BAC Sequence – LE_HBa0197N20

>C06HBa0197N20.1
CGAATGGAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTTAACCAATAGGCCGAAATCGGCAAAATC
CCTTATAAATCAAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAAT
ACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACT
CGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCA
AAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTG
CGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATA
TTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAAT
GCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAA
CAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCC
ATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGAAATTATACC
GTCTTACACAAGCATATCTAGTATATAACTTTTTCTTTTTTTTTTTATCAATAGAGAGGTATATGTCAATGAATTACTTGATATTATCCTTTTTTTTGAA
TTTTTTTACAGTATATAAACAGATCAATGGTTTTTAACTTTGTATAAATATATATATTAAATTTTAATTTTTTTTGTGAAATTTCTAGTATCAAATCACA
CCATAGCCCTCACCTTTGAAAACGAACGGATAATATGTTGATTATCTGAACTTTTTTACATTATTAATAAGATAAAAGATTCGATTTCACCTTTGTATCC
TCTTGCTCATTTTCCCTTCTCCTAGCTTACTTTTTTTTTTTTAGGATAAGGGTTTGAAAAATATCTTAATTTTGATCGAATTTGCTGTTGCAATACTATC
ATCTATTACCTTCTTGAACTATTCAATAGTGTATTTCAAATATATATATTTGCTCATGTGGAAATAAATAATAATGTAAAATTATGAATAGTAATGTGTC
CGCGTGAGACATATATATACCTTTAAAATATTCAGTGGTAAAAATATGTTTAAAATACAATATTAAATAGTCCAGGGAGGTAATACGTCCTTATAAAAGT
GTAATATCACAACAACAAATTAGACCAAAGACTGTTATCCCTTTTCTTTTTGATTTTCTATTCTTTGTATTCGATATTTATATTGGAGTCTAACTATGTT
AGGATTCTCACTCTGTATCCATATTGGAGTTTAATTAAATTTGGATTCACGCCGAGTAGTTTTATATTAGAAGTAAATCACTCTCTAACAAAGATAATTT
CATATTAGTTTTATATTAGAAGTAAATCACTCTCTAACAAAGACAATTTCATATTCAAAAAGACTCAAACGAAAAACTTTAATTAAGAATGAAAGAGTAC
TTACTATTCCACGCGAGAGAGGATGCTGGTTCTCTTGACCCCAGTTGACAATTTGACAGTTATATAAAGGTCATAGTCTTGCTCATTTTTCAGCAGCAAA
GTTTATTTTTCCCCCAATACTTTTACAGAGAAGAAATAGAGCAAACAACATAACTCAGAGAGATGGGGAATTGCCAAGCAATTGATAATGCAGCTTTGCT
ATTGCAGCATCCAAATGGCAAAGTTGAAAAGCTCTATTCATCAGTCACTGCTCACCAAATCATGAAAATCAATTCCGGTCATTATGTTTCTCTTCTTCTC
ACCACCACCACCACCGCCACCAACAATAAAACGCCGGTACGAGTTAGGCGAATAAAGCTTCTCAAACCTAATGATTCACTTGTTCTTGGTCAGATTTACA
GACTAGTTACTGCTCAAGGTTTGTTACTTCTCGAAAAAATCTTAGTAGCTCTGTTGATTTGATTGATCGACTAAATGATTTAATTATAATCCCTTTGTTT
ATGCAGAGGTAATGAAAGGATTGTGTGCGAAGAAGTATGCGAAGCTGAAGCAGTTAGAATATTCATGTGAAAAATTGACACAAAAATCAAATTGGAATCC
TGGATCTGTTCTGGAGAATTCTAAACAGGTGAATTTTTTAATCTTTCATTTTAATTCTAAAAATTTAAAAAAATTGTTGGTTAGTTTAATTTTTTTTTAA
TTTTGTTATAAATTTAGGAAGTGATTTTTTTTCTTTCTTCAGGTTAAACAGGAAAAACATAGAAACTCAACAGGTGCAAGATGCAGAGCATGGCATCCTT
CATTACAGAGCATATCAGAAGCTGCTTGCTGATTTGGGATGATTCTATTATTTCATTAATTAAACCAATTCTCGATCAGTTTCACGAGATATCCTTCGCG
TCTTTTTTTTTTATCACATGTATAGCAAAAGAGAAAAGAAAAAAAAAAGGGAAGAGATTTCTCACATTTTAATTTTTGAATCATTTGTTCAATTGGAATT
ATTGTAGCATGTAGGCTTTGTGGTATGCACCAAAGTTTGTGTACTTGAAGTACTACTATGAATTTGATAAATCTAATGGACTTTAGAACATTTATTTGAG
TAACAATTCTCCACCATAATTTTGAGTTTGTTGTTGGATGCATTATCGATTCGCGTGAACGTAATAATTTTTTTCTCAATTCTATAGGTGTTAAAAGAGA
AATCTATTAATTATTATTGTAATATTAATTTGAGATTTAGAATTCATAAAATTAAAATGTTGGCATCATTCCGTCAAGGCAGCAAAAATGTGAAAGACAA
TGTAGAGAAATCGGAGGCTCTAGCGTATTAATGATCTAAAATAAAAATCAAATTTCTTTTAGTTTTCAATTGATAATATAATCATTTTTATTTTAAATTA
TTTTTCATAAGATATAGAATTTCAAATATGTTAAATTTCTTTTAATAATTCCTTCATTTTTCATGAATTTTTTTTACTTTTTCTACAAATAGTATTCAAT
ATTTATTAAAAAATAATAACTTATAACTAATTATTATTAAAAATGAGAACCCTTAAATTTGAAGGCCTAAAAACATACATATTTTTCTAACATTGTCGAG
CACCCATATATAAAGAGAAAGAGACTAAACCTAATAGCAACTGATCAAAAGAAAGAATAATTTGAGAGTAGGTGAAAGAATACAACAAATTAAAGGCTAA
AAGAGGACAAGAAGAAGTTAGTCGAATATGATAAATATCCCTCGCTTCTAATTTAAAAGTTATAAGTGCGAGTCACTAAAAAAATAAAAAGCTAAAAAGG
AACTTCAAAAGGGAACAAACAGATACCAATTGGAGGCAAAAAGAATCATATGCATGCGTGCATTACTGTCTGAATAAGATATATTTCTAAGAATTTCATA
AAATCTCGCTAGTTTTTAAAATTGAGTTTAGACTCAAATTCATTTTCTTTACCTATTATTAGAATAAAATCCATCCCAATTATAAATTATTTTGTACTAA
TGTTCGAATTTGCTCAAATCAAATATCGGATCTTAAACGTGAAATAGAGTGTTGAAGAGATCTACAACAAATGAAAAAAGAATGAATAGTCTCCTTATAT
GAACTTGCGAAGTTTTTATAACATGTATGGGGAACCTCTTCATAATGCTTTTGATTTGCCAATAAGAATGGGGCCTCACTAAGATCTAGACAATGTATTC
ATCACAAACAAACACAATACTTCATCAAAATCCTATCTAATCATTCCTACATTGGCCAATCAGATTGTTGGAGTTGGTGTCCTGCATCTCTTGTGTCTGA
