGAATCTAAATA
TTATTTTGTGACTGTTTAGTTATCCATCTTTTATCCTGCATAAAATATACGTAGATTCTCCAACTTATATATGTATTAGTTTTGTCGGTTTCTAAATTGC
AAACCGAACATTATATTAGGTGTGTTGTATTTTATGCATAGCAAAAAGATGCTGCCAAACATGGTGTTACTTATGCAAGATTACTTAGCTCTTCTTAATC
AGCTACCAAATGACCCTATAAATGTATCAATCATCATTATATTAGCCCCTAGCGCCACTGTTCCCTCAAAAGAGTCAAGACCTTCACACCAACATAGGTT
TTAAATTTGAAAACTACAGATACATGTACAAGAAGAAGACTTGAAACGACTTTTACTTTAACTATGAAGCATAAATGATACAAATGTTCAGTGATAGTTA
TGGGGTGCTGAACTTCTGCATTATTAACACCGAGAAAAGAATAAATCAATATGATTTGATAGGTGGCTGAGCATGTGCTCATACAAGTTTTCTCTTTTAC
CTGTACAGATGTATTGAATGCCATGACTTGAATATCTAAAGTAGTTAGGCCTGTCTATCAGACTTAAATATCTGAAGTCATCTTCTGTCTTCCAACCTTT
ATGGCTCAGTGGTTTTGACCACTTTTAGCTACATTGTTTTGACTTCCCAAAAATATCATCAGATTAGTGTTGGATCATCCAAAAATAGTGCCTTCTTGAT
GGATTCTGATGAGGATGGGGCAACATTTTTTAGGAATCTGAACGACATAGCTATGACAAGTGATTTGGGACACTCGTGTTGCAAATGATCAGCAACAGAG
TGTTAGCAAGAATGAGAGTGGAACACAGATGAAAAGGAATGCATATACCATAAAGTTGCAATACTAGATTGAACTCGAAAACTATGGACAACTATACATC
TGTGTGGTGTGTGTTAGGGTGGGGGTGGGGGAACTACAACACTAATGTTGATAAATTACAAAAGATAAGACAATTGAAACGCTCAATGCAGGAAAATATA
CTACTACTGTTATTCAACTTTCACCTCCTCCAGTGATGATTAAGAGACTTTGCTGAACCTTGAAAAAAGTCCAGGAGATACTCCTCCAAGTCCTCTTCTG
TGTATTTGATGTGCTTTTCACTGAGAGATTTTCTCACCTTTCCAGCGAATGTACGGTAGGCATGAATGACCCTTAATCCGATTGAAACATTCAAATCATC
TCGAAGATCAATATCTGGAATAGTCCATCCTGTCTGGTTTTTATACACTTCCTCAAAAGCAATACTGAAATTTCTGCACCTCTCCTTCAGAACTGCCTTC
CCTAACTTCTCATAACCGGTTATCAAAGATATGATTGAATTCCATGTTTTTCTCTCATAGCTTTTTTCGTGCTGCACATATTTTACAATATGTATTTTTA
TCCACTCATCACCAAAACAGGTTCTGAGTTTGGAATTCTTGATTTTCTGGACCATGTAATGGATGTTGTTCATCAAAAAGATGTGCTTCAAAGAATCGTC
TTTATATAAATTGGACCTATCTTCAAGGTTGGATTCGAGCCTGGATGTTATTGACTGCAAGTGAAAAGCCAATGGACATGGGATTTCGGATGAAATGTCG
AGCTTGACCAGTGTATCGACAACTTCACCCGAATTCTCTACCTCTCTGTCCTCTAAAAGGAACCTCAGGGTAACATAATATTCTGACAGAAGCATGAAAT
AATTGATAACATACTTGGTCAGAGGATGAACACCTCCTCCTTGAAAGGGAGTTGTTGAAGTGTTTGAAGCAATTCGATTCCCCAACCCCAGAAAGATTGC
CTTTGCAGAATCTCCAAGATTTTTCATGAGTTCATGGTACTCCACTTGAATGGAATTACCATGGTTTACACAAAACAAAGCATCCACATCTTGACAAAGA
CCTCTAAGAAGCTCATACATGTCGAGTAAACAAAAAAGACGTTCTGGTAGAAGGGGACCAATAGCTACAGCTTGGCCAAAATTCAAAAGACACATCATGG
CATCCTTTGAGACCTCAATGAAACATGTTGAACTGACAGATCCAAACTCACCAAGAATCTGATCAAAGAGGTTTCTCTCACTAGGGAGATAGAATGCAAT
GACATTCTTCGTTGCCTGACGCCACTTCTTAATTCTGCAATTCAAGCTTGCCCAGTCCATTCTCAGCACATCTTCAATGCTGATTTGTTGCATACAGAAA
AGCCCCAAGTATTCATACAATGCATCTTTCCAGAATCTGATAAAAACTTGGCAAAATTCCTGAACATAATGTGAAGCTAACATCAGATCTGCAATGGACT
TGATATAAGGAACAACGCCTGGATGGACCAAATCCATTATTATACATTCTTCTGATTCAGCTCTACTACTATCCAGACAAGATGTTCCCTCAATTGAGTC
ATACTCAATTGAGACCATCATTTCCTCATCAACTACGGTCTCTTCACAAGAATGGAACGACACATATGCATGCTCGAAACACTGCTTACTCTGCGCAAGA
ATATTGATAACTTCTTCCTGCAGCCTTACCATTGCAATCTGCAAAACACTGTGAGCTTGATTAGTAAGTCTGCTTTGTTTCCTGTTCTTGTTTAGCACCA
TACTTTCCAAGCTCACTATTATACTCCGAACTTCTTCTACATTTTGCAGATACTCAAGAAGTTGATTAGAAGGACCAGTATCCCATAACTTCAGACAATT
TGACTGCAAGGACATGATCTTTGCCTCAGCTGACTTCAACCTACCTTCGATCTCTTTGAAACTTGTGGTCTCATCCTCTTTTGCTTCAGTCATTGCAGCC
AAATGAATGTCAAGATCGGCTAGAGTTCTTCTAACTTCATCGCTCAAGCTTGTCCTGTCTTTTAACGCCTTCACAAGGTGTTGAGCTGCAGCAATTACAT
GTTGATCCGTCGATTTATCGCCTTCCATTTTCAGGCAACAGGTAAAGTCAAAAGTAAACTTTGGATGATCCTTCCTTCCTGAATCTTGAAACCAACCTCA
AGCTCTAATTTTTTAGGTAATCAAGAAGGACAAAAGACTGCTCCCCCCACCCCTTAGTTAAACCCCAAGTCCTCAACAGAATTCAGAACACAGACTAATG
ACCAGAAAATACCCCCATAAACCTCAAGTCCTAAAAAAGGTCAAGATTCTCTAATGAAATGTGACAAGTTTCAACAAAGGACACAAAATTGGGATGTACA
TCTCTTAAACTCTTTCAGGGTCACTAACATTAAAAGATTAACAACCATCAAAGAATGGGCATGAAAGTTACTACCAAAACATAACAAAACCAAAGTTCAA
GTGCTAAAAAGGGATTAAAAGACTATGTAGGTAAAGCCAAGATTATGCTTGTTTCTTGGAGCTCTCTCCTCAAAGATTGGTTCTTTGAGTCAAGAAAAGA
ACAAAATATAGTAAAAGGGATGATAAGATGTGAAGTTATTGAAACAAGAGTTAACTGAATAGAAAGATCACACCTCTACGCGTTTTAGTGGAAGATAATA
GCCCAATCAAAACAAGGACAAAAGGGTACATCGCATAGTGGTAGTATTGAGGAATGAGATTTGTTGCTGATTTTCCAACAAGTACTTTTCCATTAAAATA
CAGAGAAAACTTTAGTGGTCAAAAGGGAAGAAGAAAGAAACTTCTTACTTATAAAAAGTAAGCAAAAATATATTCAGCTAACCTAGACTAAAGACTAATA
TTTGAAGTTGTTTCTTTCTCATTTAACTAAAATCAAACCAGCTAACCACTCGGGACTCTAATGTGGACTCCGGATATTGATTAGAAACATTAACAAACTA
AAATCAACAACAAATCTAGAAAAAAATCTAAATGAGATTTCTATAGAGACGTTGTTTTCGATAAATACTCAGCTCCAATACATCCAACCCTAGTACAATA
CAATAAGAAGAAAATAATTTCCAAAGCATAACTAAAATCAGAATTTTCTAATTGATACAGTAAGTAATTTTTTAATTCTTGGGAGTTGTCTATGTTTTTA
CTCAAGGTGCCTTTGACTATTGACTATGGTGGAGTATTGGGAGAGAAAACGGGTCGGGTTGGATGATCGACCCATGAGATTACTAATTAACGTTGACGTA
TTAATGATATACCTAGTCACATTAACGTAAGCGCCTAGCTAATACATTTTCCTGTCGCTTGCGTCACTTCCACAACCGGAATATATATAAGTTCACTTAA
GTTTTATTTAATAATTTTATTTTTATTCTCTCTTCGTTTCAAAAAGATTGGTCTAGTTTGACTTGGACCGGAGTTTAAGAATTTTTTTTTTTTTTAATCT
TGTGGTTCTAAATTAAAGTTATGTCAAATATTTGTGGTCTTAAACATGTCATATGAAAAGTTAAAGTTAAAGTATTGCCAAAAAAGGAAATGAGTTATTC
TTTTTTAAATAAACTAAAAAGGAAATAAGGACTTTCTTTTTGAAACGGAGGGAGTAGTAAATTTATATTCATATTTTATTTTTTTATTCTACATATTATT
TTTCAGAATAACAAAAAAAACTGTAATAACAATAATTTTGCAAGGTTAGAAAAAAGAAAAAGAAAACGATTAAAATTTTCAACTCTCTAAAAAAATGTGT
AATATAGATTGAAAATTTGAATATGAATATTTTAATTTAATAAAAATAAAATTTAACTTCTTTTTTTTTAATAGATGTTTAAATTGGTTTGTCTATATGA
AATAATATTAATGTTAAAAATATATTCATAGTTGTCATTAATCTTAATTTGATTTTCAAAACACTTTTTAACAAAGATTAGCAAAACACAATTTGCTGAC
AAAAATCACTTTTGGATTAGCCAAACACAAGGTTTTTTTTTTCAATTCAAAAAACAATCTCTTGAAAGCTATTAAAAAAAATTAGCAATAATGTCAAAGG
AGACTCGACAATAATAAAAACATATTTTGACTTTATTTGTTTGACTACATGACATTATGGTATTGCTTTTACAGAAATATCGTATTAGAACGAGATACTT
TTCAAAAATATGAGTTGTTTGATTTGTAGGATAAAATATTTCATAATTAAATTTTTGTAGTTAAGTTTCTATTTTATTTGATTAAAACTATACTAACTAA
GTAGTTAATGTTATTTTATTTCATTCTAAAAGTGAAATTAATTACTCTCACAATAATAAACCAACATTATTATTTTCAATAATTTTGTAACGAATTAAAC
AAATTATGTTCAAAAATGCTTTTACATACACCCCAAAAATATCTCGTGGTCATCTCATCACTCATCCGTTTCAATTTTTTTGATTTTTAAATCAAAGTTA
TGTAAAATATATTAAAATATTTTCTAATATTTTGATATTAAATCTGTAAGCAATTAAAATTAAAGAATTGTTTTTTCTAAAAAAAAAAAAGTAAACTTGG
ATAGAGTTATTGTGAATGGGGCCAAACACGGTGTTAATTTCGTAACCGTAGTCCGTACTCCGGGAAAAAAGGAAGTTTGGGCACCATGGAATCCAGCGAG
AATGTCGCTGCTCTGTGAAAATTGCCGTTCAGTTTGCGTGTGAAAATTTTCGTTCATTCCACGCTCTTCTCTTTCCCCATTCTTTCACAGAATAAGAGAC
TACATGAATAACGACGAGGGCCAAAGGGGTCTTTTGGTTTTCAGATCAGCTCCCAGGTCAGTCGTCGCCGGCCGGCAATTACCGGTTCGACGACGACCCA
TTCCTTTTGCAGCGCTTTTAGCCGTTTTTTGGGCTCCATAGTTGGACGGTTCGTGATTTCTCGATTTATTCATTTATATCCCAAATGTTACAATTTTTTT
TCTTAATTGTAGCATTTTTGTGATGGGTTTTTGCTTTAATTTTTATTTCGGCCTAATTGCTGGGTAATTAGATGGATGATATTCATTAAGAGAGCATTGC
ACCAGTGTTTCACTATGTTTATTTGTTCTTTTGAGTTAATAACTAGATAATGCTGTGTGAAAGGTTTTGAACAATGTTACTCGGACTCTCCAGAAATGCA
CTACTTTTGGAGAATCCAACTCACGCCCGAGTAAAGAGTTCGAGCAAAAGTAGGTTTTGAAAGCAAGGAGCCAAATAGTTTCTTGAAGTGATGCTATGAT
AAACGTATTTCAGAACCATTTGGTGAACTTGTGTGACAATTCCATTGAGGCTGCTATTCTTTTTCTGACTATTCTGTGGAGGCTATTCTTTTTTTGACAA
TTCCGTGGAGGCTATTCTTTTTGCTGACAATTCTGTGGAGGCTATTTGGTTAACTAAAGTTCTAATTAATATATAAACTTTTTTCTTGGAAACCAATGGA
CTGGAATGTATTGCAAATTCTTGACCCGGAAAGTGTATCAACTTCCTTGATTTAGTCATAGATGGAAAGATTGAAAAGACTAGTCTCAACTATTACACTT
CCGTGTGATAATAAGCATGCGAGAGTGCATTTCAAGCTCAGTCGTCCGAACCCTTGTCTCCTCTGGCCCTTACCTTTGGTGTCACCTTGTAGTTTTTCTT
GTTGTTTTACTTGTACTGTTTTCTGAGGGATGATTCATGATTTGAGAGAGGAACTCTAACTATTAGAACTCGAAACACATATATCTTGCTTGTTTTCATC
CTTCTATTCAGTGCTTGTCCCTTTGCATACACACAGGCAGTCCTTGGGCTCAGGAATTCTTATAGTTGCATATTTTTCAAGATATGGCGACTCCATATTT
GTTTTTGCTAGTGAAGATTATGATGACTCATTTATGTTTTTGCTAATGAAGATTATGGTGACTCATTTTTGTTTTTGTTAATGATGATTATGGTGACTCG
TTTTAGCTTTTACTTTTATCTTTGATGCAAAGGAATTGTTTGGTCTACAAGAGCTTGAGGTGAAAATGTCAAAAAACACTGCTTTTGTATCACACAAACT
GTACACCCTCTTATGCATGTTCTTGGCAGCCATTGAATTGTTAAGACATCTTTGTTGATTGTATCCTCTTATGTTAAACATTGTTGTTTAGTATATTGGA
AGAGTGGGTGTTTTAAAGAAATTTTTAGGCCTGGTTGCTATACTTTCCACCAAAGTTCAACAGTTTCTAAAATTTTAAGCAAGGATAGAGGGGTTGAACT
CTTAAATGCCAAAGACAACAAATAAGACTGAATAATGGTTTTTTATGGCACTAGCATACATACAAGAATTATGTAGTACATGTTTTTTCTTCTGGATTTC
GCTGTTTGCCTTTTCAATCTCTTGTTTAGCACGGGCTGTAAAAATGCAGGATTGCCTTGACTGTAACTTCAATATTGGTACGACCTTGTCCTAAATCAGT
AGCATAAGAAAGTCGGGTTTTCACATGGAAATCGTTGTTGCAAGCATAGGGCCAAGCAGAAAGCTTGTTGTAGATAATTCATACCTGAAACTTCAATTTG
AAATTTAATCATTGATCCATTTGAACATTGAATTGACTCTGATTTCAGTTCTTTCTATGGCAGTAGAAGTTTGACTCTTTGGCTTGGTAAAGGCAACTTT
GCATGGTGAATTGAGTCAGATGTCTTCAGCTATGGAGCCTAAGCATGTTACTGCAACTGATGGAAAATCAGGGACACCTCCTACCCTTGCTGTTACAGGA
CTTAAAGTCTCCCCTCGCGGGAAAACTTTAAGTTCCTCAGACTCTTTCTACAATACATCACCTGACTCGACACTGAATGACCCCTTTGGCAAGGTTAATT
ATGAATCTGATGATTCCACTGTTAATGCTAATAACTTACCCAAACTTGGTAAGGATAACAAATCACAGTTTTCAGACAACAAAAATCCTGTTTCTGGGAG
CTCTACCATTAGTAGTGAACCCTTAAACCATGAAGTGTCACCTTCCATGTCAGAGTCAGAAGGGACTCACTGTTTTTCCAGGTCATGCTCTGACAATTCG
TCAACCACAGAATCACCTCCCATGCAAGTAATGGAGCACTCCGCAAACGAATCTTATAGGATCCCTTCTTCAGTGTTTGCTAGAGATGAGTCTGCAAATC
CAGCAGAGTGGAGTGTAACTTCTCATGAATCATTATTTAGCATTCACATGGGTACTACGAGTTTTACCAAAGATGCTAGTTTTTGGCAGTCGGATGAGCT
GGGTGAGCTAGGAACTCCTCAAAACTTCCCGGCATCCCCTGCTATGTGTGACTTCTCACCGTACCAGTCAAGTCATGAGATGGAATTGGCTGAAGTGAAG
ATCTCAAGGGGAAATGAAGATTTAAAGCATGAAAGATCTCTTGCTGTAGGACGTGTTTCTCCTAAGCCAATGGAAAGTGGAACCAATACAATGTCTTTTG
CATTTCCAGTGTAGGCAGTCTACTCTCAAACTCTCATATGATACATTGGCAAAATTTTGTCCTTACTGTTCATTTAGAATGTCGACAATCATTTCTAGTG
TGAACATTTCTTCTTTCTATCTCACTTTCCGTGCATACAATTATAGTGGGACACCTACATTTTGACTCCAAAGACTAATGACAAATGCTCCATAAATTAT
TATCTCTACTGCATGACCTGTTGTGCTACTTACTATGAACATATCTTGTGGTTTCAACATTTAAATAATCGACTTTATATCTGGACCCTGATCTTCCGCT
AGGTAACATAGACATGTATCTATAGATAGATTCTCTTTTTCTGACTTGAATAGAATGTAAGGGAAAAACTGAAAGATTAAATGAACTGTTTCTGCATAGA
TATGACTTTCGGAAGGTATCAATGTGAACATTATGCTTCTTTGCAATTTCCATATGTATGCCAGTATTAATGAGAGATTGACTGACCCATCTGTCTAAAA
ATAAAGGCTGTCAGGGAATCTGGATAAAAACTACTCACAGCGCATGGCTGCTCCAACTGAATCTAGCCCAGAGCAGAAGCAACCTCAGTTAGAATCAGCT
GAGCTGCATACAGAATCGTCCCCTCAATCAGAGCCAAAGACCCCGACAACAACTGAAGGTTCAGGGAAAACACAATGGTTTCCTTTCTTCTCGTGCTGCT
CTTCCGGTTCCTAGGATTGCTTTCCTAATAGTCCCTTTGTTTCTGACAATGCCATGGTTCAAGGAATAATACGATTAGCCCAGAAGTGCTGATGTGGTGC
ATGCCCGGTGAGTTTAGTAGTAACAACATTCATAAAAAGGACTTAAAAGTGCTACTTTGATGCGTTTTGGTAAAGTATGATGACTTAATCATCCAGTTTA
CTTGTCTGCCCTTTGGACCACTATGTGTTTGGTCCCCAGAGTTCTAATTAGAAGATCACGAAGACCTTCAACTTGTGGGATTCTGATTTTTCAATTGTTT
GTGTCAAATGTAAATAAGCAGAAGTTTTTTTTTTCCAGATTTTGTTTGATGCTGATAAGTCAGAAATTAGAGACCTGCATGTTTGTAAGTTTCCCCCATC
CATTTTTTGACATACAGTGTAGATGAAGCTCTTCATTGATTATCAGTTAGTTGTAAATCTTTTTTTTTTTTTTTCTTTTATAGAGAAGGAGAAAATCTCG
TTTCTTCCTACTACCCAGAATTTTATATGTTCATATACAATCTTCTCCCTAAAACTTGAATATTTCTCCATATGTGATCTTATAGTTCGTACTACTTTAT
GCCCTTTTTTTAGTTAGAGATTTTCATCTTTACAAATAAAAATCTTGGAAAAGTTATTTGTTATTGTAATTGGTCACGAGAAATCACTTTACTATATGTT
TTTGAGTTAGATTGTACATCCTTAATGAACTAATCAAGCTCTTGTTTCAGTAAAAGCTATAATCATACATAGGTTTATGAGGGATCATTGTACTGATTAA
