BAC Sequence – LE_HBa0203E06

>C01HBa0203E06.1
TTCCAAAAAGAAAATTGGTTTTACTAATTACACGATACAAGCTGGGTGTACTTAATTATGCAGAAAAATGGATGTGCACATCCATATGGTTTCATTCTGG
ATATATAATTTCCGAACTATTAGATGCTTGTGAATATGATTTCCAAACATAATATATCATTCTGGTTGTGTTGGCTTACTATGAGTTTGGTGAACACCAA
AGTACTTACAATTCAAATATTTGTAAGTTAAATCAGTCAAAAGCCAATGTTGGCCATCACCAACTTATGATTTTGCACATTATACTTTTGCTTTGATAAA
ATATTTCACTATTTTATCCTTAATATTTTTTTCTAATTTTTAAAGTATCTTTCCCAAAAGAGAACTCCTAACTCTCTCTTCATTTTGTAGCCCATTGTTC
TTTCTCTTCTTTACTAGAGTACTCCTAAATTATAACATTTTATAAACTTCTTACGGATATTCTAATCATTCGAATAAAGGAACATTTTTTGTTCCAACAT
CCTAACACGTAACTATTCAATTATAAAATCAGCTCCAGCACTTAAAATTTATTAGTTATTTACAATCAACTAATTCAAACAGGCTCTGACATAGGGCTAA
TTCATGTAGTCTTAATTTATTTTGTAATTCAACCTTTAAAGATCTCATTTATCTCATTTGATTTATTTCCCACTGATAATTCTCTAAGAAAAATAATGGG
GAAAAAAGATGCATACCCCTAATTAAATTCTCCTACTTATTTTATTGTTATGCTTATTTTATATGATTTATTTCTGAAAAACTGATAAAGTACAATTACA
ATCCAAAATACAGTAATAGCCACGGAGTCGAAGAAAAAAATTTGTTGTGCATGGACATATCTTGCACCTTTCCTCATTCTTTTACTTTTGTCTTGTTAAA
CTTCTGTAATAAATAACTTATAAACTATAATTGAGAAGAAAATCATCTTTAGACAATAATCTGAGATGCTCCTCAAATATATTAGACAAAGAGAAGACAG
TATTGAGCAAGTACAACTCTTAATGAAATACACAAAAAAAAGAATCTTGATACAATAAGCCAAACTGATGGAGATCTCAACATCTTACTTAAATATCCAA
GGATAAATATTACAAATTATTAATACAAAAGAACATACAACGAACAAAGCCGGTCATATTTGGAAACATAATTTTTTGGCAAAGGAAGTGAAAATCTTCA
GATGAAGGATGAAAAGAGAGTTAATAGGTCATGGAGATGATGGGAAATGATTGATGATAATGATTAGAATGTTAGTAGGTTGGCGACGGGGGTGGAGGTG
AAGCATAGGTGACGGATTGCTCGTATTTCTCAAATGGCGGCGGCGGCGAGGAATAGGTTGGTATTTGCTCGTAGTATGGTGATTGTTCATAGGTCTTTAG
AGGACGTGGTGAATTGTAGGTCAAAGGTGATTGTTTGTAGGATTTTGGAGGAGGTGGAGGAGATTTATAGGAAGGACTAGATTCTGGGTAGTATGGTGGA
GGTGGAGACTTGTGATAGGTTGCTGATTCCTCGTAGTATTTTGGTGGAGGTGGTGGAGATTTGTAAGATGATGGTGATTGTTCATAGTATTTTGGTGGGG
GAGGAGGTGAGTTGTAGTACGAAGGTGATTGCTCATAGTATTTTGGTGGAGGTGGAGGTGACTTGTAGTATGAAGGTGATTTCTCGTAATAAGTTGGTGG
TGGTGGAGGGGACTTGTAGTAAACAGGTGACTTGTAATATTTTGTTGGTGAAGGCGACTTGTAGTAATAACGTGTTGATGGAGTTGGCGACTTATAATAC
TTTGTGGGTGATGGAGATTTGTAGTATCTCTTTGATGGAGTTGGGGACTTGTAGTAATACTTAGAAGGAGAGGGTGACTTGTAATAATGATTTGAAGGAG
TAGGAGACTTGTAATACTTTGTTGCAACCGGTGACTTATAGTAGTACTTTGAAGGAGTTGGGGACTTGTAGTAATACTTAGAAGAAGCGGGTGATTTGTA
ATAATACTTTGAAGGAGTTGGGAACTTGTAGTAATACTTTGTTGCAACCGGTGACTTGTAGTAGTGCTTTGAAGGAACATGTGACTTGTAATATTTTGCT
GGTGAGGGCGATTTGTAATAAGCGTGCTTTGAAGGTGCTGATGATTTGTTGTAGTAGTGTGATGGGTAAGGTTTCTTGTAATAAGGAGTGGGCACATGAT
AGTTGGATGGAGATGGTGATTTGTAGTACTTGTTAGAGTTGTGAGAAGGTGAGGGTGAAGTATATTCATAAGAGTAATCAGCAACAACAGTGCTGGCTAC
TAAGCAAATTGCCAAAGCAACAGTTAGAAAAGACCATTTCCCCAACTTCCCTAAGTTTTCCATTTTGATTTGGAAAAAATTGTACCCAGAGAAGTGAAGG
ATAAACTAAGGACTTGTGTTGCATAATTGAGTAGAGAACTCTGGTTTTTATAGAGTAAAGTGAGACCCTTCTCAGCATTAATGTAACAGTATCTTAGTTG
CCCACTCGCCCACTAAGCTGAGAGCAAGGTCCTAATAAATACCTGATCAGTACTAAGTGGGAGGCATTATCTGCTGACAAATGATAATTAAAATAAAAAC
AAAGAGGATCTATATACCAGAAAGTAGTTAAAAATAAATGGGGGCATTTTCTTTGTTGTTTTCTCAATGCCAGAATCTGTAGGTTGACTTATAGTATAGA
GTTTGACATTGCCCCTATCTCAAAATAAAAGCAGAAGAAGAACAACAATTCAACGGCTATCAGCACTGGGCTCTTATCTATATAAGATCATGTTAAAGCT
ACCAGAAAACACAGAGATTTGAAAATTGTTACAAAATGTTTCTGTTCTAAATTTCCAATATGTAAAAATATAAGAACTGCTATACAATATACATATTGTC
AGTTTGATTTGGTTTCAGATTAATTCTTCTCAGATCAACACAAGAAGAAACCTATTTAGATAATATGTCACCTCAAATACAAGAGATTAAACAAAAGAAG
GTACAAAACTTTCAACCAAAATAAACAGGCTTATTTTACTGTTAACTGATAAGGTTTAAGTGACTTTGATTGTATTTATTTGGGTAACTAACTAGCTTCA
TCTTTTACACTTCGACTTGTAAAATAAAACTTCCACATTTCTTGCTCAGATGTGTTTAAAATTAACGAATGAGGAATTAACTCCTCTCCCTCTCTCAAGA
CCAGATAAAAACCAGACAAGAGGAGTAGAGCACAGTGCAAAAACATCTAGCTGCACATTCATCCGACAACTTATGGTGCATGAAGTAGACGGTGTTCTTT
ACACAACTTATTCAATGATGCTCCCCGTGATCATCCTTCTCGGGGAAAAAGCAAATTCCTATGGTCTCTTTTAGAATTAGCATATGAATTGCTTATTTGA
AAAAAGCATTAATAGCCTGTAATTATACCTTAGCATTATATTTTTTTCTTTTTTCATGAACAAAGACAAGATAGAAGTAATCACATCAGGTAGAATTTGC
ACACAGATAGAGGACAAAAATAAAAGAAAAAATGGCATGGGATAGTAAAAGAAGATGGTTTGATCATGTCCTACTCCTACGTGGACACCAAATGCAGGGG
TACACAACATTAAAACTGAATATGCTAAGGGGAATAAGGTAGACCAAAAATCATATGGAGGAAAATTGGCTTAAAGGATCTACAATCTCTTGGATTTAAT
ACGAACTTACTATTGAATACAAGACAAGCTAATATTCATATAGGTGTGTGCAGTGAAGCCACTTAACTGAGGTGAAGTGAAAAACCTATTTCACACTGAC
ATAACACGACTTGGTAGGCCGGTGTTTGACACGAGTCTTCTTAGTTTGGAGAGGGATGTGTACATGATAGAATAGGGATAAGTACAAAATTTAAAAATCT
TTGTAGGTGGAGAACCCTTAATTCTATCTAAAAGATAAAATTAAACAGTATTACAACAACATACCCAATGTAATCCCAGGGTCTGGGAAGCGTGGTGTGT
ACACACCGTTAACCCTACCTTGAGACAAAGTAAAGAGGTTGTTTCTAGTAGACCATCGGCTCAAAGAGAAACATAACAAAAATCAAGTATGTAAAGCAAA
TACAGTAATGAAGAAGTCATACCGGAAACAATGAAGAAGAGAACTGTAGCAACAACACAAGGAAACAAGACAACACTCGACTATTCACTAACCTTACCTA
ATCCTCGACTTACATATCTTACTATCTAGGGTCTCGAACTCAGTAAGATACATATGTGTCACACCTCCTAATACTTCTTTCACCTACCTATACCTCTCCT
TATAACCACCGTCCACCATAGTCAATCTCTCACACCTCCTCACTTACGTGCATCTCCAGTGAGGACTTATATAAGTATTGAAATGAAGAAAAAAAAGTAC
TATCGGGACTGAAATGGTGAATGGGGACTCATATAGCCGACCCTAACTAGTTGCCATTGAAGCATAATTGCTGTTGCTGATAGAGAAAAGGTCACGTAAC
CTAAATCCAGGATAAATGTATGCCAGAGTCCTCGAAGTCCGAAGAGCACTTACACTGAACATACACAATGCCAACTAAGGGAGACTATTGGCAGGGGAAT
GGAACTTAGGCATTTCAAAATTGAGAATAAAACAACGGAAAATGTACAAGTATTAGAATCCTTGACAATCCAAAATACTTAAAGCAGTTACCTTTACCCC
TATAACACCTTGATAACAAATATGTACAGTCATATATAAACATGTGCAAATGAGGGGAATAAACGGATAAAATAAGCTCGAAACCAAACGAATGATTGAA
ATAGCTGAGAAAATTGTCGAAAGAGTAAAAAAGGCAAGGGAAAGAACCATAGGAGTAATAAGGAAGGAGCCACTGATGCAGCAAGCGAGGGAGCATTGAC
CAGCGGCGACCGGCGACGGGAACATCAGACGGCGGGAGAAGTTGAAATAGCACCGGTAATTGTAGTGTCCATTTTAAAATAATATTGGAAAACAATTTTC
ATATTTAGAAGGCAAATGGAGAAAATTAAATGAAAGTCGTCAAATTAAGTCTTTGATTTGATTTTTGGTGATAGATTGATCCAGAGCCGGTAAAATTATC
TTTAAAATGTAACTAAGTAAATTTTGGATTAAATTAATATTTTTAAAATTTGCTAATCTTTTATAAAATACAAATAAGCATTTCATTTTTCAACTTTTAT
TATTCTATTTAAATCGTTTTTAAAATAAAAAGTAAATGAAAATATGATTCTATTGAAAAAATTGCAGGTGCCCAAATGATGATGAATGATTTCAAAGATT
TACATATCAAAACAATGGTGTGTAACCCTAATCATTTATGAAATAATTTCAATTAAGAGCAAACAAAATCTAATCCACTGATTAAATTAGTTAAATTCGA
TTCAAGAAGAAGAAAAGAAGAAAGTTCATGGACGGGTAGCCAAGATCAATAATGTACGAAAAGAAGAAGAAAAAGATAAAAAGAACGGGAAGAAAGACAA
GCAAACAATTAAGAACGAAGATGAAAAAAATATGACGAGAGGTGGGGGAAAATATTTTATTTCCCCTTTTGGTACAACTTGCTGGTGGCTTTCCCCAATT
TTAATTTCTTCCAAAATTGATTAAATTAGCTTTTAGTTAATTTACGCTTTTAATCTTTATTTAATTCAATGGACCAAACTATCAACTTATAAATTTGAAA
GCAATTCCACAATCCTTAATCATTAATCACATAATTGTCACAATCCTTAATCATTAATCATATAATTGTCACGTACATCAAATACTTAAGACTTATGTCA
CAACTCATTTATTTTAAAACATTATTATCACTTTTTTTTTTTATAAATCCCTAGTAATTATGAGCAGTTAACTTTATTGTATGAGATGTTATAAATTTAA
AAACAAAATTATAGTGTCAGATTTCAACATCAAAAGATATTATGAAACAATTTTTAAATTTATAAGGTAAAAATAATATTTTGTATTATTTATTCCTGTA
TTATACTGTTAGTTGTAAGCTTTGTGGTGGATTAGTATTTGTTCTTTGTTTGAGATTATCAGAATTCATATTTATTTTTAAACATACTTATTTATTCTGA
AAAATGAAAAAAATGGAAATACAAAACAACCTTTTTTTTTAATGAAAAGTGAAGATTATTGTGTTACATACTGTTAATCCCGGTATATTTATTCATTTTA
TAATTTCGCCTTTTCAGATCAATGCTATGGTCTTATGGCTTATTTCCCATGATAAATCCTTTCAGAAAAAGAATTGGAAAAAAATAAAATATGCCTATAC
GTAAGAATTCAGTCAACTAGAAAAAACAATATGAAACAAAGATGATACAGCATTAAACAAAATAAAATTCATGATAAATTACACCAAAATACAATGTTGA
TACAATAAATCAAATTGATGGAGACCACAAGAATCTTACTTAAATCTCCAAAGATAAATATTACGAATTATTAATACGAAAAGAACACACAACAATCAAA
GCCGGTCATATTAGGAAGCATAAAAGAAAATGGATAACCCCAAAGGTGGGGGAAAATGATTGAAAAAAAATGGTTTTGACTACTAGTAATAGGTTGGTGG
TGGGGGTGGAGGTGAAGCATAGGTGGGAGGGACCTCGTACTTCTCAGGTGGCGGCGGTGAAGCATAGGTGATAGATACCTCGTACTTCTCAGGTGGTGGC
GGCGAGGCATACGTTGGTGTTTCTTTGTAGTACGGTGATGGTGGAGATGAATAGTATGTAGGTGACTGATCATAGGTCTTTGGAGGAGGTGGAGAAGATT
TATAGGAAGGTGTAGATTCTTTGTAGTATGGTGGAGGTGGAGAATTGTAATAAGTTGGTGGTTTCTCGTAGTATTTTGGTGGAGATGGAGGTGACTTGTA
GTAAACTGGTGACTTGTAATATTTTGTTGGTGAAGGTGACTTGAAGTATTTAGATGGAGTGGGTGATTTGTAATATTTTGTTGGAGAGGGTGATTTGTAG
TAATAATTTATTGATGGAGTAGGTGACTTGTAGTACTTTGTTGGAGATGGGGACTTGTAGTACTTTGTAGGCGATGGGAACTTGTAGTAATACTTAGAAG
GAACGGGTGATTTGTAATAATGCTTTGAAGGAGTTGGGGACGTGTAGTAATACTTTGTTGTAACGGGTGACTTGTAATAGTGCTTTGAAGGAACATGTGA
CTTGTAATACTTGGTTACAATGGGTGACTTGTAGTAATAATGTTTTGAAGGAACATGTGACTTGTAATATTTTGCTGGTGATGGCGATTTGTAATAAGTG
TGCTTTGAAGGTACTGGTGATTTATAGTAATAGTGTGATGGATAAGGCTTCTTATAATAAGGAGTGGGCACATGATAGTTGGAAGGAGATGGTGATTTGT
AGTACTTGTTAGAGTTGTGAGTAGGTGAGGGTGAAGTATACTCATAAGAGTAATCAGCAACAACAGTGCTGGCTATTAAGCAAATTGCCAAAGCAATTGT
TAGAAAAGACCATTGTTTCAACTTCTGTAAGCTATTCATTTTGAACTGGAACCACTATACTTAGAGAAGGAAAGGACAGAACTAAGACTTGTGTTGCATA
GTTGAGTAAGGAGCTCTGGTTTTTATAGAGAAAAAAATGAAACCCTTCTCAACATTAATGTAATAATAGCTTCTTAATTGCCCACTTGCTCACTAAGCTG
AGAGCAAGGTCCAAAGAAAGACTCTTATCAGTACTTAGTGGGAGACATTATTTGATGACAAATAATACAAAGTAGTTAAGGACTGATTATTTCTCAATAA
TGCACAGAACAAAGAAATGTTCCTCGTTTTCTGAATGCCAGAATCTGCAAGTTGACATAATCTTAGTATTGAACATAATACAAGCCTAATATCCATATAG
GTGTGTGCACTGAAGCCAATTAACTGCGGCAAAGGCCAAAGTGCACCTAGCACACGGCTTACATAACATAACTTGGTACACTTATGTTAGGCAGGTGTTT
GACATGAGTCTTCTTAGTTTGAAGAGTAGGGACAAGTACAAAATTTAAAGAATCCTCATTGGTTGACAACCCTTATCTATCTAAAAGAAAAAAGTAAAAT
TATTAAATATTACAACAATAAATCCATTGTAATCCCACGATCAAGGGAGGGTATGTAGCCTAACCCTACCTTGATATAAGGTTAAATGGTTGTTTCTAGT
AGACGCTGCGCTCAAGTAAAACATAACACAAATCAAGTATCCAAAGCAAATACATAAATGAAAAAGTCATATTGGTAACAATAAAGAAGAGAACCATAGC
AACAACATAATGAAACAAGACAACCTAGACTATTGACTAACCTTCCCTAATTTTTGACCTTCGTATCTTATTATTTAGGGTCATGTAATCGGTAAAATGC
AAACGTGTCATGTCTTATCTAATCATCTCTCCCAATAACTTATAAATAAGAAGTCATTGACGAGCAAGCGAGGTTGTATCGACCAGCGGAGACCGCCGAT
CGTCCCCAGAAATACCAGCCGGCAGGAGAAGTTAAATAGCAGCACCAATAATTTAGGTGTATCAATAATCTTTACTAATCTTAAAATAATATTGAAATAC
AATTTTCATATATTATTAAAAGGTAAATGCAGCATTTCTAATTGTAGATTTTTTCTTTATTTGAGATTATTAAAATTTATAATTATTGTTTAACTTACTT
GTTTATTTTTGAGAATGAAAAAAGAAAGGGGAAATATATACCATCCATGTTTTTCAAAAAAGTGAAAAAAATTAAGTTATATTGCGCTAACTTTTGGTGG
AGTCTTATTTGTCTTGTATTAAATAATTTCACCTTTTAAGATCAACAACCATATTATATCTTTTGACTTATTTTCCATCGATAAATATTCTTAGAAGAAT
AATGCATACGACTTAATTAAAATTCTCTATAGTTTTTTATTATTCTGTTCAATTTATGTATAATGTTATTACTTATTTTTCTTAAAAGCTGGTAAGTACA
ATTATAATCCATATCCAAAATACAACAATTTGTTGAAGAATCCATCCAAGATCCAACCATGACCATATTAATTTGCACCTTGTTGTGAAAGCTGAATATA
TAGAGAGTGAGGGAATCACAATTACTATATCTAAAGGTAGCTAACAAATAGTAAATGAGACAATAACAAAAAGAACGCAGAAATTAACGAGGTTCGGTAA
ACTTTTTTTTTTTGTCTACTCCTCGGACACAACCAATCAATATTTATTTCACTCCAAAAGAGTACAAGTGAAATAGTGTAAGAGAGAAAGAAGATTAAAT
GCCTTAAGAGATGAGAAGACAAGTTATTAAGAGCTACCTATTTATACGAGTGAATTCTTCCTATTGATGTCATCCATGACATCACAATATGTTAAAATGT
GAAGATTTACTTGTGAAATCAATTATAATTCACCTATTATTCACCTACAAAAGGTGCTATCTTGACTTTTCTACCAATAAAGTATTATCTTCGAAACTGC
CATATTTTCTCATTAATTCATTTTTGAATCTTATCAAATTTAACATACCTTTCCTCGTTTTTTTTGTTTTCTTGTTAAATTTTGTAGTAGATAAGTTATA
AACCATTATTGAGGAGAAAATACTCTACAAAAATATTAGACAAAGTGAAGATAGTATTGAGCAAAGTAGAATCCTAGATAAATCACACCAAAATAAAATC
TTGATACAATAAGCCAAAACAATGGAGATCTTACTTAAATCTCCAATGATAAATATTACTGCGAATTATTAAAACAAAAGAACATACCGCACACAAAGCC
CGTGATTTTGGGAAGCATAAAAGGGAAATGGAGAACCCCAAAGTTAGGTAAAAAATGATTGAAAAGAGTGGATTTGACTATTTGTTTGAGGCGGTTATAT
ACTTTGATAAAATTTTATTGAAAAAATTATAGAAATTAATTAGATTAGATTATGTTCAATTTGGTCGATTTAATTTTTCATATTCATTTGGTACTCCTAA
TAAATTTATTCTTTGTTCGAGATTTTATGAAAAAGAGTGGAAATAATTATTTTTTAAAAATGAAAAGTGAATGATTATTGTGTTAATTGCTGGTGTATTT
ATTCATCTTATATCAATCTTATGTCTTATGGCTTATTTTCCGTCGATAAATCCTTTCAGAAAAAGAACTGGAAACAAAACAAAATAATACGAATATGCCT
ATACGTAAGAATTCAGTCAACTAGAACATACAATATGAAACACAGATGATACAATATTAAACAAAATAAAATACATGATAAATTACACCAAAATAAAATC
TTGATACAATAAATCAAATTGATGTAGACCACAAGGATCTTACTTAAATCTCCAAAGATAAATATTACGAATTATTAATACAAAAAGAACACACAACAAA
CAAAGCCGGTAATTTTAGGAAGCATAAAAGGAAATGGAAAACCCCAAAGGTGGTGGAAAATGATTGAGAAAATGGTTTTGACTACTAGTAATAGGTTGGT
GGTGGGGGTGGAGGTGAAGCATAGGTGGGAGGAACCTCGTACTTCTCAGGTGGCGGCGGTGAAGCATAGGTGACAGGTTCCTCGTACTTCACAGGTGGCG
GCGGGGAGGCATAGGTTGGTGTTTCTTTGTAGTATGGTGGTGGTGGAGATGAGTAGTATGTAGGTGATTGTTCATAGGTCTTTGGAGGAGGTGGAGAAGA
TTTATAGGAAGGTGTAGATTCTTGGTAGTATGGTGGAGGTGGAGAATTGTAATAAGTTGGTGGTTGCTCGTAGTATTTTGGTGGAGGTGGAGGTGACTTG
TAGTAAACTGGTGACTTGTAATATTTTGTTGGTGAAGGTGACTTGTAGTATTTAGATGGAGTGGGTGATTTGTAATATTTTGTTGGAGATGGTGATTTGT
AGTAATAGTTTGTTGATGGAGTAGGTGACTTGTAGTACTTTGTTGGAGATGGGGACTTGTAGTACTTTGCGGGTGATGGGGACTTGTAGTAATACTTAGA
AGGAACGGGTGATTTGTAATAATGCTTTGAAGGAGTTGGGAACTTGTAGTAATACTTTGTTGCAACCGGTGACTTGTAGTAGTGCTTTGAAGGAACATGT
GACTTGTAATACTTGGTTACAATGGGTGACTTGTAGTAATAATGCTTTGAAGGAACATGTGACTTGTAATATTTTGCTGGTGATGGCGATTTGTAATAAG
CGTGCTTTGAAGGTGCTGGTGACTTGTAGTAATAATGTGATGGATAAGGTTTCTTGTAATATGGAGTAGGCACATGATACTTGGAAGGAGATGGTGATTT
GTAGTACTTGTTAGAGTTGTGAGAAGGTGAGGGTGAAGTATACTCATAAGAGTAATCAGCAACAACAGTGCTGGCTACTAAGCAAATTGCCAAAGCAACA
GTTAGAAAAGACCATTGCCCCAACTTCCCTAAGCTCTCCATTTTGATTTGTAACAAATTATGCTTAGAGAAGTGAAGGATAGAACTAAAGAATTGTGTTG
CATAGCTGAATAGGGAGCTCTGGTTTTTATAGAAAAAAACAACAACATTAATGTAATAATAGCTTCTTATTTGCCCACTTGCCCACTAAGCTGAGAGCAA
GGTCCAAATAAAGACTCTTATCGGTACTTAGTGGGAGACATTATTTGATGACAAATAATACAAAGTAGTTAAGGACTGATTATTTCTCAATAATGCACAG
AACAAAGAAACTTTCCTTGTTTTCGCAATGCCAAAATCTGCAAGTTGACATATGATCTTAGTATTGAAAACATAACACAAGCCTAATATCTATATAGGTG
TGTGAACTGAAGCCAATTAACTGCAGCGAAGTTCAAAACCTATTTCGCACCTAGCTCACGGCTTAGATAACATAACTTGGTACACTTATGTTAGGCAGGT
ATTTGACATGAGTTTTCTTAATTTGAAGAGTAGGGATAAGTATAATATTTAAAGAATCCTCATTGGTTGACAACCATTAATTCTATCTAAAAATCAAATT
ATAAGTATGAAGAGGTTGTTTGTGGTAGTAAAACATAACACAAATCAAATGAAAAAGCCATATTGGAAACAGTAAAGAAGAGAACTGTAGCAACATAAAG
AAACAAGACAATTCGCTAGACTATTTACTAGCGTTCTATTCTAATCCTTAACCTTCGTATATTATTCCGTAAGATGGAAATGTTTATCCAATCACCTAAC
AGTAAACATAAACAACGCCAACTAAGGCAGACTGTTGGCAGGGGAATGGAATTACAGCAAAATATTTAATCCTCACCAAATTGAGAATCTAACAACAGAA
AATGTACAAGTAGTAGAATCCTCAACAACCCAAAATACATAAAGCAGTTATTTTTAGCCATATAGCAGCTCGATAACAAATCTGCATTGTTATATATCAA
CGCTACTGTGCAAATGCAGAGGGAAAAGACAGAAACCAAACGAATGATTATAATAATTGAATAGCTCAGAAACTTGCCGAAAGAACAGAAAACGCAAGGT
ATAGACTAATAAGGAGGGAGTCATTGACGCAGCAAAGCGACCAGCGCCGGAAATATCAGCCGGCGGGAGAAGTTCAATAGCAGCACAAATAATTTAGGCG
TATTTTTAACCTTTACTCCTCTTAAAATAATATTGTAAAACAATTTTCATATTTAAAAGGTAAATGCAACATTTTTTATTGTAGATTTTTTCCTTACTTG
AGATTATTAAAATTTATATTTATTGTTTTAACTTATTTATTATGATAATGAAAAAGAAAGTGGGAATACCATCTGACTTATTTTCTGGTGGAGTCTTATT
TGTTTTGCATTTTGTAATTTCACCTTTTAAGATCAACAACAATATTAATATATTATATCTTTTGACTTGTTTTTCATTGATAAATTTCTTTTGAAGAATA
ATGCATATGCCTAAATTAAAATTCTCTTTATTATTTTTTATTATTCTGTTTATTTTACATAATTTTATTTTCTTAAAAGGTGATTAGTACAATTATAATC
CATATAAAAATTGAAGCATCCATTCATTACCATATGTTGCACCTTTCCTTTTTTTTTTCTTGTTAAATTTTGTAGTAGATTAGTTATAACTTATAAGCCA
TTGTTAGGAGAAAATACTCCAGAGAAATATTAGACAAAGAGAAGATAGCATTAAGCAAATTAGAATTCTCGATAAAATTACATCAAAATAAAATCTTGAT
ACAATTAGCCAAAATAATGGAGATCTTACTTATATCTCCAAAGATAAATATTACGAATTATTAATACAAAAATCACACACAACAATCAAAGCCGGTCATT
TTGGGAAGCATAAAAGGAAATGGAAAACCACAAAGGTGGTGGAAAATGATTGAAAAGAATGGATTTGACTACTAGTAAAAGGTTGGAGGTGGAGGTGAAG
CATAGGTGACAGGTTCCTCGTACTTCACAGGTGGTGGCGGTGAGGCATAGGTTGGTGTTTCTTTGTAGTATGGTGGTGGTGGAGGTGAGTAGTATGTAGG
TGATTGTTCATAGGTCTTTGGAGGAGGTGGAGAAGATTTATAGGAAGGTGTAGATTCTTCATAGTATGGTGGAGGTGGAGAATTGTAATAAGTTGGTGGT
TGCTCATAGTATTTTGGCGGAGGTGGAGATGACTTGTAATATTTTGTAGGTGAAGGTGACTTGTAGTATTTAGATGGAGCGGGTGATTTGTAATATTTTG
TTGGAGATGGTGATTTGTAGTAATAGTTTGTTGACGGAGTAGGTGACTTGTAGTACTTTGCGGGTGATGGGGACTTGTAGTAATACTTAGAAGGAACGGG
TGATTTGTAATAATGCTTTGAAGGAGTTGGAGACTTGTAGTAATACTTTGTTGCAACTGGTGACTTGTAATAGTGCTTTGAAGGAACATGTGACTTGTAA
TACTTGGTTACAATGGGTGACTTGTAGTAATAATGCTTTGAAGGAGTTGGGAACTTGTAGTAATACTTTGTTGCAACCGGTGACTTGTAGTAGTGCTTTG
AAGGAACATGTGACTTGTAATATTTTGCTGGTGATGGCGATTTGTAATAAGCGTGCTTTGAAGGTGTTGGTGACTTGTAGTAATAATGTGATGGATAAGG
TTTCTTGTAATAAGGAGTAGGCACATGATACTTGGAAGGAGATGGTGATTTGTAGTACTTGTTAGAGTTGTGAGAAGGTGAGGGTGAAGTATACTCATAA
GAGTAATCAGCAACAACAGTGCTGGCTACTAAGCAAATTGCCAAAGCAACAGTTAGAAAAGACCATTGCCCCAACTTCCCTAAGCTCTCCATTTTGATTT
GTAACAAATTATGCTTAGAGAAGTGAAGGATAGAACTAAAGAATTGTGTTGCATAGTTGAATAGGGAGCTCTGGTTTTTATAGGGAAAAAAAATGACATT
AATGTAATAATAGCTTCTTAATTGCCCACTTGCCCACTAAGCTGAGAGCAAGGTCCAAATAAAGACTTTTATTAGTACAAAGTGGGAGGCATTATCTGGT
GACAAATAATAATTTATATGAAATACAAAGTAGTTATGGACTGATTATTTCTCAATAATGCACAGAACAAAGAGATGTTCCTTGTTTTCTCAGTGCCAAA
ATCTGTAAGTTGACGTATGATCTAGAGTTCGACATTGCCCCTATCTCAAAAGAAGAGCAAAAGAACATATATGCAACAGCTATCAGCAATGGGCTTCAGT