TTCTTTCTTTTGATAACTAGAACACCAATAATTTAATGGTCATACTCATTTCAAACATCAATAATTTAATAGATTCATCTGGACTCAGTATTTTTTATGT
AGAATATAATTATTAACACAATAGGGCTGCTGGAAGCTGGAAAGAACAATATTTTCTTTAGCTGGATATAAATATATATATATAAAAAAAAAAACATTCT
TTGTGACTGATTATAATGAATATGGTGACACAATTGAGTAAAGGTAATTTGCTAGTAATAATGCCTTGTCCAATTTTCACTTCAAGCAATCATTTCACCC
ATCTTTGTTGCACTGGAAAAAGTAGGGGTTATCCTTCCTCTGTCCGGTGATGAACTGGTCCGCCGATAAAAAATGACTATTATACTATAATTTATCAACT
TTGTGCGAGATGAGTAATATTACCTAATTTTGAGTTTTTAGTTGAAATTTGAATTCTAGTCTCTCATAATTTTCACTCACTTCATTGATCGAGACCACAT
CTTTATATACACAGGATTTATAGACCAATTTGTGTGCACATTAACTACTCTTTCGGGATCCTACCATCTCCGACCAACATAAGAACCAAATTTAGTTATC
AACTAGGGGAAGTAAACTCACTCATCATAAAAATCCATGAGAATTTTCAGAACAAGCATAACAGCAATTGCAGTGTGTTTGGTAGAGAAAAAAAAGATTG
TATTGGTCAATGGTGGCATTAAAGCACAAAACCATAGGCATATAAACACAAAATGAAGGAAACTCTTCTCTTGACTCTCATGAAGATGTCATATAATAGA
TATATGTAATAAGTCTTGAATTGTATGTATGAACCAGAACAACAATTTGGTTCAGCTCCCGACTGAAAGTCGATTACCCTTTATGTTTTAAACTCAAACT
GAGATGAAAATGTTCACGGCTAGGCTCGTGATATTGTGCTCTCAGTCATCCCTTTAGTTTTTCTCATGGTCTTCCATTTGGCTGAAGTTGCCTCTCTCCT
TGAAAAGTTGAGTGTGATGGTGCCTACAGTACAATCTATGCTCATGAGCTACATAGTTTGATGGACTGATCACACAGCCTCCATGGCTGCATTTGAAACA
AGGCCTGTGGTACGAAGTGCCATCCACTGCTACCTACAAAAGCAGTAGTGACATTAATCTGTAAGCTTGATCTAAGAAGAAAATAACATTTCAGATATGC
CGAGTTAGAGGCACAGGCACTAATCCATGGATTCCTAAAGAGAGCTCAGCTTTTCAAATTTGCACTAAAGTAGTTTGAAATAACCTGTTCTGCTCTAGTC
TGCACATTGGGACAACAAAAGAAATTGTCAATACCTTTTCTAGTGGATAGACAGTTTTCTTGCAAGCAACACATTTATCTTGAGTTCCGCCAAACAAACT
TGAAACCTTACTGTTTGATCCCTGGGAGATAAATACGAGGCAATCAATTATAAGATCAGCAGGCAAACTGAAATGGACAAAAATGTATGTTGTAAAAGTG
CTAGAGGAAGTGTGTTCAAATAATACCTGATCCGCGGAACGTTCCCTGACAGTTTTCGGAGCCCCTAGAAAAGAGAAATAACAAACAAGAAGAAACTAGC
TTTAGAAGGAGTAGCGATGAAAAATGAAATAGAAGAAAAATCATCATGTCAACTCTATCGTAACTACCTTCGAAACTCTTATCCAGACTTCCTGTCATTT
TGAATAGCTGATCAAAGTGAGGTCGGCAGTACAAAACTCCTTCGAAGGAGTTATAATTACTCAGCTAAAAAACATTAAAAATGACAAGGAAAATAAGATT
AAGACATCTTATAATTAACCACATGAAAAAAAGGTGCTAACGAGATGCTAAACATATGAAGGAGAAAATGGAGATATACTCCAAGTACTGTGACCGTCTG
AGAAGTTTACACTAGATTTTGTACTTTTGGTTGATGGAGCAAAACATCTTCATCTGTATAACTAATTGTATAGCACTTCTATGCCAGATTCCATGCTAAC
AAAGTTGGACGAATAAAAAGTCTCATGGCCTCCGCAAATCAGAGTTGAACAACAATTACAGTAGCACAATTACTGATAGATGGAGTCAAGTTTCACAATC
GATAAAGTTAGTACAGCAGGATGCAGTTGCAAATACTCTGCTTAACTTCTCAGGTAAAGACTAAAGGCAAAATTTTCACATAAATGATTAATTTTGATGG
TATGTCTTCTTGTGCCTCTTTAAATGTCATTCTTGCATATTTCATTCCTAAAAGAAGAAAAAGAGGAACAGAGCTCATGTATTCTTCACCCAATAGAGTA
TTCTTGTTTAATTCCTATATGTAATTTGGAACTTTAGCCCTAGCTAGTCATGACCAAGAAACCACCAGCCGGTTTCACTTACTTAGTATTAAGCATATTT
GAATGGGCAATAATGTTAAGTGTCAATTAATAAACCAGGATTCTCAAGTTAACTAGTCAAAATTGGTCGGCATAAAGGTGAAGATGGGAACACAAACACA
ACTAGTTGGCTATTGAAATGATATTAACTGACGTGAGACATTTCAAAGAAGAAACAACTTTTTCCTCTATATGGCTACCAAGTTCAAGTGACAAAGGTTG
AAGGACTTAAAACTCAGGCCACAAGTTTGAGCCCTGTGTCATGCGAACTAAGCCTAATATTTAAGAGGGGAAGGCCCATCAACCCTGAGTTTCGAGAGTT
GCAGTTGGTCCTAAAGACTAGCCTCAGACGATTCTTGGTCATGAAAAACAGCTTCTTTAAATAAATAATGTAAACTTCTACCAAATCTCATTTGAATGTT
TATATGTGAATCTTAAAGCCATAGTTCCCTAGAGTCCATGTAATTACATTTCACAGACCAATTTTGGTCAAAATTTTACTCAGTAAAGGGAGTCCAGAGA
TTCCCCTGATAGATGTCTCATTTTTCATCAAGTTAACATCACATCGGTTAACCTTAACACTATCAAGCAATCACTCTTCACTAACAATTGCTGAAAGCTT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ATGTAATGTAAATTCACATGATGTAGTGTACGTTTTTGGTTAACAATGATAATGACTTAACAGACAAATCTGTGAGGTCTGTTAAGTCAAATCCTATCTT
ATGCGCTTTGATCATGACATAAACCACATAGTTTAGGACAAAGACTAAGTAATTACTAGAATTTGATTATAAGAAGTTTCCTATGAACTTTTGATTAAGA
AAATAGACGTAATTAAACCATTCGAAATTAGTCTAATTTCTATCTTATGTCTCTGATATGTATGAATTGTTGGCATTTGATGTGTATATTAATCAGTAGA
ATGTATTAGATATAGTTGTAAAGAAGTATAGTGACGTATTAAAATTATGTTTATAATAAGTAGCATCAAAGAGTAGGTAAATTATCTAATTAAATCAGAT
TTGGGAATATAAAAACATGTCTTTAAAAAAAAATAAAAAAAAAATATATGAATAGATTTTTGGGCCAAATATACCAGATCCGACTGACAGCCCAGCCCAT
GTATCAGCCCAATTAGCGAAGCCACGAGGTGATAAAAACAGACCGGCCCAATTCTCAAGTTCGATTACGTGGTGTAACTAATTACGGAAAACTTACATAA
ATATACTACGATAAAAGAATATATATCATTTATAGGAATTTTTTTTTTCTCTTGATTACTTTTAATTTATTTATAATACAAGTTTAATACATATTACAAA
GAACAATTTATTATTCACACATAATACAAATTTTAATGATGAATAGTATATTTATCACACATTTTAATACTTTTTATAATACAATGTGACAATTTTTTAC