TAGGGCTGTTCATCGTTATGGTTAAACAATAGAATTGTAATTCAAACTAAATCGATATTTGGTTTGATTTGGTTTTAAAATTTTAAAAATCGATACTATT
TGGTTTGGTTTTGGTTTTACAAAAGCAACTGCAAAAATAACCAAAGAAAATCGATAAATTAGAAATGTAAATTTTATAATTATTTATAAATAACTATAAG
GAAAAAAAGGGTATGATATACCCATCAACTTTGTTATTTAGAGCTGATATATCTCTTGTTATGAATGTGGCTCATATATACCTCTACTTATAAACAAATC
GCTCACATATACCTTTTTTCTCTAATGGAAATGGGAAAAAAATTAATATAACTTTTTATTTTTTTTTTCTAAAAAATATAGTCCATATGAGTAAATTTAA
TCCTCGTCAAACATATTTTTTTAATTTCAATAGCTAATTCAGAATTATTATTTTCATAATCAAATTTATTTATGTTTCACTAATATTCTTGTAAAACTTA
TTGTAAATGGACCAAATTTTTTTCTTCGAATTACAAATATAGACAAAAAAATAGTTTAAATTTTTTTCTTTAAACTAAGGAATGAAAGAAAAAAAAAAGA
ATAAGAAACTCAAATAATTATAATAAAAAAATAATTTATGTATGAAAAAAATTAAAATATACCTTGAACATTGATAGAAGGATCATATATTCCCCTAAAT
AATTTTTTTCAAAAAATTAGAAGTAATAAATATAAATTTAAAACTAATTTTTTTAACTTCCATTAAATAAAGGATATATGTGAGCCATTTTGTAACGGCA
TGGGTATATGTGAGCCGTTTGTATAACAATAACGGCATAGATGAGCCACTTTCGTAACGAGAGATATATTAGCTCCAAGTGACAAAGTTGAGGAATATAT
CAAACTCTTTTCCCTAAATATAAATACTTTGTTAAATTTAAGTAACTTTAAGTCTTTAACTTTACATTTTTCTCAAGTCTAAAACTTAAATTTTAGTCCA
ATTACAATCTTAAGTCCAATTCTATCAAAATTTATTACCTATCATATCTTTCATAAGATAGTTACACACTCTCTTAATTTAACAACTTTGCTCGTGTAAT
GATAACTCTAATATTGCTTAATTGAACAAACAATACCTTTTATATCGATTTTTCGTGTATTAGATGTTTTTTAAATCAAAATATGTATGTCGTCAAAAAT
TTATTATTTTCAAATTAAAAAAAAACAGAAAAACTGAATCAAAACAAACCAAATCGATGGTTATTTTTTTCATTTGATTTGATTTGAGTTTATAAATTTA
AAAACCAACTAAATTAATTTAATTTTAATTTTAACCAATAATCAATCCAAACCGAATTACTAATACCCCTACTGATTAATGCAGTAAAGTGATAAAAATT
AGAAGTATTGTATCTTTTTATTATGTAAAGAGCTCTTTTTTTTTTTGGTAAAAAATTTAAAAGAGCTCAATGTCATACTACACTTCAAAATTATAAATAT
GATGAATTCACCAAACTACAAACTATCATACCATTTTATTTTGATTTTCATAAACAAAGTTCATATACATTATAAGAAATCTTATCCTATTTTATAGACC
TAATTTAGCTAGCGTTTGGTTATAGATTTCCAAATATTCTTGACAAATATTATTTGAGTGAAAATTTGGGTGAAATTTCACCACGTGTTTGGCCATAAAA
TTTGGGAAATATATTTCACCTTTTTAGAAAAATATGATTTATACACACAAGTTTTAAAAACTATCAAAACTAACTAAAAGTTTGTATTACAAGTCAATTG
AATGTTAGTTACAACAATAACAAATAATGTCCATGACAATGAAGCAATGTGATAATTTGGAGTGAGTGCAACAAGAATTATTCCATACATCGTGAAGTAG
ATAAAGTACATGACTTTATTACCTAAAGCTAATTTTTAATAATTTTCATCAACAATCATATCATTATTTAATATTCACTAAATATTTCATCACTATTTTG
GTGTTCACGTAAAAAATGATGTAATACAACGCAAGCAACTACTAGAGAGGTGTTTTTGTAAAAGATAAAAAATTGGGGTAAAATTTTAATTTTTAAAATA
TCCCAAATAATGATATTTGGTCCAAATACTAGAAAAAACTAGTATTTGGAAATTTGAATATTTGCCAAAAAAATATTTGCTAAATAATGACAAATTATAT
GGACAAACATTATTTGTCAAATTTTTCTCAAATATTATTTGAAAAATTTATGGCCACACGGCCCTTAGATTTTTTTTCCCCACAACCTATCAGAATTAAA
AATATTTTAAAATTTTAAAACGCTGTAGAAATAATAAATAGAAATTTCTTCAAAAGTTTCCCTATTATAAAATATAAAATAATTGTTTTCTCACTTTATA
AAATTTCCCCGCTTCCAACCAAATATATGGCGGCAAATTTAACTGAATCGTCAGTTTTTCCCTCGGGAATTAGAAGTTAAACATTTTCCCGCCAGTAAAA
AATCAAATGAATAATTTCGCCAAAATACAAAAACAAATCCCCGCCAAAAACTGTCAAGTACAAAACCCCCACTTCTCTTTCATTCTTTTACTTCATTTCT
CAACAATTTTCTCTCTGCATTTCTTTGCCTTTAACCTTCTCAGAGAGAGAGAGAGAAACAATGGCGAAAATGGTCAGCCCAGATGCTATTTCAACTATTT
TAGCGAACCCATCGCCGGATTCTTCTTCAGATCTTCCTGAAATTATTGTTCAAGTAGTGGATCTCAAGCCCACTGGCAACAGATACATGTGAGTCTGCTT
TTCATTTTGAGTTGGTTTAATCGATAAGGAACTTGTATATTTTATTCAGATCTATTCGTTTATCCAAAAGCTTTTGCATATGTTACTGTACAGGATTTGT
TTGTGTAGAAGTGAGGGTAGCTTCTTTGATTTAAATCGATTGAATGAGTTTGTTAGCTTGTTGCTTTCCATTAGGGGGATGCACTTGAAATGGTGGATTG
TTCATTATACAGGTTTAGGGTTTCTCACATGGCTTAGCTGAGTCTCATGTGTGGTTTTCTTATGTTGTAGGTCTTTAATCATTAAGGGAAATCTTATTGT
AAATATATCATTTGCAGGTTTTCAGCCAATGATGGGAAAATGAAGATTAAGGGGATTCTTCAATCTAGTTTGTCATCTGAAGTTATATCTGGGTCTATAC
AGAACCTGGGTCTTATTCGGGTTATTGATTACACCCTCAATGATATCCCAACTAAGAATGAGAAGTGAGTATCTTTATAATGATTAATGTTATGTTTATT
TGTATTGAAGGTTTATATTTGATACTAATGAGTTGATTAATTTGATTTAGGTACTTGATTGTAACTAAATGTGAGGCAGTGTCTCCTGCTCTTGAAGTTG
AGTACAAGGCTGAAGTGAAAAGTGAAGACACTGGCATTGTCTTGAAGCCAAGGCAGGAAGAGACTGGGATTGTTTTGAAACCTAAACAGGAATATCAAAC
TAAATCTGCTGCTCAAATTGTACATGAACAAAGTGGAAAGTGAGTTTTTCTGGTCATTTTTATTTTTCCTGGCTTGTTAGCAGATGATATGTTGTGATAT
GGATGTACTGATAAAGTTAATTGTGTTATATGTGGGTGATATTTCAGCATGGCACCGACTGCTCGAATGGCAATGACAAGAAGAATTCAGCCACTTGTCT
CTTTGAACCCTTACCAAGGAAATTGGACCATTAAGGTTCGAGTAACTAGCAAGGGTAATATGCGAACCTACAAGAATGCTCGTGGAGAAGGCTGTGTGTT
CAATGTTGAATTGACTGATGAGGATGTAAGCACATTTTCATTCTCAGTGATGAAGTTTTTTTTATTTGATTGACTGTGTAACTAACAAAGATTTACCTTT
TATTACAGGGTACCCAAATACAAGCTACAATGTTTAATGAAGCTGCAAAGAAGTTTTTTGACAAGTTTGAATTGGGGAAAGTATATTACATTTCAAAGGG
AACTCTTCGAGTTGCCAACAAGCAATTCAAAACTGTACAAAATGATTATGAGATGACTTTGAATGAAAATTCCCAAGTTGAGGAGGCTAGCAATGAAGAA
GCTTTTATTCCAGAGATAAAGTTTAACTTTGTCCCAATTGATGAATTGGGCCCTTATGTCAATGGCAGGGAGCTTGTTGGTAAGAACTTGTGAACCCATA
GCTTGAATTATTTGTGCTGCATTTTCATACCCTTTGACCATGGAGTAATGTTTTCAAACAATGAATTGTAGATGTTATTGGGGTGGTCCAAAGTGTATCT
CCAACAATGAGCATACGGAGGAAGAGTAACAATGAGACAGTCCCAAAGCGTGATATAACTATTGCAGATGAGACGTATGTTTAAATACTGTCAACAACCT
ATATTGTAGGTTTTGGCTTTCTCTAGCAATGTGAAGTTAACATCTTATACTTTTCTGTATCAGGAAGAAGACTGTTGTTGTTTCTCTTTGGAATGATCTT
GCCACCCATGTTGGACAAGAACTGCTAGACATGGCTGATAAATCTCCTGTAGTTGCAATCAAATCCCTTAAAGTTGGAGACTTCCAAGGTGATTGCTTCA
TTTCATACAACAAAAGTTGTTCTATATGCATGATATCTTCATCGTCCCAATCTCATAGTTCCTTAAATTGTGTTTCAGGATTGTCTTTATCAGCATTAAG
CAAAAGCAATATTGTTGTGAATCCTGATTTACCCGAAGCCAAAAAATTGAGATCTTGGTATGACTTGACTTAATGGGGTAATTGATTTTCAGTTGACATA
TCAATTGACTAAAGGCCACACTTTTATTTTTGTTCAGGTATGATTCTGAAGGTAAAGAAACTTCATTGGCATCTATTGGTTCTGGGATGAGCCCTTCTAC
CAAGAGTGGAGCAAGATCTATGTATACTGATAGGGTTTCCTTGCTTCATATAACCAGTAACCTGTCCCTTGGTGAGGAGAAGGTATATATACTTAACCCT
GTTTGAGGATAATGAACTTGATTTCGAGAGCAATGTTGATGCTATGTTCTTCAGAAGATGAAGCTTATTGTACTGAGAAAATAGCACTCATTAATACATA
GAACTATATGTTACATTATTGTATTAAATTGTTTTTTCTGTTTGGCAGCCTGTCTTTTTCAGCTTGAAAGCATACATAAGTTTCATTAAGCCTGATCAAA
CCATGTGGTATCGGGCTTGCAAGACATGCAACAAGAAAGTTACTGAAGCTTTTGGGTCTGGATATTGGTGTGAAGGATGCCAGAAGAATGATGCAGAGTG
CAGTTTGAGGTGAACATTGGATATATAGTCATCTTAAAACCTCTCATTAACCTATAATGCCTACTTATGTCTTTACCTTTATTTGTCTACCACAGATATA
TAATGGCATTGAGAGTGTCTGATGCAAGTGGTGAAGCATGGCTCTCTACATTCAATGATCAAGCAGAGAAAATACTTGGATGCTCTGCTGATGAACTTGA
CAAGCTGAAATCAGAGGTAAAACAGTTCATACAACTTCTCTTTTTTGTGCTTATTGTATGTCTTGACAGTTTGTGGTCAACTTATCTGAATGTTCCTGTT
TCTCAGGAAGGAGAAACTGCATATCAAATGAAATTGAAAGAAGCTACATGGGTTCCTCACCTTTTCCGGGTCAGTGTTGCACAACAAGAATACAACAATG
AGAAAAGGCAAAGGATAACAGTCAGAGCTATTGCTCCAGTTGATTATGAAGCAGAATCCAAATACTTGCTGGAAGAAATGTCTAAGATGAACATTGCTAT
TTAATGAGGCTAGCCTAACATAGAATATTTTTAGATTTATTTTTGTTATATTTAAGTCTGAATGCTCACTAGGATTCGTTAGTAAAACAGCTGTATATAT
GTCTCATTGCCTTTGCTTAATAGCAATTCAGCATTTTGCATTTTAGTGAATGCACCTTTTGCAGTTTATCATATTTTGTTATGTATTCACTATTTAATGA
TGGTTCTACATTTTATCTAATGGAGCATTTCAATTCTTGTGATCACATCCATGATCAGTTCATTTATTTGTTTATTTTGTGTACTGAAGGAACTTTGCAT
GGTCATACTTGATAAGACATACTTGTGATCACATCCATGATCAGTTCATTTATTTGTTTATTTTGTGTACTGAAGGAACTTTGCATGGTCATACTTGATA
AGACTAGGGACTTGGGTTGCAGCATTTCTCTGAAATCCTTTCAGTTGGATCTTCAATATTGGATTGTTTACCAAATTTATTATGCATACTACTATAAATC
AAGAATCATCTGAAGAAGTTTACATAATCTGATTGATCATAAAGTTTTTTTCTCCTTTATTAAATAAAAGACAGCTTTTTAAGCTTTAGTTGTGAAGTTG
AGATTGGCACATGCAGTTTGGTGTAACAAAAGGGATGAGCTAAAACCAAGTGTTGATCTAGCAAGATCAAACTGTAGAAGATTGTCCTCAAGTTGATATC
CTCCTATAACTATTGAAGCAGTACGTTTAATCCCTCCATTCACAAATCCTAAGCAGATCACATCTTGGCTAACTTTCACCATTGAATTTGCGCCAAAAAT
CCTCCAATAAACTCGTGTAGTCTGCAACACAAGATCAATGGTAGGAACAGCTGGTCCAACCCTTGTGCTACCAACACTTTTTGAGCTGAAACATATCTCG
AAAGGTGCCACAGCAGCCACTCTGGTTGCATTAGATAACTCATCGATGAATGCTTTAGTCACAACATCATAGATGGAAGTTTCCAACATTGAATAAGGAG
TTCCTGTGCTTATTTTGGTTCCACCATTTCCGTTCTTGTCAACCCCAAGCAATTTTTTGTTAATTGTCACTGGTTTGGCATTGACTCTAATAGATTTCAC
TCCAATGTAGTACTCTGAGGAAGGTTCATTCAGTGAAGGAACAGATCCAGTACCAAAAGGGTTGGTGATCAACGGCGTAATGATGAGATCTTTTGAGATA
TCAATATTTGGAAGCATCATGCCATCACCAAAAAATATGACACCAGAGGATTGTGTGGATGAACTCAAACAAACAGTAAATTTTCGTGTAAAGCTGAAGA
TTTCAGCTAATTGGGAAGGAAGCGCGATACGATTCCTTCCCAATCCAACTGTACCTTTCACCTCACTAGCTAAACCATCAGTCAAGAATGTAGGAGCACA
AGTGAAAATGAAATTTGGGATCTTGACAAACTTACCAGGATTTGATCCATCAGTGGATTGAATCGATAATACATCTTCGTTAAGTTGTCCACCACTATAT
AAAGTCTTGATGAATGGATTCTCAGGGGTGTTGTAACATGCATTATCGTTGCAGCCAATCTTGGGAGCACTGGTGCTGCAGTTTCCACAAGTGTCAACTT
TGGCAATGGTACATTGAGTTGAGCCACAAAGAAGCGGTTGATAAGTGGAACTCACATAACCATTCTCACAGTCTACCCATAAAGTTTGTCCACCAAGATG
AATGGTTAACTTGATAGGCACAAGAGGAGTTCTTTGACCAATTTGTGTGATGTATTGGAGAGTAGATGAGTCTTTTTTCACAGGAAGGATGAAAGCTTCG
GTCTGAGGAGAAGTTTGGCCTATGCAATAAGAAGAAATGGAGAGGAGAAGTGAACAAAAGAGGATGGAATGATAGGTAGTGAAAGCCATGATACAAGATT
AAGATGTGATGTGGTAGTATGGAATTGTGAAGATTATTCATATTTTGTTTTATAGAAGGATTGTTCTCAAGTCAACTACATTGTTTATTTAAATCAGTCA
ATGATTTGGGAATGGATATGATTATGACAGAGATAGATATTGAAGAAAAAGTCAGCAAATTAGCATACAGCTATGTAGTTTGACATTTCACCTACAGCTA
CAAACTACTGATGTCGACATAAGTGAAATACATTTCAAACCTAGCTTCAATTTTCAAATACGCCACGACAGGCTACTACGCTCAGTGATAGAGTGCACCA
ACTCGAGCAAATTACTGTTAAAGCAGATGTAAAAGTGCACCTTCCTTAAGAGCCTGTAGCCCCTTTTGAAAGACGTAAGGCTACAAACGAACATAGCTGA
ATGGTAATTTTGGCACTTAAACAATCCGATGCACGTTCACATATCAAACGAAGTGCCGAATAGTGTCACTGCCAATGTAAGGAGTGTTTCCAGGGCGGTT
AATAACCAGCATTATTGCTGCAACCTGGACCAGGGATGTGAAATGTGAGATTTTGGTACATGATCAATAACCGGTAGTTCTGTTCAGAGTCCATCAAACA
AAAAATTGACAAAAAATCACGAATAATATGGCTCAATTTATTGGTCCTTTGTTTTTTTCATTCTGCTCTTTCATTTCCATGTCACAAACATATAAATAGC
CAGAAATTTCAAGTACTTAGGGCATCAAAACACAAGATGAAAAAGCTGTCCTAGACAATTGAAGATAAGCTACAGTTTCTAGTTCATAATATTTCATACT
TCCATAAAATGGGGGGGGGGGGGGGGAGGGGAAGGCAGAGATTAGGTCTTCATCCGACTTGAATCTGAGGCTGAGAATGAATATCAATCGTCCTTCAGAT
AGCCATGAGATCCCCATACTGGCGCATCAAAATGATGGACCCAGCAAATAGAGCAGTAGCTCGAAGCAGTTTCTGCAAAAGCAAAGTGCAAAAAAGATTA
AGGTAATCTCTATTAAACCCAGAAAATGAGAACATTGATCATATCATACACAACCAAGAGTCTGAAAAAAAATTCACAGGTATGAATCTCTCTCAATATA
TCTAATCATGAAAAAACAAGTTACATTTTTTATACACACATGTTTACATATAAATAAAACACAAAAATCTAAACCAAATATGTAACCAACCTATAATTCT
CTACCATAGTTTTAGTCAAGCAGCCAAATCAGATCCATATCCCACACTCACGCCTAAATCATGTTGGGTCAACATGAGTGTGACACGTGGTCTTGAGGTA
TCTGGGCCACATAGATATGTGACGCAATGATTCAAAAATTATACCAACCACTGTGCCGTTGTTCCTTAGGAGTTATCTCATCAAACAAATAGTTATTTAT
TGTAACATAGATCAGGGTTTCGCCAACATAAACCTAGTAGCTTAGCATTGTCCTAAGCGTTTAGGTCCAACCTGCTACATGGCAGTGTAGCTTAGCACTA
TGCAGAATTTCTCTTTCCATTGATACCCCAAAACACATTGATTACAAGGATTTTTCTTTCATTCGCTGATAAATATCTCTCCCACAGTGAAATCATCTCT
AGCCACCTTTTTTGCCTCCAATTCCTTGTAGCCTAGAGAAATATCTATTTTTGCAACACCTTTTCCTACTGCTGCAATCTTCAATCACCTACTACATGGT
CATAATAGGTTATCAATGCACCCAGCCTGTAGTTTCCTTAAATGTCCTAACATCTTATTTAAGAAGTGTTAAGAGTACGAGGGACTTTTTTATTGTTCCA
CCAAAAATCTATACCCAATTCCCCTTCCTCCTTTTTACTTTATTCACTGTCTGACTCAACCCTATACCAAAGCTCTTCCCATCAGTAATTGTTGCCTATC
AATTCAAAAGTTAAAGCTTCTGCAACCCATATTTGACAGAATTTATTGCTTCTCATAGAAAATCATAGCCATAAGTCTTTGTTTCTGGCATATGCAATAC
AATAACCTTCTTCTCACGAAAGATTTGATTGTTATTTCTGTTCAGGCTTATCACCTTGTTATAAGTTTACAACAAAATACTCTTATACTCCATTAATAAT
GCTTCGTTTTGCTAGTTGAAGAAGAGAAATGCCCGCACAATTTTAGTTTGGCAATCAAAGAAATGCAGGGACAGGAACTTTTTACAGAAACAAAAAGATG