ACAAACAAAGCCTATGTAAGATCATGATCCACGGCAAAGCTACCAGAAAACACAGAAATTATGAAAAGTTAAAACACAATGCTTATGTAGTTACTGACAA
TAGTATGAATCAAGCAAATTAATAAATGACAAAACTCCATAGTTGCTAAAATTTCCAAAATTTGTTTTTTCCTCGTTACATAATACAAACTGGGATATAC
AAAATACAACAGAAAAATGAATGTGCAAGTCATATGGTTTTGTTCTGTACTAATCTACACAATTGCAGATACATGCTTCATAGCACTATGCCCATCGCGA
TATACTAGAATGATCTGTAGTATTCTAGTCATGTTTGCCACTTTGGTCCGTACTTGCCAATAAGACCATAATTGACAATAAGACTTTCACCAATAGTCAT
TGCAGGAGCAGAGTCCATCTTTAATATGGTGAAAACGATTAGAATCTCTAATGATTATCTCTCTTCCCTCCGCTACTGAAATGAACTTCATTGCATTGTG
GCAATCCCCACATACTCGAAGATTTTTGAAAATTCTGATGGGTTTTTGTTTGGATGTGCTAATAAGACCAAAGGCCAAAGCAATTTTCTCACTGTGCTGG
AAAAGATATTGCTCCTTTTGTTCATCCTCCACCTCGTGAAGCACCAAGTCTGTGTTAGGAACATAGCCTATCTCCTTTATTTTAAGTGCTACTTTATTTA
ATTTTTCATATATCTCCTTTGCTTTGGGATGCTTAGTGTCGCCTACATAAAACTTGTGGACACTATTTTCAGCTTCCATCCAACTACATCCAGCTTCCTT
CACCATTCTCTTTTCTTTCATGTCTTTTCTGATCTTTGCTACCTCTTCCCATTGACCCCTCGAGGCATACAAGTTAGATAGTAAGACGTGTGCTGCTGGA
TCATTTGGCTCCTGTTCAAGAATCATTTCTGAGGCATATTTCCCCAGTTGTAGATTACCATGCACCTGGCAAGCCCCAAGCAAGGTGCGCCAAACAAGAG
CATCAACATTCAAGGGCAGTGATTTGATAAACTGAACAGCCTTTTCAAGAGAGCCTGATCGGCCCAACAAATCAACCATGCATGCATAATGTTCCATCCT
TGGAGTTATCCCGTGATCTATTGACATTGAGTCAAAATATTTCCACCCCTCATCAACTAAACCAACATGGCTACAAGCTGATAAAACAGCAATGTATGTG
ACTTCATTTGGTTTTATACCATCCTCAAGCATTTGATTGAACAATTCCACAGCTCTGTGGGCAAATCCATGTTTTGCAAAACCTGTTATAATTGAAGTCC
AAGATATTACATTTCTATCTTCCATTCCTTCAAAAACTTGAAAAGCCGCCTCTATATTACCGCATCTAGAATACATAGATATCAAAGCATTGCAGACAGA
TTGGCTGGACTGGATCCCTGCTTTTAAGACCCGAGAATGGATCTGCTCTCCCTTTCCAACTGCACCTACACTTGCAGCTCCACTCAATAAACTAGCAAAC
GTGAAAGCATCAACCCCAACTTCAGAGTCTATATGGCTGAAAAGTTCAAAAGCTTCTGCAGAATCCAAACTCTTTGAACATCCATCAACTATTATGTTAT
AAGAAGCTAAATTCTTCTCAAACAGAAGTTCGAAAGCTTTCCGGGCTTCTTCCATCCTACCAGACTTGGCATACATGCTAATTAGAGAGTTGGCTACACA
GTTCACAGATGCAAGACCCAATTTCACTGCATGATTATAGATCTGTTCGCCTATAGCAGGATTCGAAAGATTTCCACATGCCTTTAAAAGACTAGAAAAT
GTAAAATGGTTTGGCTTAACTAGACCATCTATCATCCTACAGTACAATTTTATAGCTTCCATATCGTAGTGTCCTCTTTGCACATATCCTGTTATAATAG
CAGTCCAAGACATGACATTATGATCAGCCATCCGATCAAAAACCTTTCTTGAATCATCCATGGATCCATCCATCGTACTTTTTGCATACATGTCCACCAA
ACTGCACCCGACACAAACATCAGCAGACAACCTAGACTTAATCACCCCACCATGCAGTTGCCTCCCAAGCGCAGACAACCCTGGCTCAGCACAAGCTGAT
AAAACACCACTAAACGTAAACCTATCAGGGACAAATCCTTCAGAAACCATTTCCAAGAACAGTCTAACAGCATCTTTTGAAGCACCAAGTTGTGAAAATC
TAGTAATCATCAAAGTCCAAGTAACAAGATTCCTCTCAGGCATTCTATCAAACACTTTCTTAGCTGACCTCAAATCACTAAACCCTTTAGCAAACAAATC
AATCAGTGCACACCCAACACAAACATCCGACTCAAAATATCCAGTTTTAATCGCAAAACCAAATATTGCCAACCCAACCCACCCCAACTCCGCGCTACAA
CATGCCTGAATCACCGCAGAGAAACAGAACTGATTTGGGTACTCCCCAAACTCCACCATATCATAGAAAGTAAACACAGATTCCAACTCCATACCACAAT
GAGCATAGCACGAAATCATTGCACTCCAAGAAACCAAATCCCGCTTCTCACCCATGCTCTCGAAAATCTTTTCAGCAGTTTCCCAACTACCCATTTTAGA
ATATAAACTTATCAACGAGTTAAGAACAATGGTGTCCGGTTGGATTGGCGAATCATTGAGTTTAGAGTGTAGAAGTTGTCCAATTTGGAAATTTCGGGTC
CTGATGCAAGATTTGAGGAGAACAGTATAGGAGGTGAGGTCAGGGTTAAAACCCATTTGAGAAATTTGATCAAGCGTCGAGATTGCTTGCTTAAGATTTC
CACCATTGGCTTGTCGAATCAAAGTATCCTTCAGAGCTTCGAAATCAGGGTTCCTAATTCGACGGGATTTGGAAGAAGGAGGGATGAATTTGGCGGGAGA
GGGAAGAGAGAGAGTTATCATTATCTATAACGGTATTCTGGCTTCGGTGGTTCCCATATTGGACCTTATAACACATCTCCGGTTTTATATTTGGACACTT
AAATAGAGAATAGGTTTTTCAATCACAATTTATTTTTACTCTCCATTTCACTTTTTTATTGTTTGGTTATTATTTATCTTTATTAATATTTGTTATTCAC
ATATTATAAAGAGCAACTTTCATAGCAAACACAAAATTGTATGTTATAGCAAAGTTTGCATAATTGCGCTCCATAATAAATATATATATACATATACAAT
TGAAGTGAATTGTATAAAACGAGAAAGAGAGAAATTATATACAATTTGAATTTGTATAAAACGAGAAAGAGAGAAAGGCAAAAGACACTTGGGCAGGAAC
ATATTTGTATTATACAATTATAAGTGTATAAGACAATTATATACAATTTGAATTTGTATAAAATGAGAAAAAGAGAAAGGCAAAAGAAACTTAGGCATTA
AAATATACAATTGAATCGAATTGTATAAAACGAGAAAAAGAGAAATTATATACAATTTGAATTTGTATAAGAGAAAGGCAAAAGAAACTGGCAGGGAATA
TTTTTATTATATAATTACAACTGTATAAGACAAAAAATATATGTATTTGCATGTGTATATATAATTTTCTATCGCTTTATACAAACAAAAACATAATTTA
TACATTTCGTATTTCGTTTATGTTTGTATAAACAAGAAAGACGAGGGTGGCGAGCGAGATTAGGGAGAGTGGTGAGCGAGATCCGGGAGAGGGCAGAGCG
AGATCCGGGAGAGGGGAGAGAGAGGAACAAAAATATATGTATTTATATATAATTTTCTCTCGCTTTATACAAACACAAACGCATTTTATACATTTGTGTT
TGTATAAAAAGCGAGAGAGGCAAGCGAGACTGCCACCAAATGAGAGTGGCGAGCGAGATTCCACCAAGGATAGTGGCGATAATAGTTATAGTTTGCTATA
GGTACAACTAAATCGAAGTATATTTATAGCATTTAATTTGAATTAATAATTTGCTATTATATACAATTTTTCTTATTATAAACTATATAAGACTATTGAT
TAAAAGTTCATTTTGATTGGTTTAAAAGCTAGTCAAATCTATTTTTAAGTCAGTTTTTTACTATGTAGTATTTGACAAATATAAAAGATAATTCAAAATA
AGCTAAAAATGACTTAAAATAAGTCAGAAACAAAAGTAAGTTTCCCTAGTTTTTTACTCCCTCCGTCTAGTTTTGTTTGTCATGGCTTCTATTTTTAGAG
TCAAACTGTAAAAACTTTGACTAACATTTTAAGATGTATTTTTCCATCATATTAATATGCAAAAAATTGTAATTTACAGTACTTTTCGTATAGTTTTAGA
ATATCGAATTCTTTTTGTTTAAAATATCGAATTATTATGATCTAATTTACCTTTGGAAATTAGTCAAATTAACTGTAGATTAGCGCAACATGACAAACAA
TTTCGGACGGAGGGAGTATTTTTTTACTTGAAAGTCATATCAGTTAAACTTTTTATTTTTTATTTAAAACTATTTTTTTTAAGTCAATCCAAAACAGGCT
CTAAATCTCTATTATGCGTTATTATTTTTTAATGTAATATAATATTTAAAAAATATATTATTTAATATATACCACTTTCATCTAGAATTAATAATTTTTT
AATATTTTTTAATTTTCTTCAATATAGATATATATAAAATTTAAAATTATTATTATTTTCATTATAAATAATGCGCACAATTTAAATGATAAGATTGAAA
TTTTAATCTAAAAGTATAAATACATAACATAATAATTAATGCATTTATGAGAGCAATGTAATAAACTTAAAAATTGAGTATTTATATGACGTTTATATAA
TTATATTTCATTAATGATTTCACTTTTATTTCAATTGTCGATTAATATGTATAATATACAATATTTACTTGTAAAATATGTTATTTAGTATAAAATATAA
TTTTACATTAGATAATAAAATTGAAAAGAATTTTATTTTTATATTACATGAAGATTATATAACGTGATTTTTGAAAAACATAAGAAAGCCCAAATTGAGC
AACTTTCAGATATAGCAAACATAAAAATTAGATTTGTATGTTATAATTATACATTGCAAAATTGCGTTTCATAACAAATTTTATGTTTGTTATGGAGTTT
TTGATTTGTATAGTTTACTAGATAACATTCAATTTTATACAAATAGTTCATTTTTGTATAAATTCATTTATACATTATAGTAACTTGTATAATTATAAGT
GTATAGATGAAAATATATGTGTTTGTATTTGTATATACACTTTTATCTCGTTTTATACAAACACAGATACATATATACATTTGTATATCAAATGGGTGAT
TGTATATCGAAAATGATTAATTGTATACCGAATCAAATGACAAAAAAATAAAATATTTGCTACGAATTACAAATAAAATAAACTATGACTATAACATTTA
ATTTGAATTAATAATTTACTATTTTATACAATTTTCTCATATTATCAGAGTCCAACTAATTTATATTTACACTATATTAGGAGTTTGGAGCCATATTTGC
TAGAAGTCTCATACCAAGTACTACACATATCCTTATATATACACCTAACTTCTTCCTTCAAGAAAACCAAAAGAAAAGGGCAAATGCAAAGAGCTCCTCC
TCCTTTTTTATTATAAATACCACATATTCATTAATACCACTTAACCATAATTAGGGAAAACAAGCTTAAAAAAAAAGACAATGGCAACCCCTTCTTCATT
TTCCATTGGCTCAACACTAGTCTTATGCATAATTTTTGCTTCCTTAATAGCACTAACTACTAGTAACTCCTTGGCTGATTTGTGCATCAAATGCCAGAGT
CCAAGATTTTGCTTGCAAGTTTTTGGCCTTAATCCTCATAGGAATCCTTACCAGTTGACAGTAGAGGCAATACACTTAACATTTACAAACGCCTCCGATA
CAACCAATAAGATTCATACCTTTCTAGATCAGACAAACGACGATAACTTGAAAGAGATATATAATTATTGTTTGAATTATTATGAAGCTTCTATTGATAT
TTTAAGTGATGCGGAGGAGCACTTGTTAAGGCAAGGTATATATGATACTTTGAGCAATATTGGAGCCTTTGTACAAGAAGTTGGTTTTTCTTGTGAAGAT
AGATTTCAAGAAATTGTTGATGATTCTTATGTCTCCACTCTTACTCAGAACAACAATAACATGAAGAATTTTGGTAGTATTATTATTGCTGCTGGGAATC
TTCTATCTAATTCAACATCCACAAATAATAATTAGTATGTAATAAAATGTCAAAAAGTCAATGAAAGAATGAGAATAAAGGGAGTTATGTTGTTTTTTTG
TCTTTTTTAAAAAAATCACTTAACCATAATTAATTAATATATATTATTTTCGTATTTAAACACTTAAATTATAATAAATTAAATTGATTTGATGCACAAG
CGGGCGTTTTAGTTATCAAATTTATGAATTAACATCTTTAGAGTTAAATAAAAAAGGACAATTCAATGCACCAACTTCGGCTATGTGTCTAATCCAGAGA
AGAATCGAACCACAAAAGTTTACCTTCAATATTTACAGACTGTTCAAAGGATAAGAAAAGGTTAGACAAGAAAGCTAAATAACAGTGACATCATTGTTTT
GCCCCTTTTCTTTAACCCTTTCTCTTTTTTGCTTTCACTTAGCTGTTAGAAAAGAAAAAAAAATCAAGAAATTGAGATTCTATAAGTTACATAAGCTATG
ACATTTACATGTATAAAGATCTGCTTTCCAGATACAAATGGCTAAGATTAGTCAGACTTACTTCCTCCGCTCCATATTCTATAGTGTTTTTAGCTCAGAG
AGAGGTGATTAGACAGGATATTCGTTTTCAAATAGTGGATATGTGGAGACTTGCTTCTTTTTCTTCTGTTTTCGGGGACAGGCATGAAAACCACAAAGGC
CAGCCATAAGAATTTGGAGAAATCTTAGCAATGTGAAGTTTGTCTGTCACACATTTGATGTTGCTACTTGCCTGCTTTTCCATATGATCGGAGCCACGAG
CATCCATACTGGTAAATTTGAGAAATGTCTAAAGCATCACATTACATGTTATAGATCCAAAATCTTTATAATTATACCACAGTTAATAATATTGAAGGTG
GCCAAGTTTGGTGAGCAACAACTTACTGTAAACACAAACTGCAAGCCATTCATTCACTACCCTTACCCAAGTACTAGTCCAACCAACGTCTATCGTAAAC
CTGCAGATTAACAACAAAAAGCACTATAGAATAAGCATTTTGTTACAACTTCTATTGGTTCATTTCTCTTTCTTAACAAGTAGAAAGCAAGCATTTCAAT
TTCCTGCCATCACTTTGAGCTGAAACCAAAACATATTATCGCCCAAATCAAAATTTACATGTTGTTTGAAGATGAAGGAACTTACTTCTTCATGGCGTGA
TTAGGATTCCATCCAATTAATAGCATTGCAAAATACATAGCTCCAGTCGCAAAGACGAAATGAAAGAATCCATAACCATATGGTACATCATCTTCTTCAG
GTGCATCATCCTTCTTAAACTGTAACTAGTTTCTGTTAGAAATTTTTCTTAGATATATTCGGATTATTATGTAACTGAAAAGTATTGAGGTATACCTGAA
AGCATTTTGAATCAATTCCAGTTGAAAATGTTGCAATGACAATTGTAAGGACTGCTACAACAAAGCTCTGTACAAAATTAACAGTGAAAGTTTACTTAAT
TACATGTCGGAAAAGGGATATATTAATTGTAGTATTCTACTACACCACTATATATTTTGAAGTCAAGACTCAAATAAAATTCTAGCAGCACATGAAATAG
CATTTGAATCTAAAGAAAGCAGATCTCAGACCCAAAGCCCTACGGGGAGAGCAGAATCTTGCGAGAGAAATACATTAGACCACCAAGGTAACGGAAGTGA
AGGCAAGTCAACAGGATAAAGCTTGTCCAAATTCTTAGAACAATAGAATAATACTACAACTGAACTGAACCTTTGCCAGTTTTAACTCATTATTGACAAA
CTAGCAAGACATAATGCTACGTGTTTAATGACTCAACGAACATCTTGAGTCATTTAGAGGTCGGGAACTTACTATGATGGTGAACCAGTCTCCTTTTCCA
GTTGGCGATTCTGCTTTCCGGATGCATTTCTCCTCTGCAGGTTCACTGTAAGTACATAACAAGAAATTAAAGCATAATGTGATGAAACCATAGATGACTA
ATTGTGTATCGGCGTTCTCTCAAGTGGAAGCTTGAGCCAAACAGAGGATTCCTCAAATAAATGAAATTTATAATATTAAAACTTAAGTTGTGACAAGTTT
AAGTCATCTACTTCCAATAAGTTTGAGAATATACCAAGATATGCCAATTCTTACTTCAGGTTCTTAGGAGCACGGCTTCTCACTCAACAAATGACATTAC
TTATAGAAATTGATATTCCTAAAAGGCTCAAGTGATGATAGATAAAGAATAGTCAAGAAACTCTGTATCTAGTGCTTAGCCTCAAATTGCAGCCTTCTCT
TTTTTGCACTCTTAATGAATTAAAAGAGAAGAATGCAAGGTTTACGAAAAAAACAAATCCAAATTGTACCTTCTGATGGCAGACCAGCAGAGGAACACCA
CATATAGCCCCATAAAACCTGGAGTCAGGAAACCGGCATTCACCTGGTGCTTTGATCAATTAATATAAATTCATCCCAACAAAAAAATATAAACACAAGA
AACTCAAACTCACTTTGGGGTGGAGAGAAACACTGGTCATGAGTTGGAGGAGTACTAATGTCCAGGAGATGAAGAAAATATTAAGAAGGCACGATGGTTG
AGGCGTATACCAAATGTACATTAAGATGATCCCGAGGATGCATATAACGTATGCAACTGTTGCAAGTAACATCATTTGGACGTGGCTGCAAAATGGTTTT
ATTTCCATTAGCACTAATCAACAACCATATTAAACCTTCATAGGAATTACATAAAATGTACCATCACTGAAATGTACGGCTTGTTCTTCTTCGATCTGAA
CTTTAGCCTTTTAATAATGATTCTAATTCAAAGATAACAGTACTAGCAAGAGGAACTGTTCTATTTTTAACAGTAAATAGCACGTGAACCATTTATCCAA
ATGAGTCGATAACATCACAATGCACATACTTCCCTAAAATCTTGTCTAAAATACGACCCTATGCTTATATCAAGGTCTGCTTATCGTCGATCAAATTTAT
GTATAAAAAAAGACTAAGCCAATTACCATCTCACAGCATATTTCTCTGAATGACAGAAATCGTTCAGCCATGTGATAAAACTGATTATACTTACAAGCTG
GATTAGTAAAAATACCCTGCAAATGGATCAGAAACAGAATTAACGAGAGGGTAGTACACAAAATGTTAAGCTCAATCCTATTATCAAAACCAACACTAAA
GTGATTGCACATGACGAAAGAAGCATGCTAGATGAGTTTGTCATACCCAGCACCAAAATGAGCAACCTGGCCTGTCCAGAAAACACAACATCATTCAGCA
ATTTATCATATACTGATAAAACTACATATGACTGACTTATTAAATCTGAAGTAATGCATCTATACTAACCATAGATTGAAATGATCTCTGCTGGAAGAAG
AAAGGGTAGTACAATTAGAGAAATATTCATAAAAAGCTTGGCAGACCACCATCCTGAGTGCCATAATTCTCTGCGGTCATTTAATTTCGAAGTACCAGCT
GTAGATAGGAACATGGCGAAATAGAATAGCTATAATGACCATGTTAAGGATTGACTCAGAAAATCAATAATTTCATCATCGAGCTTCATGATCATACAAA
GCCATAAAAGTTTCAACTTATTACTATCATTGAGTAAATTTTACAACTAGCTAATTTGAATCAAATGGGATTAGAGATAGGTAGGATACAGAACACCCCA
AGCTTACTCTCAATACTCCTTCTGCACCCATACAGTCTTCACCACCATTACATCCTTTAAGTCCTACAGGTATACATATACACACCGTTAGAATCGTGTA
CTACAGATGTAGCACTAGAAATAGAAATCTATGGCCAAAATAAAGAATGAAGCAATCTTACTCTTCATTTCTTTCAAAATGCTATGGCCATAATCACGAA
CAGCCCAAGCTAATAAATTAGCAATGAGAAACAATATGGCGTAAAGATATCTAGCCATCCAAGGATTAGAGCCATGTCGAAATTGGTCTAACCAGGATCC
TTTCTTGATCTTGCTATATCTCTCAATACTACTTCCCTCCATTTCTTCTTTAGAGCCTTCAACTGTAGTCATGGCATTAAAGTACCAATGCAGGGAAAGT
TGAGTTCTTCAATTCCTCTACCACCTCTCCATCTGCAAAAGCAAAAATGAGAAACATTAGTAGCTCAGCTGATTGACTTATCTGAACTTTCGGTTTGTTA
GCAAAAGCTCGATTTACCACCTTATTCTCTCCTACCTCATTTCCCCTTTCGAAAAAAAAAAAGCTAGGATGTAGTGATCCAACTGAATTGGAATGGAATA
TAAGAAAGATTGATGTGAAATGCATGAACCAGATCCTGATTCTAAAGTTGTGAATAGGAAGCAAAGAAACTATTTCAAAATTGCTTTTATTAAAAATGAT
TTGAACAACTATATCGGCTATAATGGACCATTAACAATAACTTTAAGTTTGGTAAATCAAAATTATTTTAGTCAAATTTGTCTGCTAAAAAGCATCCAAC
TCCAATCATTTCAGTAATTTATTGGTATGAAACAATTTTGCACGAAATTTAAGAAAATAAAAAACTCCTAGAATATATCAAAATAAATATTTCGTAACTA
AAAAAAACCATAAGTGAGATGTTTCGTATATCAATAGCAAAGTGAAGGTTGGCATCAATACGAAAAGAATAAAAAAGGCAGACCGAATTATTGAAACTAT
TCTGCCTTTCCATCCAAGAGATTAAATAAACAAATTCTCTTCCAATAAAAAATACGTGCAACTCACGTGACGACTCCATTATATTGTCTTCTGTTTTCTG
TTTTAGTTTTCCAAAAAAAAAAAGTTTGCTTGCGTTAACAGCAACGAATCTGCAAAAGAGTTTCTCCATTTTCAAAACACATTTTTCTTCTTCCCCTCAA
TACATACACACAAAAATCATACAATAATATGAATAACTGCAACTTTCTACCATCACAATTACATACCCGGTAACAGATCGAGGATCGCACACGTTTGAAG
CTGAAAATGCAGTTGATTCCAAATGAAAGAGTAGTTGTCAAACTAAAATTTGAATGAAGAAGAAGAAGACCACAATGTGTAACTTAGTTTGTGTATGTTA
TAAAGAAGGAAAGTTTTGGTTTTGGGTTTTGATGAGAAACTTTTAAGACTCATTTTAGAAGAAGAGTAAACTAGAATAAAGTACTACTCCATTACTTGAT
CCTAATTTAGTGGAAGTGGACCCTACACATGCTTCGGCGCATGCCTTTCCTAAATTATTACTACTCTCATTTTTTTTTATCTCCCTAATTTAGATTAATT
AAATGTGAAGCTTTAAAAACTGAAAATTATTTTATGTTTGTCACAAGTAATGATTCATGTGTGGGAGAATAGCAGCTTTATAGCCTTTAGTTAGTACTTA
CGAAAATATAAATACCCTACTTTCCTATTTGGTAGGTTTATATTATCTAAGAACTTTAAAGACTAAACTAATAGTTTTGCAAGCATAATGATTAGCTTGG
TGATCATTTTGAATGCAACTTAAGATTTTACCTGAAGGAATATAAGGTATTATTGAATTCCTAAACTTAACTTAAATGCCACTAAGTTTTAGTAAAACTA
ATAAAATGTGAAATGTTTTGATGCTTAGATCCAAATGAAAAGTGTACAGAGAATTCTTTTTATATATATAAATATTAGAGATTATACGACCAGTTCAACA
TCTACATAATAAGAGAACAGAAACTGAATGCGTACTTCAACACACTGGACTTGTCTTTAGCTCTTCTCTGTGGTTTACAAGCTATTGCACAAGGGCGGAT
TTGCACCTGAAAGGGGCAGCAGGGTTTCCGGGAATTTCCAACAAAAAAACACAAGCAAAGCATTGAATTGTATGTTCATGTGATTAGTACATCTTTCTAT
AGAATCACCTTGATAAATAATAATCACTTCACTAAACTACAAAAAATGGCCAATATTTTTTCATTTTGGGTTGTATAGACCATGGTACACCGCGAGGCTG
TAGAGGCCAAGGATAGCAAACTATCCAGTGTTTGGTCAAACACGTTAAAGTCACACCTCATCGCAAGCTGATTACAACAAGTCACCACTGATGCTGCAAA
GTCGCCACTAAATGATATGAAGCCAGTTTGGCAATCAATCATGCTCAGTTCGTCCAGCAAGATTGGCCCAATTATCCGAGTAGATAGAACTGTTTCAGGA
CTAAGTATCCCTGCGGCTTTTCTTATTCATTTTATCCTGCACACGGTACTTTTCTCGTCTCTCTTCTCTCCGTCGCTTCTTTGAGAGTTGCTCTTCCTTG
GTCCTTTCTGTTTCAAGTTCTTTCTTCTTCTCATCATCTTTGAGCTTGCGTGTTTTTATCTGAAAAATGAATTTCAAACGATGGTGACTGTACAATTCAT
ATCCAAACAGATACTGTAAGCTTTGACAATCAGTAAATTTATGGCACTGTGTCACTTAAGGGTGAATTATCCAAATAACTCTTCTAAGAAATTGTTAGCT
AGTATTAATGGGCAAGTGATCACAACCTACAGCCAGGAAAGTACTAGCAGTAAAACCAAGTCTTAACTGCTCCTGTTGGAGAGAGCATACCTTCTCATGC
TGAATGAGTCTAAGTTTTTGAATATTAGCAAGCACTTTGCGCTCATGGGGTTCCATCACCACAGCCCTCCGATCTTCCAGGAGTGGTCGCTTCCGAGCTG
GAGCATCCTTGGGCTTAGAGGCAAAGGGGAGACCTTTCTGTAATTGCTTGGGAATTACCAAGGGGTTGAACTTTTTCCGCTTTCGTTCAATTGGCTGCGG
CATCAAACAACATAACAAGCAGAGAGGCGTCTGTCAGCAGGAAGAAAAAACACGACAGAAAGACTTCAATGTAATAATTAAGTTATTAACAAACGTTGAA
ATAACATGTTTCACCTTATATAACGAATCCTTGTTGACAGGCACTGGTAGATTATGTTCTCTCCTTAATTCAGCAACTGTTTTCATTCCTCGCCAAGTTT
GATCACGCGGCTGTAATGCTGTTGTCAATGGATTGTAGAAGGAAGGAACTTCAACTTGAGTCCAAGCACGCAAGAAAACAATGTCACTCATAAGGATCTT
ATCCTCAAATGTGCATCTAGCAATGCCTTCTTTGGCACTCCCACCCTTCTTCTTGGGTTGGTTACCAATCTCTTCTTTAGCAGCCTAAGATTAACACCAA
CAACAGAAGTAGGGAAATGAATTAGGAAACGACTAAAACCATTCCAAACATAGAGAACTGTTTCTACTACATCTTCACAACTTTCTGTGGTAGAATCACT
TTGCAACATGCACAACCTTTGGATCATCCTCCAAACAACGAGACAAATACTGTTAAGAAAATGTCAAGTATATGCTACAAGTAACAAGAACCACAAACTA
GTGTCCATGGATAACCCATAGGTATGGTGAGAAGAGAGTAGGAGGAAACCCTGAATAACGATCACAAGCAGGCAGGCAGGCAGGCATGGATGAAGACCTC
TTCCCCACCCCCCAGTGCACATGCACCTTTTTCTTTTTAAAGAATTCATCTTTGTTGTGTGTAAGAGCATGCTTTATTAGAACAATTTAAACTAAATATC
TTATGGTCAACAAATCATCTTTGTAGTGTGTAAATGCATGTGCTTCGTTAGAAAATTAAAATACTAAATATCTTATGCTCAGCAAATCAACACCGCGTAA
CTTTTCTATTCTTTCTACAGATGTGGTCAGAATCTCAAAAAATAACATTTCATACTGTTTATCCCTCTGATCAAATGTAGTTGGATACCACCAGCATGCA
ATTTTTTAAAATTGCGTTGATCCCAGAAAATTAGTATAACTATTTAATCTTGGATTGATAGATGGTGGTTTAATATTTAGAGAAAAAGAGGGAATGAACA
TGAGAAGTCAGTATCTAGATGAAGTGACAAGAAATTATCTTCTTCCCGACTTGATTATATTGTCTAAAGTCCTGTCAATTTACAGTCAAGCACAAGTATC
CCTAACTAGAAAACCAGGAAGCGAAGTGAGACAGCAGTTAAATGATACCCAAAGTGGTAAACTACCTTTTTCACTTGCCCACGAATTCCACTAACAGTTC
GAATAGCTGCACCTTCAAACCTAGCTATTTCAAGATCTGAAGTGAACATGTCCTTGATAAGTGCTGTCTTCTTGAATATTTTACATGGGTGACCAACTAA
CTTAATCTTTTTGACTATTCTTGCTGCATGGTTGAACTCTAGCACAGTTGCAGTCGCAGTGATTCTAAAGGATGCCTGTAAAAGTATAAAGACAGATATT
AAAAGGTAGAACAATCAGCACAGATGCAGGATCAGAAATCCAAGTACAAAGAAGAAGAACAGTGTAAAATAGTATAGCAACTAACAAGGGAAGCAGTGCA
AAGGCTACGAGAACAACAAAATAGTGTGATAATATCAACACAATAAATATTAAAACAGGAACTACAATAATATGGCCAGTACAAAAATAAACACCAACAA