CAAACAAACATGATATATTTCAAAAAACAATCATAATTCATATATATTACATACATAATTCGCTTTTAATATATATTACAGATTTAACAAGGCATTGCTA
TAAATGGTAATAAACAAAAAATATCGCTAAGATCAATAATTATTTTTTAAAATGTATTAATTTAGTAATTTTCCACTGATTTAATATGTATTATGTATTT
AATAAAAAAATCGTGCTTAATAACTAATATTTAAATAATATTAAATGTTATAGCTATTTTTTTTGGAAAATTATGATTCGTAGTTATTGTTTTCTTAATT
TTTTCTTATTTAATTTGTGTAATTCACTCAAAATTGTATAATTCAGATAATATAAATCACAATCTTTTATATTCTTATCCTAACTATTTAAATATGTTTA
TTGAAAAATTATAATAAACTATCCTATTTTTATGGCAAGAGAAATATATAAATGAAATTTTAAAATATTTCTAAATGTATAAATAGTATATACTTATTCT
ATTTTTATATTAGCATATATAGACCACGTGAAATATGTAAATCAGAGCCTGCATAGTATATAAACTATAACTATGAATCACAATTATCGAAACTATAGCA
TACACTATATAAATTTTGTAGTATCAGATAGTATTTGCAATTGATAAAGGGGAAAGAGTATGATATATATGAAAGTGGTTTATATATATCTTTACTGTTA
TACAAATGACTCGCATATACTCTTTTCCTCTAACAAAAATGGAAATATTAATTTTAATTTTATCTTTTAATTATTTTTTGAAAAAAATATAATTCATATG
GGTATATTTGATCCTCCTCACACATATTATTTTTGATTTTTTTTTGTTTTAATGACTAATTTAAAATTATTATTTTGATGATTAAATTTATTTATATTTT
ACTATTTTTTTATAAATTTTTTTATAGATTCCCCATAATTTATTTTTATTTTTATAAATACAAAAACTAAATTATAATATAGCCGTAAAAAAATATAATA
TTAAATTACTTTTCACTAGAAAAAAAAACTTGAATAATAATAAGAAAAAAGTAAAAAAAACTATTTTCTTTTCACTTCAATTGAATAAACAATATATGTG
AGGTGCTTTTTGTAATGATAAAAATACATGTAAATTATATTTTTATAACCATAAAAATATATATGAGTAATTTTAATAATTAAAATATATCAGTATAACA
AAGTTGACGGGTATCATATTTTTCTCCCCATACAATAAATAAATAAAATAAAATAATTTTTTTACATAATTTTATTTATTTTTTTATGTGGACAAGTATA
TAATTTGGATGACATCAGACATTCTTCTTCAGTCTGGAGAATTCTTTACTTTCCCTTTTTCACGACAGCCTTCAAAATCTGTACAAAATTGTTCCTTCAA
TACATATCTACTCATCGATCCCTGAACGGTAGCATTACCGGAGAATAAAAAAGTTCGAATTTTTCTCAGTTTGGTCGCTCCAATTTCAAACATTTGCTTA
CTGAAATGAAAGGGGCAGATTTTAAATGGTCAGTTCTTGAAATTTTTACATCTTTTTAGTAACTCTAAAATTTGCTTTGTAAAGATTCAAGATAACTTTA
TTGAGTATGTTTGGTGTTGAAACTGAATTTTGCAGGTACGATGGGTTCTTCCTGTCAATGTTAGCAACCAGTATGTATCCTTTTTCAATATTCATTCTGA
GTTCCATTCTGTAAATGGGAGGTACCCTGGATGCTGAATTGGGGTTTTCATCTGTAGTTTCATTGCTAGTGTCTCACTGTCTTGGGGGTTCTGTTTTTTT
TGAAAAAAATTGGGGGTAGGGGATTACTAGGTGAGGAATGGAACTGTTGCCAGATAGCCAAGCAACTGAGCTACTAAGATTCCCAGGCTAGTATATTTGG
TGTTCCTTGTCTTGAATTGTTTTATCTTTCCTTAACTGTTTCTTTATTAGAATCATTGTGGCGATAAATTGGAAGCGGTACCATCTTTGTATATATCCGT
TGCACATTTGGATTGTGGTGGGTATAAAAACAATGCTTTGTTTACTGAAAATTGGTGTAGTATTTTTTTGGGAAGATTCAGTTGTTTTCCCTTTTGCTGA
TACAGGTTGACTACACAACAGTGTTTCTTTTTCGTCTCTTGATGTTTGTTGATAATGGACTTGCTGCTGGAATGGGATTGTAAGTCCACCTCTATAGGAC
TATAGTATTTACTTCCATTTTTTCTTACAAAAAGTCATTACTTGTCTTCTCCTTCGTCCCGAGCTAATTTTACGAGTTTTTCCCTCATTAAGAGTCTGTT
AATTTTGATATTACTCTTACCTAGGTGGTTGGCAATCTACTCTTTTGTGCATGTAGTATGAATATCATGCAGAGTTAGTGGTGAAGCCAGGAATCCAAAT
AAGGGTTTGAAAGAAAAAGAATTATACCAAGGGATTCAACAACTTATATATATGCTCCCAGAAAAAAAAGCATTTTAATTTGCCCTATTTTCATAGTATA
ATTTTTCATCTGCCCCTGTCCAGAGTTGTTACTTTGATTGGGAGTATCCTTTAGAATTATGTTTGATGTTCAACCCTCTCACCTTTTAATCAAAGCTAGT
GGTGACACATGACATTAATAGTTAGTGGATTTTCATTAAATTATTTTGGTTAACATGAGGATCTTATATTCATTTCCTTACCCGATATGAATCATGGTTT
CAGATGACAAGGACTGAAGTATAGGTGTTATTAAATTTTAGGGATTTGGGTTGGCAGCAGAGATACAGTCGCTTTCGTGGAAGAATAGTTGTTCTTTCAA
TTCTTGCCCTGTTTCTGTATCCTTTTCTTTGGGCTTGGACCATTATCGGGACTTTATGGTTCACTAGTGCGAGAAACTGTGTAAGTTACCGAAGATCTCA
TTGACTTAAGATGTTCAGATCTGAAACCTTAGGATAGATATGACTGTTGAATTCTTTCAGTTGCCAGAAGAAGGTCAAAAGTGGGGTTTCCTTATTTGGT
TGCTGTTCAGCTACTGTGGACTCATTGGCATAGCTTGCATATCAATTGGGAAGGTTAGTCTTCCAGGGCAAAAACTAGTCCAAAACGTTTAACTGATTAC
CTGATTCAATTTCGACAGCATTGTTGGCCTCTTCTTCCCCAAAAAATCGTTGAGACGACCTGTAAGAAAAATAGTAACCTTTAATACCCCCAACTTATTA
TTTCTTGGGGTAATTTTGTTGTACGTACGCATAGAAGTGCACGGTCTAACAAATGACTTTTATGCATTTGAAGTGATACCAATACTACATCTATTAAGTG
TCAAATATCTCTTTGCAGTGGTTAACTAGAAGGCAAGCCCATTCTTTACGTGCTCAACAAGGGATTCCTACTTCCGAATTTGGGGTATGCTTTAGAACCT
AAATTGTATTGTTATATCGTGATCATTATTAATAGCTAAAATTTTGTGGTAGCCCGTGCTATCTCTCGATGTTATAATTGATTTTTCCTTCAAAGTTTGA
AGGTCTCATAACTCCATTTTCTTGGCTTACATGTGAAAAGATAATGATCATAGTTTGCATTGCTAGCCTTGCTTTGGACTTGTGTAAGCTGCTCTCTTTT
GATTCAGATTTTTGGTGTTGGAAGTTTCCTAACCCCCTTCCACCAGCTGTTTGCATAGAAGTACCAAAAATTGAAATGGAAAAGAAAATCAAAGTGGTAT
ACATTTTTCTAATATCTCATGGGGATTATTGCACTTTAATGACATCAAATTTCTTTAAGCTATGAAGCTACGTGTCTGTGAATTGACCTTTGGTTGGTGA
AAATTAGGCATGGTCTAATATACAAAGAGATGATGTGGATCTTTCTTGGTGCTTCAAGGAGTTCAGTTGAAGTTTGAGGCTAGCTACTGTCTGAAATGAT