ACTTCTACATATGCTAAAGAAGATGAATGTTTTCCTCTCTGCCATTTCATGATCTTTACGTTTCACATTTGAATTTATCCTAATTTGAATTCCTCTCACA
TCAACATGGTTATAGTAGGTTAGCAAAACACATATATGCATGCATAAGTTCAGTGAGTCATTGTTACAGAGGATTTAAACAATAAAAACACACTAAAGAT
ATATATTTACACAAAACAATAAAGAACAAAAGTAAAAGATTCTATGCTTATGTGTTTTGAGAAACATGTAATCAGAATTAACAAGTTAATTCTAGAAATC
AAACTGAAATTTTATTGAATTTACTTATTAATTCTAGTAACACTGTTTAAGAAAAAAACATATAAGATCCATTCTTCTGAATATTTCGCTTAGGCAGCAA
AACAATCAAATTGTCAATCACATTTTCAGCCAAAATATTTCTAATCCTAACTCAAATCTCTTAAGATCCAATTATAACGCGCTTAACTCGTTGTTCATTA
CTATAACGAGTATAATCGGCCATAAAATCCACAACAGAAGAAAACAAAACAACGAACGAAGCAAAATTTTCTCTGGTTACTGATTTTAATGAATAACGTG
TATCTAGAAAAAGAGATAAAATCATGAAAAGGAGATACCTTGTTGAGATTCCATTTCTCTTCGTCATGAACCTGAGAGTGCCAGAAAGCTTTGACCTTGT
CAACTGATATCACAGAGTCCGCCATTGAAGCTAGTCGAGAGAAGGAGAGTACGACTGAGAGGAGGAGCAAAAATCTCTAAGGGGTTAGGGTTTTAGCATT
AGGGCCTTGCAGGTTTTATTCTAGGCAATTTGATACAATCGGGTTCTCTTCACCCACAAGGGCATTTTAGGTTTTTTCTTTCTATTTCAAAATTCCTTCA
TAATGTACTCGTTTTTTTTATAATTTTTCCTTTTTAAGTTTTACCATAGTATTTTATTTGAGTAGTCCTATTTAATTAAATAATTTATTTATATTTATAA
CTATTTAATAAGTGAAAAATTTACAGTATTTCATAAATTTAATATTATGTATTTTCTCTATCCAAAGATAGTTGTGCTATTTGTTTGATTTCATTCAACT
AAAATTGAGTTTGAATTGCTTTATATATGATCGAGAGGGTTTTTATTCGTAATTACGTGTTATTTTTGGAATTTATGCTTTCTTCCCCTTCATTCTTCGT
TGATGATCTTTTACTATATTAATCTAAAATTATAAATCTATTATGAATACTAAAAGATTTTTCGTAATTTTAAATTAATTTTATTATTTTCTATCAATTT
CACCAAAATAAGTGATATCTACGAGTATTTGGCTCTCCATTGATTATTTTATTGATTAATACTTATTACTAATAAATAATTTTATATTTTTCCAAACTAT
CGAACAATTATGAGACAAGTTTGAATTTATCGAAAGGATTAATTTGAAAGATTAATTAAAAGAATTTCCATGGAGGCAAGTGAGTGGAGGAGGCAAGCAC
GCATAGGACCAGTATATATCCAACCAGGAAGTGCCACGTGGAATATCTAGCGGCTAGAATTTGATCAGACATTTCATGCTATCTTCTCCGGGGTGTGGCC
TCACAAAAATGGGAACTTGCTTTAGCTTTCAACTCTTTTAGCACAAATAATTGAACCACTGAAAAAGAAGAAGATGATGATGATGGACGGCGCCGTTGCG
ATTTCACGTTTCTCTGCTTCAAACGCACCACTTCTCATCCGATCCATGGCTACGCAAAAACCAACTCCATCCACTAGTAAAAAGGTTTGATTTTTTATCT
ACTTCACTGCATTATATCTCAACATTTTACATAATTAGTAATGCAAATTGTGGGTGGGAGGGGATTTACAAAGTGGGAAATCGATTATCCCTAGCAAGAT
GAAAGTTCAGATAGATCAATCAACTGAGCTATTAAAATTCTCTGATGTTTCACGGGTCGAATTTGTAACCTGATTGATCATTGTATAGGTTGCTAAGAAA
AATAATTTTATTCAATTTTTGGGGTATCAAAGGGGCGAATGAAAAAGAGATGTAACTCAAGTTCCTTTGGAAATAGGTAGAACAGTCTTATTTCGGTTGA
TCATTGACAGTTACTCTTAGTTAAAATCCAGAGATGGTCATTATCTCAGAAACTTTACTTTCTTTGTTGAAGAAAATTGGAATCATGAAGAAATGTGTGA
GTTGAGAAATGGACCTGCCATTTCTATACATCCAGTGTACTCTATGGACAGAGGAATATGCACATACGATGAAAATTCATTTGTGTTTTAACATTTACTG
CAGACAACAACTGTATTTCCAGTAGGGGAGAAACCTAGGCCGGGCAATTCTTCGTCTACACCACCAGTGAAGTTATTGACAAGAGTGGAGCAACTGCGAC
TGTTAACTAAAGCAGAGAAAGCTGGTTTACTATCAGCTGCTGAGAAATCTGGACTCTCTTTATCGACAATTGAAAGACTTGGTCTTCTTTCAAAAGCCGA
AGAATTGGGGATTCTTTCAGCAGCTACTGACCCTTCAACTCCATCAGCACTCTTCAGTTTGAGTTTGGGATTGTTGGCTGTGGGTCCTGTTTGTGTGTAT
CTGGTGCCGGAAGATTACCCTTGGCAAATCGGTTTGCAAGTTGTGGTTGCTCTACTTTCTGTTGTTGGTGGCTCTGCAGCTTTTGGAGCCTCAAATCTTG
TTTCCACTTTGCAGAAAGTAAATTGAAATGTAAGCTGAAAAATACTTTCTCTGTTAGAAAATTTCTATTATATATAGTATAAATGTTAATTTTGCTCAAT
CTTGATTATTTTTTGTTGATCCCTTGCAATCTTAGATATACACTGTCCTTCCTGGTTGTGCATTGAGTCATTACGACATAGTCCTTGTCTGGATAAAGAA
TCTTGATCTGCAGTTTTCATTTCAGATCAAGATGATAACTAGCTCCGATACATCTTTGGATCTATCGTATACTTATTGTGGTACGGTGTGTGAACTAATT
GTAGTGACAGTTAAATTGTATGACTACAGAACATCAGTTTAGTTGCTCCTTCCTAGAGTTTAATATAATTATCATTGTCCAGCAGGAAACTTAGATGAGC
ATGGAGCACGAATAGCTGAGGTTAAAACCCAAGGCAATACTCTTTTATCATATCTTGATTTGTGCATGGGCCATGTCAATCTTCTCTGTATCGTTTCAGT
TTTATCGAGTGTCCAAGATCGGATGCAAAACTCTTAGTACACATAAAAGGAAATTGCTAATACACGTGTATATCTTTTGAAAGACACTGTGAAACACTTG
AATCTTGATGAACTTTGCCAACTTGTTGGGGATAATGCTGTACAATATAACTGCACTGTTCTGTGAAGGGCTCAGAAACTTAGACGTATTTTAGTTTTTT
TTTTGCACTGCCATGATGCTATCTATGTTATATTAATGAACATATCTTCTATGCATCAGACCAAAATGGGATTAGAAGACTATTGAACAGTCTTTTGATT
TATACAAATGGTTTGTCAACTAATCTGGATGTTATTGTAATTCCGGAATCTGGTGAGATTGCATGAGTTGAGAACATCAGTGTTGTTGCTCTTCTATAGA
CTCAAACATAGGCCAATATGTATGTGATAATGACAATGACAATCCTGGTGTGTCAAGTGAGTAGTTTCTGACTCTCTAAAGACCAAATTAACAATCATCA
TCCATGAATCAACTCACTGAATGTGGAGTGCGTGAATATATACCTGAGGTTGTCACCATTATTCCTATAGTTATCTGGTCTAGATAACTATAGGAATATA
TACATTTGAATGGGAATTGCTGAATGCTGATACACATTCACGTCTTTCAGAAGTCGGAGGGTCCTTTAGTTCTAGCCGCGATTCTTTAACACACTTGAAT
CTTAGATAAATTTCGCAAACTAGCTGTGGAGACTGATACTGTGCAATGTTAACTATACTGTTCTTTTCTGTTCTGTTCTGTTGTGTGATGGCATCATCTT
TCTAGTTTGATAGTCAAATACTCTTATTTGGAATCTTATAGTCTTGACAAAACATTGACATTTTGAATTTTGATCACAATGCTATAGCTCCACTAGTGTT
GAACAATATTGATTATTTCAGTACCGACTAAAAAATGAAAAAGTATACCAGAAATGAGAGAGAGAATAGTCTTCATACACGTCAAATCAGTTAATTATTT
AAACTTTCATTTTTTTCTCGATGAGCGTACCTTTCACTATCCCCTATGATTAAAAAAAAAATAGTCTTTATTACTTTACCAAGGATTGTATTTAGAGATG
CACTCTAAATTAAGAAGGACAAGGAAATTAGAATATTGAGGGTTGGAATTGAGACTATACGTCCAAACAAAAAAAGGTTTTTTTTTTTCGTCCATCTCGA
AAATAATAGTTTTTACTCGCATATCAAATTCAACAAAAAAAATATTACTTTTCTTTATACTGAACACACCTATTAATTAACGCTTTGATATGACGCCGCG
ATTCAACCAAAGGAGCTAACGCACCCTATTATTCCTATAGTTATCTAGACTAGATGTAATAAATGCAATGATCAAAATCACAATTAGCTAACTCAAAAGT
CTTGATTGTCATTTGTAATTATTTGGTATGTTCTCAACAAGCAAGATAGACAATTAGTCTTAACATATGATTAGGACCAAATTTTCATGTGTCCAAAGAT
GTATATAACAAAGTACAACGACATTAGCCTTTTTGATCTTGATTATCTACTAATCAACATTTTAATTATGCTATGGGTGATCTAGTCATCTATTGTGAGG
TGAAAGTCGTAACCTTTAAACAATTAATAGGTTCTAGATGATTAAAAGTCATAATCTATCTTAGCTTAAGTAATTGTCATGAGATTAATTTGAATTCAAA
TTTTATCTTTTCTTTTAATACATAATGAATACGCACGTAATTTTCTTCTAAGAAAAGTATGATCAAATAAAACTTCTAGATTCAGCACAAGTTGCAAATG
TTATATGGTAAACGTAAAATTTTGAAATAATCATCCCGTCAATTTCTATATACCTCGACTAATTACGAGATATCCAAGACTTTCGTCACTAATCATCAAA
GCATTTTTTACAATATAATATTAAAAACTTGCTCTCCTTCATAATTTAACTTTTTAATTGTGAATTGTAATACTTTTATGAATCTTTTAAGCTCATCAAT
GATTACTAGACCATTACAATACATATATAATGATGTATATTAAATAGATAATTATATAGGTTGAGATCTAACTCATTAAAATTCATATATAATCATGTAA
TTGTATATACTAACTCAATCATTACATAAAATGAGATACAAGTAATTAAAATACATATAAAGTGAGAGAAAAGACATAAATTTACTCCTAAATTGTATCG
AAAAGTCAGTTACACATTGAAACTATTAAGATTACCTATTACACACTTATACTACTCAAAAGTGAATTTAATATCACCCTCAAAGCTGACATGAAAATAA
AATTAAATAAAAAATAAATAAAGTGCGTTTGAGTAGAAAAAAAAAGATTTCCACCCCTACTCTTTTCCTTCACGTTACCTTACTTTTCTTCTTCCTCCAT
TTTTTTTTGTTATCACAAAGACTCTTTTTGCTATGGCTAATGTGAAAAATAATATTTTTATGATAAATTTCTAAGAGATAATTAGAAAACAATATTGCGG
GATATAATTTCATTGTAAAGATCGTGAAGTTTTTCAATTGATTAGGTTCACTGTTGGAAAAAAATTTCGTCGAGACATTTAAAATTGATCAATCCTTACT
ATTTCCACATCAAATTCGTCAAATCAAGTCCAGATTATTTAATTTATTTTTTTTATTTTTTTTATTGATTGTGAGCATTAAAAATAAGAAAATTTTCAAA
TCTTGTTTTTTTTTCTTGAAAAAAGTTTTTAGAGTTTAGCATAGAAAATCAATTTTTAAATATATATTCGTAGATCTTTCTTCTCTCTCAGAAAAATTAT
CTCTAGGTTTTCTTGAAAATCAGTAGTAGTAAATGGAGCACTAGTTTTTCAATGTTTGACTAAAATCTTTGCAAAACAAATATTGCAAGTTTTCACAATT
CTCCTCTTTATGCTCGAATGAAATTTGTATATAGTATTAATTTTTTGTGTTGGATTTGGTGATGAGTAAAAAATTAGTGGTAGTATGAATATTAATTTCG
ATAATGACAATGAAACTCGTGATTTTGATGTGAATGGTGAATTTATAGTTACGTTTGTGATAAATTTCAATGACAGTGATATGGTTCCAATGGTCAATTC
AGTTAAATTTATGATGTTCGTTATCGATTTTGATGACAATAGTTATGAAAAGATTTCAGTAGTAAATTTGATTATGGATGATGAAATCTATGGTGGTGGA
GAAGTGGAATAGCATCAACGACAGTGATTTAATGGTGGGTTTGATGGTGAATATGAAAGAAAAAAGAAATTGGACGACATAAAAAAATCCGATATAATTA
TAAATGTGACAGTGACATGGTGATAATGGCGCGTGTGTGAAACACTCTCATCATGTAACTGATCGTATGTGCATCAATATTGAAAGAAATTGACTTTTAA
GTAATTCAAATATGTAATAGATCGTCATAATAGTATAACCGTGATAAATTGAAATGGATTGTTACATTAACTGAGAGAATGTAATGGACCTATTGGTAGT
TGTTGGCTTTTTTTTCTTTCTGTTTTTCTTCTTGTTGAGTAATAGTGTGCATTATTGGAAGCATGCATTTATCATTAAATTCATCACGTCTGCCTTCCTT
TTGCATTTTTTGTTTTTGTTTTTGTTTTTGTGAATAGAAAGGAAAAGAAAGTAAGTGTGTCAGTGTGGGGAAGGGGAACTTATGTGTATTGGGATCTGAA
AATAACAGTTTCAATTGAAAGTGACACTACATATATAAGATCCCCAAATCCTTACTTTCTTTTAACACTACTGCATGCTCTCTAGTCTCTTCTCATCTTT
AATTCCTTATTTGATTATTTTCATTTATTTTTATTGGTTCGGTATTAATTTTATTATAAATAAAAATGATGTTTTTATTATATCTCTTTTGGATGTGTTA
ATTTTGATGTTTTGGAAAATGTATAAAAAATGACTATAAATTAAGAAGTAAGAGCTTGTTTGGTACGAGAGACCATAAGAAATAATTAATCTTAGAATGA
ATTTGTTTTTATATTTGGTTCTGATTAAATTATGGAATAACTTATCACGAAATTATAATGTTTTTTTTTTATCCCATATCAAAGCTTGGAATGACAATTT
CAAAATAACTTATTCTCAATCAATGAGCTCGTGATAAAGTGAAAATTGAACCGAGAGAGTAGTTGAGGAAAAGCATTAATTGCCTCTCCGGCAATTAGAG
GGTGGGACTGGTTTGCAGACTGAAAATGTTTCTCAATTTAGAAATGACTTTCAATAATTTTATTAAGTATTGAAAGGGTTTTAAATAACAAACATAAAAT
ATATAATCTGCATAAAATGAAATTTAAACAACCTAAAATATCTCAACAACATAAATAAACTATCTAAAATTTAAATTTATTTAAACTAAATAACTTATTT
TGGTAAAAGTTATGCAATAACTAAAAGCAATCTTCAACACTCCTTTGCTTTAGTTATTGCAATTTTTTTTTAAAAATAACCCTTCTCAATTTTTGCTTTG
ATACTTGATGCTAAAAAAATTTCATTATTCTTTAACTTGCAAAATTTCTTTTTTTTTTTCATTTGGTTTTGTTTTTTAAAAAATACATGTGATGATATTG
TCTTATGTAAAAGTTTTTTTGAAATTGTTTTAATCTGAACTTTTGTATAATTTGTAGAGAGATTGTAAGGGTTTTTCTTTCGTCACAACCTCACATATCA
CATAGATTTCAAAATATAATTTTATTCTCACACTAAATTTGATAGTTTTTGTATGTGAAAATTTGTGGGGCATGCTTGCCATTATTTTGGTTTAAAAATG
ATTCAAAAAAAAGTACGTGCTTTGAGAAAAGCACGGGTTAAAAAGGTAGCCTTGCTGGGTTAAAATGAATAGTCTTCATGGGTTAAAAAGGTTGTCCTTA
CAGGTTAAAAATGTATGATAGTTCTTTGAAAGATTTCAAAAATCACTTAAGATCAATGAAGTTTTGATACCATTGTTAGTGTTTTTCTAAAAGATGGGGC
ACCACAAAATGATTGAAAATGTTTCTTAGGATTGAAATAGTTAATATAAAATATATAACCTGCATAATTTAAAATTTAAACAATCTGAAATATCTCAACA
ACGTAAACAAACTAACTGAAATTCAAAATTCAAATTTATTTAAACTAAATAACTTATTTTGCTAAAAGTTACTGCAGCAAACTTCAACAGTTAATTATTC
TTTTTTCGTTTTAATTTGTTTGATGCTTAAGAAGCTAAAGAAATTTTTTGAGTGTTATTGTCGAAAATGTTTTTAGTCTTGTAGTTAAATATCATTTTAA
AAAATTGAAATTAAAGAACTGTTTTAAAAAAATTACTATAAAAATAGATCAAACAAATTAAAACAAAAAAAACTATCGAATAGGTAAGTGAGAGTTTATC
CTTACATTTTTTGAGGGAAATAAGTGGTGATGATGCTGGCCAGTGCCCACACGTACTCCTTCTGGGCTTGAAGTTTAGTAGCAGTTGATAGCACAGTCCA
TTATTCATTCTGTTAGTCTGCAGGCCAGAAAAATAACAGATTCAGTACTAGTATTATATATGGGACGAAAATAAAAAAGATTTTTAAATCTTGTAGTCTT
ATATTTAAAATATAATTAATATATTTTTTAATTTTGTAATCTTAAACATGTTGCGATGGAATTAAGTTGAAATTAAAGAGTTATAAAAAACAGAAAGAGA
TTATTCTTGTTTCAACAAATTATAAGAAATAGGACAAATAAATTATAACGAAGGAAGTAATTGTAATGTTTCTTAACAGTGGGGCAATAAGTTAATCATG
TCAATTTATGATTTATTGCAACCTCTATTTCTGTTGTTGCTTAATTTGTTCTATATTTGGTATAACTTAATTCAAGCACAAATTAGATGAATATGAGTAT
TCTCTTAGGGCATGTGTGTTTTGACCTAATTAAATTGAAGTTCCTTCCTTCTATTTCTGAATAAATTTTGTGTAGTTATTTCTTTCGATATTTTGAACTC
TATTTTATGCTAAGTGTTAGATTACTCACCTTTTTTTTCTTTTGTTGTCTGATTTATCACTGTTTTGTCAGCTTTCGCATGTCACCTAGTTATTTGGTAG
GTTAACTTAAAGATTAAGATTAAGTAGGTAAATAATCAGTTTTTATCTAACAAATTAGTTGGGATTTACTAGTGGAAAATTTGACTAGCAACTTGTGAAA
TTTGTGGCTAGGGTTGTAAACATTGGATGCTTTTTTTGCTCAATATTTATGAACTAAAATTCAGTAATTATAGTATTAGCCTTTGGCCTGTTATGATTGT
AGCCAACTCTACTCTTAGAGCAGATTGTGGCCTCTCAAAATATCCATTTTCATTATTGTATTCCTTAGGGTTTAGTGGTGGTAGAAAATAAAGATTAACC
TATGAATCAATTATACATCAAAATTAAGTCTTATCGTCTTATAAGTTTGATGACAAATTCAAAATTCATATACTTCAATAGTAATTCTACCTCTGTCAGC
ATTAACATTTCATCATAAGCAAATTCAAAATTTAAAAATCAAATTTTATTCTACGTACACATACATTTTTTTTATAAAAAATATTAATATATAATTCGAA
ATCACAAAACCTTTCTCGCAATATCAATATTAATATATATTGAATATTTTTGGTGAATATACCTTCCCTTTTCCAGTTGATTTAATTAGCCAATGGAACA