ACCTAAACCATCAAAAAGCAAAACAATCCTCCAGGATCTACTAGTAACCTTTTACCCTAAGTATGCATCCTCCACGCCCTCCTATCTAAGGTTCATGTCC
TCGGTAACCTTAGAGTTGTGTCATGTTCTGTCTCCTCTCCCAAATACTTCTTCAAGCTACCTCTACCTCTCTTCGTGCCTACTATAACCAACTTCTCACA
CCTCCTCACTAGGGTGTCTGCGCATCTTCTCTTCAAATATCCAAACCATCTTAATCTAGCTTCCCTGATCTTGTCCACCCGTAAGGCCACTCTCGCCTTT
CCCAAATATCTTAATTCCTAATATTATCGCTTCTTGTATGTCCACACATCTTTTGAACATGGAAGTTGTTGACTAGCCAGCCAACACTCCGCCTCATACA
ACAAAATTGGTCTAACCATCACTCTATAAAACTTACCTTTAAGTTTGCTATATTGTTATACCAACAAACTCCAGATGCAAGCTTCCACTTCATCCACGCC
GCACCAATACGATGTGTGATATCATTGTCGATGTTCCCATTTCCCTGAATTATAGGCTCAAGCTGCTTGAAACTATCTTTCTTAGGGATAGCCTGTGTGT
CAAGCCTCACTCCATGCCTGCCTCTTGCATTGTATTACTGAATTTGCACTCCAAATACTCTGTACGCTTGAGACTCTAGAGTTTGTCTCCATATATCCAA
CCTAGCATTATAACTTCGCTGCGCATTTCATCAATCAGTACTATGTCATCCGCAAACAACATATACCAAGGCACCTAATCTTGAATGAACCGCGTCAATT
CATATGGTAATAGTAGTTAACAATGTTGGTGGAACAGATAATTATGCTGATGGTTGGCAATATATAGTGGTGACTAGTGGTGGTGGTTGTTGTGTAATGG
TGATTGGTGGTGATGATTGCAAGTGCTGGTGACAGTTAATTGTAGAGATTGGCAGTGGTGTTATGGGTGAGGATGGTGGTTGTGACTGGTGGTGATTAAT
AATAGAGGGCCGCAGCAGAGGTAGTTGGCAATGGTGAGTGTATTTTAAACATTATGGTTGGCATAATATGTTCTCTATAAATTGCCGAGATAGTCTTACT
TTATTTGTTCCCTGAACCTTCAGACTTATTCTCTCTAGGGAGCTGATATGTATTTCTTAGCACTTAGTACTCTTCTTTTCTGCATATACTAAATGTCATC
AATGAAATCAATCAACTCATCACAAAAATTTATTGATATAGTGTTAGGTTACTTAAATATTTTATTAATTTTTAAATGAAGACAAGTTTTATATATTCAG
TTGTTGAGAAAACAACAGGCTTAACTGTAAAGTATCCATATCTTAATACATCTTAGTATTAAGATGTGTATTCAGACTAGAACATGTAAATCTTAATACA
CATCTTGACATTTAGATACATACATCTTAATCTTAATAGAAAAAACAAATAAGGCTCAAGGCATATTTAGAAATGAAAATGGCTAAGCACAAAGCCATGA
AATAAAAGGAGGCAGTAAAATGTTTTGTAAATCAAGCAATAAGTATTTAGAGACTACAATCTAGTGAAGACAAATGAAATTGTACCTATGGATGATTCTT
CCAACTACGAGTAAACATATGGTTCCCAATTAATTTAAGGAAATTAGTTTGGCTTGCATAGCTAGGCCTTTTTTCTCTTTTCTTTTTTGAGAAACGAGAA
ATCCACGAGGGCCAATAGTGCAGAACAGAAATTGGTGAATAACGGGCCTGCTCTCTCCACCCTTCTCAACTTATATACTGGGTTATTGTTTATAGCAAGT
TTGAACCCGTGGTGCACTCTTACTTACAAACCAAAGCCCTGGGGGTGCTTGCATTGCTAGACTTGTAAAGTTAAGACTTCCATCTATAGGAAGAAATGGG
GAAATGGACCATAACAGGTTAGCTTTGTACTTGCTGAATGCATTCCCACACAACTTTACAGAGGCCCACCTAAATACAACACCTTACCTAATTGTTTGAC
AAGTACTTAACAGCAAACATAGGCAACTACAAGTGACAACTTACTTGATTATTTGACAAGTTCTGGACAGCGATCATTCCCGTGTGTGGAGGCACAAGGG
GACCCCAAAACATTGCCAAACAATGCATGTGTTCAGGAGTGTACTTGAGCATACGGTGACGGCCATTTTGATCCTCAATGGCATAAATAGGTACAGTTTG
GTAGCGCCTCCAACCAATAGAAACAATAATTGGATCCCTAGTCTTCAGCACTTTCTTGTGCCACCTGTGCCGCTTCAACCGAACCTGAAAAAAGAAGAAG
ATAGTTTTCATCAGTAGTATTGGGATGAAACTATGCACTCATCTGGAAAATAGAAATTAAGATTATTCATTCCCAAAATTTGACTTCGTATAATTACACA
TCATAACAAGGCATTAACATTGACCAAATAAATTACACCACGATGCATTAACTTTTATGGTCATTTAGTTTATGCAAGTGTCTTTTCTTTTTTCTATTCA
CGAGTCATGCTAACATACTACATAAATGCATGAGAGGGGCAGAGCCTCTCACCTCCTTTTTCTTCAGTACTATCTAATATACTTGCAGATAAGCTGTTGA
GAGTAACAGGGACTACCAGTCAGGGTATTTTAAGCTTACTACCATCACATGTTCAGAACTATTCTAGTTAATGGGGGAGTTGCTTAGAGCAGGGAAGTTT
ACACCTAGATTAAACTCAATAAAATAGAATTTTGACAGAATCTTATTTTCAGTAAACTATATCTTGTTAATCAAACAAACCTAATGGACACACTAGTTCT
TCCTGGGCAAACTAATAGCTTTCTTTCGGTAAACAAAGATGATATAGACTCTCAAAAAATTGTTTCAGGTTGCACTTCTCTCTTATCTTATGACCGTATC
TGAGCAGTCTGTTGTGTCTTCTAGCATTCATAATACCATAACTATGTTATGGCCTCTCTGGGAGTTAATAATCCATCCATAGTTCACAACTGATAGCTTA
CAGTAAATGAACAAGTTTAACTCATTAATATATCGTAGAGAAGAGACAAACTTCTAAAGAAGTGAATACTAGTTCTTTCAATTGTTTACAAAACCAACAA
TCGAGTGTTTTCATTGAATATCCATTTTATGGGTAAATAAATAAATAAATAAAAATGGACATAACCAAAGAGGAGCTTTTACCTGCATGTATCCAACATT
TTCTTCTCCAAGTGCTAGACCTCCGAGAAGAATCGGATGGCAAGGATCAAAATATTCAACCATTTCAGAGGGGACATCGTGAACTTCTAGTCTAAGATAA
GTTCCTGTTCTGAAGCCTTCTATCTCTATCCGAGTGGCCTCATCAAGTTCATTTAGTGCAGCTAAATTCACTTGTTTCTGAAGCTCTACCTCTTCTTTCA
ACTGTGAAATAGGACATGATCAACTATAGAGTAAATGCATCCCACTTTATGTTTGACTGAAATTAACCAAACCTTACCTTATCATAGTACCCATTTCCAT
CAGCTTGACCCCGATGAGACTTCGTGTCTGGTTTAATAACCTCGTCCTCATCCTCATTGGAGGAATCCGACCCACCATATGTACATAGAAGTTAAGGTCA
TAAAACAAATTGCAAGGACAACAACAAAACATACCCAGTGTGATCCCATCATAGTTAGGGCAGAGAAAATATTTGATGATGAATGAAAGATGACGGGGTG
GAGTGGATGGAAAAGGAAATAAAGATGAGGTGACAAAAGGATATTGAGAATCAAATTTTGCACGAAGTGCCAATTTCTTTAGTCTGCGCTCCTCAACTGC
TGATTCATCATCCATGCGGATCATATCATTAGTTCCAGTACCACCTGCCTCATGGCTCTCATACTTCTGACCTGTTTCCAAGTCTTCAAAATCACCAAAC
AGATCCTCGTCATCCTCACCAACATCATCATTACCATTGACATCCCTTGAGCCACCTCCACGTGCTGTTTTGGACCAGCCTTTGCTGACAAACCGGAAAC
GGATAGTTTCAATTGATTCTTGAATCCTCCAGTCAATTTGACTTGAAAAATTTACAAATTTGGAGCAGTCCTCGGCATCAATATTATCATCATTCATCTG
CTCTTCGAGTTTCTGCACAAGGATATGCAATAATTTGACAAAGTCATTTCAACTTCTACCAAAATAGTAGTGGTAAAATAAAAAACAACTACAACAGCAG
AAGAGCTATAATTAATTGCAATGAGAATGCTTTCTTTTGGTCCCTGTACATGACTATCATGTCCTCTACTACAATGAAGTCATTTTGATACTTCTACTGC
ATACATTTTTGGTTACAAAGTAGGCAAAAAACATTTTGAAGATATTATCACAGTTCTCAAAATCAAGATACACTCAAAATACTAAGTAAAAGACAGATGT
GGTAGCCACGTGATCGAGTAATCCCTCTCCCTATCTATTAGACTAGAGTGGATGGATACTCTGAAATTGTAATAAAGATTATTATAGAAAATGATTCTCA
TAATTCATGTTTCATCTAATTGACACGCAATGTGCTTAGCTGGGTATCACATGGACCAAAAGCAAACTACTGTGGAACCAAAAGCTTTATTATTTGATGA
GCTGTTAAACCTTTGTTCCTTCCCCTTTGGGCACGAAGAACTCAGTATCACTTTCATCATTTTCAGCGCCATGCTGTCGTAACTCAGCTTTTGTAGTTGA
CTTGGATTCGGATGCCCCATATACAAGCTGCATAAGATTAACATTTTGGCGATTACGTGTCCTTTCAGACAGAAATTCTTTCCATCTTGAAGCATTGCCC
ATGTCCTCTTCTACGAAAGGAAACAAACAAAGACTCCATAAGAAATGAAAGATTTGGAGTAATTAGAAAAGAATTGGAAATAAAGCGAGCTACTTTACAG
CAAGTTAGGAACTTCATTTACTCCTAGGCCAAGAGGATGATGAAATACTATATGGAGATCAAACAACACAGAGAATGATGTCTGTACTAAAGGAACTCAA
AAACCTACCATTTGTATCAAAATCATCGTCATCCCCTGAATTATGATAAGCTTCATTTTCCTCATCAGTGTCCTCTAAATCATCATCTTGTGCATCCTCT
TCGACATCTTCTTCACTATAATCCTGGATTTAATGATATAGTATAAATACAACACATACGCATATCAAAGTCCAATTCCACCACACGGTGAACCAGGACA
TACAAGAGCGTAACTTTTGGGTCAAAACTTAAGTTCAGAGCATATATGTGAAAGACATAACAACTTATACAAATTAATGTGAACAATAATATGCAGGTGA
GGTTTATATAAATATTGGAAAGGGGTAATTAATGAGTTTTAGGAAGCACTACTCTTCATGCAAAGAACCTCTGCTCCCCAAAAAAACCTGGCACAATGGC
CAGCGACTCTTACATAGGTGGAAAGCAACAGGTTCATCAGATTTCTCCAAATCGGAAAGAAAAGAAAAAAAGGAGACACAAGCATTCCTCCTTAATATTC
TGGTACAGATAGCTGTCTACTTGTTTTTATCCGCTATACACAAACACCTCATAGACAAGATGAGGCACAACGAGGTCAGGAACTAGATCGGAATGTCATT
GGCTTACCTTTTCATCAAAATCATTATCATTATCAAAGATAGCTTTTCTTCTCATTCTTCCGTCATGAAAATCAACATGTTCCCTGAAACTACTACTCAA
TCCTGGGTGCTTCTCTGGTCCAATATTATCTTCTTCCTCAGAACTATCATCCGAGGAGTCGTTTGACTCCTTAAGATGAGTACGCTTCAAATCTTCAGCA
TCATTGTCCTCATCTGATCCATCGCTGTTGGGTTCAAACCCAGACTGATCTCGCTCCGCAGGCACCAAATCATTAGTTTGATCAGCTTTAGCATGATTTG
ATGGGGATGGATTATGTTTTTTCCCAAAAAGAGAAATAAAACTATTTTCTAACTTCTCATCGATTGAATATTTCGTGTTCTGAAGTGATTTAACTAAAGC
CTCTCCGACATCATTGCCCTTCCCTGAGATCAAGAAGATAATACTTGTCAGTTGGAAAATGTCTTGCAAAAAGTTGTGACCCAAGAAATAAAATAAGATC
ATATAGCATGTTGGAAAAGGTGATCTCAACATCCAATATTTTCTTTATCCATTATTAAGAAAACTACTCAGAGCCCGTAATACTTAAAAATACAAATTAC
CAGAGTTCAGAAAAAAAACTAGTTGTAGATCCATGCATGACACAGGTGAGATTTTTAATTATTAGTCTATGCAAAAAAAAAAAAAAAGTGTGCCTAACAT
AATCCTGTTCTTTTATTTTTTTTCACGCATTACAAATGTGTGGACCATTTTTTCGTAATAACATGGTAGGGAGGTGACAGTAACATAACTCAATTTTTCT
TTTCAATTGGTCAGCTTAGTGAAAATGCACAGAATCCAACAAACTTCTATCGATCATAAGGCTTTTTTAGAAACTACTATCGATCATAAGATTAACAACG
ACCATTCCTGTCCCAGCGGTATCTAAGCAATTGGTAAAAAGATGTACCAAAATTTTACAACATATAGGAGTTCTTAACAACTTCTAACATCATCTAAGCA
AATAGCACTCCTTTGAATGCAAAAGAGAGAGATAGACTGAACGTAGAGGAAATGGATGACACAAACACCAACACAAGAAAAGATTTCATAATCAACATGT
GGTCTTATTAAGTTGCTTGAACAATAATAAGTAAAGTTCAGCCAGAAATTATGATGAGTAACTGATAGGGATGGACGGAATCCAGAGCAAAGAAAAGGAA
AGCAACGACATTCAAGCCCTGCTAATTGGTAATAGCAGCAAATTTTAAAGCTATAGCTGTTTATGAATAAGAACTTACCAATTCAAACAACAAAAAAAGC
TATAACCAAAAGATAGCCAGATGCATATCACTTATCTTGCTGGACTAAATAGGGGAATGTGAATTTCCCATAAGCTAAAAAAAATTGTTCACTTTATGCC
AATCGGAAATCTATGGCCAGTGCTATATCACCGAACCAAGGTAGAAGTGGGAGATGGGTCAAAGACATCCTTCTGGGATGATAAGTGGAATGGGTCTGTT
CCTATGAAACAATTGCATCCTGAATTGTTCACTTTATGCCAACATCAACAGGCCACTGTGGCCACAATGAAGGCTGACAAGGATGGAATTTGTTTCTTAA
GGAGGAACCTTCAGGATTGGGAGATAGACAAAGTGGCAGAATTTCAAGATTCAGTAGGCTCTTTCAGCAACGTCACTGAAACGGAGGACTTATTAGTTTG
GCAGAATGATACCAAATGTCAATTCTCAGTAAATTCAGTTTATAAAGAACTCAACAAGAATGGACAGGAGATGGAATGGCCATGGAAGATCATTTGAAAA
CCAAAAGTACCCTACAGAGTAAACTGCTTCATGTGGTTATTGACAAAAGAAGCAGTTTTGACACGTGAAAATCTAAAAAAAGAAGGCTATCAGTTGGCTT
CGAGATGTACTTTATGTGGAGAACATGCTGAGCAAATTAACCATCTTTTTTTGCATTGTACATGGAGAGAACAATCATGGAGAATGTTCATCTGTCTAAA
GGGGATAAGATGGGTGAAACCAAGGAGCATTAAAGGAGTCCTGAGCAGCTGGAGTAGAGATGGCAATGCTTCTGACAAAGAGAAGAGATGGAAACTTATC
CCGGCATGTATTTGGTGGACAATCTGGAAAGAGAAAAACAGCAGGAGTTTTGAAAATTGGCAGAATAGCTTCCCGTAGATCAAGATGGACTGCTTAGCTC
TTTTCTATTTTTGGTGTAAACAAGATATATTAACTAGGACAGAAGATATCTTTGATGTGCTTGATTGTTTATAGGTAGCAGTTTAGACTAAGACTATTTT
ATTCTATAAGTTGTAAAACTTTTGAAGGGAAACTATACTTTTGTTGTAGTATACCTGTGGATATATAGACTAAAGTTACCAGTTTCAAAAAAAAATGGGA
TTCGTTTTTTAAAAAAATAGGTTTATAAGAAACAGAAAAAAAATATTTACCTCTGCGACCCCCAACAGCAGCTGTTTCATCAACCTTAGAGAACTGGACA
AAGTGATCATTTATGTTTATATACACAGCATCCTTATCGTAAAGAAGATCACCCAATCCAGACATGGGGGCATAAAACAGCTTTTCTTTGTCCCTTAGTC
CCTTCTTCTTGGCAGCAGATGGTAGAGGGCATGGATCAGGTAATGCTGTTATACCTGCTAAACTATAATCACCAACACCAGCAATATGTACCTGGTCATA
TTGTGAAAGCAGCTTTAGGATATGGAAAAGGGAGAAATAAACTGCTAAATCACTAGCTGAAACACCGTATTAAAATAACTAGATATAAATAAAATGAAAC
GGTCTTCACATGAGTCATTATACAACTCGTGAGTTTGTATCCCAAAGGCTTCCATCTTTCCCGATCTTCTCAACTTTGTTATGAAAGAGAGATAACTTGT
TCCCTTTCAATAGTACATCGAACAGTAGAATTCACAAACTCTAATTGTTGACATGTAAAGAAAATATTATTCACAAGCTAAATAGCCTAGCACTAAGCTA
ATGTTGGGCCCTACAAAAGATACCCTGTGCAAAATCTACAAAACATTGACAAGAGTCTAATTTTTCCTCCTCACATATGATGACAAGTTTACACCAAAAA
GGCCAAAGGTCCATACTATACGCAAAATTTCTAAAACTAAAGTCAAAATTCTCTACATTAGCCACTAGATATTTGAATGTTAAACTTGATGATTTTCTCT
AAGTCATCGAACCAGATCTGTGGTATTACTCTTAAAGTTCATCTATTTGTAGCCCGATAGCGTCAACCAACACTCCATAAGATGTTAGGCATATTGCTAT
GCCATCTCTCAAGTCTCAGCAACTATATTACTTTCAATTGGCCTTACAGGGTGCACGAACCTTTGCTTCTATTCCTATAAACAGCCAGTTCATAGCATAA
TCAGAATTTTATTTGACATGAATTAGTACTAAAAGTTATTTTTTGAAACTGTAGTACTAAAAGTTATTTCCCAACCAAATACAAGAAAACTACAAGAAAC
AAAGCATTCACATTACAGACCTTTGTTCCTTTCTTCATATTACATCCACGAAGATAACCGTACAAAATGACATTTCTGTCACACTTGTTGTCCATGCGCA
CTTTTTCAGGGGGAGTTACATCTTCAAATCGATCTACAACAATGTAGGGGTGGGACATGCGCCAGGATAAAGGAGGAAACTTCATGACAGATATAAACCG
AGCAAGATTATGCACTTCACGTTTAGAGTACCTACTCATTAACAAAAAATTGTTTCAGAAATTAAATAGAAATATTACATTATATCAATGTAGCATGCTA
AACATGTATTTTCAAATATGGAAGCCAGGGACTTACTTTTCATGGATGAGACCAGACAAGTAAAATAACTTAGCTCCATCATATATCTCAGTCCAAAATC
TATGCTTTAACCGTTGCTTCGTCTTTCTAAGCTTCTTAACATCCTTGAACTGGTCGAGATGTGTAAGAACACCCATAACTTTAGGAAATCCATGATTTTG
CAGTATATTAAGGAATTCAAAGGTCTCCTGCAAAATTAATTAAACCAATCACAAGGTCTACCAACAAAAAAAATATCAACCGAGAAATTTTCATAGAGGA
AATAAAGTTGGCAGAAATCACCAATCAGTAAATGTGAAAGGTACTAAAGAAAGAATATAACACCCTCTGTGTTACCTTGGTAACAAGATGGAAGCATGCA
ACAAATGTCAATTTTAATATAACCAATTAAGTTTGTGTAAGGAATCTAACTGATATTCCCTTACTATTCTGTGCGAGAATCATGATAAAACACACCATTA
AATAACTTAACTAGCATATTGAGTTGATAGTGTTAGAAGATAACACTGAAAATAGTTGTTGAAAGTGATATAGAGTAATAAAGTATTACACTTTCTTCAA
ATACTAATATTTTTGCATGTCATGAGATAAGGCGAGTCAAATAAAATGGACAAAGAGGATCAATTTGAAAGACAAGAGGAATCAAAAACTTGTGTTAATG
ATAATATTTGCATGTAATTCAATCTCACCTAACTCGCTACGATAACCCACCCTTAGACTAGAGTAGCTGCTAAATATTCAATGAGAAAACGCAAGAACAA
TCTTATGCTTATCCTAAAGAGTCTTTTTTCTCTTAAGAATCAAAAGCGCACCATTTCAAAGCCATAGCTACCGTCAATGAGAAGCAATGCCAAATCCGCA
AACTTTGCCACATCAATCATTCCATTGATATCATTTGGACACTCTATAAACTGCAAACGTCTCTGCTTACCTACAGTGTCATAAATGAATTAACAATAAT
TTTCCAATGCCAAAGATCCAAGTAAAACGCAATAGAATAAAATTATGTCAATACTGCATATATAGCTACTCTTCTAATTGATTAAGTTGACACTAACTTT
AGGACATCAAAAGGAAAAAAAATTTCTTCTAGATATTATCAATAATGTCAAAGACGAAAGGCATAGAAAAGCACCAAAACGTGCTTTATGGGATATATTA
ACAAGGCTCAACTAAATACAAACTAAATGGATAAAGATGCAAAATTGATGGAAATTAAACGCTGCACATTAAGTTTACATATTTTGGATAAAGACCATGG
TAGTTCAAGTTCCACTTAATTTTATTTTTTTTTGAGAATGAAAAATTACATAAGTTCCACTCCGTTTCTGGTTAAGTTTTTAAGTTCACAATGCAATAGT
AACTAACTCTCTAGTAAAAAAAATTTAATTCCCTATTCCTAGGGAGTAGTGACTAGAATATTTCCATCTGTCAGAGTTTCCTTAACAATTCACACTAAAT
TGATCCAGCCACCTTAATGATTTAGAGTCAACCTCTAGGCAAGATTGAAGAGTCTCATAATTAACCTAGGTTTTGTGTTGCATCGCCAACTAAGAGCTTC
CACAGAAACAGCACTTTAGCAAGGCACAGCATTCAGCCTACAAAGTGCCTTGCCTACCGGGCTTAAGTGCACATTTGACAAGACCAGTTATTAACATATT
GCAATAAAGCAGAAAAGCATATCCTCAATCACGTAGCAAAAAAACAAAAAAGAGAAAAAAAGTATAGCTAGAAAATACAATTTGACAGTATATATACATA
TCAGAGTCAGCAACAGCATCACAACCCCAGCGGATTTCTCGGACACGAAACCAAGCACTCACTGTATGCCATATCCCAACTGATTTTGGAGGCATGTCTT
GCTTGTGGAGAACTAAATATAATGTCCAAACCCAGTAAAAACCAGCCAGCTGAATTTATTCTAAATGCGGAGTATATTAAGTTGAAAGAAACCCAAATGA
AAGTAAAATAACCTCCTCCACAAAAACGTCTTTACACAAGAAAATTAGCTTCTTTCTTTTATTTCATCCATTAACCTTGAAATGATATATGGATTATGTG
CTAAGGGGAAGAATTAGGAAAATTTAATTATGGTCTTTTCTAAAGTAGGGAGTCCATCATTAAAGCCTACCATTGTAACTGAAATGAGGAGCAGGAAAAG
GATAAGGAACAAGAAAATTGCTATACTGTAAGATGTTAAATGAATAACTTCCACAACCACCCAACACCTCCAGCATATTTGATATTCTCTCTACCTCCTT
TTTGAAGGAGACAAAAATCACAATCAAGACGAAACATGAGAGAAACAGAAACCATCAAAGATAATACCTGAGATGTGATCAGGTGAATCCATACTTTCTT
TCTAATACTTCCAATTATTCATTTATGGACTAAGCTAACCGGAAAAAGGAACAAGGTGGGAAGCCAATCCATACCTGATACTATAGTGATAGGACCTCGA
ACTTCAGGTAAATTTTGCTTTGTATAGTGCTTCACGAGAGACTTAATTAACAGTGACTTCCCAACCTATAATAGCATAATCCATAAGAAGATCAAATCTA
AAACCCAATGAATGACATCTAACCAAAACAAAACATGTCCAATCAACCTTGGGAGGTCCCTGCACCACAATTACATATGGAGCTGGTTCACCAGTGGACC
TATCAACTGTTGGGACATGAAGCCTCTTCTGCTCCTTCTCTGTTGCTCGTGCTTGCAATTTCTTTGCTTTCACAGTGGAACTAAATGCAAATGCCTACAA
ATTTTCATAATAAGTCTCAAGAAATTACTATTCAAGAAATCTTCATAAAAGTCAGGCACATAAAGAACAAAAAAAGAATTGCACGAAAAACTACTATTGA
AGAAACCTTAGGATTATGTTGTTTATTGTTTTCGTCGAAAGCACCCTTCTTTTTCTTGTCGGACTTGGATTTTTTCTTGGCGGTAGGACCGGATTGACGT
GACCGGTGAGATTTGTGCGACTGTTCTCCGTCGATAGCCATGGCAGACAGAGAAAAGTCTCTGAACAATTCGGCTTTCTGGGTTTCCAACTGCAACCCTC
AATGGACTAAGAACATCGTCGGCGGCGAAGAAGAAGAATGGGTTTAAAGGGTTTAAGGGTATAGTAGCGCAGCGAACTGTTAAAATATGGAGTATTTTAA
TAAGGTTATTCCGTTAACTTTGATCAAAAACTTTCATACCGTACAAAAAGAATATTTTAATTATTCAATTTTAAAATAAATAAACACATGATTTCAACAA
AATATAATATATGTAGGATGACATATAAAATACGTGTATTTATTTGTTTAACTTTATACAAGTTTAAGTGATTTATTTGTTTAACTTTATACAAGTTTAA
GTGTCTACTTGTATATATCTAAAGTTAAAAGAGCATAAATATGTTCAAAACCAAATTAAAAGACATATTTATGTATTATGTTTGTTATATACTCATAAAG
TTAGCGGTGATTTGTAATTTCGTAACTTAAATTATATGAAAAATTATCATTTTTCTATCACTATCTATATTGATTTACTGTTAGTCATTTTTTTGTTTAT
TAAGCTTTCTTTTAATTTAGAAAGTGTTTGGAAAATATAAAGAAGTGTTTAAAAGAAATTAGGCAGAGAAATTCTTTAAAAAATCAAAAGCTAAGTGTCC
CAACTCTAGCTCTTAGCTTATAAATTACTTTAAAAAAATTGATATATTTTGATAGAGTTTGAAATAGATTATATATTGTTTCACCAATTAATAAGTTTAT
ATCAAATTCAAATACAGCTACATACATGTATTTTTACTATTAGATACACTTTGACATAAAAAATACAGAGGCAAGTGAGAGGTAGAGAAAAAGGGAGGAA
AGCCTGAGAGTTAATATATCTCAAATACATGTGATTCATACTAAATATATTTATTTTGGTATAGATACATTTTGAAATTTAGATACATAGGAAAAGAAGT
GAGAGAAAAAGTCTGTGTCTCCCAGATACAATTATACTTATTTTTGAACTCATGTGTCCGAGTAGATTATACATCTATTTGAAGATCAAAATTCCGACAT
GAATAATAATTTTAAAAACTTACGAGAATACAAGTAATTGGACCTTAAATTAGTAAAATTTGTATATTTTGCATCAAATTTTATTAGTGATAGATAGACA
CTTTTACGTGGCGTGTATCTCCTAATTTGTGTTAATCTTAATTATTACATTAGATAATTTTGTTATTTTAGTATATAAGTAGAGAATAACTCAATTTATA
AGAATGTTATCATAATTAATTTATTAATCTTCTTTTTCTTTTAGTATTTTTTTCAAAATAATTATTAAAAATAATTTGAAGAGTAATATTTCGTGTTCGA
TTAAAATAAATTATATGTTGTTATCCAATATCTACTACCTTCATTGATGCCGAATTAATTTATTTTCCCCCCATTTGCAGTTCCATTAAAAACATATAAT
GAGCTTTAATTTTTCACTATCAGAAAAACAAGAGGGATCGATTCAAGTATTAAATACCCAACACCTCCAATATAAAGCTAATCTTATCGCACATTTCATC
GTCAAATTTAAACAGTAGCAGTAAAAAGGAACTCGCAAGTGAAAACACACAATCAAGCAATAAATAATTAAAAATAAGTTCATCGAGTTCTAATGGAAGG
ACATCGAAATTCTACTTGACAGAAACAAAAATGATCATAAACAGCTAGTTCTTCAGCTCATGTATGGCAGCAAGGCTGTTTGTGTATGGTATAAATCTTC
TCTTTGGATTGAATTGCCCTGGAGTCATAATAGTCTCCACCTTCTGCCCACTCAGGTAATAAAGGTATATCCTTTCAGTTGTGCAGATCACCACAATGTC
ATCACCATTGTTTATACATGGTAATACACTGCACAACACACTACCATTGTCAATAAAGGAATCTTTATCCAATGTTTGCCGAAGCTTCTTATGTCCAAGA
TTGACGCAGATACTACGGTTCAGACTCATGTCCATTCCTCCGTAGAAATCTAACATAAAAACATCCTTGCAATCATTATAAATAGTAACATAGGATAACT
CATCCTTTACCTGAGTCAATGCACCATATCTACCAGGTGGAATAGGCACACGCAAAACTGCTGCGACCTCATTTTTTATATCAAATGCTAGCACGCCATT
TGATTTTGTACTCCAGTACGCCATCCCCTTCAAATATAATCCTCCACCAACAAGAGTTGCATCTTCGAACTCAAGACACTCTGAAGATGAGCGCCTCCAG
GAGTTTGATTCAGATGAGTAAATCTCAAATAGCACAACTGGTTGATCAAGAAGAGGGACAGCAGCGACAAGGTGAAAATATGATTCAATATTACCCTCCG