CCGCTTAGTCAATGGATTCATATAGCTGACTGAACTAGTTTTTATTTGAAGCATAGTTGGTGTATTGATATTTGTTGTAATTAAGCTTATTGACACAAAT
CTTGATCTTGTAAAAAATGTGTAAAGCTGCAAATTGGTGCCTCTTTCCATCAAAAATTCTAGTGCACGAATGATATGAGAATACTAATGCATAAACTTTA
TCATGTCATATCTGACTTGGGCATGAAATCAGAGTGATTAAATAATAGGATTACAGAAAGCTCCTAGCACTCGTGCCACAAGAACTGCAACTGCAACTTT
CCTTTCCTTATACACTTTAATGGTAGTAATCTGTAGTAGTCACTACTATATCTTCTAAATTTTTTGGTTAAATATCACGGTCTTGTGCATCTTTTGTGCA
TCTTGTTGTATAGATCTTGATAAGTATAAAACATTTTAGCTTAACTAATGGTCTGATCTCAAGGTTCGGATGGTTGATCCAATTCAAGCATCGCAGGAGT
AAGATGATCAATTCCGAGTTACTTTACTGGATATATACTATTTCTGCGGGGAGATTTACAATTAAATAGAAGTGTTTATTGTAAGATATTTTGCATGATA
TAATCTAGTAAATTTATTCACTAATCAGCACTTTAACAATTTTGTTTTCGTAAGCTAGTTTTAGGAAGTTACAGCAATGTCAAGAATGAACTCAAATAAT
TTAAGTTCAGATTAGTTTGTTACTTCTTTTGAGGCCGAGTGCAACTGGACTCTGTCTAATTTTTTAGGTTTTAGAGTTTGCACTTTCGTAGTGTCAAGTG
TCCCAAATTAGGTGAGGGTATAAGCTGTAATATCTTTATATGGTCTTAGACAATCTTCACGTTGTGAGCTAGATTTAGGTCAAGTTCAAGGCCCATTTTT
CTTAATATGGTATCACTCCCGACTCGTTTTTCTTAACACATAGTTTAACATCGGTAATGGATGTCTGATTTTGCTTCTCATAGGATATAGTAATTAGATA
TTTGTTTCTATTGACATGTTTAACCTTTGCGTCAATGCAGGTGCTGGTTGACATGATCAGAGTGCCAGATTGGACTTTTGCAGCAGCAGGGCAGGAGATG
AGAGCAATGGGCCCTGATGCTACTTCTTATCATCCAGGACTTTACTTAACCCAAGCTCAGGTAACAAGTACCATTTTACTATCAATAGCTGGAGTCACTA
GTCAGTGGTCATCATAAATCTCCATGCTACGCTTGGTCAACTGAAATCCTTTTGGATCATCCTAACTTGGTGGTATCTCTCTATTTGGCACACAGACAGA
AGCAGTGGAAGCACTCATTCAGGAACTGCCAAAGTTCTGCCTGAAGGCTGTTCCTACTGACTGTAGCGAGTGCCCTATCTGTTTGGAAGAGTTTCGCATG
GGAAATGAGGTAACTGTCTCTCTTGTGTAAATACTACTTTATTGTACTTCTTGAAAAAATAAAACTTATGGTTAACCTTTTCTCTTCCATCATGCCCTTA
AAATAACTTTACTGAAATTGTAAACATTTTGTCAAGCATTCTCAAGTGTGTTCAAATCCATACCATGATGTAATGATTCCGGCTAAATTATATTTGAGTA
CACCTAGCCAATGCTCTAGCACACTAATTTTATGGAAGTCAAATTAATTCCTTAATATCCTTGCAGAGTAAATTAGATCAAACTTGTGTGTGACTACTGG
AGATATAATTTAAAGGTGCCTGCTCAATAAGTATGGAAGTATTTATTTTCCTGTACTGTCCATATCCCAGCTCACTCTGAGAAAAAAGCAAAAGCATAAC
TGTTAAGGAGGATGATTTGTGTTTGGGTTCACTTTTGAGGAGATTCTGCCTTGTCGATTCACTGTTTTTTATTACTCAGCCTACAGATTATACTTGAGTT
AGGGATCTGGGGATATTGCTGAGCTTGAATGCATACTGATTTTGATTAAGCAGTATGAATACGAATTTTACATCCGTGCTTAATCTAGGGAGGAGTATTG
CCTTATCTTACTACAAGATTTCATATGCAGGTTCGTGGTCTGCCTTGTGCTCACAACTTTCACGTGGAATGCATTGATGAATGGCTTCGCCTAAACGTGA
AATGCCCTAGATGCCGCTCTTCTGTCTTTCCAAATCTTGATCTCAGTGCTTTATCCAATATCCGAACCGATTCAGAGGGGTCAACAGCCAATGTTGTGAC
AGCAGCACAGTATGTGAGATCCCAACCCTCCAGCCAGAGCTATCTGCTAAGAATGCAAGGTTTGCTCCGCCCTGTACGCACACAAGATGCTGGCCTGGGC
AGTGAGGTAGATCCAGCTGATAGCAGCAACCAAGCATCCACACCTCATAGTCACGGATTCGTGGAACCAGTACAAGTTATAGTGGAACAGTCCCCAAGGG
AGCTATAACCATACTTCCTGAGGAGGTTCTTTACCTCAAATGTCTTAACTTGATGATTCCTAACAACTTGTAGCCATTGTCAAGTGTTCGAAGTGGTTTT
TCATTGCAACCAAATTTCATCAATTGGAAATGTGGTAGCAATGATTTATGTTCACAGCCAGCTTGTTCTGATGGAACAATATATGTTTGTTTTACCACGA
GTCATATCGATTAATTCACATACGGTTTTTTTCTGTGTTTAAATGAACCTTCAAGACTTTGTTTCCCATTACTAAAACTGTATAAGTAACACAATCTGGT
GCTACTTGTTAATACTAAAGTAGTTATATATGGTTTCCAATTCTTATCATAAAGTATGATGTGACTTCCACAGTCTACTTGATTTGCACTAGCAAAGTTA
AATTAATCTCAAGAACCACTTGTAAATAGACGACGCATCTGTCCTTTTTGGAACAAACATAACACTTGGGCCCTGCTGTACAGCTGTTATCTATAATTTA
TACTGTATTAAGTTAGTTATAATGTACTTTCTCCGTCCTAGCTTATATGAATCACTTTTCTTTTTAAGTTAAAGTTTTAAAAAAACGATACGCTTATATA
TTTAGCAAAAATTAAACTTAAAAATATTTATTCTATTCTTAGTGAAATGATTTATAGTCACATCAATATTTGTAGCTTATTTTATATTACAAATTAAAAA
AATGTTTGATAAAAAGTACATTCTTTTAAATAGGGTTTTATACGACATAAATTTAAAATAATTAGCCGATTCAAATTAGTCGGACTTCAATTCAAAGTAA
TGAAGATAAAATAAAAATGTGAAAAAAAAAACAAGAAGAATAGGCCCCAGTGGTCCTTGTGCGAAACCATTAAGTCTCTCTCTCTGTTTTTCTAATCGGC
CGTAAATTATCTTCTTTTATCCACAAAATACAAACACCATTTCCAAAGACTCCATAGAAGATCTCTTCGAAGAAGAAGAAGAAGAGTAAATATGGCGATG
GCCAACGCTTGGGCTGCGGCGGGACACGTCACCGTCCGTCCTTCGCTATCTTCTTCATCACCTTCTTCTACTTATTTCGTTAATTTTCCAAATAAATCAT
TTCTTAAAAACCCCAAAAACTCCAGGCTTTGTTGCCGATGCGTTACTGTAAACAACACCGCAACTCCTTCTGCTGATGAAAATTGTAACAATACTTGCTT
CGCTTCTTCTTCTTCTTCTTCGACATCGTTAGATTGGGATTGGAATCGGTGGACTCGCTATTTCTCTGAAATTGAACAAGTTGAGAGCTATGCCTCTGTG
TTAAAGGTACCTTCTTTCTTATCCTTTTCTCGTATGGTCGGTCAATCAACTAATACTTATTATTTCAAAAAGTCACTTTTCTCGATTCCAACTTTTTTTC
AACAGAGAAAGTGACTTTATGAGGTAATATCTATAAATTCAGGGACTGAAATCAACTCTGTATTTTGATGAAATTGGTATTATGTGTTACATCTTTTGGA