GTAGATTGGAATTTGATCATTCTAATATTTGTCCTTTTCTTTCTACCCTTGTTATTGAATGATAATAGTAATTAAATTTATTAGTGTTACAATACGGTGG
TAAGATTGCTTTATCCTTAATTAAAAGTGTCACATTCGAGCCTTAAATATGAAGAAAATCTTGTTAGGAATATCACTCCTAAATGAGCTTGCAATACGCA
TCCAAATTTAATCAGGACTTTCAATTATTAAAATTAAATTCATTAAGTTAATCAGTGGGTTAAGTCCAAGTTGCTGCTACTGCTGCATGCAAAAAATCTC
ACTGCAAGTGGCCCATTTTTATATATATATATATATAATATATGTGTACTAAGTGCAAAGTCTTTTAAGAGGTTGTATATTATTATTATTGGTTTATTGG
TCCCTCATCTACAATTGAGCATATATATAGCTTTGGGGATACCACTACATCTCCACTAGTTATTCTAATTACTAATAATTTGTTTCCTTTTTGAAACTTA
AATAATTAATTACTCATCAACATTCTTTATTTTCATGTGTTTCCTAATCTTTAATTTCTTCATCATAATTATGTTAAAATCTTTCAAAAATGGCACTAAC
AAATTGTACATATATAGTTTCTTTATAAATTAAAAGATATTAATGTACAAGGATTTCTGGTATTTCTTTTCTGCTAATTTAATTGTGCATGCATATGTAG
TAAAAGCTTTTCTCCCTTTTCTTCTATTCAATTTAGGTGACGTACTCGATTAGAAATCAACAATAACAATAACATGTTTAGTGTAATATATCTCATAAAA
AAGTTTTGGAAAGGATGATATGTATATGGAGTTTCTCTCTATCTAGTGAAGATTAATAGATATTTTCCGATAGATCCTCGAATTAAGTAAAATATATTAA
AGTTATTGAGAAAGGAATAATATAGTGAAGGAACCCTTGTAGAAAACAATGGAGAAAAGAAAATTATAAATAACAAATAGAACGATATTCGAAGTAATAA
GAAAATAATAAATAAGTAGAATTAAAGAATAAGATAGTATAAGAGTACCCATAATAATACTGATAAAGAAAATTGGATCACTTTTAAATATTCCCTTCGA
TCACTTTTAATTGTCATGATTTTTTTTAGAGTGAAATGATAAGAACTTCGATTAATATTTTACCATGATTTTTTTCATCTTATTGATATGCCAAAAAAAT
GCAATTTGTAGTACTTCTAGTATAATTTTTGAATATCTAATAATCTAATTTAACTTTGAAAATTAATCAAATTGACTTTTTAAAACACAACATGACAATT
AAAAACGAACAGAGGGAGTATGAGATGAGTTTAATTAGGATTCGCTTGGACATGCGATACAAATTATGATTTGAAATCAGATTAATTTGAGATTAAACTT
TTGTTTGGATGAGTAATTTATATTTCTCGGGTTGTGTTTTTTCTTATAAACATGAAAAAAAAATTCTACAAATTGTATAAACCACCGAAATTTCTCCCAT
TCTTATACAATCTTAGCAAAGAGTAAAAAATAATTCATAAACAAGAAACTATAACATCCTACGACGCCACATTAAAAAATTACATATCTCCATATATCTT
TTTTTATAAATAGAATATTACAATTAAAATTTTTAAATACACAATTATTTTATAAAAATCCACTATTCAACAATTGTAATAACGAGGGAAAAGGTCTGAA
AAATACTTCAATTTTGATCGAAATTGCTATTTCGATATGAAACTTTATGGAGAACCTTTTAACCTTCCCCACTCCTCCAAACTATTTAATAGTGTATTTT
AAAGGTATATTTATGTCCACGTAGACACATTACTATTTATAATTATGTAATATTTTTATGTCCACGTAAATACATATATACCTTTAAAATACACTATTAA
ATAATGTAGGGGTAAAATGTCTTTTCTAAAATTTGATACTACAACAATAATATCAATCAAAGTTCAAATGTATTTCACATCATTTTCCCTAATAACTGAT
TATTATTTAATATAATTATTCTACATGTAACCGACAATATCTCACAACAAACATATATATATATATTCAAAATTTTAAATTCGGATGATTAGTCATTTAT
TTTAATTTGTACTACTACTATAGTTTGCAGAAAAGCAATAAACCCTTTTCTTTTTTTTTTCTTCTAACCCTAGAGTGGTCCTTGTGAGGTTAACAGTGTA
CCTTCCTTTCTTAGCATCATTAAATAGAATCAAAACTTAAAATTAAAATATGAAACTACTACAATAACTAGCTTCTTGACTAATAGACTGTTAAAAAAAA
AAAACTATTCATGATGGAGTAGTCTAAATACGAGAAATTAAATTTCTATTACATTATTATTTGTAGCCTATGGACAAAGAATTATCGCGATTATATATAC
AAATACTATAAAAGTTTATATACACAGTAGATACATAATACTTAAAACTTTACATTTTTCTCAACCCTAGAATTGAATTACACACGAGTAAGCGCCACGT
GGCCTTCTACTTTCCTCTTTTGAGATAATATTATAACATAGTGAGAATCTAACATTGCTTCTTTTTCTACAAACCATAACTTATCCTTGTAAATTTATTC
TCTCTTGTTTCTCTTTTGGTCAAATTTTGTCCATAAACTCATTTTTTCCCCCAAGCCTTGGGAGAAATTATTATAAAAGAAGTTAAATGTTATCAAGAGT
TGTTAATTCCATGTTGAGATTTTGCTAGCCACTCAAAGATATATATACAAGTTGTAGTTTATCTTCTACAAAACCTAATTATGTAAGTACAATTCATGAT
TCTTATAGTAGTAATTGTTTATACAAAATTTTAAACATCTATTTTTTTAGATCTTAGTCATTTTTACAAAGTCTTGGGTGTTTAGTGAAATGATTTTGGA
GGTTACCCTAATATTAATCACAACTCCAATTTTCCCCCAAAAATTGCACTATGTACACAAGAAAATTTCCATTGATGGAGTTTTTTTTTTTTGTGTGTAT
AGTATAATTTGATAATATTTTATCTCGATCTAATAGATGCTTAATATTTTTCTTTGATTTTTACTAGATCGATGCTGATGAAGAACGATATATGATATAC
ATATCATGAATTCATCGAGTGGAAATAATTTTGAGACGAAACAAGAATCAAATAATGATAGTAGATTGGCCTCAAAGACGACTAGTGCACCACCATCGAG
TACTTCAAGGCAATGGGGAGCTAATAAAAACCCAAGAATAGTACGCGTATCGCGTACTTTTGGAGGGAAAGATAGGCATAGTAAGGTGTGCACCATAAGG
GGGCTTAGAGATCGAAGAATTAGACTATCAGTTCCAACTGCAATTCAATTGTATGATCTACAAGACAGGCTTGGCCTGAGCCAACCTAGTAAAGTTGTAG
ATTGGCTCTTAGAAGCGACTAAACTTGATATCGATACTCTTCCTCCACTTCCTGTACCACCTGAGTACTTCACTCGGTTTCAACAACCATCTCATGAAGA
GTTCTCTGATGTCCGTGCTCAATGGTTGAACGCGAACACATCTTATTTGGAACATGGGAGGAACAAGTCAATCGCTTCAAATGAGGAATCAAATCAAGAG
GATAATATGTTTACCTTAGGAAATCAACGATCATCTAATTTACCAGGCATGCCTTTCAATTCTTATAACTATCAATGGGATCATCAGCCTAATTCGAATT
TGTCTTTAGGTCATTTTGGACATAATCATTCATTTTCATCCCAAATAGATGATGATCAATCTCATCAAAATACTAGTTTCCCTCTATCTTTGGGATCATC
ATCTTCGCCTTTTCCCTCGAGTTCTCAATTGTATTTCAATCCAATAACAACAACATTTCAACCTATAGTTCCATCTCCTAACTATATAACAAATCATCAT
CCCATTGAGAGTCATGATCCAAGGGCTAATATGAACCATTTCAATTTCTTAAGCTCAACTACTTCACACAATAATCAACTTGTGATGCCAACTCTTAATT
TGATTAGTTCCCAAATGAAACCCTTTAGTCTCAATAATGATCCTAGATGGATGAGTTCCAGAGATGATGAAGATGACGATGATGACGATGATGATGATGA
TAATCAACCACATGAAGGTCGCGCAATTTGATTCTAAGCCAAGTGGAGGAAATGAATCTTCGTCTTTACTTCAAATATTTTGAATTAAAGTTGTTGTCCT
GGATTATAATCATGCTACATTATTCCTTCTTCACAGGTACAACAAATAATTAAAGTGAATCATTCTATTTCTTATACCATATAGGTTTATAAAGTTTTAA
TCTCTATTCTGAAATATACAAATATTAATCTGTAGTTTTTTTTTTTGGGTGATTCAAGTGGTATAAATCTACATTATTATTGGTATTGGATTAACCTTTA
ATTTATACAAATTGAAAGTGTGTTTAGCATTAATTTTTTCAATTTTGTTTTTCTTGGATTTGCATCATTAATATGTCATGGTTTAACCGAAATCTCGATA
GTAGAAACTCTAATCGAAGCAAAGGTTGGGTTTATTCTCGACTCTCACAACCTTAAGGTAATTGCAAATATGATGCAACAGATCTGGAACTATAGTTACG
TAGTCAAGTCAATCAGTTGTTGTTGGTATCTTCTTCTCATTTTTCTTTATTTCATTATCAGAGCTCCGAGAAGTAAGAGATAAAGATGTTGAAGAATATA
GTGAAAAATCCATAATAGGATCTAACCACAAAGTATGAATGATTTTAGCCAATAAAAATATTTTATAGAAGGTAAACGAAACTATTCAAGTTCAATTTTG
TCATGTAAAATTGATACATAACATATCATGCTTAGCTGTGTACTAATGATAGACGTAATAACTAGTAATATAATTAATTACTCCATTAATTTGTTTTAAT
CTAACTAGAAAACAAAAAGTTTCTTTCATATCTAATTAGGTTTTTAGACGAATTAGTTGGAAAATAAGAGGAAGAAACTTAAAAGTTTTACTCTTTTAAG
AATGAGTCTTAGGTCTCATTTGTTTTCATTAAGATTAAGATGTTAGAATCTTAATGCTTGTCTGAACATTAAAATGTAGTTTCTAGATTTGAACACTAAA
TGATTATTTATTTTCAATATATGAATGTGCATGATATTTTTTAAAAAAATTAGGAATTAAATATTATATCAAAAAAAGTTATAATCTAAACCAAGAATAC
TTCTTCTAAAAAATTGTTTCAAGAATAAGATTATAACTCATCCCTAGAAAAGACGATTTATTTGTTTTCTCATGAAACAAAGATAACTTTTCCAAAGAAG
TTTTGACAACAAACGAATTGTGACATGAAGAATTTTTCATAAATATCAATTCACCCAAGAATATTGTATACATTAAAAATATTATGTAAATACTTGTAAA
AGATTATGAAAACTTACTTATTCAAAAGAAAAAAAAATATTTGGTTGGAAAATGAGAGGAAGACTTAAAACTTGTCCTGAAGAGAAGCAAGGAAGAAGAA
AATGTGTTTATGAAAGAACTTCTATTATTTCAATAGAGTAAGATGGTATTAAGACTCTGTTATAAATCTGATTCATTCAGATTCATTAAGACCCAATAAG
ATTTTTTTTAAAAAAAGAAACAAATAGACTTAATGGAATGAATCTTAATGATTAAAATCAAACCTAAAATCAAACGCACTTATGGGTTGAATCTAAATGA
TTAAGATTCAGACTCTCATTAAGTGCAAACAAATGAGGCATGTCTTACGTTATAAAGCATGAATAGGTGTCGAGTTCAAGTCTCAATGCCACTCATTATC
GGATTTTCACGTTATTAGAGTCGGGTGGTACTAGAGACATACACTACACAAAAAATGATCAATAGCTTAAGCCTATCTCGGCATTGAATCTAATAATATT
TAACTAATATCGGTAAAAATTTTAATACTTTTGGTAAATATTAATGTGCATATTTATTTTTGTTAAAAGTTATTTTTGTCGTAGTGATATAGTGATCCAT
CACTAACATACTTCCTTATTTTGTTTTTGATGCAAGCTATTCTTATAAACAAAATTTAGTTGTTACTCTTCTTCTTTTTTTTTACCCTCCTCGGAAGTTC
TCACCTTTTTGCTTCTTTGGTAACTAAAACTCGCAACCTTCGAATTGAAAGTGAAGGATACTTTTCATGCGAGCAACTTTCTCTCGTCTAAGATGTTTCT
CTATAAATTGCAATCATTTTTTTTACACTACTCTAATTTGCTTGTTATTTATTGGAAGTAATTAACCTGTATGAGTTAGAATATATTGGCAGATCTTGGA
CTTAATTGTTTGTGAGACCACAACGATATTTGGGACCAAAAGCATCTAAAAGTTGCTTCCTGGAGCTTGAAAATAATCTATATTATTATTGTACAATGTT
GACAATTCCTCTCCATACTATATCCACCTAGCCTTAAATATCATATGAGATGGTCACACACTTTTACATATGGTATCAGTGTCACGTGTTTGGCCTACGA
AAAGAGAGTCACGCCCACACATAATCACGAGACATATTGAATATGCTTTCTCTAAGAAACTGATAACTTAAATTTTTAGATAAGATGATTACATATTTCA
ACGTTCCTAATAAACGGAGTTGAATTTTATTATCTGCTATCTATGAAACTGCATGCCTGCAAAATTGAAGAAGTAATTCCTTGTTAGTTGTTACTATGTA
GTATATTAGTTATTATCAACATGGATTGTGGTGTATTACTAGTCGGGAGTGTTTTATTTTTAATCAGAGATATTGGGTTCGAGCTCTTGGTATGGAGAAA
ATACTATTTGGAGCGTTACCTTGAATGGACCCTGCAGTGCGCGATCTAGATTTAATTGAAGTTCTAATGTGAATTCTAGACACTAAACGAAAAATTAAAA
AAATAATAATTATTACTATACCCTATTTGCCGACCTAATCAACCCTTTGTATCTAAATTAATAATTAATTAGCTTGATATAGACATAGATGTAGAATAAT
AGTATAGTCATATATAGGAATGGTATATTTCCCCGCATGCATATAGATGCATGTTAAAGTCCACCTCCTACGCTCATCAACCACTTAATTAATGTTGTCA
AGATAAGTTTAATTTTCTCTTAACTAATTAAACATGTAATTGGCATTCTACGTATATTATGACAGGTAGGATATATATAAGTTCATTTGTTTAATTTTAT
ATACGTGTAAATATCTACTTGTGTACGGAGCATAAAATTTTTTGAAACACCTTGAAGTATTAAAAATGTCATGTTTGTTGCTTGTTAAATTAAAAAGAAA
AAGATACAGTCTTTTTTAAATAGTGTAAAAAAAAAAGAAGGTAAAACGAATAAATTTGTCCATGTACTCTTCGAAATTAATTAAGTTGTCCCCTGGTTCT
TTTCTAACCCTTCTCTACAAGCTTCGATCCATTTTTGCTCTCTTGGTTACTCAAACTTACAGTATTTATATTATTGAAAGTGAGTGGTGTTTACCATCTC
TCTCGTTAAAACTGCTTTATTTACTTTTGGTCCTTTCATGTCCATTGTCATCATTAGTGAAGCATCTAGTATTTTCCCTTATCTGATGAATCTCCAACGT
GAAATATGTTATAGAATTGGAATGTGCAGGTGTAGAGCCTAATTAATTAGCTTAGGATTAGTCTTTAAACATTGATAAAATTGATTGATATAGTAGAGTC
CAATCCCAATTGAACATAGAAGACATAACTATATATATATATAATATAATGAAATTATTGTCTCGAATAGAGAGGTAAGAAAATAAAATATAATGGAAAA
AGTTTTTTTTTATGTCCAAATTTACCCTTCAACTTTTTTGTATGGTACAAATGTACCCTTCAACTTTTCAGTATGGTTAAAAATTATCCTAAGGTTGAAA
CTTTCACTATGGATCAAGGGCTAGTACGCAAGACAAATAAGTTATTCGATCATTAAGAATAATATGTTATACCGTTAGAAGACAAATAAGTTATTCGATC
AATTTCGTATTTATGATTAAAAATTGTTGGTCAACATGGTGAAGTATATATATAATTGTAATAGTGACAACTTAAAAAAAGAAACCCTAGAAGAAAAAGA
GTAATTGTTCTAAAGAGGAAAAGGAAGGGGATATATTATTATTATTATTATTATATGAAATGAGTACAAGCATGGAAGGAAGAAAAAGGAAGTGAATATT
GGAATCTATATTTCTTCTATGTATGAATGAAAGGGAAAGGAGATAAAACAAATGGACATAGATTGGATTGCATCAATACTCTATAGTATTATATAGTATA
TTATCAACATTATATTCATGACACTAGATCCAAGAATTCTTTTTTTCATTGAAAGGTGTTCTTTTTCTAAAGTAGAAAAAATAAAATAATACTTCCTTCG
CTTTAAAAAGAATAATCTAAGCTAATTTTACATTAATTTAAAAAAGTAAAAAAGGTTTTTCAATTTTGAGATCTTAAATTGAAATTATAACAAATACACC
AAATTGAAATTAAATTGTTACCAAAATAAAAAAAAATCACTCCTTTCGAAACAGTTAAAAAAAATAGATCATTTTTTTGAAAAAACATATGGAGTACTAC
AATGCTATTCTATTACTTTTATTATTATAATGGTAAGTTTGGAGATGCATGAAAAATGGAATCTTGAAATTAACTGATTGACATAAAGGATAGTATGTTA
CAATTGAGAAGTATTTTTAACTTTTTTTTTATATATAACTGGGTAATTTTTAGGAAAATAAAATTAGTTTTTTTACAAAAAAAAAAGGTTCTTACTATTG
ATGAAAACAGTTATTTTTCTTACTTTTGAAAAAATTATTTTCCTATAGAAAATATTATCTATAAGATTTAATAAACTAAACAAGAAAAATTAAAAATGTT
TATTTTTCTTGGTACAGCACACCTTTAATGGCTCTTTTTCCTCTGGCTAAAGGAAAATATAATTTCCACGTGAAAAGGCTAAGGTTGTATTAATGTTACC
AGATGCTGTGGTCCAATATTAATTTGTTTTATATATTTAGGGTTACTTCTAGTATTGCGTTTGATTGCACAAATCCCTTATTTCTATTCGTACAATTTTA
GATAACTTTTTTTTAGCGAGAGTTCCTTTTTGGTTTGCGTTATGTTCAAAATTCATTTTCTTTTCAATGTTGAGCCCCCATTTATATTACTCATGCTTAA
GTGTGTGAATTTGAATCCCGTCTCGATAGATTCAACAGGTCCCTTGACTTGACTCGCTCAAATTCAATTAAATTCACCTCTTAACACCCTCACGATGGTC
AAGGTCCATTACATCTTTTCTTATGTTTTATTTTCTGAATAATTTCATTAAAACTTGAGTTTTAAAGCCCTAAGTCTGAATTAAGAAAGAAAAAGGCATA
TGGAAACACAAATTCCAAAACTTTTTGATTCAACAGTCCCACAAAAGGATATGTCAAATTATAACTTTGCTTCCAAATTTATCAAAGATGGAAAGATATA
TTCCAAATGTTGAATGAATAGTTGTGTAAAGGATGAATTAAAGCTGCCATTGGTACATGGGGACAACTAAAAAGTTGCAAGTAACAAACTACTTTTCCCT
CACTTGAAGCATGTTACTAATTGAGATTTGAGAGAGTACACCAAAATTAATCATCTTTTAACAATAACTTAATTGCTAACGGCCATTAACACTCTTTGTA
AATGTCTCGAAAGTCTATACACTGATATTGAATCTAATGACAATTGACTAACGCTAGTAGAGATTTAGCGCTCTGTATTAACGTGTATATATATCATCGC