GATCAAATGCAAGAATGACAGCTGGATCAGATCCGTGATAATATTGATGAGGAGGGATACGTTTCCAGTCTTCGGTCAGAGGATTGCAAACGTAATAACT
CTCCAACCCCTGGCAAAGGAGCAACCCGCTACTAGAACTGATAATTTTAATCCCCTCAGGCAAGAAACCCAGGGAAGGATTGGGGACTCCATTCGCAGAA
TGATCCAGAGACAAAAGGTTAGGATCATATTGGAGATCCACATCCACAATCTGATGAAAGTAGCCTGAAAGTTTCTGGAATGAAGTGCTTTGCTGGTATG
CCAATAACGGACAACCTATCCAATGATTCCATTCATTGGACACTGTCCGAAACTTCATCAAGGACTTGCCAGGAAGGAAAGGCAACACATGTTTCATCGC
CACGTCTTTCATTTCCATATCTTCTCTCCTAATATAGTCTGCAGGTAATTTTGATACTTCATTCCATTCCTGCAAGACAAAAGAGGTATTTAATTAAATG
AAAGAGATATATACATATCAATTACAACTCAAACTCATACTAGTTGGTGTCAGTCATCCGAAATATTTATTTCTACTCCTCTATATTTAGGTTGGGCACT
TTCAACAAGTTCACTTAAAAAGGCTCATTTAAAAAGTGTATCATCAACATCTCTAAAAAAAATAAGAAAGATAATGGAAAGACAAACAAGAGAGTAGTGG
TATCAGAAAGGGCAAGATCTAAAGAAGCAGCTTCTCAAAAAAATTGGGGAGTTCAGATTGCCTATATAATTACATTGTGAAAATAAACAAATTATTTGGA
ATAAGATGAATTCAAATGAAGCAAAGCGAATAGTAGTTTTCATCCATCCAAGTAATTGTTGGTTGTGTAACCTAGATATGTCTCACTATTGCAGAATTAT
CTATCAGAAGAAAAAATGACCATTATTCTATGATAAAAGGTTATTCGAAAACAGCCTCCTTATCCAATAAAAGTGTGGGGTGAGGGGTGGGGTAAGGTTT
GCGTATTATATCCTAGTCCCCAAACCTCATTTGTGGGGATTCCACCGGATATGTTAGTTGTACTGAAATGAATAAGTTTTTGTATAGTTCTTCATATAAA
ATGAATAAAAATACTCAAAAATAGCAGATAAAGAAAAGAATACCTTATGAGTCCCACTATCCTGTTGTTGAATAGCTGGAGAAAATTCCTCAGCATCAGC
CATGATATTATTCTCAAACTCATCAGAGCTAATAGTCATCACGTTGTCCTTCAATGTTTCCATTTAATTTTTCTGCACAAAAAGCACAGTGTTAGTGATG
ATGGAAAATTTAAAGCATAAACTCCCTCAAAGTATACTTATGAACAATAAAAAAAAAAAAGACAACCTAATCCACACTGACAAAGTGTTTAGTATGCGAG
AAATAGGGATCTCAATAAATGAGCAGATGAGGTAAACTCTAGACTCTGCTTCATAGATCACTAATTATCAGTATCAAAAGAAGGAAAGACATTTCACTAT
ACTTAAAATCATAGATTTTGAAATGTAAATCTCCCAATCGCCATTTAGCAGTTCATCTCCTTGGTAACTCTGATTCGAAGAAATCAAAATATCAACAATC
AAGAAATTTCACAATACTGAAAGTCAAAAAACCATAAATTTAAAGAAGTAAATCTTCCATAAAGGAGGAATTTTGAAACAAAGTGTCAAAACGCAATTAA
ATAAGTCGTCCACACATAGATCATATTGTAAATCCGAGAAAGATCCGACGGTTCATATATAATTCTTGGTCAATTGAAACGTGAAATATTTACATACACC
TAGTCCCACACAAGTATTCAAGGAATCAAAACACAATACAACAATTGAAACAGATGACGATCAAATGGAACAAATTAAGAATAAATCACAATTCCTGACA
TATACAATGGATAATCGTAAAAAGAATATAAAGTTCTTAATAAATATGTTGGTAATTAAAAAAAATTAGAAGAATTAAGGAAAGAACTCACAATGCCCAG
ATTTTGAGTTGGCGTTAACAAAGAAGAAGGGAAAAGGGGGCTTGAAACCCTAGCAGCAACGAGAATCGTATGGGTAGAGGAGAGTGGAGACGGTTCACGA
TTGCCAAAATTTAGCAAAAAGTTTAACTTGTATAAAGGAAAAAGTGTTTGCTTCTTTGGCTATATATACATAACGAAACATAGTTGATAAAGGGAGGAGA
ATATCGACATTTCATTGACTTAACACAATCTTAAGTCAAAATCTTTCTAGTAATTTTCATTCCAAATAAAGATGTCAAAATAGGCCAGCTCAATCTAATT
CAGCTTAAGTTATGCGAACCAAGGAATTTGATGGGTTATGGCGGGCCAACCCTTCATGTTAAAAAGTCTTAAATTGGTCGGCCCAACCCAGCCTTAAAAG
TGTGTTACAAGTTGGAATGGACTAATCCTTCATTGTTTTCAATCTATATTGGAACTTGTATGTCAATTTGTTAACATTTCTAACATATAATTATATGAAA
GTACATATTCAGCACTAACACATCATCAACGCATTTGAATCAATTCATAAAGTTGTTTCGATTAACATCTTATGCCCCTACTTCATCAAGTCTATAAGGG
GTAAATTTGCATGAATCAACATTATATCCAAACTTATCTCTCTTTTGAATTGATTATGTGGTAATTTTGGTTGGATTTATCATTGAAGCAGGAGACAATA
TGGTTCAGCATTGCTCATTTTTGTTAATTTCACGGGTTCTCTAAATTTGAAAGTGATCATTTAGTAAGTTTCTATACCAAGGCTCAATCCAATTAGGTTT
GTAGCATCTAACAATTTCGCCATATTCCCCTTTCTTTTTGACCAGAGGTTATCTTTGTTTGCATTTACATGCAAGTTTAATTAGTTGAACTTTATCAAAC
AACTATATCATAAAAAATAATAATATTTAAATTCACTTTAAAATATTACCGCTTTGAATTTGAATTAAAATGTACATCGAATTTTTAGTAGAAACAAGTT
TTTGAACATTTTCACGATGGATACAACTTTTATAGTTGGTGATTAGGAATTTCAGTATTGGAGATTTAACACGAGGAGAGTTCAGTATTGTGTAAGATAC
CAAGACTTATTTGGTAATCACTATTCCTAGCTTTCACTCTTTTTCACAATTTTCTTTTTAAGTTTAGAGTTCATATTAAATCATAATCATGACTGCAACT
TCTATACTTGGTGATTAGGATTTGCAAAATGAGTAAAGCATCGTGTAAGATACTAAAACAAATTCTAAAATCGTTATTCCTAGTATTTTACTCTCTTTTT
TGACAATCTTCTTTTAAATTTCTAATTTAAATTAAATAGCCTTTAGGAAAAGAAGGAAGAGTAGGAGCTAGCTTTTCATGAATGCTCTCAGGAATAAATT
ACTATCACTTTCTCCACCAATAAAGGTTCAGCCTGATTGCCCCACAAGACGGCCTTAATCTAACTCCGATCAAGGCTCAATAACCAGTGAACTGACTTGA
GCTGGCTTTAAGCATCAATTGTAAATGAACTTGAGAAATCTTTACAAAAACAATTCCTAGTAGCGAATTGGACTGGAGAGGCCTCAAGGGTCAAGTCCAT
TTTGACGGCTCTTATACTAAGTAACTACGAAGGTTGAACAATTTGACTTGTATAAGAAAGAATATTTATTTCTCTTTCTTTACATATAAGTATTATACAT
TTCATACAAATGAAATTTTTACACCATTAAATGACATAATAATCAAGTAAAAAAAATAATTATAGGTGTAATAAGTGAATTAACATCCATAAATAAAATG
ATATTAAAAGCGCAATTATCACATTTCATATCAAGCATACTGACGATAGTAATTAAATCTCTCTATCTTTTAACCAATCAATCCGATCTTTTAAGTTAAA
GTTTTATATTATCAATTAGTGGATCCTAAATCCTATATACTCAATTGATTGAATTATAATATTATTAAAGCACGTTAGGTAATTATCAAATTAACAATTT
CATCGCTATTATGCATTTACTTGAGTAGAGGATATATATGAAACAATCTTTCTACCTTTACAAGGCAGGAGTAAGGATGCCTACCCTCCATTCTTCCCAG
TTTTCACTAGTGCAATTACACTAAGTATGTTATTATTGTTACTAAAGAAGAGAGTTACATCTCAAATTAAAATTTTCTCCTCTTTTACCGTCAAAAAGTT
ATACAAGAGACTTAATTAATTATCAGTGACTTCCCAACCTATAATAGCATAATCCATAAGAAGATGAAATCTAAAACACAATGAATGGCATCTAACCAAA
GCAAACATGTGCTTTTGCAACTTATTTTCCTTCACAGTTAATAATTCCCATAAGTCCCAAGAAGTAACTATTCGATTATCAATACTAAAACTTTGAAATT
ACTTACATCACACATATTATTGCCTAAATATATCTGTCAGGAATAGCGTAAAAGAGTTAAAAATTAAAATAAAAATTAAAGAATATGAGTACCTTGGGAT
CATGTTGCTTATTGTTTTCCTGGGAAACACCTTTCTTTTTCTCATACGACTTCGATTTTTTAGGACCAGATTGACGTGCTCTGTGAGATTGTGCGAATTT
TCTCCATCAATAGCCATAACAGAGTGGAAAATCTCGACTAATTCGGCTTTCTATGTTTCCAACTAGAAACGCCCAAAAGAGAGGATATAGAATACGAAGA
AGATACTAAAAGAGGGTTTAAAGAAAAAACTGCTTTATTTTATTTTATTTCGGTTTTGCAAACTTGTAAATTTTTTTTTAAAAAAAAAGAATGATTTAAT
TATATTTTATTTTATTTTGGCTTTGCAGGTATCCAACTGGAGAATCTCCTTCAGGTGCACAACCAAGTCCTTTCTATAAAGCATAAATTGTATATCTCAA
AGATAGTTATATTTCTTTAGGTCGATATAAAGAACATCTTTCATCCACCTAGAGTTGACTATTGATGCGCTCAAGGTAAAGCTTCCCCTCCTGCACAACA
GCTCGCAAGGCAAGTCCGGTATGACGATTCTGGCGTACACCTTACTTCTGCTAGGCAAGACATTTTGAACTTGAGACATTAAACATGGATGTCCCAAGCC
TTGCTTTCGCTAGCAAGGGATTTGAACTTGAGAACTTAAACATGAATGTCTCGACCTCAAATCAGTGGGCTAATTAACAAAAAATTTGTGACAAAATATC
CTTACTAGCGTGGACAAGTAATAATATTTCATGGAGGCCTTGGAAAGGCTTTGTGTCATCACATCAAACAAGAAAGAAAAGATGAGAAGATAGAAGAATC
CCTCTCCATTGTCCAAGGCAAAATCTTCATCCTAAGTTGTAATAAAATATTCTCAAGTTGGGAGTATTCCTATAATTTAACAACAAATAAAAAGACATTT
CACATCAGAGCTAACCAGGGCTCTCTGCATCCAGGTAGATGATGGGAATTGCCTTGTTTGTTTGATACAGTAAACCATAACTAAAAACTCCAAAACCATT
GTTATTTGTGAAGGAAAAAACATTCAAAACTACTGTCCAAATGAAATAATGGCAATTCAAAACATGATCTATTTAATAAAGAAGCTAGTACTAATTCTGT
CATCCAATTCCAACAAACAAAAAATCATGAAAAATGTTCAATTTCACTTGGAACAAAGCAGCAGCAGCAATGTAGGAGAGACTATTCTACTTGACAGCAA
CCGAAATAATATCAAGGCACTAGTTGTTCAGTTCATGTAACATAACGAGGGTGTTTATATAAGGTATGAATCTTCTCTGAGGATTTAGTTGTCTTGGAGT
CTTGAGATCCTTGACCTTCTGCTCTCTCAAGTGATAAAGATATATCCTTTCATCCGTGTAGATCACCACAATGTCATCAGAATTGTTAAAACAAGGTAGC
ACGCTACACGACAAGGTACTGTTCTCAATAGAGGCATTTTTCTCAAATGCTCGCCAAGACTTGTTGTGTCCCAGATTTATGCTTACACTGTTTTTCAGGC
TCATGTACATTCCTCCATAGATATCTAATACAAAAACATCCCCACCGTCATTATAAGCCGTTACATAGCATAGCTCATCTTCTATCAGAGTCAAGGAACC
ATATCTCCCAGGTGGAATAGGCACATGTAGGACTGTTGATATCTCATTTTTCACATCGAATGCTAGCACCTCATTTGATGTTGTATTCCAGTAAGCCACC
CCCTTCATATAAAATCCTCCACCAATAAGATTTGTATCTTCTAACTCAAGACATTCCAAAGAAGACGCTTCCAAGAATTTGATTGAGACGAGTAAATCTC
AAAGAAGACAACTGGCTGACCTAGAAGAGGGACTGCAGCAACAATGTGATAATACGATTCAATATTATCCTCAGGATCAAACGCAAGAACAACAGATGGA
TCAAATCCATGATAATATTGATGACAAGGGATGAGTTTCCAAACTTTGGTTACTGGATTACAAACATAATAATTCTCTAGCCCCTGACAGAGGAGCAAAC
CGCTGCTAGAACTTAGAATTTTGACCAAGAAAAGAAGGGAAGGACTGGGAACTCCATTCGCAGAACGGTCCAGAGACAAAAAATCAGGATTAGATTGAAA
ATCAACATCCACTGTTTGATAAAAATAGCCTGAAAGTTACAATCCAATGATTCCATTCCGTAGACACTGCCCGAAACTTCATTAACGATTTAGCTGGAAG
GAAAGGCACTATATATTTCTTTGCCAGGTCTTTGATCTCCGTGTATTCAGATTCTTCCCGCTCAATAGCAACCGTCTTAAAGGACGAGACAAATAAGGTA
TAGTAATTAGACTCATGAAAAAAATTGTATCCAAGGCTGGGCTCTGTATGTTTTCGAGGAAGAAAACAATACCTTGAAAATCCCATCATCCTCCCATTCA
TCAGAGCTATCAACCATGTAAGATTTCATTTATCTAAAAGCACGGCGTTAGTGACAATGTAAAATTGAACCCGAATTTTGAAACGAATAAAAGAATCAAA
AAGACAAAAGAAATTGAATCAATTGCAATGCGTAATCATAATACTCACATGAATTGCCGGAATAAAGAGTTTTAGTTTTTTAATAAAACAGAGTAGTTTC
TTCGCGAATTAGTTGGTTTATTTAACAAGAAGATTTTCTTCTCTTGTAACTTCCACCCCAAGTAACTGAAACAAACCAATTTTTTTTTCTAGGATATTCA
TTCAGAATCCCGCTAGGATATAACTTCCTTTTATTTCTCCTATAATATAAACTAAGGTACAGAAATCTCGTGTTTTAAATGGGTTCATTATTTGTTCATA
AAATTATTTTCAAGTGTTTATTAATTTAACGACTTTTTCAAAATTATTAAATCATTTTACTAAGTGTAAAATAAATATTTGATAAATATTAAACGGTATT
GAATTATTAACTAAATGATTTTAAATTCTTACTTTAAAATATGTAGTTAAAAATGCACACATATTATTGATATTCAAAATAATAAAGGTATAACTAAAGA
ATATGAATTTAAAACTTAAAATGAAATTTATTGTTTCAAAAAAATCTACACACCAATTAACATAATGAAATTAATGAAATAATGGGGGAAGGGTAAAACA
TTAACCATGGTATAAAAATTATATGGAGTAAAATCAAAATTCTTTCTATTAAAAGAAGTAATTATAAAGTTTTAAGGAGCGAATTATTTTAAATTGAGTT
TGATTTTTCCATTCCTATTAACACTAGAGTGAAAACACAAAAATAAAAATATAAAAAGCATCCATATACAATGGAGTGGAAATTGTGGTCTTCTGATCCT
CTACATATACGTTAGAGTCAGAAAAAAGCTTGAAAGAATTATGAAATAAACTTAATATTTATGAATGTTCAATATATTCACTGCTATTATATAATCCTAC
ATTGTCACTTGAAAATAATAATAACATGAAATATAAAATAGGCAAAATACTTAATCATGAAAGAAATTTCAAACAAGGATGTTGCAGCTCAAGCAGAGAC
TAGAGAGAGACTAAACTGTTGACATAGGGCAAGCATCTCGAATTGTGAAATTCACCAGGAATGCATTTTGTTGCACGAGACTTGAAATCATACAAAAAGG
CTTTTCCCAAGCTCCGAACCACCAACATATTACTGTCGACATGTAAAGCTGTGTAGTCCCCCGCTGCATTCCCAACAATTTTACTGTCAAGAACAACCTT
CGGTTTTACTGCCCACATTTTGGTTTGGCTTCCCATCTGCATTGTATTTGTGTGGACATTATCCAAAATGCTTAAACTGATTGAATTACCACAAACGTTC
ATCTTACAGAGCTTTCCACTATACTCCCCCAAGATCCCACGAGAATCATAGTTTTGAAGGAGCTGTGACCTCTCCTTTGTTAGATCAAAAGCAAGAATAC
TACCTGAAGTGGTCATCCAGTAAACAACACCATTCACATGAAGCCCTGATTTTGGCATACGTGTTGCTCTAGCTCCAAAATGGATCTCCCCAGCAACTTC
CCAAGAATTCGCTTTGGAGGAATAGATATCAAACTCAACTGCATCAGCAAAATCAGTGGATGGAAAAGCGCATATAATTTTATACTCAGCTACAAAGTTG
AGCAATGATGGTTCAAATATGAGCACAATTGCTGGATCTGGTCCGTGATTCACATTTGATTTTGGAAGTTTCTTCCACTGCTGAGTAACAGGATTACATA
TGTAGTAGGCCTTGTCCTCTGCACGACCTTGGCAGCAAAGCAGTCCATTTGAGGAGGACCTAAGGTCAACAGGCTCGGGCAAAAACTTAAGGAATGGATC
TGGCACCCCACAAAAGCTTGGGTCGATGGGTATGAGAGAAGGAGAACCATCAAGTGAATGGATAAAGAAGCCTGAAGTACTGCGACAAAAAAGTGACTGA
CTATGAGCAAAAAATGGACTCGAAATCTGGAGTTTCCAGTCCCTACAGACAGCGTTGAATTTGAAAAGTGATTTGGCAGGAAGAAATGAAAGGGAGTGTT
CCCTGATGATGTCCTTAAGATCCAGATACATCTTATTATTCGGCGCAGTAAGAGATCTGTCTGGCCTTTTTCCACGATCCATTATTGAAACCAAAAGCTG
TTCCGCTGTCAAATAACAACACCAGTCTAAATGTTAGAATGCATCATATTGAAACACACACTTTAGGAGTTTGGAACTAATAGTTTCATACTTCCATTAA
CAAATGAAATTACCCCCACAAAGAATTTTTAACATATTCTTTCTCTAGATACATCAACTGGTTTACGTGTTTTATCTTGTTTAGTTTTACCAGTGACAGA
CCTTACACATTATAACTGTTTTCTATTCACATGCAGATACTTACAGAACAAGATGACATACTACACAAGCAACGGTATCTGATAACAAGACCTGTTATGA
CAGCTTGTTGATGACTTTAGTGTCTCTAAAACCATAATTCAATTGGACCACGAGTTTGGTCATCAGGTGAATGTTATTTGTTACTAAGCAATCACTTGCT
ACATTCTGTGTCAATAGAATCAATGTGAACCTAGCTTCAAATCAGGACTAAATATGAATAATGCACGGACTCCTCACTTTTGATGCCGCACCTGTCTCGG
ATTCTTTAAAAATACACTACTTTTGGCGAATCCGACACGCATCCGTTGGCAGTTTTGAAGAGTCCCAGCAACATTTATTAATACACTTGTCCTAGATTTG
ATAACTAAATAATAAATGATCAAACAAAAATATTCAAGTCAATTAAATTCATCAGTTTCCATGTCAAGATAATCACCATAAACAAAATACAGGGCATAAC
ATAAACACGAATGTCGATTAGCTACTCAAGTTTGATGCTTTTCATTTATATAGTGATTATAAGTTCCCAAAAAAATGATTTCTGTTCTGAAGGACATTCT
TTGAAAGGATTTTCTTGACCAAAATCAGTAAAACAATTATTTGAGCATAAAAATAACTTTATTCTTCTAGAAAACAAGATGGGTCTGAAAAAAATCCAAA
AATTAACCCCCTTTTAGTCATCAGCCCACAAATTACATTGCATATAAATGACTAAACAGAAAAAATCAGTAAGAAGGTTGCAAATTACAAAACCCTAATC
CCAAATTCACATACTATAAGATAGAAGCAATCAATCATAAAGCTACAACGAAATCTCATGATATAATCAATACATTGTATGGATAATTGATAATCGCGTA
ATTAGAGAAATCAAACCTTGATCAAATTTTCACACAGCGTTACTCTTGTTGATGAAGTGTAGATTTTACCTTGGACCCTTTGTATACTAGAATGGACTCT
TCTTGATATATATTTTTTTTTCATCAAATTGTTCCCATGATTTTAATATATGCCTAAAATAGTCCCTTAAAAAGTAAAAATTACTCATGAATACCATCAA
ATATTTAAAAGATATGTAAAAAAAAAAAATTAAGACAAAGTTACGTCTAAAGATTTAAATTATATGCAATATCGGTATGAAAAAAAGTTGTTTACAAAAA
GGACATTTAGTCATATAAGGTTTGTAACTCATGAATTATATTTAAAATAATTAATATAGTGATTGTTGTTATGTATAAAATAATGTGCAACTTTCACATA
TAGCGGATAAAAAATTTATACTTATATGCTATAATATCAAAGCTTACATGATTGCGCTTCATAGCAAACGTAGAAACTGTATAATTCGTTGTACATATAC
AGTTGAAGCAAATTGTATAAAACGAAGTATATAAAACAAGAAAGAGAAAGACACTTGGGACAGAGAACAGTATAAAAATGAAGTGTATAAAACGAATTAT
ATTGTTATTAGTGTATAGAACGATTATATACAATTTGAATTTGCATAAAATGAGAAAGAGAGAAAGACAAAAGAGACTAGACAAGGAATATACAATTGAA
TCAAATTGTATAAAATGAAAAAAAGAGAAATTAGATGCAATTTGAAAATTGTATAAAACGAGAAAGACAAAAGAAACTGAGCAGGGAAGTATTTTTATTG
TATAATTATAAGTGTATAGGACGAAAATATATGTATTTACATGTGTATATACAATTTTCTCACGCTTTATGCAAACAGAAACGCAATTTATATATTTAGC
TTCTGTTTGTATAAGTGAGAAAGACGAGGGTGGCGAACGAGTTTTGGGAGAGTGACGAGCGAGGTCTGGAAGATGGGAGAGAGAGGAACAAAAATATATG
TATTTATACAATTTTCTCTGCTTTATACAATTAGAAACAATTTTTGTACACTTGTGTTTGTATAAAAAGTGAGGAAGCGAGCGAGAGATTGGAGGAGAGT
GGCGAACGAGATATTTGGGAGAGAGTCGCCTGACAATTTTTTGCAAACGTTTGATATAAAGCACAATTAAATCAAACCATAACTACTCAATTTATTTTAG
GTTATTAGTTTGCTATTATATATAATTTTTCCTAAAATAAAGTAATACATAAATTGTTAAACAAAAACAAATAATGCATAAGTTATTTTACAATAAATAA
AGAGAAAAGACATAAAGACACCATCGAAGTTGTCCCATATTTGCATAAAGACACCTAAACTTTTAAAGTGTCCTATAACACCACTAAACAACTATATATC
GTTGTAATTTGACCATTTTTACTCATTTCGTCGTCTATGTAATGCGCGTGTTGCTCACTCTCTAGGTAACTCGACCCGACCTTTTTTTTTAAAGAAAATT
TGTGAACTCCTTTTCATTTCATTTCTCAACTTTTTCCTAAAAAATCAAACGAAATACACAGTGTTGTTGTTGACAATCTCGTTGTTGATCATTGTTGATC
GTTGTTGATGTGTATTTGTGAAGATTCTTGGAGATTGAAGGTCTAACATGTTAGGGATCTAAAATCTTCACTTTTTTTGGATTATTCTGATTTTATGGAT
TATTATAGTGTAGAAGTATTAGAATCGACCTCCTACAGTTGCCATTGTTACAAATACGATTCAACATTGCATTTGACATTTTCAATCAAAAACTAACCAC
AAAATTGAGAAGAAATTCAACCATAAAAAAACTTCAAATTAACGTTTATACTGGAAATTAAAAGAGAAAAGACGAATTCTTACCTTATTTTCTTGAGGAA
GATGATGAAGTCGTCAAAAAGAGAGAACCAATATTGTTCTTGCCATGGAAATCAAAATTTTAGGGCTACCAAAGGCTATTTTTGAGTTTAAATTGGTGAA
GATACAAAAATTGATTAAACAATTAATATTAAAGAAAGAAAATGACATGTGATTGTTTTAAACTGGTAAATAAAAAGGAAAAATGGCCCATGACGCGCCT
AACATGCGTGTAAACAACCCAGATGAGTTAATGGGTAAAAATGGCTAATTTACAACGATATATAGTTGTTTAGTGGGGTGATGAGATTATGCAAATATGG
GACAACTTCGATGGTCTATTTATGTCTTTTCTCATAAATAAATAAAAATATACATGTTTGACAATAATTATTTAAACAGTTTTGCTCTATGAATTGTTCT
TTTTTATTGAATATATCTATTTCAGTTTTGCTCTATGAATTGTTCTTTTTTATTGAATATATCTATTTTGAGACATGTACGTGTTTGCTATTTAGTTATA
AAGCACTTGTTAATATGTTGTATGTCGAAGAATATTATGTTAATTCCTTATAATGTAAGTTTTTATAAAAAATGTTCGATCTTTTACTCATATATGTGTG
TTTATTTAGTTTTTGTATAAATTTCATATATTAAATATGATTTAAATTCTTTGTTCGAATATTTTATTTTTAAAAATTTTATCATCAAAAATTTACATGT
ATAGATTCTATTGACTTTAATGATGTCATAATTTCAAAATTTATATGTAAAAGATGGTTAAATATCAAATCGTTTAGATAATAGTTACTATAAATTATTT
TAAATAATATAATACCACAATGTTAAGATTGTCATTTTTATTTTTCCATATCCATGTTATGTTAAATAATTGTTATTTTAATCAATCGAAGCTCATTATA
TATGCATTATAAAATGACAAAATCTCTAAGAAATTATGATATAAATGTAACGCATAAGAGTATATATGTTTTTAATAAAGTTTGGGGTAGGTCGTACACT
TATATAACATTTCATTTTGATTTGAAATAATTATATGAATTTTGACATTTTATTTATGTTTTAATAAGCCTTATCATTGATTTTAATATATTGAAGAATA
AATAATGAGCATTTCTACTATTCTTATTATTATTGTTTATTTAGTGGTGATACTTATTGTCCTTTTCCTTTAAAATTTATTTAGCTTTGTCTTCTACCTG
TACACATTATGTGATTCATAAAAATCTTCATAAACTTAGTAGATTAATTCATATGTTATTATGAATTATATTTTGATATCATTTGTTAATAAGTCATATT
TGTTATGAGATATGTTCATCACCTTATTGATTGTTGTATATGCTGTGATGTACGTAAATTTTTTATAAGTCGTGTCACTTTTAACACACACATATATATG
ATAATTTACGTATACTATTATACCCTTTTTTTCAATAAAATAAAAAAATATTAAATTATATTTTTCATTTTGAAAATAATTTCATAAAAAGTAATAGTGT
TAATTTGTTTTTTATATGTATAAAGTATAAAGAGAAGAAAAACTAAAAAGCAAAAGAAAGAAAAAAATATACTAAACAACTTGAACCACCTAAAATGTAT
AAGCAAAAAAATTATGTCTAGCGGTTCAATAACACTTGACCAATTAAACCGCACACACTTTGGTATCAAGAGTTAACATTATACTCTATCCGTTTCAAAT
TATTTGTCATGTTATGCTTATCAAAAATTAATTTGATTAATTTTTAAAGGTAAATTAAATTACATAATTTTATATTTTAAACAAAAAAATTAATATTTTA
AAACTATATGAAAAATACTATAATTACAATTTTTTGCATATTAGTATGATAAAAAAATACATCTTAAAATATTAGTCAAAGTTTTTATAATTTGACTCTA
AAAATAGAAACCATGACAAACAAGACCAGATGAAGGAAGTGTACATATATATATATTAAATCTTATCAACGAAGTTGTATATGTATTGCATGATGATTGG
CTTAATTTAAATAGCATAACTCCATGAAAAATATGTAATTTGAAGTTCGTTCATTACTTTCAGATTTGATTTTAGATTTATAACTATCAATCATAATATG
TCAATTTTTGGAATTGTTACTTATGTTATGCGATATTTTAACTAATAATATGAATTTAAAGACACATTAAGTTCTCTAAAATATGTCATTAGTTATTCTA
ATCAACACTTATTTAAGTCCAAAAGGAATATTTTATCATATCTGAATTATGAAAACTGTGATTTAACAAAAAATATCAAATAAAAAATTAATCCGAACTA
CGGCCCTTGAAAATATTTACAAATATAATACTAAATTAGCACTACACACAAAAATAAAAATAAAATTAAAGTTGCACCTGATAAAAGCAACATGCATTAA
AAAGTAGTAGTATATATTTCAAAAATTCGAGTTATATGCATCTTAGTGTAATGGTGATTTATTTTTAAGATTATAAATTTTATATTTAAAATGAGTTTAT
TTATAAAGATCATTTTAAATGCATAAATTTTAAGAACATTTTTATTATTAAATTAACTACCACTCCTGTTATTTTTATCACATTCTATTAAATTTGTAAT