GTCTCTGTAACCAAGGTATCAGTTGTTGTTGCTATGTTTAACTAAGGTCTTTGTTTGCTGCGGGACTTTTTAGTTTGGTTAGCAGTCTGTTATATATTGA
GTGTGAGATTTGGTGAGTCTGTAAAAGATATCTTATTTTTCCGAATAACCACAAATTCTTGATATTTGCGTCAATGGGCTCAATTAGAGCTGAATAGATA
TTGAGTATTCATATAATTGATCCGAAGGTCTTTCAGGGACAACCTCTCTACCTCCACAAGGTAGTGGTAAGTCTTGCGTGCGCTCTACTCTCCCTAGACT
CCACTTGTGGGATTTCTCTGGATACGTTGTTGGTATAAAGTTGACTCTAACTGGTTCTGGATTAAGGATATCTGCTGCAGTTTTGTCAAGTAATATTTTT
TAGCATCAGGTGCTTCTGTGGACCACCAAAGATTTTCCTGAATCCATGTTAAATTCCTTTATTTTTTTTTTTTGCTTTTGAACTTGAGAAACTGTATCTA
ATAATTGTTTTTGAAATAGCTGTATCAAATAATTGTATAAGAATGGAAGCTTCAACATCTTAGTGGAAGCTCAGAGTCTATGATGTAGTTTCTTTGAATT
CTGATACCCATAGAATAATGTTTTTAATCAATTATATGGTTCATAGTTTGTGGAGATGAACTTCACACTTGCTTGTTGCTAATTAGACATGCTTATAAAA
CAAAGAAAGAGGATGAGCAATGACCATAGAGAAATGTAGTTTGGCCGTCTTCATAGGAAGATAAGGAGGAGTTACGAAAGGTTTATGCTTTCTGTTCATA
GCTTAAGAGATGTGAGTGGTGCTAATAGGTGCATCCTACCTTTCTAATTCGTGTACGCTCCATTGCATATGTCCCACACTGTTGATGGAAGAATAAAGTA
AAAGACTACTGGATTGGTCCCTTCTGCTTATACCCTTTGTGACAATCATAAATGCACAAGCTAGAAAGCAAGAAGACAAGTCTTTCTTCTTTTCCTATTA
AATTATCTAAAAGAAAGTAGAGTTATCTGATCCCTCACCTCGTCATTTTGCTTTCGGAAATTTTATTATTTCCTCTTGCTTCTGTTATTAAGAAGGAATC
TAGAACTAACTAGCTTTGATTAAACAAATTTTATTATTTCCTGTTGCTTCTGTTTAAAAAGGAATCTAGAACTAACTAGCTATGATTAAACTTTCACATT
TATGATTTTGAAACCAGTATATCACCAAGGACAGAAAAAAAACTTCAGCAGCTGATTGTTATGGAATTTGTATACTTTGGGCAGTTAGCTGTGTCCTATG
TTTAAGTTGTTGACTAACCGATCTATCAAGGCCAAGAGTACCCTGAGGAGGTATTCTCTTGTACCGTGAGGCATTCTTCCCTTACCCACTTACTGTTGGT
ATATCAACAGTTCACGCAAGAATCGACAGGAAGTCTTGTGCTAAAAAAACTGCCTCAAGGAGTAGAGAAGGGGATAGAATATAACGACCCGAGGCTGTCG
TATTCTTCCAATGTGGGACATGGTAAAAGGTCCTGTGGTATGAACAACTGACAAAGAGGGACTCACAGTTCCATATTCAAGATATTGAATTATCTCTGAC
CAGCTGCTTGACAATCCAATTGAGAAAAACCGCTAGAAGGGTGTAAAGGTGTCATTTTAGAAACTGGGCAGCAGGAAAAAAAATTAGAAAGAGTAATAGG
GAGTTGACAGAGTTGGTCTGCATGCAATTTATAATGCAATGCATCTCTTTTTATGTCCCTAAAGAATGAATATCTTGCTTAACCACTCTCTAAAATCAAG
TTTAGCGGTACAAATCAGCGTTGGCATGCCACTTCTTCATTATTTTCTTGTCCAGATGAAACTCCTCAGTTCTTATAGAAGAGGAGAAATAATTGTTTTC
CAGTTGTTTTTAGGACAGGTAGACATCACATATATGGTCTCCATATTTTAATTTGCAATTACTAGAAATAGGTGGGTAGATGGGAACTTACGAGTTGATT
GTACTTTATAATATCACACTTCAGTTCCCTAGTGAAGAATTTAGATACATTGTGATCCATTTGTCTATTCTTTCCACTGGTATATCCACCATGCACTGGT
CCAAGAAACTCTTCTAGACAACCAAGAAAATGGTAAACACGTTCTTGTCTGATTGGTCGTCATATTCAATTGATATTTGATTTTCTTTTCTGCTGCTTTT
CCGTCATATAAGCGACCGCCAAATGTTTCCTCTTATATTATCATGAGCAGATCCTGTTTATTGATTACTGATAGCAATTTAGTATGCTTCTTTTAAATGT
TTTGAGAAGGTTCCCTATGGAACATGTGGTTCCGATGTAAAAGAAATTCAGATGGTTTTGTTTTTTAAATTAAAAATGTCCCAGGAAGCTCTATTCCTAT
GAGTTCTAACTGGTTGTATGTTTACTATGTTTTACAGTTTCAACTTGAAGAAGCTATAGAAAAGGAAGACTTTGAAGAAGCTGCAAAATTGAAAGCATCT
ATTGCAGAAGCTACATCGAAGGACTCAGTTGCTGAAATTATGTCCATGTTGAAGGTATAAATTGCAGTTAAATAGCATTAAGTTCCCATTATCCACAGTT
TCTAACTGTCTCCATTGGACACTGGTCCTTACTTGCATCTGGATATTGTCAATGATTTCTTTTCTCCTTCTGCCTCCAGAATGCAATAGATGAAGAGCGT
TATCATGATGCTTCAAGATTGTGCCGAAGTACGGGAAGTGGCTTGGTAATACTTATCATCTAACACTTAAATCTGTAGGCTCCTTAGTGAGCCTTTTTGT
ACAACCACATTACTAGCATAAAACAATGCATGCACTTTAAAATTTATTTATCATGTATTAAATCCGTGTTCGAGTCTTTTTATCTCTATATACGATAGAG
ATAGATTACCTTTTTACTTTAGAACCACCTGTATAGTTATGTTAAGTTCATGACTGACCTTCCCTCACCTCTTATTTCACTTCAAACTGCAGGTTGGTTG
GTGGGTTGGGTATTCAAAAGATTCAGATGATCCATTTGGTAGACTAATACGTATTACTCCAGGTGTGGGCAGATTTATTGGCAGAAGTTTTACTCCAAAG
TAAGAATACAAAGCTGGAAGTTAAAGCTGCTGTCATTTATTTGATTTTTGATGAATTGAGTTGGTAATTTCAGACAGTTGGTCAAAGCCTCTCCTGGAAC
TCCACTTTTTGAGATTTTTGTTGTCAAAGATGGAAATAACACTTACAACATGCAGGTGATGTGCAACTGTGATTAATATTTATCTTTTAACTTTGCTGGT
GTCTATTATTTGTCTTTCACTGAGCTACCAAGAAAATGAGGATTTCCTTTCAGATTTCTTGATATTTAAATCCTCATGCTGACAGTCTTAAATGTATTTT
TGTTATAAAGTGGACAATAAGCAGATTTCCACTTGTGCACCAAGTAATAGCTTGTTTTGTGTCATTATACCAATCCATCGTGATAATCAGAACATTGTGC
TTGGAAGGTTTCACTATGTTTCCAAGATGAGCTGACTCACTGTTATCTTTTCCTAAATTCAAATAAAAAAAATATTGCTTTCAGTTACTAGTCATATTTA
GGTGTACTCTGATAACTATCAGTGTCCTGCACTTTATCTAAATGTTGCTGCTGTTCAGGGTTGATTCTATATGTTATACTGTCACCTTGACTGTGTTAAT
GCTGCTTCTGATGTCTGTTACCCCTGCCAGGTGGTGTTGTTGCAGCGAGCCAAAGGAAGTGCAGCAAGTTCAAGCCCATCATCCAAGTTGAAGCCAATGA