TAAAAGTAACCAAGTGGTTTATGCTCCCTATGTTCCTTTTTTACTTCGTCACATTTCCTTACAACAATTATGACTCATATTTTAACCTAAATTGAATTAA
ATTAATTTAATATTTTAAACTTGAATTTTTGAAAAATATATATACATGAAATATACTATAAATTTCAATTCTTCTCATATTAGTATGATAAAAATATATA
TCATAAAACACTTAGCAATTTCACCTTAAAAGAAAAATATCACAAATACATAAAAACAAAGAGAGTATATAATTTTGCAAAATTGTAGCCAACAAATAAC
AAAATTCAACATACAAACTCAAAATTGTATCCAGCAAATAACAAAATTCAACATGCAACATGAGTTGTTTTGCATTAGTTATACATTAATACATATATAC
TTTATAATAAATAGAATTTATTAATTTCTCAAATACATGTTATCAAATAATCCCTTAAAATTTTCAATAAATAGGAAAGAATTGCATCTTAGTTCAAGAT
AAAATACTAGACATAAAAAATCAAGCAAAGTCACGAAATAATGTCTTAAAAGGTGACTGAACTATGAGAATTTATTAAGTGAAGTCATTAAACATTATTT
TATACCAATAAAATCACTCAACTTAAAATTTTTATCATCAATCACTCAACTACATTTTTCATTTATTTAATAAGACAAAACAAAATACTTTATAGGTCAC
TTAAAACTCCATAAATATATAAAACTTCAAAAATCATATTTTGTTTTTTCTCTTCCTTTTTTTAAAGAAAATTTATCCTCAAATAAATTTAACATGCCAT
ATAAATTATTTTACATATCACATAAATGTGAATTTCAAAAGTCAAGATTTTATATTCAACCTCCGAATAAATCCGCATTTCCCAAGTTACTTCAATTTTC
ATTTTTTTTATTTTGTGCCACTATTCGTAAAAATGTTCTTTTTTTGTTGGCTGAAACAATCATTATCTATTGATTACTTTGTTTAGATGGTCCAAGAGTC
CAGTCTCCATATACAAATATATTAATGATTAATACAACTAAATGAGTAAATAGTGTATAAATCAAAACAATTAAAAAGTAATAACGGTAGAAATTCATAT
AAAAATTTCACGTAGAGTCCTAAGTTAACTATACTTAGAGTACTATTAAAATACATATTACTATTACTATAATAATAATAATAATAATGCAATTATAAAT
AATTTAATCCTAGTTGTACTATAATCCTGATCATAATATAATTCTAGACGAGATATAATCCTAATTAACATAGGCAGTCTAATCCTAGTGCGACTCTAAT
TCTTCAGCAGTGCTGTAAATTTGCCAGACTGGCTTCATTGGACCTGTTCCTTTGACATGTTCCAATAGTCATCTTCTAGTCAGTTGCGTTGGACCTGTTC
TTTTGACATGTTCCAAAATCGTCAACTTCCTTCTTCTTCAACAATAACGAATGGTTTTTCTTTTCAATTCCTTGATGTGATTTATGAAATTTCATTGATT
TTGTATTGCTAGGCTCTAGTTGGTTGTTATATGATTGTGGATCTCTTATGAATATGTATTTTACACCCAAAATTTTATCATTTTCACTTGTGATTGGACA
AGGAACTGAATAAATTGATAAACAGGATAAATTGGTTTTAAAAATATTATATTTATTTTGGGGGGGTCATGTTTATATAGCCAAACAAATAATTTATTTT
GTTATATTAAATTTATTTTAATAATAAATGTAGTTGAGTGATTTTTATATATAAATGTCAAGTTAGTGAGTTTTGTAGATAAATGTGTTGAGTTGAATGA
TTTTATTGATATAAAATAAAATTTAATGACTTTACCCGATAAATTCACATATTTCAGTGACCTTTTAAGATATTAACTCGTTATACATAAGTTAAACTCA
ATAGCAAGGAATTACATATATAACTCTGATTACAAGAGTAGCTCTTAATTACATCAAACATAATAAGCAAAACTTAAATTAAAAAAAAAAATCACAAATG
AAATAGCTGTTGATCCTTTCCAATTTAATACTTATTGTTGATGGAAGGTGACAGATATCTCGAATAAAATATCATATAAAACATTTACTATAATAATCTT
GACATAAGATTGTTAAGAGCTATGACAATATTATCATAACATTCCCATAGACGTGGCACATTCCTATCCCTAGCTGCAAAATCCATTTTTGTAACATTAT
TGAACAGAATTGAATACATTTTCCTCAATTCAGGTCTTTGTATACCTGGTTTAGCTTGAATTATAGTATACATATCTTGTTTCAATAAAGCTGAGCTTTT
TCTCAATGCTTTTTGACCTTCTTTCCAAGATTCTCCCTCAAATAATTCTTTGACTTGTAATAAATTTTTGGCATGATTTTTAATTCCATCCTCTGCTTCT
TCAAGTGTTTGGTCTGGAACTGTGATTCTGAAATCAAATGCATTGGCATTTTGTTGTTTACTTAAAAGGTTGATTGAAATTGCTGGGCAAAGAATTAGTG
TTGTTCTTCTGGTGAAATTGAGGGACATTTGGGTTTTGGGTTTTGGTTTGTTAGAAATATTGGAAGAAGGAAAAGGGGTTAATGGTTTTTGAACTAAAGG
TAGTAATGCCATTTTTTTTTTTTTTTGAAGATATGGTGTTTTTGATTGTTTATTTTTTCAAGATTGAATAAAAGATGTATTGCAAAAAATTAAAGTTATG
GTGAAAAAGAAGATAACAGGTTATGGTTTACTTGTGAAAGTATTTCATTCTTAATCAGAAGAGCTCTGGACATCTGATTGGAAAAAAATGATAAATAAAA
ATAATTATAGCCCCCGGCGAGGGTCGAACTCGCGACCTTTCGCTTACGAAGCGAACGCACTACCACTATGCTACGGAGGCACGTCGATAGTAAATTTCAA
TAAAAATTATAAATCTGATATTCACAAATCATGAAGTTTTTGCACATATTTATCACGTACGTTATTATACTAAATACCTTTGCGATATAAATCACTATTA
TATAAATTCTTTTATCTTAAAATTAAATACTTAAACTCTTAAATCATATCTAAAAAGAATTCAAAACACCTAAAGCCCGATAAGAAAGAGAAATCCTTAC
ATTTCAAGTATTTACATTACATTTGATGAGAAAATACAAATTTAGCTTTCTTGGAGGATTTCCAGGTTCGACTAAATTTGGATCGCACTTGGCAAAGGCC
ATTCGAGGATGAAATTCCCAATAGGATTTTCTCCATACTTAGGACTCGAATCGAAACCTCTAGTTAATGACGTAAAGATAGCCTAATACCAACTAGGAGA
AAAGGAAAAATCAACGTAGGAAAAATTATGATTTTTATAATGAGTTGAAAATTGTCTAATACTATATATCGTGGATTAGTGATACTACAGGAATGTTTAA
TTTGCACCAAGCAAAAGCTAAATAATACAGGATATAGTACATTTTTCTGCACTGGTGATCTTGATTAGATATGTTGGTAATACAATTAAGTGACAATTGT
TCCTTTACAATACATCACACAAATGAGTATTCCTGAATTATTTTACTACTCAATATAATTAGCTGAAAAGGAAAACAAAGAGAAGTCGAGAATGGAATGA
TACTATTTTGCAAAGAGCTGTCTACGCCTAGTTGGTTTTGCTCTCAAACCAGAACCATCACCCCTTACTATCTCATCAACTAAATCTTTAAAGATCATCC
GCTCCACGTCAAGGACTACACTCGATATCTCACCTGTGAAAATCGTCCAACTCTCTGAACGATGCACCACGTCATCCAGCAGTATGTTTTTCCACTCATC
CTCCTCATCCTCCATGTTGCATTTTGATGGTTTAGCTTGAAGTTGTTCTATCTCTGAGCACAAGTCCCTTAGAAGCCTTTGAGCATTCAGGGTGCTCTTT
GCTAGCTTCTGGGACATCAACCATGGCTCGTACGAAGGTCCCACTAGCATTAGTTTTCCAGCAAGACTCTCATTAACAACATCAAAGATGAGTTTCCTAC
GGATCTTTTCCTTTGGATTCGACTGCCTCATCTTATCATTGCAGAGTTCCTCCTTGAGTAAAGTGCTTGCCTTGGTTTGTTCCAAGACTAGGAACAGCTC
AGGGTTGATTGGGTGACCTGATGGATGGAACTGGAAACTAGTTAGGCTTGAGCCGAGATCCCTGAGAAGGAGTCCTGAAGCCAATAAGATCTCTGAAATG
TATCTGTGGTCAGGGTTTGTGTTCTCACAGAGAGACGCAATGTAATCCGTGCGAGCCTCATCATGGCTGGAGTTCAATCTCCTGAGCTTCTCAACTAAAT
TCTCAATGTTTTGCAACTTTTTTCTATTGATTTCTGAGGAGAGACCAGAACTGGTGGCATCAATCGCAAGAGTATTAGATCGATCACACTGTGGCGGACT
GGAAAATTTATCAGCAGTGTTGCAGCTTTCATCTGTCACAGAATAACAGAAATGAGACAAACAAATAGAATCCAACTTCTTAAGCAGTGTATATATTCTG
AGACCTGAATAGTCAGGACTGTTTTAATCTCTAGACAAGGGACTCTGACAACATAATAGAGACTCATATCTGATATTTCTTACTGAATGTTCACTATAAA
TTCATTTGAGCATCTTTAAAATATTTGCTATTGATCTTACTTTTCCTACTAGAATTAGAACTCCAATATGTTTAGTTTTGAAAAACAAAGGAGGTTCAAG
TGCAGTGAATAAACTGGTGTCCAGTGTGGATGGCCTGATCTTGAGCAAGCAAGTTCTTTTCGGAGCCAACATTGTGATGAGAAGAATTATTTAAGGTTTA
CTACCATTTTCCGCTATTCTAGCTGACATAAGTGACCAGAACATGAAAGCATAAAAGCCAGAACTGAAAAATCTAGTGCATATAAAGACCATATAGATGT
ACATATAGATGTAAGTGCCTTCTTAGCTTAACATGTTACTATTCATGTTTCACTTTGTTCTCTCAAAGTGATTATAGTCTCTTGATCTAGTTGAGTCTGA
ACTCCTAAGGAGCCAAGTTTGGGCATTTGCTATCGCTGTTATTGGAGAAATCCTGCTCACACTTCAACATCCCAAAAGACTTAACTTCTAAATTTCCTTA
CGCTGTCCTTGGCCTATTTTATTCAGAGATTTAGTCTCTCTTCTACTTATTTTTCCTTTTGTATTATTTAAAATTCTGCTGGCATTCACTTATTTGTATA
GCCATGGATGGATAACTGCAAAGTGAATATTCCTGATCAGATGTTTAGTTTCAGCTAACAAAATCTAAAAATATATCCCCAACATGTCATCCACATAAGG
AGCTAGTTTCATTTATTATTTCCACTCATATTTGCTTATGTAGACGTGCTTATAATTTCTTCACAAAAATACTAAGGGAAAGCAGCACCTTTCATGACTT
TTGGAGTATGCTTCACAGGAGAGGGTGATTCATCCATATATACAGCATTATCAAGAACCGATACCGGACTTGGATACTCTGGAGCAGGTTCAGTTAACAT
TTCATCCTCAGAGAGCACCCGAATTGATTTCTGAAATGGAAGTCACAGTGTCAAGCATGTAATGGCCTGCTTGAAGTACTCTATAAAATGCACAAATAAA
TGGAAATTTCTTACCTTCTCTACCAAGTCACATCTCAGGTAACTGGATGCATCAATAGATGAACTCGGGCTGCTTGTCATCTCAAGAGAGCGCTCGAAAC
TAGTAACTTCGAAATCCACTTTTGATTCTGCTACCACATTCCCATTGGATTGACCAGAAATTTTATTCCCGTGGCAACTCAAATTCCTTGATTCACTACT
GATCTCACTCACATGGTCATCATGTTGCTGGATGTTTGAAATTCTTGGCCTTCGTCTTCCGCCTGGGGAACTAGCCTCTGTATGTTGCTTGTTTGACTGT
CTCCTCGATCTGTTGGAATCAGATGGAGGTGTGGGTGGCCGAGATTTTTTCTCTAGCTCCAGTTTATTCTGTTGCAATCTTGGACTGATGGATCCTGAGC
TCTTTATTGAGCCTGAGATGATCTCTTTAGGAAGCTGTTGGGACCTTGTTGAAATCTGTGGAGGTTTCGAAGTTCTTCTTGCTTCATTGGGATTCACTGG
ACTGTTTCCATGACTAGTTCTAGGTTGATGTTCTTTAGCAGCCCTGCTCACAGAATTACCCTTTCTACTGACAGAGTCACCACCATGAAGTGGAATCATC
GAAGACGAAGGAATGTCAGATTTTTCCACTAATTTTGCTGGCTTCATGATCACTATTGGGGATTCAAAATTCCTTGAAGAATTAATCCCCCTCTTTGTTG
GAGCAGTCACTTGATCAGTCTGCCTCATTCTCTGGTTCGCCAGTTTTGCACTCTGTGCAGGACTTGCAAACTTCTGGTGATGCTCTTTCTGACCAGTAAA
ATTTGAATCCTGCTCCTCTTTTTCTGTCTCTAGGAGGCCCTTTGCCTGCATTGCTTCCAATATCTGTTTAAGAGCTCTTAGATCCTTGCCTGAATGGGTG
AATTCTAGATCCTTCCATCTCTTTTCTATCTCACTGTAAACAGAAGGAAAGGGGTGGGCTGGCTTTACTGGAGTTTTTGTTGTCCTGGATATCGGTTTCT
CATACACTCGAGTCCTATCAGGTTGCTTCCAGGGTGCTGGTTCAATGGGAAACCTGGATATAGGTTTCATAGCCATATCAGGGTTTCTCCACTTAGGAGA
AGTAGGTTCTTTCCACAGGTTCTTAGAGGTATTAGAAGTTCGGATAGGTTTGCACGGATCAGATACTTCTGAAGACCTTGGAAAAGAAACAGGTGCTTCA
ACTTGTGAAGAAGTGCTCAACCCCATCTTGTTGTCAGTTGATGACATGGAACCAGGTAGTGTATCAAGACCCATTAGCTTTGCCACAACACTAGGAGGAC
GAGCCGGAGTCCCAGATGTTTGCTGCAGAGTTGGTGACTTTGCATTGGTATTACCACTATCCTTCTGCATAGATTTTGAGGAGAAATTAGATTTTGGTTC
TGAGTTCAAGCTTCGTACTGGACTAACTCTACTGTCCAAGGAAAGTCTTGGTAGCTCTTTAAGCTTAAGAGTGGATTTGGAAATGTCTCGCTGTTCAAAG
GGTACATGATTTGTTTCTCTCCCATCATATGAGAAACGAGGAGCATCTTTCGAGACTGATAATGTAGAAGTATCCTTTGAATGATATGATAATGATCTTG
TAAGTTCCCTATGTTCACTTGAGTACCAAGGAGCTTCCCGAAGTTTAGCAAGAACTCTGAGAGATTCCTTAAGATCAACAGACGAATTCTGCTTCCCATT
TGGGCCCGAATCATAAGCCCCGTCAAAGTTTTTCAAAGTCTGAACTGGCCTTGGGGAATCCCCGGGCTTTGACATCGATTCTGCCACCTCTTCTTTCACT
GCAGGTCCAGCTGAGAACCTCTGAGCTTCTCTATTCATAGAATCCTTAACCACATCCCGAATGTCAAGAGATTGCCTACCAAATTGTGGTGATGCATTTG
GTTGGCCTGCAGCTGGTTCTCTTGAAGGAGTTTCAGCAAAACTTAGTCGATCAAAAGCTAAGGGCTCTTGTTGACTTGTTTTATTACAATCAAGAGAAGA
AAAGGAAGACGAACGTGAAGAAGATGAGAATGATGGTCTCGACGATTCTGTAGACAATCTTTGTTTATCTTGCACAGTCTTGTTTGTGTGGCTTTCCTGC
AATGAAAAGCAGTGCCATCAAGCTTTCAGGATATGATATCAAAGAAATTCAGCTGTCAAAAGATACAAGAGTCGTTAAACATTCAACAGACTTGGTGAGA
TGGAAAAGAAATTAGTGGATTCAAATCTAACACATCAATTATCTGAATTGCTATTTTTAAAAGAGAGAAAAAATGAAACCAAGTTATCATCAGACATCAC
TCAGAAGTCTTCCTATGCAAACATACAACTCAGTAGTGTCTACATCGTTGTCAATCACATTCAAGATGAACTGTTTGATGCTAACGACCTCATAAACATT
CCAACTGGCTCAAATGAATATATTTTTCAAAGTCGAAAGAGAAAGAGAGAGAGAGAGAGGAGAGATAACAAGTTAGCACAAATAACTCTTACCATAGCTG
GTGATTTTGGATATGTGCTAGTGTACTCTTTCTCAGAAGTACCACTGCCAATGTGAGAGCTGCCTGTAAGAAGTCATTCACATGATGTTACAAAACTTGT
ACAGTAAAAAAAAAAAACAATTGAAGCACCCCCTTGTTATATATAAGTATGATATCTCGAATTTCGTTTGAAGAATCCTAGAAAATTTTACATGAGAACA
TGGATGAAATATTGATTTTACATTTTCAACAAATAAGCAAACACCATTATTCAATATTGTTGTTGACATAAGAGAAAGTAAAACACATTCTAGATTCTAC
AATGAACATGTATGATATAATAGAATTAGACACAACACAATGAAATATTACCAGAAGTGAGCCTTCTGGGGCTGTTGCCGATTAGGCGCCTACTAGCAAG
CATACTTTGACGATCAAATATGTGCAAAATCCCTGTCATACATCCAATTTGCTTTTGCAGATCTTGATTATCTTCAGTCAATGAATGTAAAAGCTTAGCA
GCCATGGTTCTACTTGTATTCCTCTCCTCTTCAACACAGCACAACCTATAAAGTCAAATCCCTCTTTAAACTATTACTCACTTTTTTTCATTGGCCAATC
AATGCATTATCACTCATATCTCTAGATAGTCAAAAGTCAATATATCTTCACAATCACAGCTGGAGTCAGTTCCTAACCACACACAACAAAGAAGAATTGG
AAAACCTCTCCTAGGCACCATTACCACTAATGCTAGGGATTACAAGCCTGAATCATCTCCAGCAGCATACTTTATACATGTCAAAATCATTCAGTTTTCA
TCATTTAGCAACAACCCCAAAAACCAAGATTTGATTTTTACAACAGAAAATCAAAGGTAATGAACTTTGTTTCTCCAGTACTTCAGAAAAATGCACAAAA
TTTTAATCGATCTCTTACTAATGAAAAGTGGAACAAACTAACACACCCCACAAGAACAAATCAGGTTCTTGATTTTTCTTTAAAGAAGCCTAAAAAGTTG
AGGAAAAAAGCAATGGTAACATCAAATTGTGAAAATCACAAAGTAGCTCTCAGTTGCCAAGAAAGTGAATGCACTAGTGCAAAAACTGTAAAGGGTCTAT
CACTGTAGATCCATAGGTAAATGTTTGAAATGCTGTTTTCTTGGAGAAAGAAGAAAAAGCCCCAGAGATTGAAACAAGAAGTAGTACTAGAGAGAGAAAA
ACTAACAGGGGTACATGTGCTTGCCAATGAGTTGATAGTGAGGGAGGAGTTGGCAAGAAATATTAAAGTACTATAATCAAGATTGATACTAACAGCATAA
TTAGTACTAGTTTTAGTATTATTAGTATGCATATCTTGATGTGGAGTGTAAAGAGAGAGAAGATGTTTTGCAGTGCCTTACCCCTTCCCTCTTCCATGTG
AGTTGAATTACATGGGTATGGGGGTGGGTCTAAATTTGTCTGCATCTTCATGTGATGCTGTCTTCACCTCATTTTGCTTCCACAAATTTGTTCCTCTAAA
CACCATTTTAGCTAACATTAATCTAATTCATGTCCTTAAGTTGTTACCATTCAATTCCTATCTTCTTATCTTACCTCGACGTTCGGTACTTATATTGAAG
CCTAATTAAATTTAAATTTATCTCAGGTTGTCGCGTATTGAGGATTAAACTCTTTCTAATGAAGATAACTCTATACTCAAAAGAACTCGAATCTCAATCC
TCTAATTAAGAATAAACCCTCGGTGTTCAATTCATTTTAGTTGTTGTAGATTCTAATGTCAGTCTCATATTAGCATTGTTTTTTTTATTTTTCAATTTGA