TAATACATAAATTCCCTTGCAACTTCTCTTTTTATAACTTTATATAATAAGTTATTATTATGTAAATTAAAGACAAAAAATAAGTATCATCGTACAAAAT
TAAAATTAAGGAAAAATTATATATAATGAGTAGTTATTAATAATTAAATATTATAATTATAGTTTAATTTAATCGTGGCTGTAGCAAATTGTTGTCAGTT
ATTTCTCTCTTTAAAATTCTCGCTCGTCATTATATCTACTCATCAGTCTCTCGTTTTATACAAATAGAAATGTCTAAATTGCGTTTTCGTTTGTATAAAG
TAAGAGAAAATTATATATACGCATGTGAATACATATGTCTTCGTCTTATACACTTATAATTATACAATACAAATAATACGTTGGCCAATTCTCGTTTGCC
TTTCTTTCTTTCTCGCTTTATACAAATACAAATTATACAAAATACAATGTATAATTTGTGTTTGTATAAATTGCGCGAGAGAGAGATTTGATATACAAAC
GTTTTATTTCTATTCAATTGTATACAAATTCAAAATTTATGCAAATATAAAAACACATAAAAATGAATTGAGATGTTGCCAATGATTTATACAAATGAGA
GACTGACAACAATTTATATAAATGATCTGCCAGCCAGCGAAGTTATATAAATTTGAAAAGAAGCAAGCCAATTATACAATCTGGTGCTCTGCTATGGAGC
GCAATTATACAAACTATAATTATAAAATACAAATTTAAATTTTATATTTATACAAGTTGAACCATTTTATATTGATGTAATTTATACTCTCTATTTCATT
TTATTTGTTCCATATTTATTTAACGGTCTTATTAACCGTTTTATACTTGTATAATTTATACACACTCTATATTATATAAAATAAGTTGTTGAGTTTTGTG
TGTGTACTTAGGTTTCTCTACTAATGTTAAAAACCCTTTGTTCAAAACTCAGGCGTCATCATCATCTGCTACTAAGAAAAACCCTTTTGCCTAACATTCT
TAAACCCTACTACTACAGATATCTTGAAAACACCCTTTTGCCTGATACTATGAAAACTATGGATGAATCTGATGTGGGTATCTCTTGCTACATTTCCAAC
CTCCCTGGCTTTCGTGGCATTCTCAAGCAAAGGTCTTTTCTTTTTTTTTTCTGCGACAGTTTCTTGGTTATGTATTTGCAGGTGCAATTGATTATACAGT
AAAGATAAGTTGGAAACCTATTTTATCCCAATTCTTGATATTCTTGATGAGTTGGGAAACCTATTTTATCCCAATTCTTGAAGAGGAAAGATAAGTTGGG
AAATATTCCAAATTTATATCCCAATTCTTGATTACAGAATGTGTTCTTTCTTTGTATCCCAATTCTTGATTACATAATGTGTTCTTTCTAATTCTTGATT
GCTCAAGTCTTTGATTAAATTGATGGAAATCACTTAGAGATGTGGTTTTATATCACTTGGGAATGCCTAAATAATGAGTATGTATTTGCATTGGGATGTG
TTGTCAAATGGGGTGTATCATTATTTGGACTTGGTAAATTGAGTAATACACATGTAAAGGGAATTCTTTGAAGAGGGAAGCTAAATTGGGAATTCTGTTC
TTTCTCTGTTTATATTGGTCTTAGAGTAAAACATTGGAGATCATTTAGAGATGTGGTTTATATTACTTGAGAATGCCTAGACGTGAAATTTCATCTTTTG
GGTAAAAAATTTAAGTTCATATTGATTTGTTATACCACCCATTGATGGAATTGCATTTTCTGTAACACGAAAGTTTGAGTCCAGTGTTTTCTTGTCCTAT
TAAAGTGTGTGATCGATACATATACAAAGACAGTTACCATCTAAACAAAATATTTTAGAAGTCATAAACTTGAGGTATTTTCAATGTTGAAATCTATATG
CATGTTCTTGATAATTCAAGCAACTTTTGTTTTGTGGTTCTGTTTATATATCCACAATGAGTGTGCTGTAATTAAAGGTACAAACTGTTTAGTTTGAAAT
TGTTTGGGCATTTTTGAAAGCTGCAGCCAGGTTTGTGGAATTGTCTTGCTTATTTTAGGAAAATAGGTTCATCTTTGTGGTTGTTTTATCTTTGTGGTTG
TTTTGTTTTGTTTCTAGGTACTCTGACTTCATTGTAAATGAAGTGGACTTAGATGAAAATGTTGTTCATTTGAATTCGTTGGAGGCTCCAAAGGAGGTGA
TAAGTTGACCGTAATTTCTTCTAAGTAACCTCTATGTTCATTTAAAATTGTTGTATGATATGTGCCAATCTCTCTCTCCAGTGTTCAGAGAACAAGGACG
TGAATATATCTGACCAACTGAATAGAAGTTATGTGACTGAGATAGAATCTTTCAGATCTCTCGCTGGCAATTCTGATGCTGACAAGCTTAAAGCTTTTAT
TGATGAACTTAATTCTGGGGCCGATGTCAGTGATGAATCCATCGTCCTTTCACCAAGTTCAGATAAATCCCATCGGACTGTTAGTCCTTATCACGTGCTC
GTTCGTTGTTTCTTTTGGTTTCATATGGTTCCCTTTGGAAGTATCCTATATCTGATATGTTAATACTTTTCAGGAAATTCATAACTTTTTCAAGGAAAGA
TTAAAATTCCTTGTAACCGATACAATTGATGGAGTAGAGGACCAATCAAAGTGTGTTCGTGTGAGATTGAATAACGACAGGAATAATGGAAGGGGTAGAT
ACTCTAGGAAAAGGAAAGACCGGAATGATAAACGTTATGACAGTAGAGGTTCAGACAGTTGGCCAGGACATCTTGGCAAGTTCCTCAGGTAAACTCTAGT
TGTTGCATTTGTCTCTACTTATTAATTCAGATTTTTTTTTGAGAAGGAACTTTATTCGTACAAATCTACAGCTTTGATGCATCTTTAGCTTATTGTGTTC
TGTGTGGATTTTTGCATCACATACAAAGATAGGTATTCTAGTTATCAAGGAAAGATTAATGGTCTCTATTTTCTTCTTTCAAGAATTCCATACTGCACAT
TTGTTGGACTACTGAGTATGTTCTGAAGGTATAGTCTTATAAATTAACTACATAGAGAAGTCAAATAATCTGGAAAAGAAGAATCTCTCAGTAATACATT
TTGGCGTAGTCAAACTATTTTTGAGTGATACTTCAAACAACTCTCCAAGAGGGTGTCAAAGAAGCATGTACAAAGTGATTCTCAAGCAAAATCCAATTAT
TCATGTAAGGATCATAACAATTAATTTTGTAAGCATATCAACAGATCCAGTCAATTTTGATTCCTCCAGTTGCTAATAACTTTTATAAATTAGTAATCTC
TGTTCCTTTTGCTAAATGCTAGCACACTGAGTGCTACAACAAGAAGCTCTTTTACTAGTAAAGGTTGGCTACCCTCTCTACTCCTATATCTTTTACCCAT
TCATTTTAATTTATACGACAAAGTAAAGATCATTATCCATTCGTGGGGGTGTAAGACCATGAATCTCTTGTAAAATGACTCACCTCTTTCCCATCACCAT
TCTAAAACTAAGGCGAACATCTTTAGTGAGTGACTGCAATTGCTATATTCTAGAACAATCTCCTATTTCATGGAACTGCTATAGTCTAGAACAATCTCCT
ATTTTCAGAGAACTGCTATAGTGAATGTCTTCTTTTAATACTATATGCAGTGTAATGTCACCTCTATGGAACAATCTCCTATTTCATATGTTTCAACTTC
CAAGTAATGATTAGTTACTAAGAATTTGAATGATCATTCTTCTGATATTTAATGTTGTAGAATGTGATGTTGGTGAAGAATGTGAAGTCAAGGAATGTAG
TGCTTGCTTGTTTATTCAAACATGTTGAGAGTTGAATGGTGTTTACAAGTAATCAAGAAAACTAATTTCTCTCCTGATTACACAATTATAGGGATTTAAA
ACTTTTTCGGTATTTACAAAGAATGATATTAGAGCAGGATCTATATCTATTCTTGATTCACTCAATATTGGAATCGGGCCCACCTATCATGTTACCCATG
CGCTAGATGTTCAATCTGGAGTGTGCAGGGAGATGTTTGAGTGACCCACATTGGTTGAGCAAATGAACTGTCATTTTCTTGAAGCGTCTTAGGTAATCCT
CACCATGAGCTAGCTTTTGGGTTTGCGTCAAGCCCACAAATCATTTTCTTAACAATGACGATTGGTTGCAATCCAAGCAGGCCGGATTATCATCCAATTT
ATTAAGAGGAGTATGCCTTTGGAAGGTTGTCTCCACTCTAGCAACAAGCTTGAGTGCTGAATTTCTCTTTCTTTTGGTTTTCCTATTTATCCATTCTGCG
GGCAAGAGAAGTATACATATGTTCGTTGGGATGAAGACAAATATGATTCAGTGAAACAGGACAACATTAATTTCTTACTCTTTTTGTGCTGTAAATGTTA
TGTAGTATGTAGTAAATTCTGATTTCCTTACTTAGACCATACAATAAAATCTTTGACATCTATGAACTGAATTTTCTCTTTATCTTACTCATTAAATTTA
ATGTTCTGATTGCTATATAAAAAAAAATCTTAATAATCTTTTTTGATAAATTTCTTATATTTTTCACTATCCTTCATGGTTTCAGAAACCATGGCCTTGT
TTAACATCATATTGCTCTTGAATAGTATCTGAAAGGGTGTTGTTGCTGCAAAATCTAAATTTCAGGTTTCATCTTTTCAAGGAGAATAAGGATACACAGG
AAGCTTTAAACGTTATAGCAAAGATGCTTGGCGTTCAGGTTGGTGACATGCAATTTCCTAGATTGAACTTACTTCGTTCAGTTTCAAAACCAGTATTCTC
TTGCATATGTTTTCTAGCTTTTCTAATGGATACCTGAGTTTAAACAAGAAATATAAGGAAGCACTTCATCCAGTGTTCGTATTGCTGTCAGATGTGTGTT
GCGACGTACAAGTACCAGTTATGCATTATCGACAGTTTGATATATAAAAGTTGTAAGACAATATGTATATGATTGATTTTATGGTTGATCTGGCAGCTTA
GGTCCTTTGGATTTGCTGGTACTAAAGATAAGCGTGCTGTTTCAACTCAGAGGGTGTGTTTTCTGGTCATCTTTTTCTTTCTTTGCTATTTACTTGCATC
TTTGTTGAGGAGTAAAAATTAATAGGTTTGTCATCTGGTCAACTTTTTGATGTCGATGTGTTTCTCTTTAATACTTGAACTGAGTGTCTTTCGGCAACAA
CCTCTCTATCTTCTCAAGGCAGGGGCAAGGATGCGTACTCACCACCCTCCCCAGACCCCACTTGTGGGATTATATTAATTATATTGTTATTGTTCTAATC
TTTAATAAACACAATTGCTAGCAACTTTGGAGCTCCAACGCCATGTTGAGTGAATAAGACCTTTTTCTTGTTTGAGAAAAGAGAATGATGGGGGATCACA
ATTGCAAAAAATGAAGGAAATGATTTCTTTTGGTATGGTCATGTTTGAGCATGTTGGTTTGGGTTCTGTCTAAAGATGCTTTTCATCTAAAGCTTTATCA
TGCTTTTATGGTACTTTATTTAAAAGTTTTGTCCAGTAAGTTGACACAGAATTTCTGAATTGTGCTTATGCTATTATTCTAGTGTTTTCATGATTTTTCT
TGCATTCTAACTTCTCTTAAATCACAATACTGAAATTTGCCTATTAGTTAGTAGTAGTAGATGTAGGACTACCTCTTTTTTAAAAAAACGTAGTTGTAGG
ACTAGTAGTATTATTGCTGATGATTTAATCAACCAGAGTGGAATAGTAGTTGGTTTCTGTGGTTTCTGGTAAAAGTTTTGTTGATTTTCTGGTGTTGTAT
GGAGACTAGCTAACATTTAGCTTTCAAGGTAGCATTCCTTAATATCTTCTCCTTTTTGTTTACTTTGTGCTGACCAATCTGCTCTTTGACTGTCTATGGC
CCGAAACTCTTTTTCGCTTACCCCCACTGTCATTCGAGTTGTAAAAAGCTAGCAAAGCGAGGGTATAGCGCTTCTTAGTTTTAAATTTGTGAAAAATTAA
GCTTCGCTTCAATGAAGTGCACTCTGTTTCCTGCTTCATGCTTAAAGCAAAGCAAAACCTTGTCACTTTTTTCTGCTTCGCGGTTCCAAAAACACTGCTA
TCACTTGTCTGGACATACTTAAAACTCAACAAATTCTAAGCTGGTAATATTTATTAACCACTATAGTCATGATTTTCCAGGTTTTGCAATGATCTCTCAA
TTCGTCTGTCTGTCTTTAGGTTGATATCCATCCATTTTATGAACTGATAATTGCTACTTTTGCTAGTTTCACATCTGTTTTGACCAGAAAAAATGTTTCA
AACCAGCTGTGCGCCACAATGCTTGGTGTATCAGTTGTCCTTCATCTAGATAACTCTATTTCACACAACAGCACCTTTTTTTCCTTTTCAATGTGCGTAT
ACATATTTAGTGATATCTCTTTCTGTCACTAAGCTCTCACATTTTCACGATATAGGTAACCGTTTTCAAGCAACAAGCAAGTAAATTAGCAGCTCTCAAC
AAAAGATTGATTGGTATCAAAGTTGGTGACTTTTGGTGAGATCAACGCGTCTGTGTTCTTTGGTCTTATGACAATCTCTCTCTCTCTTTGATGTAAAATG
TTTCTGACGTATTGATATTACAGCCATGTTAAAGAAGGGCTTCTGCTTGGGCAGCTTTATGGGAACCGATTTACTATAACACTCAGGTATAGTTATGTTT
GAATATTTCATTTGTCCATTCTTGTGAGGCTCCAGATTGGAAATGAATGTTATTTTCCTCTCTTTGCTCATATTTCTTGTTCTTTTGAATTATGGCTGTA
AAGTTTGCTGATTGTATGACCTGTTATATGATCGGCTGGAACTGAAATCCTTACAGGGGAGTGTCAGCAGAGTCTGAGGATATAATTAAAGCATCAGCAG
TTGCCCTTGGAAAACATGGGTTTATAAACTATTTTGGCTTACAGGTACGTCGTAATATGCAGATCTTTTTATCTTGGTTTTGGTGGTTAAGTTAACTCTT
CTTTAAATCCAGTCTAGGCCTTCCATTTGTTGTTTTTCGGAAGAGTTTTTTTTTTTTTTTTGAAAATGGTAACTTACTTCGGAAGAGTCTCAGTAGAGGA
GCTTTTACAGAGGCTAACTTTGAAGATCCAGAGGCTATTTTGTGTCTTAGAATTATTGTGAAACTTAAGAGGGTTGGGAACTCTTTGTCCTGTGCATTTT
AATTACTTCTTGTGACTGTTCTAGAGTTAGGGTAGTGAATATATATAAAATTTTGTTACCTTCTCATTGAAAAAAGAAGAGACTCCTGGAATGACCTCCG
ACCTTATTTTACTTTAGGAAAAACTCATTATGATCTTCCTTACTTCGTTTTCCAATATCTTGTTCATATACACTTCTGGTTCCCAGATTGTTTAATTAAT
TCATAAGTATGTCAGTATGTGGGGTAAATGTGAGCTACAATTTTGAAATTACTGCTTGCTTGAGCTTATCTTTAGTCGTGCATTGCATGTCATCATAATC
ACTAACAAGAAGCCCGTACTCAACAAAATCAAGGTAGATCAAGATTCACATTTAATAATATTTTCTGGTCATTGTTGGTTGGCTGCATGATATTCTTTCA
TTTTTTCTTGGCTCTTCATTTCTCTTCGGATTTTGACGAGGGATTTAGTGAAGTTCTTAATTGGAAATAAAATATGGAACTCCTTTATTGCTAAGCTTGA
GTTTTTATTTTGATTGGCAAGTGAAACTGTGAAAGTCACCAATCTGTCATGAATTTGATGGCCATGTTCATCTTGTTGTCTATGCAAATGATGCAGCGGT
TTGGCAGCAGTTCTGTGCCAACACATCTAATTGGAGCTGCATTATTGCGTGGAGAATGGAAAGCTGCTGTCAGCTTGATTCTTGATCCAAGAGAAGGGGA
TATCCTTTGCTATTTCACTTTATCCATTATTTTGCTTTTTTTTTCCACTCTCTCTCAACTCTTAAACATGAAAGTCCTCTTCCCCAACATTTTTAATAAA
AATATTCTGTATTATGTGTGCCTGTAAGAAGTAATTGTTCTCCTTAGCTTTAACCTTGAATACAGAAGAATACCATCAGTACAGTAAGGGAGTATTACAA
GGAAAGTGGTGACATTGATGGGACTCTAAGGCAGTTACCTCGTTATCTGGTTGCTGAAAAGGCAATTGTAAGTTCCAGTGTAACAACATTAAATTTATCC
CACACTTGAGTCCTTTAATTATTATCTGTAATTTCCAAAAAAAAAAAGGAAGTTGAAGTCAAGCCTCTATTATTACACCTATTTAAGTCCGACATCCCAA
AAGTAAGCTAAGGTTTTGCTCATGATGAGCGTCACCATTTAAAAACTTGCAATAATCCAAGTTTGGCTAAAATTTTAATTTATTTTTATTCTTTTTTTTG
CTTTGCATTATTTGTGCTGTCCTTGACTTCCAAAGTATTTGACTTTCTCTGGGATAGAGCAGGTCATATTTTTGTTCCAAATTTTTTATAATTAAGCATT
ATTTGTGATATGAGATTGTGTGTTTATATTCTTCAATTGACGTTTCCCATCAACATTATACAGTTGCAGAGCCTGAAAAGATCTCCTGGAAACTATCTAC
AAGCTCTGAAGGCCATACCCAGGACTCTCCGAATGATGTAAGTCTTCATAGTAGGATTCACTATTTTCTTGTACTTTACATATTTATCTGAAATTTAGTG
ATTGAAAGGTGAAAAAATAAAGTGCAAATACATGCAACTCATTCTTCCTAGTCATTTCTTTTGAGTCTTTGCGTTAGATCTACGTGAGATTTGCATTTTG
ATAATCCTTTTCCTGAGCTCTCTGATCAAGGTGCTTCAAAGACGTTGAGTTATCAGCTCTGAAATAGTGGGGTCAGTGTGCCTGCTTCTCAGTTTTGTTG
AACTACTGTTAGTTTCAAGTCAAAGCTGCTAAAGCTGTTATTATTTCTACCCATACTAGGTATCCGCTTGCTAGACGGGTGTCACCATAAGGCAACTTCA
TCTAGAAAGATATATTCCTCCCCAGGCTTTTGCACATCCCTCACGCACCCCTCTGCCCAACAAGGAAAAGAGAAAACGCATGAGCATGAAAAAGACGTGA
ATAGTCTAAGAGTCACATCCCAAACTACCCTCTAGACGTGATTGATACCCAAACACACACCACTGGTCAGGTGAACCCAATTACCAAATAACCACTAATT
AAATTAGGGTTGTTACACTAAGGCCCTTAGTTGTTTTTCTTGTGTTTCCATTTTTGAAATCTCTCTTTTTGCAACTTGGGAAAGTAAATCCTTGTGGAAA
ATTCAACAAAGATAATCACAACTTATGATCACCTTTTCCTCTTGCATCCTTTCCCTCGAACAAATTCAGTATGTATGCCGGGCTTGTTTATCAGAGCCCT
TGATTTGATAGATCCTTCTAGTTATACCCTCCACAAGGATGTGCCTGAAAGATATGCTTGACGAACACTTCAGGAAGAAACCCTTCTGAAATTACTTGTA
TGTAAATTCTTGAAAAAAATTTCTGTGCTCAACTTCTCTAGTGCTGTATGATCCCAAAATCCTTTACTTTTTCTGTTTATATATCAGACCTCTGACAGTA
TAGTTCAATGCGGTAACTCAATGGGTCTTAAGGTAAATACTGTGAAACCATTGGCTCAACTTTAAACGAGAATTGTGGAATTAAAGAAGGTGAAACATTC
TAGTAATTGAAAAGCTATTCAGTTTCATAGAACTCTACTGCTTCTTACCTGCTTCCAAGAGTGTAAAGCCATAAACGTCAATTGATCATGAGATTTTAGG
GCCTTAAAGCATTGGGAGTACAGAAAAGAGTCATGCATAACTTTTCAAGTTTGAGCTTTTATAATAATACAGATCTTCTCCTTTTTAGGTATGTTCATAG
CTATCAAAGTTATCTTTGGAACCATGCGGCAAGCATGAGAGTGCAAAAGCATGGTTTGCGTTATTCAACTTCTATTAACTATTTTTCCGTATATATGTTG
ATCAGAATGTACTCATGGGTGCTTCGGTGTGCCACCGATTCTCATACATTTTCATTGCCCCATATCATAGGGTTTGACCAAGTTGTGTTGGGAGATTTGG
TGTATTCAAAAGAAGATTATAAAGTGAAAGAATCTTTTGTTGCTGAATGTGAAGACGTGAATGACAATAATATGGATGATTATAGCAATCTGGATGAGAT
CTCAGAGACTGATCTTCCTGAAGAAAGAAATATACCAGTCAAGGTTGGTATCTGGATTATCCAAGTACAAGAGCTGTTCTAAATTTCTAAGTGAAGAGTT
AATATGAAAATCTTTGCATGGCAGATGGGTTCATATGTATTCCCTCCACCTCAATGCAGAGTTCACATTTCATATTCCAAGGACATAGTAACAAGAACCC
CTAATTAGATTAAACAAAAGACCTTTTAGCTACCTAGCTCACTCTCTGGGTCTTTAGCTTGATAAAGCTCAAAACAATCCCAAATTTTGTACAAATGTTC
CTCCCTGATAGTATGTTTTATAGAATATGTCCAAATGAAATAATGAAAGGGATACATCCTAATCACTTTGATTTTTCATTTGATTGGTAAAGTTACCATT
AGGGTTCAGAATTACAGGGTGCTCTAAAGCAGGTGGTATATCATATCATGAACTTACTTGCAAGGATGGTTAGTGGCTTACTGCATTTTGATTTTAAGCG
GGCCAACTGCTAAATGCCCAAATGTTTATGCAGCAACTATGCCTCTGTCCCAAACAAGAAGGGGTAGGCTGTATGAATCCTCAATGACCATGTTTTGCCA
TTTAAAGTCGTTTCAGGCCAACATTTTACAAAATAAGAAGTATTAGAAGTTCTCTATATTTTGAGAGAAGTAATTGAGAACACGCTTAAACTTGGGGTGA
ATTATTAGTTTCATCCCTGAACTATTCACGCCAAGTTCAGGGGTATTTTCAATACTTCTCTCCTATATGTTCTAATTGCATGTTGCTACCTAAATCCCTA
TATAACTGAAAAAGAGGAGGATGCAAATGCAACTTGGTGACCTGCATGACCACCATCTATCCAGTTGTATGGTGAACCTGATGGTGTTAGCTTGCTATAT
ATTCTGCATGATTATCAATTATCTGTTACTTATTATATGGGGGAAGTAGTTCTTTTCTGTTGTTTAAAAAGGCGTCTATATTAATTTAAATGTTAAAAAG
TACACCTAGTGGCTTCACTCTCATGCCTGGTTCTTACTGAGGTTCCTAAGAGGTTTGGGAGAAGTTAAATTGGTTAAAAAACTCCGCTCTTGTGGTGCCT
TTCCTATAATGAGTTTCCTCGCATTGCCTGGTCTTGAGGCGTAGTTGTTTCATACCTTTGCTTTTTTCCTGTGAGCAGTTCTCATCTGTCTTATTAAGTC
GAGCGATATTTTCTGTTTGACAGGTAATAAATGAAGAAGACCTTAAATCTGGTACATATACCATTGATGACGTACTTCTACCTTTGTCTGGGTAAGATAA
GATATTATTGTGTTTACAATATTCTTTGAGTTTTTGTTTGCTCTTGTTTGTGAGACATATTATAATGGCAGGTCTAGAGTTATTTATCCATCAAATGACA
TTGGTGAAGTTTACCGTGACTTGGCACAAAAGGTATTTTTTCTTCATCTAAAGGCTGAGCTTGTTGATACATATATCCGATTATACTTTGCCAATCACTA
CTTTTTATTTTTATGTGATTTGGCGGCACATTATTGAAAGAGATATCAGTGAGGGATGGGAGGTGTTTGTTCCATAATGAAGAAAGAAACTACATGGTAT
TTGAAACTAGATGGTTTGGCAGTACCATGCCATGCTAGTGCTGAGGAGGAATAAACCTGTAGCTATGAACAAGGACTTGGACTCCTATTTAACAGGCTCT
TGTTTCTTTAACATTCTTTTTCCTTCTTTCTGTTGATTGTTCCTCTCTAGCTGAACATCAATCTGCCTTTTAGATTGTCGGAGAAATTGCTGCCAAGTTG
CACAACCTTTTCCTTTTAATCTATTTCCCTGAGTGAAATGAGTTTTATCTGCAACTCTTTATTTATGGTTTCTGAACAGCACCTTTTCATTTTAATCTCT
TTCACTGAGTGAATTAGTTATCTGCAACTCTTTATTTATTGTTTCTGAACAACATCTCAAGTGCTTTAACCAAAAAAGCATGCAAAGGCGAACAGAATTG
GGATCACTGTCTCATATGGTTTTCGGTATACCTTAAGTGACAATCATAACTTCAGATTAGGATTATTAACATTCTGCCACGATGGTAACTAATCATATTC
TAATTCATATAAAAATGTTTTGCAATTCAAGATGTGCATTTAGCTTCTTGTTTAATTTTGAAGTACATTAGGAAGTAGAACAGTTTAAGAAGATTTGCAT
GTGAAGTTATCACTAACCTTTGTCCAGTCCACTTGTGATGACTGTCGTTGCTGTTCTTAAATTTATTCGTGTCTACTCTCTTTATTTTGTTCCGTTCTGA
CGCACTACTATTACTGGTCAGGATGGTATCAGCTTGACAGAGACTGCTCATAAGATTAAGTGAGTAAAACATTTTTCTCTAATTTTGTATAGTTCATCCA
CTTTTTCATTAGTTGCTTGATGTTTTTCTTTGTAAGTAAATTCTTTTTAGAATAGAAGTCACGTCAGCATTATATGGTACAAGAAATCACAAATTGTTAT
TTAGCTTGGTAGCTAGCTACAGAACGCATATACTATGTATAGAAGACACATAGTATCAAAAACAGTCATCTCTTCTGTTGCTTTCCCTAATATCACACTG
CATATGTTTTTTTTTCTTTTTAATTCCATTGCTCTATCGCTTGCTGTCCTTCCTCAATTTCAAACCTGTTATTTTCCGACATAATTTTCGATGATTGGGA
TCATCTTAGTCTGGGAAATTCAGACTAAAGAATATTACATCTTTAATAACCAGCGAGCTCGGTATTTCCCTGAATCTGTAACTAATAATTTGACCCTTGA
CATGTCTGTCAGTGACAAATCAGCTTTATATCATTCTCTGTGGCCTTCTCTAATCTACCAGAAGCAATTCATGTTCCATGAATGAAAAGGAACCACTAAA
GTAATGACTAGAATACCTGTTGTTTAGATCATTACATGATGTGCTATAGCGGTCCATCGATCAAGAAACAGGTAAAGAGCCCTTCATTGATCAAGTTCCT
TGTCCCCACCATGATTTGCTTTTTGAAATCTAAGCAACATCACATCTTTGCCTGGAAATCGTCAATTCGGTTGCGACACCAATCCGAACTGTCTAATCAG
CGATTCCATGTACCTAGAACGTCTGACGATCAAATCATTGCTAGGCATCTTTAAGGAAATTCATTCTTCTGTCTACTCACTCGCGTGATACCGAGAATAC
ATGTTTCTTGCACAAAAAAAAAGTAAAAAAAGGAGATCATATGTGGAAAAGGAGCATCCCATAAATATCTATGGGATGCTCTCATTATCATTAACCCTAG
AATGGACTGACGTCTGAAGTTGTGGATGGGAACAGAATTATCCTTTACTCTACAGTCTTTATATTGCTGCTATATATTTGATGTTCCTAAATCTAAACCT
TCCCTTCTCGGGGCTTGTCCTCCTCTTTGTTGCAGAGAATTCTCCATAACCAATATGACCGGAGCTTACAGACGCGTGTTTCAAAAGCCGAAGGATTTTG
AATGGTAGGTTCAGAAATGGTTGCACATATCTAGTTTCAGTTCTTCTCCGCTGTCAGGTTGTTCCATCCTTCCCAGGTTTGCTGAATTCTATTCAGAAGC
CCAAGGACTTGTCACTTATCTTGTGTGATTTTCTGACTGTACAAGTGTTGGGGCTTGTTTCAACCTGGATCTGAAAAGACTTGTCAAGATGCCTTTTTCT
CCAAACTTTTAGTTTTCAATTCATTCATGTGTGGATCCTCGAAGATAACCTTTTTCCACCACTAGATTTAAATTTTTTTTTGTCAACTGCTCTTATTATT
ATTAACTTAATATTTTTATTTCATTATAATCATCATTCATCGATATGAATGTAGTTAAACATTGTAAGTACTTTTGCTACTTCTTGTCATAATGAATGCA
CTTCACTTTATAAAATTAATATAGATCTCTTTAAATGGCAACTCTGTATCTTAATTGTGATTTGGTGACTGATCTGAGTAATATATGCCAGTTCGAAAAA
ATATTTCTTTTGAATACACTCTTTAGAATTGTGATTCTCGCCCCACCCTTGATACGCAAACCATCTACGTGTGATTGTAACTTATTGTCGTATTGGACAA
AAAGCTTCCGTTTTCGCCTTTTTTTGAATGCATTTATTGTTTTTGTAGGGAATTGCTTAGTTACACTGATGGAACTATACCTCTGGCTGAGACAGATTTT
GATGTCATTGCCAAGTCAGTAAAAAGCAAGGTCATAGAGGAGGTCCCGAGCAATGGAAGCAAAGAGCTTCCTGCTGACTCTTCAGCTATCTCTGTAGGCG
GTGACATGCTTTCTGGAAAAGTGTGCGAGGAAACGATCAACAATGAAGCAGGGATGCAATCAGAGAAATCTCAGAGTGGTGGTAATGCTGAGGAGAGCCA
GATGGCTCTCAAGCTGAGCTTTACACTACCAGCTTCTTGCTATGCAACTATGGCTGTGAGGGAGCTGCTGAAAACATCCACTTCTGTATGTTAACTGACA