AGGGACCTTCATCTGCTGAAATTGAGAACAGAGCTGTAATTGATGTTAAAGTAGATGAAGCAGAAGCAGAAGCAGAAAAAAGCAATGAGAAGAGCATAGA
TTTTGAGGGAGCTGCTGAAGAGGGAATAAGAAGTGTGATAAATTTTCTTAAAGATAAAATACCTGATCTGAAAGTGAAAGTAATGAAAGTCAATATTACT
GAAGAAATGACAGATGATGGTGATTCAGTGAAGCAATTTCTGGAAGAAGAAGATGACAACACTATTTCCAGTGAGGAGACAGATGAAACAACTACTGATT
TGGATAACATGAATTCCGACCGAGTTACAGTAGGAGGAGATAGCGGCACAAGTGAAGAAGGAAAAACTGTAGATACCAAGCTTTTTGTAGGGGGTGTATT
ACATAATAAAGAAGACAATCCATTAAAGGATGAGTTTGTTCGTTTCCCTGTTGAGATCAAAGATGTGGCAAAGGATTCCTTTGTGCTTCACATCCCCAAG
AGACCTGGAGAACACGATGCTGAAGAAAATACTGCGTCAAGCATTAATGAGGCAGCTATTGCAGCTCAGAGTATCTCTGAACTAATGCCTCCTGATGTGG
CCAAGGCATTTTGGAGTTCTGATAAAGCTTCTTCAAAAGTATGCAAACATATTATCCTAAATATAATCGTTACATTCTGCTTGTAGTTGTGGTTTGAGGA
TATCATCTCATACACAGTGAGTTCAGTAACAAAGTAAATTGATGGAAAATCAACCATCTACCTCGTCATATGAAGAGATATCTGGGTCCTAAGCGAGAGA
AGTTGTCAGGAGACTCAGTCTATTTCAGATCGTAGCCGTTCTATGTTTCTCCTTCTAGTTTAAGATTTAGCTTTCTTGTTGTAAGATTTTATTGCTTTGA
TAGTTTTAGGTGTATTGTCCTATTGATTCATAGAATTTACACTTGCTGTAGGTTTCTAGAGATGTTAAGGAGATGCTAAAGCTTGCAGTTACTCAGGCAC
AGAAGCGATACAAATTATCTGAATACACAAGTTTTAGTCGAATAACCTCTCCTGGGGATTTAGATCCTTTTGAAGGTAAGACATTCCCCTGTGACCACTT
CTCTCTCTTGTTAACACAAATATAAATATAAACACAAACACAGCCATGTCCCGCGCTAAATATGCCCCCCCCCCCCCAAACCCATATTTGCTAGACCTCC
ATGTAAATATGTGTTTTTATGCCTTTATTGCTTTGTTTGTCTCTTTAACATCAAATCCTAAACTAGGTGAGAGAGCTAGATATGTGGGACTTTGTCAGTA
ATGTAGTTTTTTCTCTTAATTCTAGGTCTATATGTTGGTGCATTTGGACCTTATGGAACTGAGGTAGTGCAATTAAGGCGGAAGTATGGTAACTGGAATG
TAAATGATGCTGAAAAATCCTCTAATGTGGAGTTCTTTGAGTATGTTGAGGCGGTAAAGCTAACAGGGGATATCAATGTGCCTGCTGGCGAGGTTCGATT
GTTCACTCTGAAGGTTGTTTTTTTGTATGAAAGCCTAATGAATTGTAAAGCTTTTGATTTTCAGGTGACATTTCGAGCTAAAATAAGTAAAGGAAGTCGC
TTGTCCAACAGGGGGATGTATCCAGATGAACTTGGTGTGGTAAGTAACAGTTGGTCGATCATTGTTTTTATGAATGACGTTTCTTATGTTGTGTGGTTAG
CATCGTTTTAGCTTTCCCAGGTTGAGCAAAAATACCATTAGTATCTTCAACTTTCCCCCTTTTCATGCTATTTATTATTTGTTCCATGCTCTGATTGCCT
TGAACGGTTAAGAGATACTTGCTGAAATTTATAGTTTCTATTAATAGAAGATGTTGATTTTTTATTTTTGTTTTTGAAAGAAGAGAATGTTAAAGTTTTT
GTGATCATAATTTTAAAAGAAGACTGTTTAATGGATTCAGCATTGTTTGAGAAATTGTTTTTTCTTTGAAATTGGTAACTTTGTCTATTCCTCAAAAGTC
AGTACTATCTTTTACTAAGTTGAGTCTAGTACATCAGTTATGGAGATAGTGTCATTTGAGTATAATTGAATACACCAAAAACATACAATTTAGTTTGACT
TTTTGCATACTATTTTCAACACTATCAAAAGCTGTAGAGTTCCTTTCCTTCTATATTGCCCACCATATACTAGCGGGGACAATTCTCCATTTCTCTATTC
TTGGATTGCTTTCCTACTTCCTCCCAACTCTGGATTGCTTCTGTGATCTTGGCAGGCAAGGTCCATGACATACCCTTAAGACTCAGGAATAACCTCCATA
GTAGGCTTGAGAAATTGCTTTAGACCATCTACATTTTAATATGTCAAAAATTACTTCAGCGCTATAGGCAGATGGAGCTAGCAAGCCAATATGTGCTACT
TGGTGATGATTCCTGATGGTTATGATTTTACTCTCCGTTCAAAAGTGCTCGTGTCTCTTTCAGTAATTGATGTCATAGTGATAAATTTCAAATTGTTCAT
AAATCTTTTTGGTATGAAATTTAGATACAATGAAAAATGACAGTAAAGGAATTCTTTCCATCCGTCTAAGCCTTGGTGAATGGTGACCGTTACCTCTACT
GGTATGATGTCCCAGATTCTTTTTGTTGAGTGCCTTGGAGAGTGGAGACAAATATTACTACTATTACAACAACAACATACCCAGTGTAATCCCACAAGTG
GTGTATGGGGAGGGTAGTGCTTACACTGTACAAAGATCTATCCTACCTTGGAAGGTAGAGAGACTGTTTCCGATATGCATGGTTTGTTTGTTTTGTGCCC
ATAAAGCATTAGTTGTTAACCATGATACTGTATTACACTGATGAATGCAACTCTTCTTGGTGAGCCCTAGTTTTAGCATGACTTAGCATCAACTAATTTG
GCTATAAGGGGAGTCAGCTATGCATCGAGAATTAGAACAGTCAAATGATCCAGTTTAGATTGCTCCAGAATTATAGGTGTGACTCATAGTGTTTGTTTCT
TCAGCTTGCTGGTTACAAGGGTCAAGGAAGAATAGCTGAATATGGTTTCAAAAACCCAAGGTGGGTTGAGGGAGAGCTTCTACAACTCAATGGAAAGGTA
ATAAAACTGCTGGGAATTCTTGCTTATGTCTTTTTTGCCTTATTTTCTACCTGACAGCTTGTTGAAAGGTGTAAGTTAGAGGTCCTGGTTTCTATTCATT
TCTTTGTTAATTTTCCTTAGGGAATGGGGCCACACCTCAAAGGTGCAGACCTTGGCTTTCTTTATGTCATTCCGGAGCACAGCTTTCTTGTACTCTTCAA
TCGCTTGAAACTACCAGAGTAAAGATACAAGTTGATTGTATGACTTTGGACCCAGTTGTGTGGTTAGGCTAGGAGAAGATCATATTCCTTCTTCCAACAG
ATTTTTTCCCTTTTGCCAGATAACCTTTCCAGTGTTTTTATCAGAGAGGAATCAACCTTCAATGTGATCGAAAAAGCCAACCCTTTCCCCTCCCTTTTTG
CCACTGTGAGTGTTTTGCTGTCCAATAATATGATACATCCTTTCAGTTTTCATCATAAACACTAAAAACTCATATCTTGTAATGCATTTTTTTTTGTTAA
GAGATGATGTGGATAATAGTATTCTAGCTGAGTTGAAATTCATATATATTAATGAGTTCCTCTTCTCTACGGTCGTAGAAAGTTGTTCACATTAGCTTGC
TGGAAGGCAGAATGGTGGTACACATCTTCTAGTGGCTTACTTTTTCTTCAATATAGGTAGCTTTGATCAAAAGAAGTCCCTTTTGTGCTTCCACTCTGTA
GAAAGAAAACTTCTTGGATTGTTCTCTTCTTCTTCTCTCTCTCTTTCTCTCACATACACACACACTCACACTCACGTATACACACACACACACACACATA