TATTCGTATTAAGATTTGATTAAATTTGAATTCACATCAAAAAAATTATATTAATAGTAAAATGCTTCTTAACAAAGAAAACTTTACATCCAGTTAACTC
AAACTCCCTAACATTAGCTATGAATAAGTTGTTTGATCTCCTATATGATTTTAGATACAGAGAAGAATTAAAAATACCCTTAACCTATTCAAAAATGTTT
AAGTATATCCTTCATTTACCTATTTGATTAAAACTCCCTCTATCTTTTTGATGCACCCTTACCCTTAAAGTCTATTTTTTTTAATATAGAGTTAAATCAA
TTTTAATTTTTAATTTATCAAATATTGACCTCATATTATATTATTGATATGTCCAGACTTGGACACGTGGAGGGTGTCAAGTCGCCATATAAGTGAGTTT
ATTAAATAGGATCATGGCTAATTTAAGCTATAGTTTATATGCACATTTTCTTATCAAAATGCTTAAATTAGTACTACTTTGCCCTTGAATTTAGTGATAC
CCACCTAACAATTTACTTTGGCTGGTGAGATCTGATTTTCCTTTTCTTTTCAACAATATTTATATTTTAATAAACACATTAAGATATAACGCGTATAAAC
AGGAAGAAAATTTCAGTATTTATTTGATTTTAACTTGATACGATTTTTTAAAAAATAAATAAATTATGTAATCTTACACTAAAAAATGTAAAAGGCAACA
TAATACTTTTTAATTTTGTCATCTTAAATATATCAAATGGAAATTTATAATTAAAAAATTATTTAAAAAACAAAAAATATGATAAGCAAATTAAAATATA
TATTTTAACTCTCAACTGCTAATGGTATACAAGAATCAATTGGCTTTTTTTTCTTTTTCTTTTACAAATGAATGGGAGTAATAGTTTGGTGAGACATGCC
ACTTAAAAAATGAGATTAAATAATGTCAACTTACATAAAGAATGAGCAGACTAGGTTGTATTTTATTTATTTATTTCCATAGGAATTTTTATTTATTTAT
TTTAATAGAAATAAAAAAAATGGAAAAAGTGTCAGAAATCCAGATTAAAAAGTGGGTATTTTTCTTGTGTAAAATAATAATTTTTGTATTAATGGGCTAA
TCATGGTTTAATTAGGACAGCCTAAGACTGCAATGCACGCGTTTACACAAACTGGCACAGAATTAAATGGATGGCCGGTATTAATGAAACCACTTATTAT
CTTGTTGGTACTTAAGGGTTCCTTTATATTTGATTATACAATTAGGTGTTAAATAAGCGAATTAAATTATAAAAGTTATTTGTATTAGAAAAAAATATGA
GTTTTATTATTATTATATCAATAAAATTTTCTTTTTTTAGAAGAAAATTGACAAGGAAAGCATTGATTAATTTGGCCTACGTATCAATTTAATTTTTGAT
AAATTGAATAAATTAATGGACAGGTTAATAATACGTCCCCCTTGCGTATAAACCAGGAAATTGTAAGGTATAATTCACAAATAGTCATTTTTAATAAGAA
ATAACTAGTAGTTTTATCCATAAATTAAATTTATATGACAACAAAAAAATTTTTTAAGACAATTAAGGAATCCACTTATAGCTTTCAATCGTATTTTTTT
TAAATTCTAATTTATTTATCTTCTTTTTTTTTATATATATTTTAGTGTTGAATATATGGATTAAGGAATTAACTTACTCTTAAAAATTAAGAAAAAATTT
AACAAAGAAATCTTAATAATGATGTTAATTAAATACTCTCTTTGTTCGGTATTGTTTGTCATGGTTTGTATTTTTAGAGTTAAACTATAAAAAATTTGAC
TTACATTTTAAGAGGTATTTTTTCGTCATGTTAATATGCAAAAAGTTGTAATTTATAGTACTTTTCATATAGTTTTAGAATATCTAATTTTTTTGTTTAA
AATATTGAATTAATGTGATCTAATTAACTTTTGAAAATTAGTCAAATTAATTTTCGATAAGCACAACATGACAAATAGTTTCGAACGGAGAAAATACTTT
TTAGATTTGTGAAACATTTATTATTCTTGACCAATTTTAGAGTCTAGAGAAGGTGTGTAGGGGGGCATAAACGGAAATTCAAACTAAATACAAATTAATG
AGTCACAATTAAATGATGAAGTTAAGGCTAATTATTGGCGATTTGACCCTATTCTAAAAGCAGAACCCTTGGATATTTTATTTAAAAATAAATTCAATTG
AACTACAATTTTGTTTTTTGGCAATTTAAAAAGACTGAAATATTTTAAAATTATGTTTATAGTATCACTTTAAAAATTAACATATTTCAAAATAAGTACG
AGTAATTTTGATTAGAAATATGAGAGCACGATATGAAAATTTAAAAATCATACGAGCTAAAAGTTGATCAGTTAAAATAATTTGTCCATAATATAATTAT
AACATCTTTGAGAGAAGAGCAAATTATACGTACAAAAAATTTTGGAATATATTTTAGTGGATGAGTTCCACAAAGACCATACAAACACCTAATAAATTGC
GTAATTAAACCATCACTTTTGATTTTAAATTAAGTGATTTCTTTTGATTACTTTAAAACTTGATAAACATAATTATTTAACAAATACATTGACAGTATAT
AAGATATTACCTATCGAGGGCTCATAAACTGATCTGAATACTAAAATTATCATACGTAAATTAAAAATGACTAATACCCTTAAAGAGAGAGATCAATTTA
CATTTAGGGAAAAAAATATCAAACTCTCTTAATTAGAAAAAAGGTCACCTCAACAAATTATGTATGTAACTAATAAAGATTTGATGGTGATTTCCCCTTG
CATCCGTGCCTTATATTACTATATCTTTAAATTATAATTATCTTTTATATTTACGTTTTTAAGCAAAAATGGTTTGAAAAATATTCTAATTTTGATCGAA
AGTGTTATTACGATATCAAAGGACCTTTTACCCTATACACTATTTAATAGAGTATTTTAAAGGTGTGTATATATATATATATATATATATATATATATAC
CCACGTAGACACATTACTATCTATAATGATGCAATTGTTATGATGTTCATGTAGACACATATATACATTTATAATATACTATTAAATAATACAGGGTATA
AAGTCATTTCGAACGTTTGGTATTGTTACAACAATTTCAATCATGATTCAGATACATTTCAAATCTTTTTCTCTTTTTCTACGTTCGATTAAATTTAAAT
TTATACATTAAAAAGCTCATTTATGGAGGTGAGCCCAATGAGATTTTTTTTTAAAAAAATTCAAATTCGAAATCTTTAATTAAAAATAAAAAGATGTCGA
CATCCGCTATAACTCATTATCTTTTGTGCTTATGGAAATGTAATTTAACTTACGTTTCAATGCAAATATTATAGTTGAAATGTTCAACTCATTTAATTGG
ATTAAACTTTCATTTTCATCTTTCATTTACAACTACCTTTAATTAATTTCCCCAATTTTTTATGATATTGATTGAAATACATATAGAACCTAATTAAAAT
ACAATGTGAAGAGAAAAAAAATTATTTGTGGTCCATGGTCACCCAACAAACCTTATTTGTACTTGGTGTCAAACCAAAGCCTTAAATTAAAAATAGGTAA
TTGTTAATTAGATCTTATCTTAATTTAAACAAGAAATTAATAGGTAGCAAAAGCAGTTGGCGTACGTACGTGTTGACTGTTATTATTAGTAATAAGAAAC
GGTTCAATTATATTCTTATTAAGTTATTCTACAATATTATGGTTATGCATGCCACATGTGCAAAATTGTGGTCAAATCTTTGGTCCTAATAGTTTAATTA
TAAGGAGAAAAAGATGAATATATTTTCAAACTATTGTAAATAATATTCAGATATTTTCTGTCGTATTTTTGAGATATTTGTGTCCTTGCACCATCTGTAC
AGTAGAACATATATATTCTTTATATTAACGGACATACACGTGGTATAATCTTATATATTGAGCCGATATTTATCAAATATCGAATCGGCGTTTAAGATTA
TGTGATGTGTCCCTATTAAGTTTTCGTTAGAGTAAGGGTAAATATGTAATATGTTCTAGTTTTTGGATGACAAATACACTAGTGTACCAAAAGTGTAACG
GAGAGTATGCGCATACCGATTCAGGATATCTTTATTCTTTTTTCTCGTAATTATATATCAATTGACATTCTTTAAAAAAATTAAAAAAATCCCCCTACCC
CCACTCCACTAAAAGAAATACGTATAAACTCCCTGTTTTGGTGTTTGTTTTAATTTGACTGTATACAAAAAAATTTAAAATAATAATTTTATGATCATAA
ATTGAGAAGTTAGATATATAGTATATAATTTTTTATTTTTTTTTTGTGATCTTAAATATGACTTAAAACTTTTAAGGGAACGGTTATATATTTTGTTTTA
AGAAAGAATAAATGACAACGTTTGATGATGACCGTTCAACAACATTAATATTCTCTTCTGTCTATTTGAATGTCCTTAAAATATTGCAGACATATTACGA
AAATTATTTAATAACATTAATCATAAGGGTTAACTGATTAAATTACTTTTTTAATCTCTCCTTAAATATTCATAAATTTTCTTGAATTTTATATAAATCA
TTTATTAGACGCTGAAAGTAACTGTGTTAAACATGACTTGAAATTAACAAATCATAACCATATGTAGCAAGTTTGTGCATACATAAATATAAATAAAAAT
ACACTACAGTAGTAGAACCTATGACATTGGATAATGATGAAATAATGAATATCTCGTATGAAGTAGAAATTTGAAAATTTGAATTTTCGTAATTTGAAGT
TATATTAGGATATATATTTTTTCTTTAAAAGAAAAAAATAGTAGTTTTGTGAGAAAAGATCATAGAAACTTCAATTATTTTCAGTATAATAATCTTATCT
AATTTCATGATTGACCGAAATAAATTAAAGATAAATCATCAAATCCAAAAAATTTATGACGAAATGCTAATGGAATACAATATCAAGGGATCAATAAGGG
TTGTGGCGAAGTGGTAATTAGTACTCCTTCATCCTTAACTAGAGATCTCATATTCGAATCCCCCAAGTAATGAGTCTCCTTTTTGTTACAAAGTTTATAT
TTTCGATGCAAATTAACTATAATCAAATTTTAATATAGATATCGAACACTAGAAGAGAAGATACAAATATAAAAATCGAGCACGAGGAGAGGAGATATGA
ATGGAAAAGCAAATTAAAATGATGTTGATATGTAGGTGTAGACAAGAGACAGAGTGGTTTGAGCAAAGGGAAATAGGTGAGAGGCACATGCAAAAAACTG
AATAATTAACAAACCACTCCACATGCATGTGAGGTGCCCTATAATATAATTTAACTCTATTAGGCAATAACAACTCAATCATATTAGCCCATGTTCTAAC
CTAAATTTCTTTCAACAACCCTACTATCCTTTGATTGCTACATTATGCCCAACCTTTTTTTTTTCTCCTATTACTTTAATTTTATATAAATCTTTGTGTG
TAAAGTGGACATATCATTGCATTGGGTTGTGTAAGATAGTTTTTTTTTTCACCAAAAGTTGGGGCTCAACCATTCATAGGTTATCCAATCTAATCATTGA
TGTGCAATCCTGAACTTGTGAGGAGTGATAGAGGTCCCATTAAAATTCAATTGTATCTTTTTATATTTCTATTCTGTGCTTTAGGGTAATAGGATCTCGA
CTAATTGAAATTTGCATGGCTAAAGTTAAGAAAAAGAGTTTTTCATAAGATATTTTTTTTTTCATTTTTAAAGCTTTAATCGAAGATCAATGGCGAAGTG
AGTGGCATGTGACATTTATAATCATATACGGTATATATAAGGTCTATTTTTATAATATATTAATCGTTGAATTATGTTGATTTCTTGGTATATTAATTCT
TTTTATCATTCAATTTCTTTTATTATCTTTTTAAAAAATTTATCGTTAGATTTTTTTGTATCTAAAATGTCTAATTAAGAAAAAAAAGGATATGGAGAGA
ATCTTGCATAAGCTTTTCTTCCAAGTTCCAAGAAAAGAAGAAAAAGACAAATTAAGACTACTACTCATTAATTATTCTCAAGTAATGATATTTCTTGAAA
GAAAAAGTTCACACATAATTAACTTTTGGCTATCATTTTTAAAGTAAAAAAAAAAAAGTAAACCCTAACTTTCGCTTTTTGTTTTGAAATACCAAGTTTC
TAAACCTAATTTTTTGAAGAATATATTGTTTATCATCAAGATGCACTTTTTTTTTTATAAAGCTCTAGATTTTGTTTACCTTTTAGGTCATCAAAAAGGG
GCCATGACTCATGTAGATGTAATAAATACAATTAGGTATAAAGCAATAGATTTCTATCTATTTGTGGCACTTTCATTAAATTGTAATTCATATAAATATT
TATCACATTTTGTAGTTATTGTGAAAGCAACAAATTGACAACCCAAATTTATTGTGCCCGTGACACTATAGGGACCATGAAGGTTGAGTAAACAAGGTTT
TTGTAGTTACACATCACTAAAAAAACAAATAATAATTAAAAAAAAAAGAAAAAGGACATAGATCGTAAATAGTCGTTCATCCAAGAACTTAAAACTAAAA
AAATAAGCAACAGATGTATAATATGTATATCAGTTAGGAAAAGTAAACGGTGAATTCGATCAGCTATATGTCAATTGAAGAGAAATAGATGAGACAAGTT
TTTTTGGATGGAAGCTACAAATGAATGCAATTAAGCTAAGCCAGATCATAAAAATAAATTTCCAAGTCTAAAGCACGTGTTGATTGTAATTAGTTACCTA
ATAACTTAATTAGTGAGTTGGTTGATAAAGGACAAGGCACCTAAAAAGCATTCTCTCATTCTAACCACAGACACTCATTTACACTATCCTCAACCTATTT
GGGCTCTTCGTAGCTGTCAAAAGGACCCAACTATGGACCACGACCACCATTATTTGGTTGATTATCACTATCATAATTCATAATTGTGGGCTCAATTTTT
GTATGTGTATCCAGAAATGACAAGTATAAAATTAAGTCCAATGTTTCTCTCCTTATTTAGTTCTTTGTTATATATAGTAAAAGAAATTTGAAGTTGGTTT
AATGCACATGGAAGCATATGGTAGTACATATAATGAAGTTAAGCAATAAATAGATTCTTAATAATGTACTCTAAAATATTAGAGTTGAGTACAAATAGAC
GTGTAATAATAGTATATTGGGTTAAGTTATTTACTATTAGATAGTGATATGACTAATAAATTCTAACTACCACATAAGAGAATACAAAGAGAGAGAGAGA
GAGATTGTGATGTTGACAGTGACGAGGAAGGTGGGCAACTAAAATCTTGAATTCAAAGGGGGGCAAAATATTGACTACTGAACAATTTTGTCAGCTATTA
TTGTATTGGCAGCTAATTTACTTTGCTGGTCACAGTGCACCAGTCTGGGATTTAAGGGTACAAAATGAAACTAAGATTTAATGAAAGTATGAAACTAAAA
CCCCATGTAATCCCACAAGTCGCGGGTCTAGGAGGGTAAGATGTAATCAGACTCGAGAGAAATTCAATAAAACTAAAATCCATCATCCATCAGGGGGAAA
AGGGACAATGAAAAAACTTTTGTCCAAAAATACAACAAAACTATTGTGTGTACCTGTGAGCTGCACGAAGCCAGGACTAACTATACGTCTTTGTTCTTGG
ATGGAATAATACTACATGAACTTGCCTAGGTTACAGCTTGCTACTAGAGTATACTTGATGGGGGAGGATATACTTTACAGTTTTGGGTCAGGGATGAGGC
TACTGTTGCAGTTGTTGTGTCCTGGGTGTAATGCTCAAAAAATATTGAATCCCAACCAAAGCAGGCATCCCCCAACTACAGCTATCCGAAAGATAGTTGC
AAAAGTTTAAGTGTAGCATCGGTGTTGTTAAGTCGAAATTGTGTTAGCACTATGTTCTGGAATGCATGAAGTGGCTTCAATGACTTTGCGATAGTAACGC
CAAGATGCGTTCTTTTCAGTGATTGGTCGTTGACCAAATGGATTACTCTCTACATACTTCTGAACATTTTCAGCCCTGGACAGTCCATCAAGATAAATGC
GCAGATCACCCTCTGGCCCTATTGAGAATAATGAGATGAAGCTTATTTAATCTTGACAGAACTGGATGGATATAATACAACTACGTCATTACTAATAAAT
TGGACACAATAGTATTCAATTCATATTTTTTGCACTCACAGGGAATACAACTATCATTCATATCCCACACAAATAGACGAATTACTTGAACCAAATATAT
TCACATTAAAATAAAGCACTTGGTTATATTGAAAGAAGTTGAAATGTGGGAAACTATCAAGTACAATTTGAGACCCGTTCAGAAAAGATGAAAATTCAAG
GACAGCATCTATTTGCACGATATATATGAAATGCCCAATCAGGAGATGCATAAAGTGAAGTCCAAACATAATAGTCAGATTACCTATCATGTACATGTTT
GGAAGAGAGAGAGATACGCACCTAATGAATCATCTTTCTCATCCGTGTAGAGGTATGTACTTGGAAATACTGCTGTGTTTGGCTGAAAATAAATAAACAC
AGCGCAAAATCATTTACTTAAAGGTCATGGAGGAAGGTTCTTGGCAACAAAGAAAGGGTTAATACTCACTGGATTACACAAGGCCTTGTGAGGAGAATCA
TCCAACAGAAGTGTGTTTGACTCATCATATTCACCCCTCTCCCATGGAAGATCTGGTTCAAACTTCTCCCATAATTTTTTAAGCTTCTTCAAAATAATAG
ACTTGCTTCTCTTCTTACCAACAACAGGGAAACCAGTATCAGTGCAATGGGATTGATCCTGCATGACATTCTAAGTTATTATACAGAGTTGAAAGCTACG
AATGAAAAAAACTATAACAGGACAAGGCTAGGTTATCAATTTAGTTAATTCAAACTCATAATTGAATTTTATGAAATACTGTAACAAGTATTTCTCATCT
TTCATTTCGTTGAATATGTAAGAAAAGATGCCAACATCTAAAAAAACATTTTGAGGGAAACAAAATATTAATTGATTAGGATAAGCAATGTAGCATGAGA
GATTAGAATTAAGTGCTTCAAGGGTTTTTTGGTACTAAAACGTCAGATTCAAATTAAATGCAAGAATAGATTATTCAGGGGATATTCCGTTGGTACAATT
TACCAAAGCATTAGATCCTCTCCTAACAATCTTTTTATCCCAGGATGTCCTTCATGAGGCCTACTAAACCAGCATCAGGGATTCTAAGATACTTTTAGGT
CCACAAGCAAAAGGGAAAATCAAGAGCAAGAGACAAGAGATGAGTTGAAGAAGATCAATGGAGAAAGAGAGGGAGAAGCTCCACACCTACGGTGTCACTA
TATTGTGAAGCAATAGTTACTACAAATTTCAAAGGACAATGCCAAAAAAGAAAATTCCATGCATGTAAGTATGCTAGAGCCTTCAGTTATGAATTGGGAC
AGATTTTGGATAGTGTTCACTTGGTTGATGTAGCCTGATAGATGGTGGTTACTCTTCTAAGGAGGTGATCCTTTGAGTATTCTCGGAATTCACTCAAAGG
ACTATATCTCACACACTGCTCGCAGAATGTTCACCCAAACCCTGTATAGACACAAAAGATAGTGTATATCCATGAATATTTTATTCGAGAGCTATTTCCT
ACCTGACCCACAGAGGCACCTTTTTTTAAAAAAACTGGTGACCTCACAAAGGCTTTTTTTTTTATAACCGAGAAATCAATCTGTGACTCGCCACCATTTG