TTACTTTTACCATTTATCTTGTGACGAAATCAGTAACATAAGCATATATTTCTCCCACCAAAAAGTTATCTTGATAAACCTGACATAGGAAGTGTTAAAC
TTACCTTAGGGGGAAGGGAATAACTACAAAAGAAATATGTGACAGTCAGCGAGTTTAATAACTGCTGCTCACTTTGTCCGTCTTTACTGACCTAGCGTGA
AATTTGTTATTTCTTCATATTGCACATATTGATAGGTTGGTGCAGTGCATGGATGAAAGCTAATATTTTGTACTCGCTATGCAGGTTGCATTTCACAAAT
CACTGAATGATTAAGCAAACTCTCGTCTACAAAGAACATTTTGGCTTTTGAAGTGGTTACCTACTTACCTTTGCTAAGTACCATTGCGTTAGATAGTAAG
CATTTCTTTTCCTCTTAGCTTTTGCTTTTGAATTGCAGATTGCTTAAGTGTAGTATGTTATAATAGGCGGTACCTTTTTGAGAAAAGATTCACCAAACAA
AATGGTACCCACCAGCAGCGCGCTGGCCTACCCCTTCTCTGATTGCTTGCTCATTATGAGGGAAACAGAAACCTTGCGAATTGAAATTACTAGGATCAAA
GGAAATTGACTTAGAAATTTGCTTGAGGCTGGTTTCTCAATTTTTTAATTTTGTGGTTAACTTTTAAAACTTAAATGTACATCTGCAGGTTTCGGGGAAC
ATTGTTTTCCAGTGATCAAAGTGACGTTGCAAAGGAAATCAGCCACGAGTTTCAGTCTCCGCCCTCGGTTGTACTGCTAATTCACCTTTCGATAAGCTTT
ACTGATGATATAGGATTAGCAAATGTGTAGTAGAATGTAAAGAGCCAATTGAATCGGATATACGGACCACTACTTGGAAGAGATACTGTTGATGTAAACA
GTGTTTGTGATATACCCTTATGTTAGATGATATACTGAAGGAGGCGGGATTTTTGTTGAGGGGTTCGAAACACGTAAAATTTGCAAGAGTGAGATGGGAG
GAAAATATTAATTTTAATACGCTAAATTTAACTTATATTGTCATGTTGTGTTCTATTATATTTCCAGAAAAGACCTTCATTTGTTGTGTTCTCTTTACTC
ATCGCAATTATAATAATTTTTAGTCAAAAAGGGAAATCAGCTTTTCATTTATATTTTATGAATCTGTTTTGATGAAATTTTGTACTGGAGAAAAAAAAAG
GCATGCTAATAAATAATACTCTCTCCGTTTCAAAAAGAATTACTCTATTTTTTTTTAGTCTTTTTTAATAAGAATGAACTCTTTTTTTTTTTTGGTAACG
CTTTTTTCACGTGATATACTCCTCAACTTTGCCATTTGGAGTTGATATACCCATCGTTATGAAAGTGACTCATATATGCCCTTACCGTTATACAAATGGT
TCACATATACTCTTGTTGTTACAAAATGAGCTCACATATGCAACTTCATTCAACGGAAGTTAAAAAATTAGTTTTAAATTATATTTTTTACTTTTAATTT
TTTAAAAAAATTATTTAGGGGTATATACGATTCTTCTATAAAAGTTCAAGGTATAATTAAATTTTTTTCATACATAAATTATTTTTTGACTTCTTTTATA
ATAATTGTTTGAGTTTTTTATTCTTATGTTTTTTCTTTCATACTTTAGTTTAAAGAAAAAAATATTTTTTTTGTCTATATTGCAATTTGATTTTTGTATT
CGAAGAAAAAAGTTTTGTCATCTGCAATAAGTTTTATAAGAATATTAGTAAAACATAAATAAATTTGATTATCAAAATAATACTTCTAAATTAGTCATTG
AAACAAAAAGAAGTCAAAAAAATTTGTTTGACGAGGTAAATTTACTCTATGAAATTATAATTTTTTAGAAAAAAATAATTAAAAATTAGATTAATTTTTT
TTCCATTTCCGTTAGAGGAAAAGGGTATATGTAAGTCATTTGTTTATAAGTAGGGGTTTATATGAGTCACTTTCATGACAAAAGGTATATCAGCTCTAAA
TTGACAAAGTTGAGGGGTATATCAGACCCTTTTACCTTAAAAATTTTTGAATTCTCACAAAATACAGTGAAGCCAAAATCGCTCAACATGCCATAGCTTA
TAGATATATGACTAGGGTTGTTCATGGTAATAGTTAACAACCAAATCATACTGTAATCTGGACCAAACCGATTAAAAAGAATTGATATTTGATTTAGTTT
GATTAGGTTTGATTTTTAAATTTTGAAAACCAGTATTGTTTTATTTGGTTTTGGTTTTACTAAAAAACAACTACAAAAATAACCAAACTAAACCAATAAA
TTAGATATATAAATTTTATAATTATTTATATACATTTTCATAAATAAATAAAAATATTTTGTGAAATTTTAGTTTACTTAAGTTTTTAATTCTGTCATTT
TCTCAAACCCAACACTTCAACCCAAGTATAACAATCTCAAATCCAAGTTCATCAAAATCCATTTTAGTCTTTATACCTACAGTACTTCACATAAAATAGT
CACACTTTTTCTTAAGTTAATCACGTTGTTCGTGTAATGATAATTCTAATATTGCTTAGTTGCTTGACTGAATCGACATTAGTTTTTTTGTAGATTGTTT
ATGCATGTACTTGGTGTTTGTGTCTATTGAGATACGTACGTCCTCAAAAAAAAAATTATTACTTTCAAACGGATAAGCCAGAAAAACTGAATCAAACCGA
CATAACTAAATCGATGGTTATTTTTTCGTTTGGTTTGGTTTTAGAAATTTAAAATCCGACTAAATTGATTTTGATTTTGATTTTAAACAATAACCGAATC
AAACCGAACCATTAACACCCCTAGACTCATACATCTTTGATTTTTATTTCGTTATGCCATAACTATTTCCATAAACCCTCCTCCTTTATCCGGGCTTGGG
ACCGGCTGTGTTACATTACAAACAAAACACAGGCGGAGTTAAAAGTTTTTTTTTTTTAGAATCTTAGATATTCCATAGCAAGCATTGGATTAGACTAGAC
CAACTGAAATGTATAAACTCTCTGTCTTCGAAATGTGTGACCGGGAGAAGAGGATCAAGTATAATGAAGGGTACTGCACGAGTGTAGTACTACTATAATG
AATTAGGTATGACTTAACCCCAGCTGGAGATCGAGCGTGGATATTTTGAAAAAGTCTTTGAAAGGCGTTAGTCATCGATTTTCCGTTAAATAACCAACTA
CTAGTTTAATAGTAGAAATATAGTCCTCAATTACTTGGAGGACCACATGAGACTCCAATCGGCTCACTCACTGGGACCTGGGGATACGCAACATCGGACG
TAACGGGTCAATTGGTGCACCGTATTCACACAGAATAGATATAATTTTTGCTCATTTTCGTCTGTTGTGATATACTTTGAAAGATTTAGCGTTTAGCTCA
TATGCATTTCCATTACCCTAGATATATTTTAAGCTCATGGCTCATTGCCTGTCCTTATAGTTGCGTTATTTTCTCCCTCACCAAGAATCGATCTATATTA
TCAACTTTATGTCTAATCACAAGGCACTAACTTTGAATCTAAAACTAAAACCTTCTTCAGACTGTAGCGGAAGTAGTAAAGCAGGGTAGGCTTCTACTTC
ACCCATGATAGCAATCCTAACAAGTGCAGCACTAAACTTCACATAAGACTTGGGGTCTAGAAAGTGCCGTGTGTGTAATAAGCTCAGACAGATTATTTGA
TACACAAAAGAAGTTCATACCTAAATTCACTACACAAGTATAGTATATTACTAAGATTAATGGAAAAAGGTTTATTCAAAAGCAATTCACAACTTAACAT
ATATATCGATCAAAGCCTAGTGAATCTAACCCCTTCCAATTCAACCTAATTTGACATTATTACTCATATGAAATGCTACTAAGTACGTATTTCTAAACTA
ATAACTAGAAAACATGCAATAATTTTTTTTTTAAAGGGAAGTAGAAACAACAAAACACAACCCTTTTCTTTTTTTTGAAACCCAAATAGAAACGACTAGA
AAAACACAAAATATTTTTTTTGAAAGAAAGTAAAACAATAACTTGAAAACACAAAAATGATTTTTTTTTTCGAAAACAAAGTAGAATCAACCACAAGAAA
TCCCTCAAACTTTTTTTCTTTGAAAACCGAAATAGAAACAACTAGAAAAACACAAAATGTATTTTTTCTTGAAAGAAAGTAAAACAATAATTCGAAAACC
CTCAAACTTTTTTTTTTTTTTGAAAACAAAGTAGAAATTAAAAAGCAACCAGAAAAAGCATGCAAACAACGAAAGACTTACGTAGATCCGATAATCGCCA
AAAAATCTCTTTCGGCTTGAAGAGCATCATCAAAATAAACCGTTCTTTTCATGCTTGCAATAGCGATTCGTGCCGCTTCCCTATCTTTTTCCCTTGACTT
TGCTTTCTCTTCTTTATCTTCTCTCAATTCCCTTTCCCACGAACGAACTTTCTTCTCCATCTCTTCTTCATCATACGAATCCCCAAGAATTTGCTTTTGT
GATTTTACTATCATATTACAGTAGCGTTGTTTCAACTTGGCTTCACGAAGAACTTTATCATCCAACGCCATAATGTGAAAATTACGAATCAATTGAATTT
TTTTTTTATATTAACAATGAACAACATATTGAAATGGATTTCCTAATATTGAGTTGAATTTAGTTTTTTTGTTAATTTAGGAAACCTGAAAATAGTTTCC
TTAACAGATTAGGAAAACTTTTTCCTTCTGCGCTTGTAAATTTATACATAGCGGATATAGTAAGCATTATATACTACACATAGTCTTAAAAAGGGGTTGA
AAGCACCGTAAAATTGTTCGGTTTTTTTCATAGTAGAAAATTCTCTACTATTATGGAGCGGAGTAGGTTTAGCCGAATCCCATTAAATCTTTGTGTTATT
CTTTTTCTTTTTATTTGTAATTGTATGCTAGTTAATCACGATATATCTTTCAACGACAGTAGTTTAAAATTACGTGCATTTCTAAATTAAATGTATTACC
CCATTTCACTCTCTTTGTATGTTGATTTTTTTAAGTCTTGAAAAGCTTATCGTATATAATCACTAGGTAATGAGCTCGCGTTTTGCGTGGGTATAAATCG
TATATATGTATTATTGTTGTAATTTGATATATAATATTTTTATATATTTATGCACGATAAAATATATTAAATTTATGTGACATTTTTTCTTGTTTTGAAA
GTCCAACCATTCATTTTAAGAATTTATTTAACAATTCATGGTCTAAAGTAATTTATTTAACTTTTGAAATTTAAATTGTAAGAAGGAGAGAAGTACAATC
TGAGAGAAAGCATATACATGAAAAAAGAATCAATTAGAAGTGCACGAACGTTAATAGTATTGATATATGAACATATTGTCTAGCATTAGGCATATTAATT
AAATATTTAAGAAATAAGTTCATCTAAATCATATCTACTAAAACATAGAGGATATATAATAATCTAAAGAACAAAAATATAAGTATATGGGCCATAACTT
GATGGTTGTTTGAAGTTGCTATAACCGTATAGAAATTACATTTTGTTACTTGATTTCTATTTCTTTCAAAGCTGTAGTTGAGTTTGGGGCTTAATTGTCG
TCTGAAGTAACTTCATTTTTCATCTTTATATAATTGATGCAACTAATTAATTAATATGTTTGATAGAAAATTCATGAACAATTATATTTAAGAAGCCAAA
AACACAAGTAATGAGCATTACGAATTTAGAGTTAATAATTTTGATGGTAACTCAACTATCAATTGTTTTTACAGAAAGTTACTCAACTTTTATTTTCTAA
CTTAAAAGTCACTCAACTATGACTTCTTTGCACAGAAAGTTACTCAATTTTCATTTTTAACTCAAAGTAAATTTTTAACTCAAAGTAATGTATCTTAGTA
CTCACATGAAGCAAATAAGAAGTTCAAAATCCAAAATTTAACAAAACATGCTTTTTCATTCTTGTCAAATCAAAGGCTTAAAATCTTAGAAAAAGAAAAG
TGAAATTTCTTAGTTGTGGTGCTGCCACGTATATATATACAAGTTATTGGCACACGCTTGTGAGACATTTATGTAATAATTCTAATTTATTTATTTCACT
CATTATCATAAATTGTGGTGTACATTTCATTTTTCGGATCAATTTTATATTATTCGATTTGAATTTTATACTAATTTACCATACATATATACATTATATA
AGATCAAGGTTCCCAAGGCCTGTAAAAAGATTGCCAAAGTTTCTTAAAATTAATTAGCATTATTACTATATGGAAACTTTTTCAAACGGTAATTTAACTA
CATTCATTTTCCAAGTGGAGAGATAAGAATAGGGCCTGAAATTTCACACCTTTCATCAGGCCCAAACTTGTGATTTGTTTCTCTATTACTTGATGTAGAT
TATATTTTGATTCTTACTATTTAATTTGACTTAAACTAAAAAGGGAACTTTCATATATAGCCACTTTAAAATAGTCTGATCACTCTTCATAGCTATAGTT
TGATAATTACAATTCATAGTTATATGTTATATGGAGGAGAGAGGCGAGCAAGACTAGGAGAGAGAGGGAAAAGAGTTGAAGAAAGGTGCATTATATATGT
ATATCGGTTGATAATTGTATATAATACATATGTATTTGTATATATGGCAAGCGATATTAGGAGAGGAAGGAGAGAGGCAAGCGGTACTGGGAGAGGGAGG
AGAGAGGCGAGTAAGATTGGGAGAGGGAGGAGAAAGGCGAGTGAGAGATGGTTGAGAGTGGGAGAGAGGTGAATTGTATAGGTATATAATTATAGATTAT
ACATATGCATTTGTATATATGCAAGCGAGATTGAGAGAGGGAGGAGAAAGGCGAGCGAGATTGGGAGAGGGAGGTGAGAGGCGAGTGAGAGGGGGCGGAG
AATGGGATAAAGGTGAAATGTATATATATATATATATATATATATAGGTTAAATAATTGTATATTATACATATGTATTTGTATATTCTAGCGAATTATAC
ATATACAAACGTGACTAATTATACAAATTCGAATTCAATCCTCGTAATTAATCTATAATGTTAGTCATGAGTAGTAATTATAGCAAACTATAACTATGAT
GAGTAATTAAATATTGTAAGTTTGCTTAAGCGCGTAATTTTCGCAACTAAAAAAACTTGTGTGATAGACGCTTTTACTGGCATTAAAAAAAGTGTGTTTC
TTAATTAGTCAATAATATTTATAAAATTATATTAAGATAATAATTAAAAAAAAGAGGAGGAGAGATTGAGATCATAATTAGTGAAAGTAGGAGATTGAAG
ATTTAAGAGGATGAGACTCCGATCATTTGGATTTTAAAGAATTGAATATAAAAAATATATATTACAATTCTTTTTCAAGTTTTGTGTATGTTTGTATATA
TTATTCTTTTTTATCTTTTTTGAAAAAAAAAATGAAATTGATTCCTTACTTATTTTCTCGGATTATCCTACAAACTAATTTTTCTTAATTTTGTTAATCC
ACTGAGCTATTTTGAAATTTAAGAGCTGTAATATAGTTTAATCGTATTTTTGTCCAAAAATATTATTTTTTCTATCCGTTTGACCTTTGATTTTAACATA
ATTTATATCATACTATTTCCAAAATGATTTCATGAATAAGAATACATGCTTATTACAGCTTAACCTAGACCGATGATAAATTTGCTTATGTCTTTTGTTA
GTGTTTTTAAATTTAAAACTCAAAATAATCGAGTACAAAAATAACATTTATAATACATACAATCAATATATATTCAATTTTCAAACCTTCTCCTCATGAT
GAAGACATTATTTTATCATTCACAAATAGCCATGGAACTGCCTAACCCCAGTTTTGTTCAATGTGAAATCCCACATTGTTGCATTGTGACTATATTTTTT
CACATGTATAAATTTTTAATACTTTTAAAAATTATTGGTTGAGTTACATTGTTTAGAAATGAATAAAATAAAATGCACTCCTCCTTAATTGTCACTTATT
GCAAAATAAACACTACAGTACTAAACTACTAATTAATCACTTTTAAGTACATCATACAATATAATTGTCTCATGTTGGGTCAAATATATTCACTTATTAT
TATTATTATTATTATGAACAAAAAGGTCTGATATACCCTCAACTTTGTAATTTAGAGTTGATATGCTCATTGTTGTGAAAGTAACTCATATATTCCTAAC
AAATAAGCCTTGAAAGACCACGAGTAAGAGATAAATGAGAAATATACCAAAAGACACAAAGATATAATGTGGTTAGGTCAATTGATCTACGCCCACAGAG
GAGATGAACAATTCACTACATAAACATGAAAATGCAAAATATAGTGAGAAATAACCTCAACCAGTTCACTCGAAATACATGGGAGGTTCACACAAGTGAT
AACATATTACTTGTGAGAAATTCTCCCTCTAACCAAAACTCTCAAAGCCTTAAGACTACATTGTGAATGATTATTAAGTTAGAAGGAACAAACTTTTATT
TGTAGAGTCTTAAACATTTTCCTATCAGAATAGGATTGGTTAATCCTAAACCTTATCCTAAAAAAACAAACATGTTTATGATTTTAAAAAAAACTCAGAT
TAATTAATACCCAATAAAAATAAGACGTAAGTACTTGAAAGAATTATATTCAGAAATTCTATTTTGGTTTATTTGCTCAGACCAAGACTTCATTTAAGTT
GATCTTCATAATTGTGATATTGTAGTTGAGTAGAAGGAAAAAAAAATGTGTTGTTTGGGTTTAATATCATCCTTTCTCAACATCGCAATTGACTTTTATT
TATTTTGATCATAAACTCAATAAAATTAGATACCAAATAATTAGAGCCTGGAAAATTGGTGGAAATTCTCTAGTGTAGACTTTTGGCTATCTTAAATCAT
TTTATGTGTTATATATTTTCTTATTGCACTAGAAAAAGAAAAAAAAAAGGCAAGACCAAGGCCTTATCTCAAAGTCATCACAATTTTGAGTGGACTACAA
GAAATGTGGCACTTCCTTTGAATCTTTCTCTTGCTTAATTCCATGTTTACTACTTTCTACAACCTACGTGTATAACTTGATTTCATTAATAATAAAAAAG
GCGTGTGATATTTAATCGTTAAAAGATCAATAATTTTAAAAACTTTTTATTGAATGAATTTTTATTTTAATAATTTACTCGCTATTTATATTTTGTATGT
ATTGAATATGTTTATATTTATTTTGTTTATAATAATGATTTTGTTGATCGATTAATTGAACACAATTTTGATTATATAACTATATTCAATCTAAAGTGCA
CCTTATATTAGAATTGCCGACAAATTCTATTGCTCGAATTAAAAACGGATATTTGTATCGTTTGAAAATGTGATCACTCAGGACTTTGACTTTTCTAACG
GTGATAAAATCAAAGCCCAACTTGTGCAGTTCGATCCAATCTATTTATGTTTTGAGTTGGTTATTATTTCGTCTATTTATTAATTTTTTAAATAATTAAA
AAATAAGTATGTAATTCAAATTGAATTTTGAGAAATTATGTCAAATTATTACTATTAAATTTTATTTTTTTATTTTATATGTTATATATAGTATTAATAA
AGAAAAATAATATTTTTGTGAAGGTACTAAAAATTTATAAAATAATAATTAAATCTAATAAAAAATGGTAAATGACCCGTTATTAGCCCGTTTTGTCCCA
ACCAATTTTGATCAAAACAATTGAACTCGATTTCATGCCCCATTTTTCATCTCGACCCAATTTGAGTTGCCTTAATTTAATTTAACCTGCCTAATTATCG
CTGTTCCCGCCCCAGTTGAGGCGAATTAACACCGTGTCATATTTTTAAAACTTTAGGACAACTAATGAGTCTTAGATACCCTCCAATTTATAGTTATTCC
GTCGATATTTTCTTAATCGAGTTTATTGTTTATACTTGTTTGATACAATTACATTTGTTATATAATTGATAAATTTGTACGATTATGAGTTGATCTAATA
TGCATACAAAAGATAATAATAACTCGGGCACAAAGTTCGCTAAATTAATTCATTTCTCCCATATCATGATTCATGGTACGTAAAATTATTTACAGTACAT
TCTTATAAAACATGAGTAGCCACTGCGGAAAACATACAAAGAAATTATTTATCTACTTTGCAGATTCCATGAGTTCAATTTTTAATATTTTTATGAGTCG
TCCGAGCCTCTGCTTTTAACCTCCACATCCACCACAGCCGCCGCCGCCGCCACAGCCACCACCTCCACATCCTCCGCCACAGCCACCACCACCTCCTCCT
CCACTGTCGATAACAGCGGCGGTGACAACTGTTGCAGCAGCAGCCGCACCTAGAATTACCATTCCACCATCTCTCATTGCTGTATTGTCCTTGGGTTTAA
TTTCGCCCTTTTCAACATCACGATTTGCTGGTAAAGGCTTCGGCGGCAGAGGAATAACCGGAGAACCACTGGTCACATTCCGAGTCACTGGGGAACTCTT
TTTCTTTCGGCCAATTTTGTAAAAACAACACGATATTAAAACTAGAGCTGCTGCAACAGATCCACAGACAATGAGTGCAATTGCATATGCTTTCATCTTC
TAATTCTTAATTCGGCTCTGCTAAAAAAAAACCTTTGTCAGGCTTTTATAGCGTCAGATTGGCCAACAAAGTTGCAAATTTAAATTTCTATATAAGTTCA
CTAATGATATAGAAATTCTCTACTGTAGACTTTTGGCTACCTAATTATAGATGTACACTCATCGCATCAGAAATATATAAAGAGGTAAGACCCAGGCAGG
TTTTGAGTGGATAACAAGAAATGAGGCCGTTTCTTTGAACTTTTTTTTTTTTGATATATAACCCGAGTTATATAGATGAAAAAAGAAAAAATTAAAAGTC
TCTGTTATGCTTTGGTAAAAAAACATTTCTCCTTTATTAATAGTGGGAAAAAAATTAAAGTGTTTAAATAGATGAACACTTTATTAATTGTTAGAAGAGT
TGGAAATTAATTTTTTAATAAAATTCGTTTTATTTATTTATTAAATCAAATTAAATGATCAAAATATTTTAATTGTTAAAATAATCAGCTGAAATGACCC
GGTCCGATACTTTCCTATTTTATTTGAGCTTTCCACAATTGGAGATGAGTGATTTGAAAGGTTGCAACTTTCAAAAACAATCACGACAACAGAGATACAT
TTTGCAAATATTAGTTATTTTTAAATTAATTTAAATTTACTATTTCTGCAAAGTTTTTTCCGAGAAATGCATAAATACCCCCTCAACCTATGAGCGAAAT
CTCAAAGACAGACTTATACTACACTAAGATCCTAGTACTCCTGAACTTATTTTATAAATAATTTCTACCCCTTTATGGCGTACGTGACACTATCTTCTGA
GCGCAGCGCATGTTGACTTTTTTTTTTCAAACTAGTACCACGTAGGTCGAAAAGGAGTAAAAAGTTATTTATAAAATAAGTTCAGAGGTAATAGAACCTC
AGTATAATATAAGTGTGTCTCTGAAATTAGTACTTATAAATTTTTCCTTAAGTTTTTTCGTTATCACTAGTATTGTTTAGAATAAAGATAACAAACATGC
TGGTTGAATCAATTTTTGCTAACCACACATAATAGGTAACAGAAGGCCAAACTTATAGAATTGTTGATCTTTGTGGCAATTGAATGAAAATAACATGAAT
TTCGCGTAATTTGAAATTTTATTTTCGAATTGAATATTATATTAAAAAGATGTAATTTATCAACATCAATTACAATGAATAGGTCAATAACTCAATACAA
AGAGTAAGCTTGAAAATAAAAGAAGAGGTTATTTATTTGAAAGCTCGACGAGTTGCCACTCATTTCCTTGTAGCGGCTATAAATGGCCTTAAGATGGAGC
TTGCTTCGGATTGAGAGGATCCTCACAATCTCTTTGTCTTCAATTAGATTCGTCTTTTTAGCAAGTGCATTCACAAACACCTTAGCCTCAGATTTTGCTA
GATCCTCGTTCAATTTTGCCCCTTCGTAACGGTAGATTCTCACGAGCAATTATTTTCGTCTGTTATGATATACTTGGATAGATTTAGCATTTAGCTTAGA
TGCATTTTCATTAACCCTGGATATACTGTAAGGTCATGGATCAATGCATTTACTTTTAATTGCGTTATTCACTCCCTCGCCAATAATTGATCTATATTAT
CAACTCTGTATACAATAAGTTATATTTATTTTAAAATAAATATAATTTGAAGAATCATTTAAATTGTAGAATGTATCAAAATATTCTTTAATCTTTTGAT
TTAAGACTAAAGATTCGTAAAATGTATCAAAATATCCACTAATCTTTTAGTTTATGACTAAAGATTTATAGATCAAAATATTCACTAATCTTGTGCTCTT
AAACGTATTATGTGGAAAGTTAGAATTAAAGAGTAATCAGAAAAGAGAAATAAATGCATCTCTATTAACCCTATATATATACATTATAAGATCATGATTC
ATTTTACCTATCCTTTTTATTGCATATTTGTGTTCCTTGTCACTAAATTGATCTAAATTACCAGCTCTATATTCGATCACAAGGTACTAACTTGGATCCC
AAAACCAAAGTCCTCTTTCTTCACCCATGATAGCACTACATATATATACATCATAAAATCACGACTTGTGATCATGTTTGCATATCACTTCTTCAACATC
ATTGTCCGAAAAAACTTGTTATCTTTTTCAACGTCTTAACAATCTCCACACCAATATCACATAAAAGTATCATCACAATGTAATGCGACTAAACTATTTG
ATCATAAGTAACAATAGAATCGGTTTTGTATATCCACGGCCTAAATTGAAACGACTCAGTCGATCAGCTAGAATCACCGTTCCTTACCATAACGTAACAA
TTAATAATTAATAGAAACAGATCTGTTGATATTAATATAACAATTAAGAACTAATTGAAAAATATTTGTTAATATTGTGTTAAATTTCTTACCAGTATAA
TTTAGGAAACTATAATTTTTTATTAGTGTTGACACCTAATTTCGACCCCCGGTATAAATTAGTTCTCGAGCTTCTTAAATTTCCAAACAATTTAAAAATA
ATTAGTTTTATAAATTTTACGATTATTTCTCAAAATATTTTAAATTTTAGTAAGTATTCTATTTAGCTAATTTAGTTTAAATTATGGTTATATTTTGAAT
CACTATTTTACAATTAAAATAATTATATTACTAAAATAAAGAAGCTCGTTGATTAATTAATACAAATTCGTTTTATTTAAGATTTAGCCAAATTTATCCT
CTTAACTCAATTTGACTATTTATTAAATTTAACCCATCTTAAATTTCCAATTTAATTTATTTTGGGCCATTCTTGCAAATTTCCTTTAATTCCCAATTCC
AGCCCATTTCTTTTGTGGCCCACTTCCCATTTCTTCCCCTCAACCCTTTTTCAACAATTATTCACCGGGAAAATTATGTGGGATGGCAAACATTCATAGC
TAATTATATTATAGGGGTATAGTTTAATTTATTTACCTTATATAGTTATAGTTTATTTTTGTTTGCTATATTTAATGGGGTCCACAACCTATTATATAAC
CAATGGTATAAAAACATTATTTTCTAATTTTGTATATAATTATACACAAAACAATTTTCTCTCTCCTTTTCACATTCCAAATTTTTCTCCTACATTTAAT
ACTCCAGCTATCCGGTTTGAAATTCAAATTATTGTCCAAAATTAGATTACTCCCCCCCCCCCCGAAGTTGAAGTTCCCTTCCGAAGTTGAAGTCAATTTC
GTAAGTACTCCTTAATTTTAGTTGTTTACCTCTTCTTCTTTTTTTTACTTATTCAAAATTTGTATATGTGTTCTGTTTATTATTTTTTTTCATATATTTT
GATGAAATAATCGATTTTTTGTTCTTGATAGATCTAAAATTGGTCACACAATGACTGAATCATCTTCATCTTTGAGGATTACCAGAGGTATTCCTTTGCA
TGTCAATGTTGTTGACATTTTACCATCGTTTTCAATGGGGTTAACTCAAGATTTTGGGTTTGATGTAGGGTCATTGGGAAAATCAAATCAAGTTATACAA
GAACAAACAATGGAAGAGCTTAGATCAAAGAAAAAAAATGACCCTACGGCAGTTCAACAAATTATTAACAATGCCAAAGCTAGAGGCATTAAAATAGTAC
AAGGAAGAAGAAAGAGGAAAGCTGTAAACATTGAATCAGAGGAAAATGCTTCTGAAGTTGTCGGATCTGAAGAACATAATATTCATGAGGTACTGTATTA
AAACACAAAGTTAGATACAATTTTTTGGTTAATTAGATGTCAATATACAAAAAATATTACTTAAGTATTGTATATAGTATAATTGCATGTTTAATAATTG
TATATAGTATATTGCATATTTATGTTATTTTTGTTTTTTGTATATATATACAAAAAAGTAATTGGACTTAGTTATACAGATGAATTTTTTATATATATGA
TTAGAATTTGTATATTCTATTAGTTATATACAAATTATTGAAAAGTTATTATATATTAAGTTTATATACATATACAAAAATTGATATGTACATGTCTGTT
TTAATAGCTGGTAGTAGGAAATTATATATTACAGGCTCATTATTTTTTTTATATACATATGTACACAAAGTAATTGGATTTAGTTATATAGGTGGGAAAA
TATCATATGCGATTATAATTTGTATATTGTAGTAGTTATATACAAATTATTGAAGTTAGTATATATTAACTTTATATATTATTGGAGTTTAACAAATATA