TGCACCTGTTGGAATCATTAAATCACTGATCCGAGGTCATCTTGATCAAACGTTGACCGTGGTCAATCTGGAATTGCAAAAAGAATGAAATGTAAGAGAG
ACTTGAGGGAAAAGAATGTGATCCTTTGCTTAACTGCCATGACTACCTACCTAGGTCCCAGGAATCACATGCATTAAGAGACTTTTTCAGTTTTTACTTC
CTCTTGACACTCTATGTATGAGCTCATGTGACATAGTTTTGAAGGATTCCATTTGGAGTAGAAAAATATTTTGTGAATACACTAAAAATCTGTCTTTGTT
GCAACAAAGCCTAACATGATGCTAATCTCTGGCCTGAAGTATGTCTATATCCTCCGACAAAACTCTATTTATCTTTGCTTGTTCGCGCCGCCGCTGGATA
CTGGCTACTGAAGTGCTAAGAAAGTAAGAAGAGTCACAAGTTTCTGACCTTTGGTTGATTAAAATAAGAAGAGGACATTTGTTCCTTCAAAATGTAATTA
AAAAAGGTTGAAATCAATTGAAGAAAGGGACAGCTAATGGTAAATAAATAAATATCCATCAATTTTAAAGCATGTTGGCAATTGAAAACACTTTATGGAC
CCTCAAAGAGACGTGAGTTTGTTAATGAATTTTTGATTTGGCCACTAATACCACCTACTCACACCTGCTACTATCTTTCACTTTGTTGCAGTCAACACAC
TCTGTTAAGTCACAATTTTTAAGACTACTGAATCTGAAGAAAATACATCAAATTTTAGGTATTGTGAGTCAAACTTGTGGGTGTCATATCGTGGAACATA
AAAGAAAAGGAAAAAGAGCTCAATCACCACCACTTTTAAAGACGATGTGAGTGTTGAATTTTGGAAAATCGTGTAAGATATTGCATGGTGTAAAGTATTA
TTCTTTCGTTTCAATTTATATGATATGGTTATAGCAAATTATTAGCATGAAACTTTTATTAAACATACCAAAAGAGATAAGGTGGGACAAACAAATGGCA
TGAGCTTTTTTTGGCTTTTTCTTGTTCAAATTTTGGGACTAAAGAATCACAATTCACAATTTAGACTATAGTTTTAAACTTTTAACAGTTCAATTTCAGC
ATTTAAACTACCCAAATTTAGTTATCATGGTTAAAGTCAATTTTGACTCATTTTTGTTAGAGTGAATTTAATCAACTTAATACTTTATATTTAAAATTTA
AATATTCATAAAATTGTACGATAATTAAGTACTATTAGTTACAACCTTTTTTCTTGTTAAATGAAAAAAAATATGTTTTAAAATACTAATCTAAGTTTAC
ATAATTGGACTCTCAAGAAACAAATATAAGAATTAACACGAGACTAAGTACTTAACCATCAATTATAGTAGTACTCGTGATTAATTAATTAAGCAAACAT
TTTACCTCACTTTTATGATTTAGCTATCTTTATTTATGGTAATTTGGTATAAACACCAAAAAGGAAAAGTCACTTGAGGATGCAAGTGTTCTAGATTATA
GTCGAGTTACAAATATGATATTTTTTTTTATATTTTAAGATACGTTTAATTAAATATGGATAAGTATATACAGACAAAGATAATCTTATAAAATGAGTAT
ACACTGATCTAAACTGATCTAAATAAGATTGAGAATTCATCTAAACCTCTTTTAGTGAAAAATCACATTACATAATATTGAAAATTAAATCATATGCATA
TGATATATGTTAAATTTTATTTGAATTTTTCGTGTGTTTACGTTTTCATATTTTCGCACCAAATTTACACAAACATTTTTAATGGAAAAAGAAAAAAAGA
AACAGCATCGTATTTTAGCATGCATTACCATTCAATAATATCACGTAAAGAATCACTTCCTTTTAGATTCACGTACAACTTAAGCGGAACACTTTTTTAT
CATCAGCCAATCATTACTCGCCACGTTATACTAAATTCCAAAAATCTCCACCTGGCACTCTCACATTGATTCATAGAAGAGAACACCATAATACCTATAG
ACCTCCATATATAGTTCACTACACCTCCGGTGATTCAAAAGTATCGACAAAGACAACCCACTTTGTTTTCCAAAGTATTTTTCTTCACAGTTGTTCAAAA
ATCTCTCAATAAAGATCAGATTTTTCAAGAATCCCACCATGAAAAATCCAAACCCAGAACCCAATTTCAGTTTAAATCATCGAAATCTTCATAAACAGAG
TAGTAGTCATTTATCAATGTCGGATACAGAGTCACAGGTCAGTCAAATTGATTCTTTCCATTCACCACTTCGATCCGAGTCGCCATTACGTTCTGATGAT
CCTTTCCCTGAACCCCAAAACTCCAAATCACCTTCAAAGGCAATCGTTGCAGTAGACAAGTACTTTTCCCCAATCAGATCATCGCATAAACTTTCGTCGG
AAAATTTGAGTTCGCCGGCGACTCCACCGCCGGCGGTGGAAAGGAGGTCGCCGCTGGTTTATGTAAGTAGGGCGGTTAGGGAGGATATGGCACCTGGGGT
GACGAAGGTGGGTCCGGTACGTGGTGGTGGTGCTGACGTGGAAGGGGGAGAAGTTGGAGGTGAGAAGCGGTCGAGGGCGGCTGTTGAGTCGATTCTTGAA
AGGTCGCAAAGGGATGTTATGATGAACAGGGTGGCGTTAGGGTTTAGGGTTTGTGAGGTCATTTTTTGCTTGATTTCGTTTTCGGTTATGGCAGCTGATA
AAACTCAAGGTTGGACTGGTGATTCATTTGATCGTTACAAAGAATACAGGTGACCATTTTCTGCTTACATCTATACCTCTGTTTATGTTGGTATTTTTGT
TTCAATGGTAAAGAAAGCATTTTTAAGTGGAGAAATAAATTTTGCACAGAAGCAGTAGTCTGTGCACCACAGCCGATAGATTTTAGCTGAAATGTGAATA
TTTTGTTTCCTTTTATCAGAAGCAAATACAGTCAAACCTCTTAATTACAACATGGTTGTTATAAAGAACATACTATAATATAGCATACTTCTTTCCATTG
ATAGTCTTACTTTTCTTTTTAGTCGGTTCAGAAAGAATGTCTATCTTTTCATTTTTTGGCAATTCTTGAATTCTAACATTTCACGTGTCTTGTTTAGGGC
CACAAGATTGAGGGACATTTTGATACAATCTACATATCTTTAGTTTGAGACTATAAGATTCAGAAGTGTTTTTGTATTTCTTAAATTTCGTGTCAAGTCA
AAGCTAGACAAACAAATTGAAACGGATAGAGTAATATGAAAGTCGGTTCCCAAGAGAGTTCTGACTGTAATTCTGTGTTGGTTGATCCAAGGGATTCATA
GTTGATATCTCTCATGTTTTTTCCTTTTTTTCTGGTTTACTATGTCCTTGCTTTCCACATCTTTAAGTAATGTTAGACCTAATTTTTGCCACAGGTATTT
GGTAGCTGTTAATGTTATTGGATTTGCATATGCTGGATTTCAAGCATTTGATCTAGCACTAAGTTTGGCAACTGGGAAACACTTCCTCTCTTACCATATG
CGATATCATTTCAATTTCTCAATGGATCAGGCAAGTAGTACCATTTCAACTGGTGTACTTCCATAAATCTGTGTTTCTAGTTTGAGGTGAAATTAGTAAC
TGGTATGGTTTGCTCTTAGGTATTCGTATTAGGCCCTTAGAATGTTGCTAGCAGGGAAGGGTGCAGAGTCTGGATTATTCCACCTCTATGTATTCAATTG
AGCTGCTTATTTGAAGGAAAAATAGCATTTTTCAATGGCTTCTTTAGTCCTGGTTTTTTTTTATCTTTATGTAGATTTTAGTTTAGAGTCGTGCTCGGTC
AAAAAAATAAAATGATTTTCCTCCCCACTCTGAGGCATATGATTTGGATCCTTGGGAACAGGTCTTAGAGAAGTAGATGGCTCAGCTCCACTAGGAGATG