GACCAATCACACCCTTCTAAACTCGGTGGAATATGCATTATCAAATTTCTGGAAAGAATCTCCTTAAATGAAACAAGAAAGCAAAAATCCATGTAATAGC
CTTAGCTCAAATTTATTAGTTTACAACCCATCAATGGGATGATCGTATATACAGCTTCATAATTCCATAAAAAGACACGGGAAAACAGTAAAATGGAAGA
AGAGAGCATAATACAATCCTGGGTGCTCATACAAGAAAGACCATACTGAAATCACATGTGCTTTTTCACATGGACTTGATTCTTGTTCTAAGTGTAATTT
CCTAGCGCTGTTTGATCTCCAGAATTAAGCGACCATGCTCACAAGATTATTTTTTTTGTTCCTGGTGCTTTCAGATTAAAGTTTGCAGACTTGCACTGAC
GCTAATTTACGATATTGAGGAAGAACAGATTCTTACCCAACAAAAGAGCAATTTTTCCTTGGCATTTCCCAGTAGAAAATCAAGAAACAACTCTACATTC
TTCCTGCAAATTTTTGGACAACACACATAAATATGTTAACACATATATGAACTTCATAAATATGGAAGTGAAAAAAATTCAGAAACTACCTGATTCTCGA
CGACCAAACACCTACATTAAATTTCTCAAAGCAGAATTGCAGAAAATCATCATGAAAAGGCCTTTTGAAAACTGGTAAAACAGATGATCACTCAATTAGA
AGATTTTTCAAAAGACAAAATAGACATCAGAATGAAATTATTGGCGCCACTACCACCTGCTTTCCCTGAAACAATGATGTCCACTTTGAAACCACGCGGC
ACAAGTTGAAGCGGAACAATATCAGCAAGAAGTCCATTCAGATCAAGTACAAGAAGCTTTTTATTTGAATGTCCATTAAGCGCTCTCCTCAATGGAGGGA
CGGTCCTGATATTTGCGATTTCAGTGTTTGCATCTATGAAAGCACACATATTTGACGGAGAAGAACTACTTTCAGCTAAAGATTGTCTTTTCTCATCGAA
AATTTCATTGGTTAAAGACCCAAAAGTGCAAGTGCCAACATTCTCCATGAATGCTGGTAAACTGTTTCCAAGAGTACTGAAATTCCTTCTCCTCTTTCTA
AAATAGGTTCTTAGTACTCTCGGTCTTGGATGTACTCGTTGACTCCTTGTAACAATGGAAAAATCATTAACCTCAATAAACTCACTGCTTTCAGCAGGCA
CAGTGATGTCCATGTTAGCCGATTTTATTTTGCTCTCTTCAATCACAGCATCCTCCACAATTGCTGGTATAGTGCTTGCAAGAGCAACAGAATTCTTTCT
CCTCTTCCTGCGATATTTTATCAGCACTTTTGGTCTTGGATACATCTGTAGATTCCTTGTTTCAAATGAAAAAACAGTGCATTCATCAGGCAAAGTAGTG
TCGGCGTTAGTGGACTTTGTTTTGCTCTCCTCAATCGCAACATCCTCCATGATATCTGGTACACAAGTTGAAAGAGAGATAGAATTTTTTCTCTTCCTGC
AATATGTTATTAGCACCCTTGGTCTTGGATACATCTTGAACTCTTCGTCTCAATTACAAAATTGCTAACCCAATTAACTCAGTGCTTTCATCAAGCAAAC
TGATGTCTATGTTAGATGGCTTTGCTTTGCTCTCCTGAATCACAATATACTTCAAAATTATTTGTATACTGAATAGAATTTATTCTCTGCTTGAGGTTAT
CAGCACTCTTGGTCTAGGAATATTTGTGGGCTCCTTGTCTGAATTGCAAAATTAATCTGATTAAACTCACTGCTGTCAGCAGGCAAAATAATGTCTTATG
TTCGTAGATCTTATTGTGCTCTCATGAATCACAGTATCATCCAAAATTGCTGGTAGCTGCTGGAAAGAGCAATAGAATTCTGTCTCTGTTTCCTGCAGTA
GGTTATAAGCTATCTTGATCTTGTACATATTGTGGACTCCCCCTCTCAATTTCAGAAGCATTAACCTCAATAAACTCAAGGCTTTCAGCATGCAAAAGTG
ATGTCAATAATAGTGGCTTTTGTTTTGCTATCTCAAATTACAGCGTACTCCATGATTGATGGTATACTTCATGTAGGAGAAATAGAATTCCATCTCTGCT
TCCTGCAGTAGATTATTAGCACTCTTAGTCTTGAATATATTAGCGGACCTCGTCTTGACCTCAATAAATTAACTGCTCTCAGAAAGAAATATGATGCCTA
TGTATGCAAACTCTCATCACAATGCAACTTGTTTAACAGCAAATCCAAACTATCGGAACAAAAATCCTTAAACATGACAACGTAGAGACCTGCAAGCTAC
ATTATTTTCAAGGGGCAGGCTCGTCTCTTCAGCTTGATTCTCATTTTCTTTTATTTCTCTGTGAACTCATATCCACAAAACAACTTCTTGCTTGTGACCT
GGTTTCAATTATTAAGACGACCAGTGACGCGAGCTCATTTTAGAATTGTATTCCTATGGCCTCTAAAGCATTCAATATCAAATATACAAGATGACAAAAA
GTACCCCCTTATGTTGCCTATTTTCTTTTCTTTTTTTAGCCCTTCATGTAATCAATGTCAGATCAAAGATTTTAACTTGATGGGTTTAATCTTTATAATT
TTACCAGTGAACCCATTGAACTTTTGAAATGATGGGTTCAAAATGTGTTTTACTGAAATTTTGGTGATATTACTACCCATATACCTAAGCTCCAAATTAA
AATTACAGGGTTCAACTGAACCATCTTGTTAGCTACATCCGCCACTGCATGTTATGAAGGCAGCGATATACAAGCTATGCTCTCCTTCTACGAATGCAGC
ACTGCTGTGTACTTCATTTCTCAGTTCAATACATCCTTACTAGTTCTCTTTTTAGCAACATAATCTGGGAGCTCAAGATCAGCCAATTCCTGGAAACCAA
TCTTACTGCTATGCCTCTTCCTCACAGACTAGTCACCTCAATACCAAGTGAAACACCACCAGCAACAGGAATTCCAATTTCCTGTTGCTACTTATCTATC
CCAAACAATTGAATATCATAGGCCAACTATCTCTATATGTTAAGCAATGTTTACTAAAACCAATAAAACAATTGAAAAGCATAAACTAGATTAGTTTGTT
TTCTCCAAATCAAGCTATCATGAGTTCTAGAGCAAACAAAACACCGCTTCGTCAACACCTCATAAAGACACATACTTCCTAGGATTAGTAAACATCATCG
TGACATGCCACTGTCCTATCTCTTCAAGTCCTTGAGTTTGACTTTTACTAAACTTAATTGTAAGTACACACTCATAAACTGCTTGATACCGTGTAATCAC
AATCCAAATAAGGGGAAATGCCTATAAATTAACAGTTGTAGTTTATTAAACAAGCGAAAATAAAGTAAGATGCGTTCAACAGAGTTAAGTTTTAGAGCAT
TACCAGATTTGAAGCACTGCATACACATGAAGTAAAATTGGAACTCAATTACAACCTAGAACTCCAAAGTGAACAAATCGAATACTTCAATCCATCAGAA
AAATGTAAATTAAGTTACGGAAACAAAATCTGAAACAGCAAAAGAATTGAAGCCGGCGGATGAGAATACCTGAAGCATATGAAGAGAGAAAACACTTTGA
GTTGTTGTCTTTAAAGGCGACAAGCTTTTTGAAGCACAGAGAGGTGACGTGAGACAGTGAAGTTGGGGAATATGAACTATGAAGACGACGGATCGGAGAA
AATGGGTTCAGTTTTGGTATTCCAAGAGATTGCGGGGATCTCAGAATTAATATTGCTATTTCCAAAGGGGCCAAATGAGAATATTCTTGCAGGAAAAAAA
AGGATATAATTGATAATTAACCCGTTAATTAGCATAGTTAAACCTCTATAAACTAATATAGCATTAAATTTTATTATTTTAAAAAAATATTTTTCAATCG
ATAAATTAATATTTATTAATTTAAATAATAGTTTGAGATTTGATGAAGGTTAATTTGATTATCTCAAAATCATTATATCTTACTAATTTATGTATCATAT
TCATCGATTTCACATAAAAAAGAATATAACGAATACATCAAAATCGTTAGTAACTTATTAATTTCAATGTTGAGATGTTGTAATAATAAAAGTTTTCAAG
ATATATTATCGAACATAATTTATCGTAGGATAAAAGAAGACTATGGAGTGGGACAAAATGATCCAACAAAGGTCAATGTTTTGGATGCTATCAATTATGC
ACTTTGTTTGAACAAAAAATGTTTAACAAGAGACAATAGCAAATTGTTTTCAATACTATAAAAATCGTTCGGGCGATGCAATCTCAAAGGATCTTAATGA
ACCTACTTGTGAAAACGTTATTCATGAACTTGAGATCGTGATTAATGATCTCGGTTACCATAGTAAAATGAATGTCTATAACCTGTTTGGATTATCCGAG
TGAAAGTAATACTTGTATAGAGGTCTAGAAGTTTAGAAGAAATTGTGGATACAATCGAAAAAAGCAATGTTGATGATGAAGTTAAAGATGATATTGTACA
TTTGGAACCAGATACGCGTAAGGAAACACTTATCGCATCTAGAACTTTTCACAATTTTATGGTGCACTTCGAAAAGACAACACCAGAGCTCTTGGATACA
ATAAGAAAAGTTAGAAATGAGCTTCAACTATATTTAAATTTTAAGAAAAAACATAACACAATTTAATCATATTTCACTAAATTGTCTTACACATATTTAT
ACTTTAAAAAGTTATTAATTTATGATATTAATGAAATCATATATTTATATAGATATCTTTTGAAAATATATTACCTTAATTATCTTATCGAAATTGATTA
CAATATTTTAGGAACGAACACACTTAAATACTTTCTCCCACCCCTTTTATTCATCAAATGTTGACATAATGTTTATTATTTTATCTTTTCTATCTATAGA
GTTTCAAATATATATTTTTAAAGATATTTACTCAATTTAATAAAATAAGAATATAATAGAAAAAAATTATTTTTATTTAATTTTTGTCATAAATAACAAG
TGAAATAAAAAATTAGTAAATCAAAATTATTTGATGAATAAATATGAACAGAGGGGTATGAATATATCTTCTTGTTATAATTTACATTGCAATTTTTATG
TTAATTCTTGCTTTAGATACCATAAATAATTTAATGTATTGATTTCTAGGATCGATAAAAATGATTTTGTTTCTATCCCTTATTTGTGATTCTTAGTTTT
TCTTTTAAAAAAATATTTGATTAATATATACTAGATAAATTTATGAAATTTATATATGATTGTAATGACCTTTATTTACCTTCCGTTTTTCTTATTCACC
CATAATTGTAAGTTTGTAACCTCAAAATATTCCAAATATGAACTACATAAAGCTGAAAAGACAGGGTCGAAAAGAAAATTTAAAAGTTCATAAAAATTAC
GAAACCGACCTCGTAATATCCCGTTATTATTTGCACAACAGTCCACTAAGTCCAGCCATGCAAGCAGGCACCCACTACACCGAATAGTGTTTCAGATATT
TTCATATCCCTTCCGTTGCTGTGCGTGCCGTTAGTTGTACCTATAAAGCCCTACTGCTCTTCGATCAATTTCTCTCAACAGATCTGATCCGAACTCCTCA
GGTACATGATGCCGCTCTCTCGTTTTGCTCTTACTGAGTCTGAATCTCATTTTTTTATTTTTTGAATGTCGAATCCCGTTGTTGTTGTAGTTCGTCTTCT
CTGGATCGGCGTTTTGGTTTAGAATCTATGCATCATTTTTTTTCATAATTATCATGGTTTCGGATCTGAGTTTATAGAATGCTGCTGATATACATGATGA
TGAAGTTTTCGCGATTTTGATTTGCATCCACGGTGCTCATGATTATCTGTTTTATGTGTTGTTGATTAACATGCATCGATATATCTGTGTGCAGTGTATA
CTGCTGATTCGTTGGCTTTCCGTGTTACCGATGAAATTCTAAGTGTTATCTGAAGGAATTAGAAGAAACTGACAAGTTTGATAGAACTAATCAAATATTT
GATCCGACAGTTGTTGCTAGAGTAGCTTTAGTTTGTTATGTTTCATTCTGGATGATTTAACAATTACTGCACATGTATATCCACTAATCTGATGTTGCTT
TTGCAATTGATATGCTATATTGGGCTGGAGATTGTGTTTTTGTCTAAGTTTTGAGTGTATTACTCTATTTACTTGGTTGCAAGGTTTGCTTGCTAATTGA
GAGATGTTATCTGGTTTCAGTAGATGGACGAGTCAATAATAGTAATATTAAATCTGGCTCAAAGAAAGAAAAGATAATTGTGTAACATGCGTGTAATTGG
TCTAAATGGATACAGAGCTTTGGACTTCTAATATCACAGATCCAGATAGATTTGAAATCTACGTCTGCAGCTATTTCATTATTGTGTATATATGTTGATT
GATCTGAATAGGACAAACTTATATGTATGTGTGTCTAGTCAGAAAATATGTATGCCAGTCTTAATATTATACCACATTGTAGTCACATGTTACCAAGTTC
TGCATTGCCTTTGTACTAATAAAAAAGAAGTTCTGAATTACCTTTGTGATTTCTCAATAAGATATGGTTAGTTTATTATAGGGTGGTTCATGGGAAAGGC
AAGTTATATACTGAAGTGGGAAGAAGAAGTTATATAGACTGAAGTTTTGCATTTGAAATGTATAATGTTCTTGTAATCTCTATATAAGTTTCTCTCAACT
TTCACCAGGAGGAAATTCATTTAAACTATAAGGTTCCATATGTGATACTGTTAGTAGTTCGTTTCACTCACACATATTGTAGTTTATCTTTATGAGGTAT
ACTGCAGTGGATTGTAGAGCTTATTTGTACTTCATACTCTTTGTTTACAATGTCATCTAAGTTTTTCTGACATTGTGTACTGCTGCTTTGAGCAGAATCA
ATCAATTAAAAGTTTGAGAGATCATGGGTCGTGGAGTCAGCAGTGGTGGAGGACAGAGTTCCCTAGGTTACCTCTTTGGAGATGGTGAGCCTCCAAAGCC
TACTAACAACAAGGTAGAAGCTCCACAGAATCAAGGACCTACTACAAGCGATCCACAGAAGCCTACTGCAACTGCACCAGCTCCAAATGTTAATAAGCAG
ATTCCAGCTGGCATCCAGGGGCGCAATTCCAATAACTATTTCCGTGCAGATGGACAGAACACTGGGAATTTCCTCACGGTAAGATGCAGATCAGCTTTCT
TTCAAAGTCGATTTTACAATGAACTTGCAGATCACTTATCCCCTCCTACTCATTGGTTCTTTCTTTATGATTGTCAAATGAATTAGTTTTTGAAATGACT
GCTTTCAGAAGGTGAACTTTACATAGAAGCAGATTCTTTAATGAAGAAATTTCTTTTCCATTCTCTATTTAGTTCAGTACTACAGCTTCTTGCATTCTTG
ATTCTATCACCTCCTTCAGTTCTTGCTGCTCCAGGAGTAAAATTGCGGATAATAACATCTAAAAAGTTCTGAAGGAAGTTCTTTTCCAATAGTTATTTAG
TTCAGTACAACATGCTTCTTGATTCTGTCACATCACATTTCTGTTTGTAGCAACTTCTGTTTTCCAATCACCTGGGATTTTGCCATCATAAACATTTTAC
CAACTTTTGGGAGGGGATATGTGAACTGAACGATCCTGTTCTGGAGATGTTCTTTTCCATTCTTTATCTAGCTCAGTAGCATATGCTAATTCTTTCACAT
CTTATTCCCTTTTTCTTGTCTATTTCACAGGGTAATATTGTCTTGTCAATTAAATGTTTGAATCTTGTGTCTTTTCAGGATCGCCCATCTACCAAAGTGC
ATGCAGCACCAGGTGGTGGATCTTCCCTTGGTTACCTGTTTGGCGATGGCAAGAACTAGTTCCTTCTGTCCAAAGATGAAACTGTGTACTGAGAGATCCC
CTCATAATTTCCCCAAAGCGTAACCATGTGTGAATAAATTTTGAGCTAGTAGGGTTGCAGCCACGAGTAAGTCTTCCCTTGTTATTGTGTAGCCAGAATG
CCGCAAAACTTCCATGCCTAAGCGAACTGTTGAGAGTACGTTTCGATTTCTGACTGTGTTAGCCTGGAAGTGCTTGTCCCAACCTTGTTTCTGAGCATGA
ACGCCCGCAAGCCAACATGTTAGTTGAAGCATCAGGGCGATTAGCAGCATGATATCAAAACGCTCTGAGCTGCTCGTTCGGCTATGGCGTAGGCCTAGTC
CGTAGGCAGGACTTTTCAAGTCTCGGAAGGTTTCTTCAATCTGCATTCGCTTCGAATAGATATTAACAAGTTGTTTGGGTGTTCGAATTTCAACAGGTAA
GTTAGTTGCTAGAATCCATGGCTCCTTTGCCGACGCTGAGTAGATTTTAGGTGACGGGTGGTGACAATGAGTCCGTGTCGAGCGCTGATTTTTTCGGCCT
TTAGAGCGAGATTTATACAATAGAATTTGGCATGAGATTGGATTGCTTTTAGTCAGCCTCTTATAGCCTAAAGTCTTTGAGTGACTAGATGACATATCAT
GTAAGTTGCTGATAGGTTTCCAGTTTTCCGCTCCTAGGTCTGCATATTGTACTTTTCCTCTTACTCGACTTAACCAGTACCAACCCAGCTTCTCAACGGA
TTTATACCATGGCACTTTAAAGCCAGCATCACTGACAATGAGCGGTGTGGTGTTACTCGGTAGAATGCTCGCAAGGTCGGCTAGAAATTGGTCATGAGCT
TTCTTTGAACATTGCTCTGAAAGCGGGAACGCTTTCTCATAAAGAGTAACAGAACGACCGTGTAGTGCGACTGAAGCTCGCAATACCATAAGCCGTTTTT
GCTCACGGATATCAGACCAGTCAACAAGTACAATGGGCATCGTATTGCCCGAACAGATAAAGCTAGCATGCCAACGGTATACAGCGAGTCGCTCTTTGTG
GAGGTGACGATTACCTAACAATCGGTCGATTCGTTTGATGTTATGTTTTGTTCTCGCTTTGGTTGGCAGGTTACGGCCAAGTTCGGTAAGAGTGAGAGTT
TTACAGTCAAGTAAGGCGTGGCAAGCCAACGTTAAGCTGTTGAGTCGTTTTAAGTGTAATTCGGGGCAGAATTGGTAAAGAGAGTCGTGTAAAATATCGA
GTTCGCACATTTTGTTGTCTGATTATTGATTTTTGGCGAAACCATTTGATCATATGACAAGATGTGTATCTACCTTAACTTAATGATTTTGATAAAAATC
ATTAGGGGATTCATCAGAACTGTGTAGTCATGAAAAAACAATGAGACTGCTGTTACTCTATGTTGGTTTATTTTGTGTCTGGAGAACCAGTCTCGGCATT
CAGATGATCCAATTGTAATATGATCATCCTTTCCTATTCACTGTTGGGATATATACCCAAAGCTTCAACTGTGAACTATCCTCAATGCCTGGTTAAGGAA
ATCAAGTTTTAGTTCGTGTGCTACTGTTGTTCTAGGATGCAATGATTCTAGCATGACTTTCATTTTTAGATAACATTGAATGGCCATTATTATTACGAGA
GAAAGCATTTTTAAGTTCTTACTATTTCTCAGTCCAAAAAATTCTATATTCACAGACCACAGCCAGCCTTGGAACTTGGGTATCATGTTTTTACTTGGGT
TAGTTTTAAATCAATTTAGTGTTTTTTTTTCAAATATTAGAATTGAATCTAATCATTTAAATTGGGTTTTAATGCTTTCGTTTTTGTGGTCTTCTTTGAG
AGTTTGTCGACTTATATTTAAATATATCTAACAATGTTACATCGAAGTTCCCAACCACATACTGTATTAGATCGACTATAGTCTAGATTCTAACATAACA
TCACCGAATCATTACTATAACTTCCTCCGATATAAAAATGTATGGAAGGGCTTAAAATTTAGCCATTTCGACGAATATAATAAATTTCAAAAATAAGTTT