TTCATGTACATATATAAATATACAAAAAAGGTAAGTTCATATATACATACAGTTTTTTTTTTGAATTTGAACATTTAGCTTAAAAAAAGGGACGTTTCCC
TAAAATTGTGGCATTATCTAAATTTATTGTTAGCATATTTAACGCTTCAGTTACAAACCACTTTTTAAAATATAATTGTATAAATAAAAAAAATTATATA
CAAAATTAAAGATGCCTAAAATAACTAAACTATACCCATATAAAGTAATTAGATAAACTATACCCATATAATATTATTTAATCTAATAAGTTTGCCATAT
ATGAAATTTTCCCTTATTCACCTCCTCCCAGGCCCAACCCTTTTCTACCCGACCCAATTCCCCTTTTTCCTCTCCTAAAATCGACCTAACCCCTATTCCA
TTTTTCCCCTTTAGCACCCGACCGACCCCATCTTCTTCTTCTTCCCTACGCGACAGGACCTAACAACCAGCGAGCAAATCGCGTGTCCCTTTCCCCTCAA
CCTTATCCTCTCGTACAAGAGCCGTTAGAAATTCGTGAGGTGTCAAAATCTCGTAGCTTCGTCGTCCTTGCTCCAAGATCGAACGGATCCCTTCTTGCAT
CCGTTGGAGATTGTAGTACTGTTGACAGACCTTTCAATGCTTTCTTTTCAAAGAAATATTTGAATTTCGAATTGAAAATTCGAATCTTCTTCACCCGTCT
TCCCCCCTTAAAAATATGCATTTTTGCCTTCTATAAATATAGCCTTAGTTTTCACTGAAAAGGGGAGGAAAAATAGAAAAAAAGGAAAAGAAACAAGGAA
AGAAAGAAAATATAGATAAAAAGGGAGTAAAGAGAAAAGGTTACAGAGGAATATGGCCACAAGCTTCCAGCCATATCACTGTATATAAGTATTTTGAGAT
AGTTTCTTGAAACCATAGAGACGTTCGTCCCTGTCCTATCGCTACCTACAAGGAGCTCTATATCGCCTTTTGAGTTTGAGTGTTGTGGTGGAAGACCTCA
GCGTTATTTGTTGTTCCAGTTGGCTGCTCTAAAACAGGTGAAATCTCCTCGAGTCCTCATGGACTTAAACCCATCTCGTTGCACTTTCTCATTGAGCCGT
AAAGGCTTGGACTGTCATCCTTGAGTCGTAGATCCCCTCAAAACTGGCGAACAGGCTAAAATATATCAAACGAGTTGCTGGAAATTAATTGCAGGTTCAT
CAAAAACCTGGAAAGGGGCTGTAAAATGTATTGGCAGGTGTTGATGAAGCTGTATAGCAGCTGTATACATACTTTATACATCAGTTTACAGGTCAAAAAA
CGTACAGGGGACCAAACTCGAAATACAGGTTTATAACAGTGAGTACATACTTCTGGAAATAATTTTTCAGCTGTCAAAAGTTGAAAAACAGGTTGATATA
CAACCTGTATACACATATATACAGGGACGATATACTATATATATGCTTAAAAAATATGATTGGCAGGGGAACATAGAGGGACGCCTATTCTAATTAAAAT
TCGGAATTAGTCAAACAATGCGGACGTAGGGTGCAGCCCGTATACATTATCGGGCGACGATATACACTTGTTTTTAAAAAATGATACAGGTATAAATACG
CGGGGCAATACAGGGAAAAGTAAGGTAAATATATATTCAAAAGGTGCAGGGCTCAAGAGGTCCAAATGGGTCAGATATTGCTGTATACAGCATGTATACA
TTTGTATACTTTTATGTCTCTTTTCAGGGAATTGGGCCAGGGCCCTTCAGCCCCCCTTTTATTTAACAGGCCCAAAGGTGATTTGTTTCTGCAGGTTTTA
AAGAAGGCCCAAGTATAAGGATTAGTTTATGACAGGTGGGTCAAAGCCCAAATGAAAGAATTTGAGCAATCAAGCCCAAGTTCAAATATTTCTTTCTCTA
TCATTTATTTGTTTGAATTATTTAATATCTTGGTAGAATTTTAATAATCTTCTAAGGGGTAGCCATTTTTCATTATTTAAATTTTACTATTTTTGTTTTA
CTTACTTTTATCATAATTTAGTTTTCCTTAAATTAATTCCCTCAAAATATCTCCCTTTAGAAATAAATAAAAATAATAATAATGAAATAAAAAATATTAA
AACAAATTTCTTTTTACTTAGTTAAAAATTTTATTTTAATAGTCATTTAGTCAAATCGCCGGTCAACCGCGAATTAACGGGCATCCCGAGGGCCTAACAC
CTTCTCGGGATGTACATTGAACTTCGAACCTTTTTTCAATTGATTTTATCTGTTTTGAATCTTTTGACAGTTTTAAATTTTTTCTTGATTTTATCAAAAA
TCAAGTGGCGACTCCATAATTTTGAAAAGTCAATTTTTCTTAAACAATAAGATTAATTGATTTTTCGAAACCTAGTCAATACTTTTTCCATTTTTTAAAC
CAATAAACAAATAGTAGTATTTTTTAAAATAAAACAATTAGATTAGGAATCTCGAATATATTGTCCTAATCGGAAAACCTTTCTTCGTAGGATTGGAATC
TATATAATTTAAAATTTTATTTTAAATTTATTTAAATTATAAGTATAGAATCTTTCTAGGAATTTGTCAAAAATTTATATTTTTTAGACTTGTTTTTTTA
TTTCTATGTGTTGTTGCATATCAATAAAAAGCTATTGAACGAATAATTTTATTCTGCTAATTCTTCATCAATTTAATTAATTTGTATATTTGATATTAAC
TTTCGCTTTTTTATAACAGCCACAATATATACACGAGTAAGCTATTTTATTTGTTTAGACCAAGATATTAGAATTGTGACAATATTGTTAGGGATAGTAA
TGAAGCGGTGCGGCCGTGCGAGGTGGAGGCGGGATAGATTGAGCTAAACCCCCTAGACCGTAAAAATTTTAAGCCGATTCACTCCGCCTCACTACTAATT
TTTTTCATTTTCAAGTCACTCCACCCGCCCCACATGAACCTGCACTACGTAAATCGTTTAATATTTTCTTTTTCTAGGTAGGTTTGATACAAAAAATAAA
ATTCATAAAAATAAATTTATTTATTCATCATGTAATATTAATTTAATAGATAACGACTTAAAATTTTATTTTTTAAAAAGTCAATTGGAAAGTATGTTAG
AAATTATATTAGTTTTGATTGAACCATTAGTAACTTTAAAGAATATCTCAATACATAATGTTCTATCACTCTTATAACATGTAAAAAGTTAAAATTAAGT
TTGAATCTACATAAAATTGTATAGATTCGCAACTCACCTCCGCATTAGTTTCTAAAAAACCCACTTCAACCAGCCATACATTCCTCCTCGCACTGCATAA
CCTTAAAATCGCATAGACACGCAACACGCCTCGCGCTGCAGTAGTTTCTAAAAAATCTACTTCAACCCGCCACACATCCCTACCTTCCACATAACCTGAA
ACCCGCACCACCCGCATAATCTTACTTCTCCCTGGCCTCATTACCATCCCTAAATAATTGAGTGAAAGAGAGAAATGTGGCATGCAGTTTTTTTTTTTTA
AAGATCAGGAGAAAGTGATAAGACAGATATTGAAATTGTTTATTTGTATTGGAAACAAGGAAGTAACACATAAATTGGAGAAAGATATAGAAATTCAAAA
GAAATTAAGCATTCATTTGATCAGAAAAAATAATTATTTACAAATCGATGGTATAAAAGACTCTCACACCATGGATATATATATATATAACTTAAATTTA
TTTCTCCAATCTCATGATACACACATTATTTATAACCTATTTGTATTAGACGACACTATCATTATGTAAATTAAAATTAAAGTAGCTGGCCATAATAGAA
AACAAGGGAAAAAAAAGAAATGAGGCAGTTCCTTTGAATCTTTCTCTTCCTTAATAGGTGACAAATGAGCGGGGTGGTTGAATCAATTTTGCTAACCACA
CAGTATAGGTAAGGGATAGCAGCCCAAGCTTATAGAATTGTTGATGATTGTAGGCTGTAGCAATAGAATGAAAATAACATGAATTTCACGATAATTGAGG
GGTTTTTTTATAAAAAAAAAAAAGTAAATTTGAGGCTATTAAATATTATATTAAAAAGAAATAATTCATCATTATTTGGTTAGGATTAATAGGTTGATAA
CTCGATATGATCTAAGAGTAAGTTTGAAGATAAAAGGAGTAGTCATTTATTCGTAAGCTCGAAGTGCTCTATATTTTATTGCAACATTTAAAAAGTATGA
TGTTGAAATTGATCGATTGAAATGGGAGCATTGCAATCATACATCAATTGAGCAAAGAACCTCAAAACAAACTAAACAAAAGGGGAAACTAAACAAAACA
TTTGAGAACATGGAACAACTGTTTGGAAAATCTGGCCAAAATAAATTAGTCAGATTTTGCAATTATGGTAAGCAAGAAATCTCTGTAGCTTCCATTAGCA
ACTTGTTGAATTTTTGCAGCCAGGGTACTTCCATATTTGCTCTGGAATTCTTCTTTGATTAGCTTCATATCATTTTCATCTGCTCTTGTAACTATGACTC
GAGTCACCGAGTCTTTAGCCGATTCTTCCACATCCAAACTTAAGGACGAGATCAAAATCTACGTAATAAATGAGAAATAAATCAAACAAAAGAGAGAAAA
ACAAGAATGTACGATATATTAATCCCTTTAGGGCGATTTGTATTTACCTTGCTAAAGTATGTTTGTGGTGAGCAAAGGCATTGAACTACTTGTTTCAAGA
GCAAGTCACCATCAAGATCCTGAAGAAGAAAAAATTTGACATTATCAACAATCTCAAATTAACGGAATAAAAAGACTATGAACAGTCGGCGCTCAGAAGT
TGAACTCTTTTTTTGTTACCTCATCCAGGAAGTTGCCAGTCATTTCCTTGTAGTGGCTATAGATGGCCTTAAGATGGTGTTTGCTTCGGATTGAGAGTAT
CCTCACAATGTCTTCGTCTTCAATTAGATTAGTCTTTTTAGCAAGTGCATTCGCAAACATTTTAGCCTCAGATTTTGCTAGATCCTCGTTCACTTTTGCC
CCTTCATAACGGTAGCTACTCACGAGAGCAACTAGAAGCTGTTAATCACAATAAATCTGACTTTAGACGAGCCCCACGAATAAAATAAAATTAGTGCATA
CAACTTAAGTCATAAAATAAAAAACCTTTCTTTCGTGAGCTTTGATATGGTGAGCAATGTCTTCCTCAATTGAGTGTTCGAAAAGAGAATGATATGCTTT
TCTAGCACCCAAAAGATCTTCAGAGGATCGAGTGCAAGCAGTCTCAATGAGAACATCATGTTGAGGTATTTTCAATAGCAACGCCTCTTTAAACAAACGC
GCATCTCTTTCCCATGGGTGCATTGTGTACAACACTACTGCATCCTACAATATTAAGTCAGACATTTTTTTTTTTCATTTTAAATGGACATTTTTTACAT
TTTACAACTTTTTTTTATACCTTGAGACGCAAAAATTCTTGACGAAGCTGAAGGATATGGTGATCACTCCATCTCTGGAATTGGCGTTCGTCTTCTTTGA
AAAATCCAGGAGTGCTTACTCTGTACGATTCCCTTTGATAGCGATTCCATCTCCCCAATGATGAAATGAACAAATTCTCATCCACACCAAGTCCTACAAA
TTTGAATTTTAAAAAAAATCGAATAAAAATATCAGTTTCCAATCATAATCAAATTATGTGAAATTAGGTCTTAGATGTAACTCACAAACCTGAGAAAGCT
TTAGTTACAGCTGCAAATTCATTAGCCTCTGACATTTTTTTTAATCTGTTTATGAGTTTTTTTGTGTAATAAAGAGAGAAGAAAGTTGAGAGTTGAGGTG
TGGGACTTGTGATTCAATTGCAACTCAATTTATACGAGTTATTAAGGGTATTTATGTCATTTAAACAACTACCACCATTGGTACATAAGTTTTGAATAAA
GGCGAAAAGACCAAAGTAACCCTCCGTATATAACGTAGCATTCATGTTCCTTTAATTAATAAAGTAATGAATTTAAAATTATTACGTGTCTATTAAATTG
TTGCTTGTAACGCCTTGCGTCATTAAATTAAACAAAAATAAAAGTCAAAAGTATTTAAGGACAATATTTTAATAAATTAAATCTCTATGAAATCTTCTTA
TTTAATGTTTATTAAATGATAATATGTTTTTAATGCTTTATTTAATGTACCATGAGCTTTGCACGTCCTAGTATAATATTAGTATATTTAATTAATCACG
ACATCTAGAATAGTTTAAACTGAAAAATACCTGATATTACTGGCGGTTTATTTCTAATCAAAGTAATTATCTTGGTTGGAATTTACTTAAGTTGTTATAA
CTGATTTAATAAAAATCGCTATTGATCAAGTTAATTATATCAGTTATATTATTATGGCATTAACTCAATGACTTCATGAAACACTTTTATGTCGTCCTTG
GAGTTTACAATTAGTAATTTATTTTTTGTTTTATTAAATTGAATCCTGATTAATTTGAATTCATGAAATTCATGAAATAAGAAAATATTTCTTACTAAAA
AAAATTAACTTGAACTTAGTTTAATTAAGAATAAAAAATAATATTCACTTTATGTTAAGTATCGATTGATAAGGTTTTTTACACCACTCATCCAAAAATA
AATAATAAAAAGAAACAAAAAAAAATTATGATGTAAAACAATAAATTTTAGATTTAATTTAATTTCGAATATAACTCATTAGGAAAAGATTATCCAAAAT
TATCGTTGAAGATCAATATTCATTCATTTTCATCTCATTATCTGGTGTGGGATTCTTCATAAACACACCACGTCATGTCCATGATGAAACATATAGCATA
TGGACAATTTAATATACGAGCGCACAACATTAATAAGTTATAATTGAGATGAGTTTTATTTAATACTATATAAAAATTCGATCTTAAATCTAATTTAATC
ACATAAATTAATTTATTAAAAGATGATTATTCAAAATCACGCTAAGATCATTCTTTTGTTTTTTCATTCGTACCCATGCAGGACTCCCATGCTAATAATT
GAGGCCTGAGTCTTAGTTCATTTTACGGAAAATATTATTATAATTTATATATCCATCGTACTTATTATCGTCCATACTAATTACTGGTATGTCATCTAGA
TAGTTATTTTTCCCAATGCCGATGATTTGAAAATGAAAACAACGTGCAACAAAACTTTAAATTAATTTGTTCACACCATGAGATAATATCATTTAAATTT
GTATATACTTTATTATTAAAAATAATAATTGACTTAAATGACAGTATGGCACCCAATGCTCTTCCCTAATACAAATATAAGAACATCAAGAATTGAAATT
ATAAAAATATAATTAATTATTTGTAATGAGCAAGTCAAGACTATCAATGTGAAGAGATATATCCAACATATTTTAAGTTCAAGCAAAAAGAACGTGTTGA
GCTAGATAATGTACTTTCCGTTGAGAAAATTTTAGAAATAGGGCCGGTATACAAATTGAACAAGTATATACAAATTCTGTATTTATATATTTAGGAACTT
TTTAGAACTTTGTTTATATATTTCGCTTGTCAATTACAAACAGAGTAATTTATTATGATTTTTTCATAAATCGTATACAAATAGCTCTTGTAAGCATGTA
CAAATTTCTGAATTTATAAAATAAGAAATCGAATTACACAAATTCTGAATTAAATTAAATAAGGCAAATCAGACAAATAATAGGAATTGGAAAAATTGAT
TTTTTAAGAAACTCGCTGCAAAAGCAGCAGTTTAAGTTATTTAAAAAAAATTGATTTTTTTTACTAAATCTTATTTTTTTTAACGACGGAATGGAGTTAA
TTTTTTGACGAAAAATATCATTACATTAATTGTAATTTTGTCCTTTTGATTAAATAAAAAATTAAATGTTATTTATGTGTTCTTTTAAGGAAAAAAGGCA
AGCTCCGAACTCACTTTTTTCGTTAATAAATCTTATAATAAAAACTAATAGAATATCCATTAACAAAATGGTTATAAAAAAGAAATAGGAGATCATTTAT
CTCTTTATCCCTCTAAGATACGTATAATTGTCTATGTAAAATAATTATTTACTTTATATACATTTTTCTTCTCTATAAAATTCAAATCATTCACATTATG
TGTTCATACAAAACGCAGTCCATTAATTTCTTCAACAGTAAATTTATTATCGTATAATATTATTTTGAAATATTGGGTGATAAACACATTCACAGTTTCA
CACAGGACTATGCAACTCGTATTCAAATCGATCGTCCGCGTTCCAAATAAAAAAACTCACTCGCACCAAGTGTTTACATTAAACTAATTCAATTTTCATT
ACTATGTAATTTAATGAAATAAAATATCAATTGATTAATTAAAGTTAAATAAAATAATTCAAACACATGGCATGCATATATTGGATTGATGTAAACATTT
GGTGCGGGTAAGTTTTACTCCATACAGATTTGTTACTAATTAAAAAAATGGAACTGATAAAAATGAGTCAAACAATAATAACTTTGACTAACATTTTACG
ATGTATTTTTTGTTCATATTGACATTCAAAAAATTGAAATTTATAGTACTTTTTGTATAGTTTTTGAATATCTAATTTTTTATTTAAAATATCAAATTAA
TGTAAACGAATTTAATTTTAAAAATTAGTCAAGACTTTTGAAAAGCGCATGACATGACAATAAAAAGGGACAGACGGGTATTTATTAAGAGAAGTATTGA
AAACATCTCTAAAACTCGGTATATTATATTTGTTTCATATTTTAATTATTGACAGCGTTAAATAAACTCATTTACTCGACAAACGGCACTTAAATTCAAC
CCAATCTTGCAACTTAAGTGAAATAACTCTTAAATTCTCGTCAAGTTTAGGAGCGTTTTAACACTTCTCTCGACTCTTTATTAAGAGCAATAGAGCATCA
TGTTCGTACAAGAATTTGAGACCACTTATTATTACATGTATATAAGCTTAATTAGTCAAGTAGAGAAGTGTTTTTAATGTTGTCAACAATTTAAAGACGT
CAAACTCAATATAATTAAGAATATTTTCATTACTTCTTTCTTTATACTTTAGTATTTGATTGGGCATTATTGGAGTTGGAATATAGGCGGAGTAGACAAA
AAACTATACGAAAGTCAACTTTCGATAAAAAAATATTTTAATCAATCAAACATTACAAAATTAAAAATATAATTATTAATACAAGACGCACCCTTCATTC
TTATACTTGATCGAATTGAAAAAAGAGCCACGCGTACAATGAGTTTGAAGAATGTGAATATTCAACGTTAGGGGTATTACGGTCTAAACAAAAGATAAGG
GCATTAAGGACAGCGAGGTAAAAAAAAAACTTTTTCTTTATTTTCATTTTTGCCCTTTTTGGGAGAGGAAAAAAAATAACTGAAAGTGTTGCAGAAACAG
AAAAGAAAAACTTGCAATTTCTGGTTAAGGTGAAGAAGAAGAAAAAATGGCTACACTGAGAATTCCAGATGTTGTACCTTCTCCAGCTGAAGACGCTGAA
ACTCTCATGAAATCCTTCAAAGGTATCTCCATTTTCTTCCTTGCTCTGTTTTTTCTCTCAGCGAATTCCCCTTAATTGGTTAGGGGCTTACTTCCTTTCG
TCAATTGAATCCAACAGTAATTATGTTTAATTTATGAATATGATTCGTGTCTGCTAATATTTTTCATCAACTTACTTTGCCATTGATTGATGCAATTATG
ATCTACAAATTGCAATTTGATAATTAACTGATAGACAGAGAGAGATTAGGTAATGGTTGTTTCATGCACAGAAAATACTGCTCCTTAAATCGTAATAGGC
TAATAGCAGTTTGTGAGAAAATAGAGAAAAAACTAAGCCAGGTTGGAGGTGAGTATTTGGAGATCATTAAGGGGAAGCTTGTAAATTGGGGGAAATATGA
CTTTTGAGTTTCACTGACCGGTTGCAATCCCATATCTGATGGAGTGTTTGCAATTTGTTCATTCTTTTTCTTAGGGCTGGGAACTAATGAGAAGTCGGTG
ATATCGGTGTTGGGACACAGAAATGCAAGCCAGAGGAAGAAAATCAGAGAAACCTATCAGCAACTTTACAACAGGTCCCTTGTTGATGACATTTTTTCTG
AATTGTCTGGTGATTTCAAGGTACAATTTCTTTTCTCACTTTTCTAGACATAATTATTTCATTCACTCCCGTAATTGACTCACAATTTGATAGTGTTAGC
TCACTAGAATGTTAAGTCATTACAGGCTAGATTCAGACTCGAAATAGCTAGAATCTAGCTAATTTTGCTATACATGTGTGACAGAAAGCAGTTGTCCTGT
GGACATACGAGCCTTCGGAAAGAGATGCACGGCTAGCAAATGAAGCCTTGAAATCAAAAAAGAAAACCATCACCCAATTGCAAGTGATAGTAGAGATAGC
TTGTGCATCATCTCCTGATCATCTGGTTGCAGTGAGACAAACATATCGTGGCCTTTTCAACTGTTCACTTGAAGAAGATATCGCAGCAAATGTCCCTATG
CCTGTTCAAAAGGTATGTATGAACACTTCTAGTCACATCTTACTAGCTTAAGGGTACTATCATGTTAACCGACCTCATTTGAATCTTCTAAAGACAACAT
AGATCTAGTCGGGTGCATCCCGAGTACTGAAGACATCTTACCTAGATGATGATTCATTATCAGTTTACATATCATGCTTTCTGATAATTGCTTGTGAAGT
TGAGCAGTGTCTCACTAACTTCTAGAAGTTATTGAAATGATGTGTTGTGTGGATGTCTACAGGTTCTCATTGGTTTAGTCAGGTCCTACAGATATGATAA
GGAACTGGTGGATCCTAGTATTGCTAATAAAGAATCTGCTATCCTTCGTGAAACCATAAGGACAAAACATTTGGATTCCGATAATTTTCTGTTGATACTC
AGCACAAGGAATGTTCATCAGCTTAGAGAAACTTTTGAGTGCTACAAGCAAAATTACGGATTCTCCATTGACCAGGTTACACTTCTTACAAGCTGCCTGC
ACAACCTGCTTAACAGTGCTACTTGCGCATTTTTCTCTTATTTTATTCTATCTACTTTTACGGTTCTTTTACAGGACATGAAGAGCTGTGGAAAAGGTCT
GCTGGAATCTATACTGAAGGTGGTTATCTGGTGCATTGATTCGCCTGAGAAACATTTTGCTGAGGTACTACTCACAGAAACAGATTCTTCTTTTTTATAT
TTTGTTTCAAGTATTTTCTGGTTTTTACACCCTTTTTGCTGTCAAAACTTCTGTCGCAAAATCACATATCCCTACCTTATTTTTATTATGTTAGTACAAG
CTCAGGCTCCTGTTGAATTCTACTTCCAAGAGATGAAATTCTCTCTAAAAGCTAGACCGTATATTTCAATTATGTATGTTAGTCCTATCAATTTGCTTAT
CGATGTTCGGTTTAGACTAGATTTAAATAGTCATCAGTAGCAATGCACCATAGATTCTGAAATTTCTTTATTTTTATTCTTATGCTGCTTCTATTACCTG
TATTAAACTGCCAAATAGGGTCATAACGTGTGCAACCTGAAACAAGCTCAGCAACCAGAGTTCTCTAGAACTGGTTCAGTTTAGGCCTTACTTTCAGGGT
TTACAGCATATCATGCCATTCTGCTCTAGTGTCTAATATTGTGATCCAGACTGTTTCATTTAAATAGTGTATTTTGGAATATTCAGGTTGTCAGAGCCTC
GATTCTTGGGTTTGGAACTGATGAGAATGCTCTAACTAGAGCCATTGTAACTCGGGCTGAAGTTGATATGATGAAAGTCAGGGGAGAGTACTTCATCGCG
AACAAGAGTAATCTTGATAGTGCAGTTATTGATGACACATCAGGTGATTACATGAAGTTCCTGATGACACTGCTTGGGGCCAAAGTCTAACTAGCTCTCT
GGATCTGAACATTGTGTTGTATGTAGTGTTCCAATTCTGTATTTTTACTTTGTATGCTATTATGAAACATTAATGTATGGACCTGTTGTGAAAAACCTAG
TTGTTGGACAGAGTGAAAATATATTTAATTTTGTTGTTTGTCACTTAGTTTTTGAGTAAATTGCATCTTCAACGTTCATGCATAACTTCCATACCAAGGC
TAGCACGGTTGATGATATCGGCCCAAGTGTTAATTACATGACACTGACTATCAACTACAGATTGGTTGAAATTGAAACCATTCAGGTTGAAAGCCATAGT
GCTGATACCTAAAGCGGTAAACCAGATATACCTACTACAGGCCAAGCAGCTCAGAAGAAGTGTAACCCTGAGCGGCTATGATATTATAAGTTTCTTCCTC
TGATCGAATCTGTAACCTTCATTAGCAGATTCATTCTGTGGTTTCCCTGATCGAACTAGAAGTTACCAAGGAACCATGCATAGCACTGAATAAGAAGCCA
CCTAATACCCCAGCTAACATGTGAAATGGGTGCATAAGCGAGATCAAGAAAACTGTGGTTAAAGACTATTCATTCAATTTCAAGATAAAGATGATATTAA
TCCAAAGTGCATTTTTAAGGATGAAAACAATGGTCATATGAAACTTATTCAATATTGTTTAAACAAAGTAAGAGATGATAAACAGAATTAAGTTTACCAC
AACAGATAATTTACAGCATGAATGGTTAAAACTAGAGTTGTTGAGGTCTCATAGTTGAGAACCCCTCCAAACATTGGCGTATGCGACTAATTGCAGCGCG
CACACGGTATTCTTTAGTAAAAGGCGAAAGAATAGTTCGCTTTGTGCTCACTGCGTGGCTGCGTGAGTTTTGCAGTGTCACCACGCTGCAGTTTTATATG
ACGACAACCTCGAATTTACTCGTTCTCTATCGATGTGGGACTCTCCTAGTCGCCTCACTTCTTATTTCTCTGTCAAATATTGCTCTCTTCTTCACCAGTC
ATTCAAATAGATCAATCAATTTAAGCTGCACTGTGCACTTTGTTGTTTGTTAAATTGAAGATTTGTTTCGCTTCAGTTTCTTGGTGGATTCGGATATATC
ACTGATCCTTTTGGTTACCACCAATATCCCCATTTATTTACTATTTAATTATATAATACGGATAGGAACTTCAATGATATATGGACATGGCAATGGGAAG
AGGGCTGGAGGCAGCAAATTTGTTAAGTGTAGTACAAATGTTCAAAATCTATAATAAAAAAAAAGTAATATTGCATGACTGTTAGAACTTATAAATGATT
GAAACTTGAGTTGTTGGAGCTTCAGAAAAGAGAACCCCACGATATGCAGTGCACACACGGTATTCTTTAGTAAAAGGCGAAAGAATAGTTCGCTATGTGT
TCACTGCGTGGCTGCGTGATTTTTTCAGACCGACTGTGCTGCATTTGTATATTGCGGCAACTTTTGAATTTACTCGTTGTTTATCGATGTGGTAACCTTC
AGATCGCCTCACTTCTTTCTTGGTGATTCTGAAGAATTATATGCTCACAAGGTGACTTGAATTTCCTATGCAGGTTTGGTTCTGAACTTTGCCCAAATTA
CTTACAACTACATCCAAATTAACTATTTATACATATTCAACAGATTTTACTTGGCTTAAATAAAAGTTACCTGGTTGTATAATATTGTAGTTCCGCCCTT
GACTTTAAGTTTGACCTAATAATGGCATTGAGTTGTGTGATGAAACACTACTTGTAAGTTATGGTATGGTACGTGCAGTTTCTAGTTGTTCAAATTACAT
CTTTGTATGGTAGCTTTAAACAGTGGCGGATCAAGATTTAAAGTTAATGGGTTCTGAACTAGCCAACCGAATCAGTATATATACTTATATACATCCAAAC
TCGTATCCAATATTGTAGCTCTGCCCTGACATCGAAACCTCTGAAATTAGTTATCGTCCCTACTGCCTAAGTTAGTATAAGTATTCCTTGCTTTGTTTGA
CCTCCACTTTAGCTGTGTTTCTGGCAATCAATTAACTAACTTTGTTGCTAAGACACAAGGGCAAGTACCCAAATTGTACCATTCAAATACGCAATGATAA
GTCAAAATCAAGAAGCTATAACTATGGTGTAGAAATAGCTCATTAGAAAAATGGATACACTTCACATAAAATGAGTGAAAGACTTGAAGGAAAAACAAAG
GGGGATATAAACTAGCATTTGAGAACATGGAACATTTGTTTGTAATCGGACCAATAAATTGGAGTATGGTTCAAAAATGTTAAAAGGCTAGAGTTGTTGG
GGTCTCAAAGTTGAAAACCCTCCAAAAATTGGCGTATGCCACTAATAGCAGAGCGCACACGGTATTCTTTAGTAAAAGGCGAAAGAATAGTTCGCTTTGT
GCTCACTGCGTAGCTGCGTGAGTTTTGTTGTGATAATGCGCTGCACGTGTATATGTCGGCAATGTTCGGATTTACTTCTTGTTCATCGATGTGGTATTCG
CTCCTCTCTTTTTTTAAAGGCATCAAATATTGTTGTTCACTCTGCTACTTCCTTTTCACTACAATATTTATATTATCGAAAATCGATTTCAATTTCTATG
CAGGTTTGGATTCTAAATTTCATTATCTATGATAGAATAGATGCTTGGATATAGCAATTGCAATGATAAATTGAATCAAGAAGCTGAAAACTGAAATCAT
ACATAAATTGAGCAAAAGAAGATCAAATGGAAACAAGCGTGTGAGAACATGGAACAACTTTGGATATGTCAAAATCTAGGCCAAATAATTACTCAGATTT
TGCAATTATAGTAAGCAAGAAATCCTTGTAGCTTCCATTAGCAACTTCTGCAATCTTTTCAGCCAAAGTAGTTCCATATTTGCTCTGAAATTCTTCTTTG
ATTTGCTGCATATCATCATCGTCTGCTCTTGACACTATGACTCGGGTAACTGAGTCTTTAGCAGATTCATCCACATCCAATCTTAGGGACGCGATCAAAA
TCTATGCAATAAGAGATTGAAAAAACAAATCAAATAGATAACCAAATTAGTTCAAACAAAAAAGGGAGAAATACAGTATGATGCATTATCTATCAGTTTT
GTGTTTGCTATTTACCTTGCTAAAGTATGCTTTAGGTATACAAAGGCATTGAACAACTTGTTTCAAGGTCAAGTCACACTCAAGATCCTGAAGAAAACAA
AAAAAGTTGAGACTATATTTTAAAAGTGTCGGTGCATAGAAATTAAACTCTCTTTTTTCTTACCTCGTCCAAGAAGTTGCCAGTGATTTCCTTGTAATGG
CTATAGATGGCCTTAAGATGGAGCTTGCTTCTTGTCGAAAGGATCCTCACAATCTCTTCATCCTCATCAATCAGCTTCTTCTTGTTGGCATTTTTTATTG
CATTTACAAAAATCTTAGCCTCAGATTTTGCAAGATCATCGTTTACTCGTGGACCTTCATAACGGTAGGAACTTACAAGAGCAACTAGAAGCTGTATGTC
ATTAAAAAAAATGGTAAATCACTAATCAAGAACTTTGAACAAATACCATTAATCGGTAACTTATAAGAATGATAACTCACGTGCAATCACAATTCACATA
TTAAATCCGTAAAATGACGGGTACCTTTCTTTCAGAACTTCGAACATGGAAGGCAATGTCTTCCTCAATTGAGTGTTCAAAAAGGGAATGGTAAGCTTTT
CTGGCTCCAAGAAGATCTTCAGAGGATCGAGTGCAAGCAATCTCAATGAGAACATCATGTTTAGGTACTTGCAATAATAATGCTTCCTTGAACAAACGAG
CATCTCTTTCCCATGGGTGCATTGTGTACAAAACCACTGCATCCTAAAATAATTTGGAGGGAAGAAACTTATAAGATCACAAATACTATATAGAGAGAGA
GAGCATTACCTTACTCCTCCCGACATTGGAAGGAAGGTAGAGAGGTTGTTTCCGATAATTAATATAAAAATGTATCTAAATACCTTAAGACGCAAAAACT
CTTGACGAAGCTGGAGGATATGTTGATCATCCCATCTCTGGAACTGTCGTTTGTCTTCTCTGAAGAATCCAGGAGTGCTTACCCTGTACGATTCCCTCTG
ATGCCGATTCCATTTCCCCAGTGTTGAGATGAATAAGTTCTCATCCACACCAAGTCCTACAAATTTTATCAATTTTCAGTTATAATTCAACTCCATGCCT
CACTGGATGCCTTAACAACTGTTACACCGGTAAATACTTACTTGCATCTTAGACTAAACATTTTAACATTAGCAATTAAGCAAAAATACGAATTAGCTAA
CTATGTTTGAGAGATAAATTAGCTTACATTCATTGATTTGATCTATAACTTCAAGATATTACCTGGCGTGTGCAACACGATTAAATTATAGGGCAAAATC
CGAATACTCAAAAATCTAAATTCCACGTACAGTCAAATCAAACAAATTGAAACAGTGAATAGTCACTATAAAGGGCAATTTCCATTATCAGACACAAAAA
AAGCACATGAAATCACAAATTATACAGATCGGCAGAATCAGATGTAGAACACAACTTCTCAAAGCAAGTGAAGATCCAGTGAGAGTTTAGTAGTAAAAAC
TTGAAGAAAATCCAACTTTTAACTCTAATAAACATTTTCAAAAAATCAGTTATAGAAGGAAGAAATGGAAAAGAACCTGAGAAAGCTTTGGTAAGAGCTG
CATACGAATTAGCCTCTGCCATTTTTCTTTTCTGTTAATTTTCTTTGTTTTTGAGTTTTTGTCTCTTTGTGTGCCTGTGAGAGAGAGGAGAGCTGATAGA
TGATGCTGTGATTCAATTCCAACCACATTTATATGGGTTATTAGGGGTACTTCTGTCATTTAATTATTACCGGCCGGTTAGCAAACCAATAAATGACCAA
AGTAGCCTTCATTGTAAATTAATTCTTGTACTTTCCCGTTCATCAAAGTACAGAGTGTAACGCCTTAACCAATTTTATTTTTTTTAAAGAAATGTCGTTA
ATTATTTTAATTAAAGTCTAATCTTTAATATTATTTCTTATTAATTAATGTTTTAATAAATATTCGGCTATCTGTTTTTTATGCTTTTATCATCTGCCTT
TGGATATTTCCATGTTAGCAATTGGTTCTTTCCTTTTTAATTGAGTTTTTTCGTAGATTCAACGATGATAAGTTTTGATAAAATATGCTTGCATTTTACG
CTGTATATATATCATCTTTTTAAAATAAATTAATTATTGGAATTTAAATAAGTGATGTACAACTTAATTTTAAAAGGATTTGCTATTGCGTTATCAACTT
TATTTTGTTATTGCGGAGTTTAAAATATATGTATTTTCAAAATTTTGCTTTATATAAATTGTGTAATTTTTACCGAGAAAGAGTTCAAATGAACCCACTT
AGCTACTAATACGTGTCAAATGTTAAAATCCATGTTATTAAATTTTCATATGATAAATTTTACTTCTACCATCGCTCAATAACTTATATGTACTAAAATC
TATTTTAGTAGTTGTACTTATTGAAAGCAACTTATTCAAAATAATAATAAATAGTAACGTTATTTTAAAAAATTAAAATATAATTAATTGTTTCTTTTTT
ACTTTTATCTTTACTTCATAAAATGATAAGAAACTAACATGATAAAAAAAAATATATATTATAACAAAAAGAGTAAATAAAGATGAATTAGTCAAATTAT
TCTCTTATTCAAAATTCTTTTCTAAATCCTAAAAAAAAATATGACAATTAAAATAAAATGGAAAATACTTACTATAGTTAATGACAATAAAGGGACAACA
TAGAAGACTAGCTAGAAATTGATGTAGAACATCCAAAATCTGTGTTTCTCCGTAGAAAAACACGTTTTCATCGTATTGAAGATAGGTAAAAGGACCTTGT
TGGCGGTGTAATAATAAAATTATTTCACTCGTTATTAATAGATTATGTGTTCAAATTTTGAGTATAAATTTTTTTTATAAAAAATGTCTTTGAATGAGCT
TTATAGAGCGAGATTCAAATTTAGTTAAGATTTTAACTTGATAATTAGGGAAGAAAAAAGACTAAAAAGGTTGCTCGAATTTGAATAAAAATATATATCA
AAAATGAGATTACTTTTATGTTTGATTTAGATATTTATTAGTTTTAAAGTATTTTATTTATTATATATATAATATAAAGATAGGATAAATAATTTTATCC
GTAGTTATCTCATCTGGCATATACCAAAAGATTCTAAAGTTGAAAATTTTCTAACTATTATACCCCACCCTCTACGAGAGAAAAACAATGTTCCCTCCAT
CTTACAATTTACATTACTTATCCACTTATATTTTATTTTAAACATTTCTAAAGAAATTATATATAAATAAGAAAATTATTTTAACTAAGTTATCATTTGT
TTTTTTTCAATACACTTTATATATAGCCCTATTCATCAATTCTAAATTGAACAACGAAGAATATTTTTGAAATTTTATAATAATTTTAATAGAAAATAAT
GTTTTTAATTAATTTTTTCTATAAATGAATAGTAATTCTAAAAAAAATATTTTTAACGGCATCAACAAGTAATATAAAAGGTGAGAAGTGTTAAAAAAAA
TACTACTGTACTTTTTTTTTTAAAAAAAAAAAGGTTGTTGCACGAGAATCACAAGGTTCTTCGTACAGTCTTTCTTGCTTTTATTTATCGCGATTATAAT
TATTCTTGTCCATATTATGTCAATTATTATCAAGACAGCCATGCACGGGCAGGTTGCTTTTCCCTATGTCATCTCAAATATTATAAACTATTTAAATATT
AAAAATAAATACTAATATTTAACAATAAAAATAAAATAAATATAAAATAATTTATTTTATTTTATTCCTTAAAACTTAACAAATAAAAATTAATATCTAG
CGTGAATAAGTAAAGTGAGGAAATAAATAGTACTGTCAAATATGAACATGAAGACTTGACTTTATAAAGATAGGAAAATCGCATTAAATTACAACAATAA
AAGAGAGTATTAAAAAATGAGACAGGTGTGGAATTATTAATTGTGTTGATATATGGCAATAATGGCATGTGTGAAAGAGATATGTGCAACAACTAAGCCA
TCTCTCTCTCTCTTTTTTTTTTTTTTAATTGTTTAAGCTATCTTTTTATTTCCACGTATCTTATTTATTTTAAGTAAAATACCAAAAAGGCAAAAAGAAA
GAAAGAAAAATATTCATATACTGAATTAAACTATATTTCCATGAGGAAAAAATGGTACGAACAACAATTAAGATTTTTTTTCGTCGAGTTCAACTTAAAA
TTGAAAGTGAGGTGTAATTATCATCTGAACAACTTTTTCTAATTAAATAATACAAATAATTAAAAGTTGAAATAAATGTGAAAGGAACTTGAACGATATA
GCATGAAAATGACTCATCATGATAAATAAGTATAACCCTCCGAGCTACAATTTATGTAGTACAATAAATTATTTTGCTTATTTCATTATCTTCAAGTGTA
TAGTTCAAACCTTCAACTCATTCACACTATTCTTTTTTTTTTCCCCTTGATCATATGTTATATCGTAATTATTTGTCACTAGTTCAGATTTGTCGTGGCA
TATTAATTACATTTTAAAATAAAACTAATATTCCTATAATTTTTTTTAAAGAAAATTAAACGTTTATAATAAAAAACAAAAAAATCTCAATCGTCTCCGC
CATCGCATGTGATAAATGGTACGTTGATGTAGTCGTCTTACCTGCAGGGTACTTGATCAAAACAGAAAGGTCTAAAAATATCTTCATCAATCTATTTAAT
TGGATTTAGCATTTATCAGTACCCTCTGTCAAATTATTGGTCCAACAACGTTCCTATAATTATTTCTTGGTTCACATTTGTCCTTAGGTTCTCACATCAC
CAAAAATAATACAAATGATAGACATGACATTGAAGTCAAGCATAATTACTAGTTTCATATTCGAACTATTGACAGTCTTATTTTGCTTGACTATTGAAGT
TAAATATACATCCTTAATATCTTGCAATATATATTAGTGGAATTTTTCAAAAATTCTCATCAAGTTTCGAGATGTTATCAAGATTCTTTTTTTTTATTTT
TATTAAGAACTATATGCTTCTAAATATAAGAGTTTAAAATCACTTGTTATGTCATGTTGCATATCAGGAGTGTATCGAGGATGTATCTAAATTTAGTTAA
TCTAGTAAAAAAATATTTTTACGACTATCAATAATTTAAAATTAAAACTAAAAATGACATCAAATTTAAAAATATTTTTAATACTTCTTACTAAAAATAA
TATTCTTATAATCTTTAAATTTCAGATTCACACTGTATGGTCTGAATTGAATATGTCAAAGCCATTTCGTTAAATGGGACACGTAAGAGATAAAACAATT
ATTGTTATATAGTACTCTCTTAATTTTCTTTGTTCCTCTTGAGCATATGAAACACATGGGTGACAAAAAGTTCCTTCATATTTTACGTCTTATTAATTGT
GCATCTTTTACTGGTGACTGATGAGATGGAACCATCAATGTAATTATTTATACATCCTCCTGCTTATGAAAGTAGCAGGAAAGAGACAAGATCTATAAGT
TCCCAATGTGATTTCCAATTTAATATCCCTCGTTATATTTGGTTCTTTAAAAAATGCAATATAAAATTATAATATGAAAGTAGATTATATTAAGTTAAAG
TTCAATAAGATACTCAATTTGAATATCTTATGTAAATTTCACTAAGTTATTTCTCAAATCTTATTAAATGATCTTAAACAGATTTATTAATCTTTAAGGC
ATCTTTGTGTTTTTTTTATAAATAAATATTTGTGATATAAAGATTTTCTAATCAACAATAATATTAATAATTAGTTATTCTATAATATAATCATTTCACG
TAATACAAACAATCTCTTCGCATCAAACATTAGTCTTTCTTTTGTAAAATTAAAATAATGTATATTTTATTTTTTATAAAGTATAAACTTTAGAGTTAAG
TTTTACATTTAAAAATAAATAAATTACGATTTAAAATCTCATATCATGCTTTTTAGAAAAAAATGAAATTTAAAAAAATAGGATTATTTTTTCTATATAT
ATTTTTTGGCTTCTTTTTCCTTTTTATCTTCTTTTACTTTCTTAGATTCCTGATCACTTTATTTCTCATAATTTTCCCCTATTATTTGAATTTGTTTAGC
CTAAACCCATCTTAGACTATTTACTTGTCCAAATGTGAAATGGACAATACTAAACATAAATTTGATATAAATAAAGCAATCGTCTAATATCATTATGTAA
GAAGATATTTCTTATGAGCAAATCAAAGGGTAGTTGTTGAACCCCTAAATAATTTAATTAAATTATTATTACATAATTGACTTTACATTTTTAAATATAT
TATCTTTGATCATTTTAAATACTTTTATTTGATATCTTTATAAATATAGTTGTTAGTCACGGTCCACGTGTGAAATCCCAATAATTTAATACGTTATTAT
TGCGATTATGACTAAGCTCTTTAAATTATCCATGTGAGTAACTTAAATGTGTCATGTTCTAGACATTTCATCGAAGGGGGACTGCTTTTCTAATAATTCA
AGAAAAAAAATTATTTCTTATTTCATTTCAGATATTGTTATACTATGTAAACAATTAAAAAAATATCAAAAGTAAATTTCTTTTTGCCAACGTGTTTCTC
TCTATATTTTTTAATTGAAAAAAATTTGAAACTCGATTTTTTTAGCTGAAAGGAAGACGACGCACAGCCGATAATACCTAGGCTAATTGGAATTAAAATA
TATTAACAAGAAGATATATCTATAAAAATAAGACTACATTGGTTTTAACAATTTTGAAATGTAATCCTATAAAATGGAGTATCATGTTTTGGATTTTTAA
AAAGGCCAAATATGTGAAGCCTAAAAGGAAAAAAAAAACAGAAATAAATATTGGACGGCCTAGGACCAAGGTGTGTTTAACGATTTAGAAAACAAATTAT
TCATGTAAAATATAAATATAAGAATTAATTATATTTATGATCAAATATTTAACTATTAATTTATAAAGGAGTTTTTCGATGACACTCTAAAATTAACATC
CAAAAAAAAAGGACCACGTGCATGTATGATAAGGAAAAATAATGAGGGAGAGGAGTTTGAAGGAAGTGAAATTCAGTGTTGGGGGCATTAGAGTCCAAAA
AAAGATAAGGGCAATATGGGTAGTGTGATTTTAAAAAAGTTGAGGGGTAATCTTTGAGCTACATGTCTTTTACTTTATTTTCCTTTTTGCCCTCATTCTC
TTTCACGGAGGTGAGAGGGAAAAATAACTGAAAGTGTTAAAAAGAGAAACAGAGCAAAAACTTACAATTTCTGGGGTGAAGAAAATGGCTACACTGAGAA
TTCCAGATGTTGTTCCTTCTCCAGATGAAGACTCTGAAACTCTTGTGAAATCCTTCAAAGGTCTCTCTACTTTTCTCTTCCTTTCTCAGTTTCACTTTCC
CCTTTTCATATGTCATATATATATATATGCATGCTGTGTGTGTTCAAGTAAGCTTCAATTTTCAACCTAATTTTTCATTCCAAATCCAAATTATCTACCC
AACAAGTTGTTGAAACATTTTTGTTGTGTTTGTTGGAGCTGGGTTAACAATGGCAGAGACAAAATTTTCATCGAGAGATTCATCATTTAATATAAATATA
GCAAATCTGAGCTGCTGATAGCAATTTGGTTCTGTACGGGTTGATCCATGTGCATATTAAAAAAAGTGTTTTTAATATGTCTTATTGTTGTTCGTTGTTA
TAAAGACGGGATTAGTTTTGTGGTTGTGTGTAGGACTGGGAACTAATGAGAAGTCAGTGATATCGGTGTTGGGACACAGAAATGCAAGCCAGAGGAAGAA
GATCAGAGAAACCTATCAGCAACTTTACAACAAGTCCCTTATAGATGACATTAATTCTGAATTGTCTGGTGATTTCAGGGTACAATCCGTTTTCTTGCTT
TTCCTAGACCTAATTATTTTGTTCTCTTCCGTGATCGACTCACAGTTTGATTGCATTAGCTCATTAGAAGTTATTCCATAAAGGCCGTTTCTCGTATTTA
ACTTTGCTTTTCTTTGGATTCTCGTTTCTAGGAGTATTATTTTGAGGTTAAATCAGGAGGTTTGTGAATATTTGACGTATGTTTTTGTTACTCCAAAAAT
GGAATAGTTCTTACTGTTATTTTACAATTTGAAAGAAGATTCATTTGGCTCAAGAAAGATCTTAACTATTGATCGTAGGCCTTAAATCTTGTGCTAGTCA
AAATAACGACATTGTGACATTTGATTAACTTTTTAAATAGCACGCCTGCTTACTAGAACTCATTGTCCATTAAGATAATAATTGCTCTGTTCATGTTTCC
TTGATAATATTTAGTATTGATGATTGTCCTTGCTTCTCCGTCTCCTTTAATCATTTCTAGTGGGTGAATCATAAGTAGAGGAGTAATCTATGCCTCAGAC
AGATTCACTCCGGAATAATTTTTCAGTTGAGATCTTCATATAGTTACTATTGACCAAACTCCGAGCTCAACTTAAAATTGAGTGTGTCATATTTTTAACC
ACTTGATCTTGTAGCTGGTGAATGTGACACTTGTATCAATAACTATATTTTTGACTTCCTCCTCTTGCTATACCTATAATGCGTTTGATAATGGTAATAC
TAATGAAGCTTCAATAATCAACTAAATCCAAGCAAGGGGTGTATGTGCTGGGTAGGGCGGCATTAGCTTTGAGGTAGATTAGTTTTCCTTGTTTGATGAA
CCTCTAGCTGGGAAGGGTCGAAGGGGTGGTTGAACACTCCTATTTCTTGGACCCCAAAGGAAGATTCTAGCCCTGTTACGGCGAACAGTTTCTCTAAATG
TTGGTGTAAATTTCCGCGAGTTATAGCTTATCCCTTGTTATGTTTCTATAATACCAATCAGATTACTATATCTGCAGCAGAATGCAATTTCAGTCTCCAT
ATGAACATGGTTAATCCCCAAGACTTCAAGTGCTAATTTTAGCTTTTCATGCGTGACAGAAAGCAGTCATCCTATGGACATATGAGCCTTCTGAAAGAGA
TGCACGGCTAGCAAATGAAGCCTTAAAGTCGAGAAAGAAAACCATCACCCAGTTGCAAGTGATAGTAGAGATAGCTTGTGCATCATCTCCTGATCATCTG
GTCGCGGTGAGACAAGCATATTGTGGCCTTTTCAACCGTTCACTTGAAGAAGATATCACAGCAAATGTCCCAATGCCTATACAAAAGGTACATATGATCA
CTTGTAGTCAGATCTACTAGCTGAAGTATACAATATTCTTAACCAATTTCCTATGTATTAGCAGTTAAATAGTACTCTTTCTGATGATTGTTTTGCTATG
TTGAGTTGCATTATACTGACTTCTGTGAAATGACGTGTTGTCTGGATGTTGCCAGATTCTTATTGGTCTAGTCAGGTCCTATCGATATGATAGAGAATTG
GTGGATCCTAGTACTGCAAATGAAGAAGCTGCTATCCTTCGTGAAGCCATACGGACAAAACAGTTGGATCATGACAATTTTCTTTTCATACTCAGCACAA
GGAATGGTTATCAGCTTAGAGCAACTTTTGAGTGCTACAAGCAAAATTATGGATTCTCCATTGACCAGGTTACATTTCTCGCTAGCTGCCTATGTAGCCT
TCCTTTCATAGAGCTTCTTGTTCATGTCGTCTCTTTTAAGTGCTTTTCATTTCATCTATTTTAATTATTCATTTACAGGACATTAAGAGCTGTGGAAAAG
GTCTGTTGGAATCTATCCTGAAGGTGGTTATCTGGTGTATCGAATCGCCAGAGAAACATTTTGCTGAGGTAATTAAATACGTAACAGCATTTGATATATA
GCATCTGGTAATTCGGTTTTACAGATCAATGTCAGTATTGTACCTTGTTTAAAATATAATCTTGTATGCTGGAATTGGTCAGGTTGTCAGAGCCTCGATT
GTCGGATTTGGAACTGATGAGGATTCTCTAACGAGAGCCATTGTAACTCGAGCTGAAGTTGATATGATGAAAGTAAGGGGAGAGTATATCATCGCGAACA
AAACTAGTCTTGATCATGCAGTTATTGACGACACATCAGGTGATTACAGGAAATTCCTCATGACACTGCTTGGTGCTAAAGTGTAGACCTGATCATTATA
TTGTTGTGTTTCAATACTATGCTACTACTTTGTATGATTTATTCGAGAATGCATTATTGGGGTGGTTTTGCAGTGAAATATTTAATAATTGGAGAGTGAA
TTTGTATATAAGTTTGTGGTTTGTCACTTGTTTGCGAGTTAATAGCAGCTTTTATTTTCTGAAGAAATGGAACATTGCTGGGGATTTTTATAGCCAAAAG
GAAGAAAAAAAGAAACAAGTTCAATAAGCTTGACTCTCTTGGGCAAAGAGAAAGTTATAGAAATAAGAGATTTCCCACCAACCCAGCAAAGAGTGGCCCA
AAAACAAATTTCTGTTTTTTTTAAAAATGAAATGATCACAATAAAAAGTGCAGAATCGTAAAGTAGGCATGGATTTCATCAACACTTTATTTTTTTATTC
TCACCCCTACCTCTCTATTTCACTCCTCTTTGGCACCCGACTGGATTTTGGACCGAATAATTTCACATTAGAATAAAATGTTTCCTAACAAAGATAATTT
CGTACAAAAGAAATTCGAATTCGAAACCTCTTGGTTAAGGATAAAAGAGTATTACTACTCTAACCACAATCCTTGTTGGTAATAAGTTAAAGACTCCGAT
CTGATTTGAATTAACTTTTGATTTTTGAGACTTTTGCCTTATTTTAAATATTTTTTACTAAACTAAACGCGTATAAGTACTTTTAAAATTTATCCAAATA
TTTTAAAAATATTTAAAAGTTATTTTGATCTAGAAACACTTAAAATAAGTTAATTTAAACAGATTCTTTAAGACCATGGTGTTGGTCCTAGAACTTTGAC
TTTAGTGAAATTTTATAACACAATCACAATCGTGCACCTTAAAATTTAAATCTTTTCACTTCATGTATTACAATTTTTTTTGTCATTCTCCACGTTTTCC
CCCCAAAGATCAATTATATTTTGATCGAATATAAACTTTACATACTTCAATAAAACATTAATATTTTGAAAACAATCTTCTACCAACTTTATAATTTATT
TCATTTGATTTTGAATGACAAGGTGAACTAAGTTTAGATTATTCTGCACAAAATATCCCGATTATTATAACAATTCGTTTAATTTAGAATAATTCTATTA
TTAGACCAACCATTAAAATTAATTGGAGAGAAGAAAATGAAATAAATGGAAAGTTTTAGTCAAATATGAAATGTGTGAGTTGATTAGATAATTAAATAGG
ATTCACGGATAAAGAAAGCCTCATAATTGACCAGAGGAAAAAAGTTAGGGCCTGGGCCCACATTTCTAAACCCGACAAACGCTCCAAGTAATTTATGGCC
CACCCGTACACCCCCCCTACCCACTTTCAGGCCCATCTACTTAGATTGGTAAAACAAGTGGTCCCCACATATAACCCTAAAATAGTTTGACCATTATTTT
ATACAAATTTCAACACTAGTACATGATAAGATTTGGAATCCAAATAATTTATTATTGTCATTTAAAAAATAATTTTTTTAAAGGTATAAAATACAGAAAA
TGACATTTTTACTATATGTATAGCTAGTGAAAAATAGAGTTGTAGCTGATGACAGATAATATTATACATCTGATTAATTATTTTCTCATTTTATTTGTTT
TCATTTAGAGGTTTTTAATTTTTAAAATACAATTAATCATCTTTTCTCCTATCCCGTAAATGTGCAACTTTTTAACTTATTATGTCGTAAGAATTATTTA
TCTAATGAAATATACTTTATAAATTAAACGTTGATGAGAGTCAACAATATAAAGTAAATATTTTCATTTGATAATTATAATATGTATTAATAAAATAATG
TATAATGATGATCAAAAGCAATTAATCAACAACGAAAATATTTTGATTATAAAAAAGGTTATTATATTCAAGTTTGTAAAACCAAAATTTGATTTGCTAA
ATATGTCAAAAAAAGATTATGCTAAATCATAATAATTATTTAACTTTTTTTTTTTTGGAGTGGGGTTGAGGTATTGAGGCAGGTGGGGTTGTCTCCAAAG
AGTTTGTCTAACTTCTTACTCTCATCATTTTCATTACATTAAGATCCCCAAACTAATAAATTAAAATTAATTAATCTACTTTTAAATTGTTAATCTCCTT
TCTCTCTCTATATTTGTCGCCTTCTGCTCCCTCCTTTGTCACCATTCTCACCATTTTTTTTAAAAAAAATCGATTCAATATACTTATAAATTTAAAGTGA
TATAGTATTCACATTGTACAGTCTGTATATATTGATCAATCGATATTGGACGTGGTCTGCCTGTATCGTTCATGGCCTGCTCACATCGGTCAATTGACGT
CGGAAGTGGCCTGCCTGCATTATCCAAAGGTCAGCTGACGTCGGACGTGACATGTCAACATCGTTTGTGACTTACAAACAACAAAATTAACCGACATTAA
AGTATTAATTTTATCTCTAATTTACTGATAGTTTTGAAAATTCATTTATTAGATTAACTAAATTTAGATGTATTTATAATCAGTCAATAACAAGTGATTT
TAAACTCGAATAGAAACATGAGATCTTAATAAAAAGTCGATAGAAGTATTAAAAACACTTTTAAATTTGACAATAATTTATGGATATATATTTTATTTAT
ATTATAAGAACTAGAATGTATTTATAATCAACAATTAAAAAATACTTTTTAAAATTGTCAATAATATGAAGATAATAAATAATATAGCTATTTTACCATA
TTGTTCGATGCTTAATATTAAGTACGAAGACTTATTTTAAATATTAAGTAGGAGTACTATTTTTTTTTTTTAAAAAACTTATTTAACTGCTCCTATAGTA
CAAATCAATAAATAGTAGTGTAAGAGTAATTATTAAATAAATATTTTCCCCATTATTCTTTTCTTTCTCTCTCTTGTAACAAAAAAACAAAAAAAAAACA
CTATGGAAGAAGAGCAAGAACACTCACTTCTTCCTCCTCATCTTCTTCTTCTTCTTCTGCCTCTACTGCTCTTCTGACCAAAGGCTACGGACGACGTCGT
TTTCACATCTCGTTTGCCCTATGTATTCTTCAATGTAGCTCGTGATCCATCAAAGCTTCACGTTTCTGGTTCATCTTTTTCAGCTTTTTCTTTTTCACTT
TTTTTCCCCTTTTCTTGTTTTCAACTTAAATTCAACTGAATCTGTACAATTTTCATGACTGTAACCTATTTCTTCCTTCACTAGCTTCAATGCTGGTAAA
TGGGAACTTGAAATTTGCTCAATTTTTAGGTTATTTTAGTGAGTTGCCCATTCTGAATCTGCTTTTAGTTTTTTGCTGTTTTTGGGTGTTTGGGGTTTTC
TTGTTTTTTTTTCTGAGTCTCTGATCTTGTTAAATTTCGAATGCAGTGGTGATAATTGAATGCTGATGTGTTAACTGCAAGGGTTTTGGTACTTTCTTGG
TTTTCTTGAATGTCAAACTGTGCAAGGGTTTTGGTTCTTTCTTGAATGTCTAGTCTTGCAGGGGTTTTGGTACTTTCTTGGTTTTCTTGAATGTGTAATT
GCTAAAGTGTTGTATATTGTACTGAATACCAACTGAGATTTGGGCGTTTGATTTGTTTTTTGAGATGGTAGTCTTGATTGGTTGTATTCCTTGTATTTTA
AGAGAGAAAAATGTACCTCATTCATCAGATTACTGTTTATGTTCACAATATTGTCTAAACTCTAACTGGGGTTTTGTAGTTTCTGGTTTCTTGGGGTGTA
TCTTCAAATTCTTGGAAGGGGGAAGACTTGATTGAGTCTTGGGTTCTTGCTTTCTTGGTTTGCAACTTTTCTTCCTCTTTAAATATAAGAAAGTGCAACT
TATTGTTGCATTAGTTTTTGTAATTAACTCGGTACCACGGAAATAACGGCCTGACTTTTCTTATTACAAAAAAAAGCTTGCATTTGTTTTACTTTAATTG
GTGCAGTGTCATGGAAAATTGCAGTTGTATCCTGATATTATACCTTGTTATGAAGATTTTCAGTAATTTGACATGATCTCTAAGTTCTGGAAATCACAGT
ATAATTCCTCGAAATCTCTTTTCTGAATGCTTTGCATATGGGATAATGTGTACCTATATCTGAAGTAATAGCTTTTTGGCAAATGTAGGACTAATTATAA
TTAGTTGAGTCCCTCTTATTTTTTGTTTTGCATTATTTTGTCTAAACTAGTAGCCTTTTAGTAGTTTATTAATGTATCTATTTGTTTTTCCTTTAGCAAC
GGGATTGGTGCAAGTTGAAGTTTGAACTTTGAAAAGAAAGTCAGTTACGGGCTCAATGGAGCAGTATGAAATATTGGAGCAAATTGGCAAAGGGGCTTTT
GGCTCTGCGGTTCTTGTGAAGCATA