GTTTTGTGAAAATAAATAAATTTAGAGTTGTGACGTACCAAAACATCTTTAACAATAACTAAATGACTTTTTTGTACAAAAAATATGGATAGTTCGAGCT
TAAATTTAGTTAATCATGCATTTTTTGAAAAATTTATAAACTAATATACACAAACAATTTAGATAATTTTAAACTTTTGTTTTGTGACATAAACTCTAAA
AAAAAGTAATGTATATCCCTGAAAAATTATGAGCATCATTTATTAGATCGTTACGAATTATTTCAGAAAACTGAAGTTTAAACAGAGTCGATTAGTATCA
CTTACTAGGTCGTCATAGATGAACCAATAAATTTTTAGCACAATCAGAGCCGGTCACTCATATTTCAAGAAAAACATGTGTTTGTGCACTTGAAAGGTCA
AAATATTTTTGTATTTTCTGTTTCGTGATCCACAAACTCTAAAAGTGATTTTGTCCTTGAGAAACTATGAGTATCATTTATTAGATCATCAAGAATGAAC
CCACAAAATTTGAGCTCAACCAAAATCAATCACACATGTTTCAGAAAGTTCATGAATTAATATACATGAAAAGTTGAAAATAGTCATGAGTTTATGATTC
GTGAACCATAAATTTCAATATATATATACATATATGCCTATGAAAAGTTATGAGTATCATTTACTAGGTCTTCTCGAATAGACCCACAAAATCTGTTCAA
ACAGAAATCGACACATATTTTAAATAAATCATGAACTAATACAATCGAAAAAATCAAGAAAATTCTGAATTCTTATTTCATGATTCAAAAAACTCCTTAA
AATACGATATTTCCCAAACTATGAGGGTAGTCCTAAATGGCCAAATTTGGTCAGAATTTGGCCAAAATTTAAAAAGTTTATAATATTTTTTTATTTTAAA
ATAAACTAATCTTTTTCTCATTTTTAATTAAAAAGTATTAATTGAAAAGATAAAAATATTTTAAAAAATAAAATAACACTGTAAAAAGTGTAAACTATGT
TATTTTACCATTATGACCAAATTCTGGCCAATTCTTTTTTTTTCTTTCTAAATTTATGAACTAATTCATTACAATGGAACGACCCTAATTTATATTAAGT
GAACGAAAAGTGACTTATTTTCCGTTTAAAATTTATAGTTTTGTAAAATTTTAACTTCTAGTATTAACCTCTTAAAAGAATGAAAATCATAAGTTTAATT
TAATCGAAGATTTAAAATATTGAGTAAAATACTATAGAAATCGAAACTACAAATACACATTTGTGTCTAAAATCAAACTCTCCCTTAGTTTTTGGAATTT
AAAAAAAAAACATTTTTCTCTTTATTCTAATTAACTTATCTGAAGATCTATTTTATCACATTATCAACCTTTGTTCATTTTTCCCCCGTAAAATCATGAT
ATTTTTCATTTATTTAGTAATCTATATAACTTTTTTTTATATATATAAAACAAGATGAAAAATACTAGTTATTGATATATATACTATGCTAAGGAGTAAG
CATAAATAAGAAAAAATTAAAAAACAAATTTCAGCAATAATTATCAAAACTCTAATATCCACCCATGTATAAATGCACGTCTATATGTTAAAAACTTATC
TCTAAGCCTTGATGACACATTTTAATCACTCGATACTTCAAACACGAGCTTCCATTTTGTTCCAAATACAATATACAACATCATATTCAATATTCATGTT
TTCTTGGTTATAGACCCAACATACTTGAAGACTCCTCGACTTGTGTATCGATCTTCACTTCACACACGTATCGCTAAACTCACTCTACAAATATTTCTAT
ACATAAGTCTCACCCGGCCTAAAACCTTTAAAATCTATGTTCTATTTCCAAACTTTACAACTAATCATTGACGATCTCTTTTGATCAATATTATATCATT
CGTGAATAACGTACACTACTTACAATATCTTCCCTTGAATATGTCACTAAAGAAAAACAGAAACAAACTAATAAACCCTAACCATGACACAAGAAAATGT
TCCAAGTCACATTTCAATCTGCATTCATTCTACACATCCAAAGTTATCGTAACTGGACCCCAAAAATCTCCAAATAACTCACCCAAAATCAGACCAAACC
AGAAAGTGTATACCATACACTTTCAGAAGTAGAAGCTGCAAAAAATTGATAATGAAAAGAGGCTAGGGAGGCAGATAAGCACTTCATAGTTAATTAAAAA
CAGTTTAACAGGTGATTAGTAAAGTTGTCTCCTTGAATTTCACTAAAGCTTCTACTATTAGCTAAGCTGGTGACCACAACACCGCAGTCGATATGATTTT
TTTTTTTTCATATAAATTCATTGGGAATCTTTACCCAGAAATATCAAACCTAAGGAAAATGAAACTATAATATCCTCAAGCAGACTGTAGAGATGAAGTG
AATTAATTCCCTCCGCCATCTCCATAAAATTGCACAAGGCTAATCGGTGTTACATTGATTCTTATCTGCGAAAACCAATAAAGCAAAAATGAACTGAGAA
TCTAAAATAATAAGCACCAAGTTTTTTTTATGAGAAATGCCACTGTTACAGAAACATAACTAATACTTCTAACATAAGAAGTCTGGGAACAAGCATCTTC
AAGTCTTAACATTGGCAATCCATACTTAATTGTGTCTATCTTTAGACATAATACATCTTTATATTAAATGTATAGTAGTAAAATTACCTCAAATAATTTG
ATTGAGAAAATCTTTTTCCAAGCTGTTTGATTCTGTTGACACCAAAAATGGAACAGTAATCAATTCAATGTCGCAATTCATGTTCTTATCTTTTAGGTAC
AAGTACAACATGTAGTGCTGCCAACAATTTAAATAAATGATAAATTATCAGGAAGAGGACGTCAAAGCAAAGATTAGAGCTAAATCACGTAGCCAAGCTC
CTATCCCAAGGGAAACCAACAGAGATGGAGATGCTGACCGGTAGAAACCATGTTATCTTACTCCCATGAAAATCAAGGTCCCTTATCATATGTAAGTATC
CATTAGAAAGTGTTTTCAGTTATTTTAGCGAAGAAAATAGCAGCATTTTTATGCTTTTCTAAGGCATATTTGCCTCAGCAGACTACGTAAGATATTGCAA
GAGCCAACAGATAACTGGAACTTGGTGAAATTAACACATAATGGGTAACAATACAAATGGTCATAAACTCAAATCTCTGAATGTTGTTCTACATTCTACT
TCTCACAACAGGAAGTAGCTAGCAACACCTCTATATATTTGCAAAACCTAATTTAGTTAAAGACTAGAAAACCTATTCCTATATTATTTAGACTACAAAT
CCTATTTAGACATGAATTAAATAAATACCAAATCCTAAGCAAGTTTGAATTCATACTCAGACTTTGAATTATTGTTCTAACGTTTCTAAATTTCAAAAAT
CTATTCATTTCTTAATCTTTTTTTTTCTAGACTAAATTTTCTAAAATAATAATTGTTATAGTTGATCTATTGCATACGTGCAAGGCACACACTCAATCTC
TCAACAATGAGACACATCAATATTTTCATTAATCTTTGTAGACAATACAAAACTTATCAAAAAGTAAAAACAAAAATAACCAAAAGCCTTTCAGACATTT
TATATTAATAAGAAATTCTTCCACATTAACAAATTTAACAAGTCAACAGAAATTATTACTGAGATTTGGAGACTAACAACATTGTGTGATGTTGACTATC
GAAAATCTCATGAGATCGGATTCCAGGTAAGGGAAGATTTCAAATGAGCAAAACGTGAATACACTACTTTTGCATCAGATGAAAAGAAGGAGAAGCTTAA
GCAATTTAAATGGAAATAACCTACTACTGTATAAGGGACACTAATTCGCTTGATTCAGACAGAACCAGAAAATTCCACTGCCATGCAATTTGTGACAAGA
TCTAAATGCTAGAAACATGCAAACGTCACTAGAATTGAAAGAGGGACCGCCAATATTATCCCCCTGTGGAGGGAGCAGCTAGCTGAGATTCTAGAGAATA
GAATCATATCCTGTCATAATAATAGTTGTCTGCTATGCTATGAGTCTGACACATTTTATCTTAATTGTCTCTAAGGTAGATAAGCTATGACGTCCCCATT
TGTGCTTCAAGGAACTAGCACCATCTAGTTCTGCTGTCGCCAGATTATCCTACATCTTTGTCTACTGATCTACCCATGGAAGATGGGGTAAGGAAACAAA
GACCATCAGTTCATGGGCTTGAATTTAAGATGAACCATAGACAACACTGTTCACATATGGCATGAGAAAGTTTTACGCTGAAGAATTGGATTCAGATTTT
AGAGTACCGGAGTAGATCTTAGTGCATATGTGTTCTTACAGAGGAAAGTCAACTTCATCTTCATGCCACAATAAGCATACTAATGAACTGGGGCCACAAA
AGGAAAGGGTTGCTGAACTCATGTACTGTAGACTTATCTAATGTAGAGACAATGGTAGCATCCATGGTGACATATTTACATTAAAGAGCTTGGATAAAGC
TTTGGTAGCTAGAGAGCGATCAAGATTTGAGATGGTGTTTATCGTGGAAGATGAGCCCAAGAAATATGGCAAAGAGTGGGCCTAATGCTACAAGTTTTTC
ATGGTGCAAGTTCAAATCTAAGAGGAAGAAAATGGCCTACATAAACCAAGAGAAGGGCCCCAGATGGAGCCCAAGAAAGAAGGCTGAAATTTCTGCCCAA
AAGGGCTGAGAATAACAACGTGCCCAGTGTAATCCCACAAGTGGGGTTTGGAGAGGGTAGTATGTATGCAAATCTTACCCCTACCTTATAGAGTTAGAGA
GGCTTCCGTTAGAATCACAGAGTTTTGGGGCTCCAATTCACGCCCAAGTTGCAGCAAAATAGGCATGTCTTTTTGGTTAAGAATTGGACACTTTTTCCTT
TCCTGTTAGGTAGAGATCAAGTGTGACATCAATTTACTTTTTTTCCTAGTTTAAGGTTTCCTTGTTAGATTTTTACAATCCGTTATATTTCCAAAAGCGT
AGGATTCAAACTCCATGTTATTTGGGATAGGTTTCCCCTATACATAGGGGTGAATTTTGTTCTTTTTAACAACATTATGCTAATATTATTCAAGAGTTTC
TCTTCTTTAACCTTTGCATGTTGGCTACTTAAGATTAGAAAAATTCTTCTTAGAAGGTAATATTGATGTTTTAACAAGATATCTTGGTTCTTCTTCATAA
ATTAAAAATGACAGTTAAACTTGTACTAATTGTTAGAGTGGGTTAGAGTATCACATTGGCTGGGAAATGGAATGGTGGTTAGTTTTTATGGACTTAGACA
ATCCTCACCTCATGAGATAGCTATGGGGGTTAAGTTAAATCAATGGACATTTCTACATAGTATCATAGCAGCTTGCATATATTTTCAGCAGGCCCCTCAC
TGGGACTCATATTAATTACATTTGTAGCAAGCTCGATACATATGACTTATCTGCACTAGCTTGAGAGGGAGTCCTAGAATAGAAATAGGAATATGATTTG
TATATAATATTCTACTAGGAGAAGAATTGTCATGTAGTGTATATAATACTTAATGTAGTTATGTAGATAATAATTCAATAAAATTTTCTCCTATATTTCT
CACACTACCTATTGCCACTAATTACTTAGAAACAGAGAAATAGAGGTCTAGATCACTGTCATAAGTTCTTGAACTGACTCTATTAATATCATAATTAGCT
TTCATCCGTTAATTTTTTAATACTAAGATCAATGAGGGTTCTACTTCCTAGCACTTAATTTGAGATTTTATTCTCAAATTTATCTCCCTCTGAACACCAA
CTTTGAATTTCTCTCTTTTTGTTTTTGATTAGAGAAAATTGGTTAGCCAACAAGAATATTATAACTAAACGCGTATCCTCCTAATATTGACAAACAACAT
GAAAACTGTCTGGATTCACCATTAACTGATAGGCTTAATATGCTGGGGGGTACTTCACAGCAGGTTACATCAGTAAATTATTTCTCCCTACAGAGCCCAA
CAAAAAGGAGTCGCATTGATTACATGAACTAGTATATGCATCTCCTTAATGATAATGCATAAAAACAGAGGCCATAAAACTTGACGAAAATGAGTGAAGA
TGTCTTAATGAAAAAGCCAAGTTCAAATAAAAAAGAACATTGTTCCGGATCCTATAACAAGGAAATATTTCAAACTAACCATCAACAGTTCCTTCAGTAA
ACTGAGTGATTGAAAGAATAATTTCATATACAAAACACTAATGTTAAAAACAAGATAGAAGTAAAATCAGTAACATTTTGTCTTTTACTACATATGAAGT
TGAAAATTAACAGCGCAGGATTATAATGGTATTTTTCTAAATTCAAACAATTGTATCACTTCTTTCTTTATCAAGAAATCAAAACTTACAAGACAAGCAT
GGGAATACAACATGTACCTTAAATAAAGGATTCAAGAGTCATTAGTTGCAGAAGAATTCTCCTTAGACACCTTAGTACCACCATCGACTGCATCAGTAAG
CATACCACTTCCCAAATTCACAACATCGGACACATTACGAACCTGCTATAGAGGCACTTCATCAGAAATCATGTCAAAGTGAAAGTACAGAAATAACCCA
TTTTGCTAATAAAGAGACATGGTAAATCACGCAATACAAGAAACCAGCAGCAAAGGGAGACATGTAGCTCCAATGATAATTATAATTCTTTGGTCACTTA
AAAACCAACCCCCGTTGTAGAGCAGGTACTCATAAGGCTAGTTATAAAAGGAAAAGAGACGTGGAGGTTAGAAACGAAATCAGAACTTTAAAATTCGTAA
CTTGAAAGAAATGCTTCCTTTTTTGTTTCACATTACTGCAGAGAGAGAGTGGAAAACGACTTCTTTGAAGAGAGAGAACCAAAAGCTTGAACACTGGTGC
ATGTAATTTGCTGATGTTGTTTTTTGACACATGTCACTCTGGATTTAAAGAAATATAAATGAATGTCTAATGCCACTAAAGAAAGTTGAATATGAACTAA
ACAAATAGAATAGAGAAGTTTTTGACTCAATAAGTTGTGGCAAGAAAGAAGCAGCACACCAGGACAAACTCTTTTGAATATCAACTCAAGCCCTCCTTCC
TTACTCGATTCGAGTGTTTTATCAAAGGATTGATATAGAGAAAAACAATCCTATATTTCTTATGTAACTCCTTGTAACATGGAATATAAGTTAGTTAAAG
AAATCAGCAAGGGTGTCGATCAAAAAAATTTAACGATAGAGAAGCACTTTACAGAGTAACAGTATTAAGATAACTATACATGAGGCCAAAATGCAAACAA
TTCAGATATCTAGGTTTCATAGTTTCAAGAGAACGGAATGAAAGATAAAGTTGATCCTAATAGACTTAAAATCGGATGGTTGAAATGGAGTGTTATCGGA
GTGTTATGTGATAAAAGGATGCCTACCTAGGTGTAACTAAGTTTTACAAAACAGCTATAAGACCAACAACGTCATATGTAATGAATATTGGGCCCACTAT
AGTTCAACATATCCATAAGATGAGTGTTGCAGTAATGTGATGCTAAGATGGATGAGCAGTCAACTGGTCACAGGATAGAATAAGATTAAAAATGAATATG
CCAAAGGACGCAAGTAGCACATTGAGGATAAAATGAGAGAGTGTCACTTGAGATGGTTTGGTCATATCTTGTAGGTATGCATCGACCTACAGATGCACAG
GTCAGTAGTGTGAAACTATGGCGTATGAAGGTATTACAAAGGGACACTGCAGACCTAAAATCACATTGAAGGAGGCTGTCTCGAAAGACCTACAAATTCT
TGGAATCAATAAAGATATAGATAATGATAGGGCAAAGAAAAATATCCATATAGGTGATTGTCTACTAGTTGACATAGGTTTTCGTCTTGCTAGAGAACTT
TTAATATTATCACTGTTGTTATTATTTGTTTGTATCGAACTTATTTTTCACTTCTATTTTTATTTGGTATGATGATGAGATGAGTTGAGCTTGAATGGAC
ATGTGAGGATTCACAAAGCCGAGTTCAACTTGTTTGGGACTGAGGTGTAGTTTTATAGGCTAGAAGCAAACTTAAGTATGTGATTGAAGAAGACTGCTGC
ATGTGGATTGATGTCTCAAATTGCCGAGAAGAAAATACATCAGAGCTTGGTCATAAAAGCCTAACTCATTAATCAAACTTGAAATAATCCAGATATGTTG
CCAACTTATATGCTTTGTATATAGAATTATTGCGATACAGTCTAATGGTCATCACAAATTTCTCATGTAATTTCAAGAGGATGAAGATAGAATTTTTTTT
AATGGAAGTGGCAAGCCCTAAAATTGTTTTATAAGCTGCAATCACGCATGGTTGCCACGTCAAATGTTAAATTAATTCCATAATATAGGAGACGCTGCAA
GGTGCAATAAGAATAATGATCTGTACAAACCAATGAGAAAGGAGATTCTGTATTCTTGTGCAACCAAGCTGGAACTAGTACAAATTCTTCTGTAAGATAG
GTATAGCACAATTAAACAATTTATTCCAAAGAAAGAAGGTATAACCTCATGGGCAGGTGGAGCATAAGAGGTCAACGGACTCTCCATTTGAGCTGTAGCA
CCTCCAACTGGAGGCTCATTTCTGATAGAATTCCCACCTAAGATATCTGCTTGCTGGAAGTCGCTCACATTGGTTTCTGAAGGTCTTGTAGCTTCTCTAA
CAGAATTATGGTCGCCATTCTGCTTTTCTCTATCAGTTTCACCATTTCCCATATTCCTAATTTTGAATTTAGGTTAACATCATCCATAAGGCAATAAGTG
AACCAAAATTTTAATAATACAGAAATTCTGCTACACTTATCTATCAAAATTAGAAAATCAGATCATCATGCACCTGATAGGATCATTACAGGGAGTCTGT
TCAGGTCTTGGTTTGGAGGAAAATACTAATCCACGAAGGGGTTTTCCATCAATAACAGTTTCAACGGTATAGCCATTTGGAAAACTCTTTGTGACCATGG
CTTGAAATGTCTTCGTCCTCAGAGGAGTCTGGTATTCATTTGAATAAACATTATGTCGACCTGTCACAATACCAATGCACCTTCAGAAGTCAGTTCAAAA
CAACTGTGACACCAATATTTCCCTGCTTCAAGCATTAGATGCACTACACACTATCACTTGTACAAAGTACACAAAAAGATACAATACTATTTATCAGACA
ATATATGACATGCTAGGACACTTTATTTTTCCTGGAAAAAAAACTCAAGAGAAAAGTGAACATGTTCAGTATCTACTCTCTCAACCATATTAAACTTTGC
CCATAACTTAGAGCAAAGAAATAACAAGAAATATTTTTGTGTCGGTGTATTGTATATATATATATACAACAACATATCCAGTGTGATCCCACAAGTGAGA
TCTGGGAAAGGTGGCGCCTATGCAGCCTTACCCCTCTCTGCCTAGTGTATGTATGTATCCACATGGAGGCTTGCTTTATGAATTATAATCTAATCCTCTC
TCAAGTTATTCCAGTCTTTAAGGTCTCCTCATTTTTTTAAGGTCTCCTCTTACCAAACATTTTGTCAAAATAAAATGATTAAGGAATGGCTGGCCACAAA
TAATTAAAGAAATCATATTGAAAAAGATAAAAGTAATCATAGATGCACAAACAAGGAGCAGCTTCAGTAAGACGAATCTCAGGAAGTACAAGGAGGGAAA
TTTCAAATTAAAATCAACAGGATATGAAAAAGTTACTCACTTGGCTGTGTATAGTTCACAGGCATTTGATGATGAACATTAGCGTTATTATCAAATCGTT
CAAAAGAATTATCGCCGGGAGAAGCTG