CGAAACTGTTTTAGTTCAGAGCTATTCGATAACTTCTTTCAGCTCTAGTGTTGAAGAAAAACTTTTCAGTGCCTCATCTAGGCTGAAGGCTTTAGAAAAC
CTAAGCAGGGTAGAATTATAGGTAGCTTACTATTCCATACAAGTGTGTGTTTGAGATGAGCTCAACAACGGAACACATTGTCATAACTTCCTAAAGATAT
TTGGACCCTCTCGTAAAGAGGGTTCAGCACTTGGAGAGCAAGAATTCGGGGCTGAATAACTTATGGATGAATTCATCATTAGGAAGGTACTAGATACTTT
TCATGGAACTAAGATGATGAGTGATATTTGAGAATGAAATTTCACTTCAATTGCCAAAATTATCAAAGCGTACATTGGCCCTAGTATGTAGTGTGTATGG
ACCCTAAGATGTTGTGGTATGTTGCAGTGTTCATGACATTTACTCGAAGCTTCTCAAGTGTATAGTTTCTATTTAGCCAGTTGAAAACTTCTGGGTCAGT
TTAGTTTATTGTTATTGTGCTGGTTATCTAGCTAGCTTTATTAGTCCTGCTACTGTTGTGTGTATATATGCTCTGATGATAGTCTTTTGTTCTCGTACCT
GTGCAGATACTGGCATATCTTATTATGTCTGCATCATCTTCTTCTGCAACGAGGGTAGACGACTGGGCAACAAATTGGGGAAAAGATGCATTCACAGAAA
TGGCAAGTGCATCAATCGCGATGTCTTTCCTGGCTTTCATTGCTTTTGCCTTCAGCTCTATCATATCTGGTTATAGCCTCTGCAACCGTAGTTCCTCGTG
ATCTTGAAATGAGTTACAACTATATTCATCCATTGTGTAATTTTGAGAAATTACTGCAAGAAATATTTATGCCTAGTGGATCAGAAGTTGTACAGATGTA
GTAAATAGATTTAGCTGTATAATAATCTCTTTTTTTCCCCACTCCTACTGCAGAGGAATAAAGTATACAAATCCGGTTGAGCAAATTGTATTGTAGAGTA
CGTGAAAAAAATAACGTCAAATATGCATATATTCTTATGGATATGGTATATGTTAAATCTATATGATGTATTGAACAGTGTGAATGTGAAACATTTTCAT
TAAGAGACATAATCAAATCTTGAGTTCAGGTAACAGTTTGATGTATTTGCAGTTTGTACCTTTTAACTTGTTTTGGAATTCTACTCAAATTTTCACTTGG
ACAATAACATTTTTATATTGGAAGTTCATAAAATACAGACAAGTTCATTAGAATCATCCTATGTATTCCTTCACCTAGAGAAGGAGATTCTTGACACTGG
AAAAAGGTCAAGCTCCCTCTTTCCTTAATTTCCTCTTCCTGCTGCTGAAACATAGTCTAGTATCATTAGTCCAGTTTGGACTCGTCTTTAATATAACCAT
CTGGAAGTTCATATCATAAGAAATCTATTGAAACACAGTAGTGGCAATGGCCTGAGGTGTTAAATAGGCTTTAGGATTATCTATTCAACTACCATATGAA
GTCCTCCTCTGATCCGAGGCTGAGGGATCCTGCTTTCGTGCCTCCCCAAAATTTGATCTGCATTTTATGGCATGAACTTAAAAATTAGGATACCCAAACT
CAATGAATTGAGTTATCAGCGGAGTGAGTGGTTGAAAAACAGTTAGGATGCTACTACAGATAAACTTCTACAATATTAAAATGGAATCAAGCAACCCTTT
TTCCTGTGTCTTCGGTTTTTGTCTGAAATGTTCTCAGGAAACAAGAAAAGAATCCTTAAAATGTAATGACAAGTTATCCATTAGCACTTACTAGGTGAGT
GATGTTCATGTATCTTCTCTCAAGAAATTCAGATAGTTAACATAGTGCAAGGTAGGTAACATTGCCTCAGCTTCTATGTTTTTCAATAGGACCTTTTAAC
TGCACCTATTATCCCTATAATTGCTGTGCAGAGTTCAACCTTTCCAGAAAACTAGCAGATATTATGTCGCAAAACAAATAAGTGAAAATCACATAACTAG
CATACACATTATTATGTCCATGCCACCCTTGTCCTTGTAAATAATATGAAACTATAACCAATAACCAATACTTCTAGTTCCCTTCTCGTATTTGGTGGGC
GGTCTAGAAGGTGAGAAGGCTAGAGATTTTGAATGAAAACATAAGTGTACATAGATTGAAAATATGTATTTATCTTTTAGCGTTAGTGTTAAAACCTTGA
TGTAATGAAGCTAGGGCATGTAAATCATGGCAACTCTCCCTATTAGAATATAAGAGTGCTGTTCATTAGAATACCTCAACTCCTTGTGTGTACAGCAATA
GAACTCCTAACTGATCAAAAAGTAACCAGTACTGACAGTAACATTGACATGATCACAAGTTCATGTGAACTCTTTGGACGGAACATTATTCTTAATGCAG
CATAATTAATGAAAAAAAGAGAAGTTCATCAATGAGACACTTCAATAAGTTTATAATGAATACTCACCCGCAAGTTGAGCATTTCTTGTGATGCTTGCAG
AATATTGATAAACAAACAGAGCATATGAAACCCATGTCAATCGTGTTTTTATGGCAAAAGCACCTGAAAATTAGTCGCACAACATAATCAGATGAGCAGC
TATACTTAATGGAATGTAAAGGGGTGAAGAGTACCCAATACTAATTGGGGGCTAAATCCAAGAATTTGTAAGAATAGACTGGAAATTGGAGCACAGATTT
ATTTGAGTCCAGATAGGAGGAAATTCAATAAATACTCTACTTTTGCTATTAGTAGAGAATAGGTCTCCTTGATAAACATTGTTTTCTTTTTTCAGGATAA
GTATCCTATCAAAAGCTGCACTCTCAAAAGTTAGTTGCAAGTTCGTAACACTCGTAATGACTCAAAGCTGGGAGTTGGGAAAGATATGGTTAAGACAAAA
TTAACAGATGATACAACAACCTCAAATAAGAAGATCCAAGGAGAATTTCTGTCTGCCAAAAATACGAGTGGATGATGAAAGCTTTTGTCTAATTGAAGTA
AAAAAAGGTATAATAGGAAAGAGCTTTCACAATGCAAGAGAAAAGGTGGTACAACCATTCTTAAATGACATTGAGCTAGATGGATAAATCACTTAAGCTT
CGTAGGTAATTTGAGACGATTCAAGAAGAATGAGATAAGCTAACACAACGAACTTGAACATTGACAATACAAAAAGTTGAATACTACCATCAAAAAGAGT
GCATAAAATATTAGTGAGGATACATACCAAATATTATATTACCAGTTCATCATATGTGACATAACTTGAATAATAGACACACTAATCACTTACGATGCAC
GGAAGTCAACTCCAACAGGTCTGGGAAGTTGCAAGAAGCTCCGAGAATGTAAATCAGTCGCAAAAACTGTCTGTATTTATTACAGTCTTGTCAGTATTTT
CAAACGGAAAATTAGATCTCAAGACAAGACATTCTACAAATAAAACATCTCAAAAATAAAACAAGGCATTTAACCATCTTACAGATCACACCAGGTGAAT
GAAAGCACAGTACACCAACCGCATCAGACAGAAATATGCAACTTGTTGATGTGAAAGAACATCTTGAATAAGAAATCAATTTCAATATAACTTCTGGTGT
AGATACTGTATTCTAGTCGTGGAAGTGGTTTTAGCAATGGGTCTATTGCATTCCATGAAACGTGAACGAAATGTTGAAAATAAGGTCATACAACAATCAC
ATCTTCATTCATGATATTATTATCTCCTACTCACAGAGACAAAGCATGAGAAGTTCACTATAGAGGGCAAAAGGAGAAGCCATCGGACTGCGGCAGTCCA
GAAGACATTTGGAGAAGATTTTCTAAGTCCACAAAGAGTACATTGGTACTTTCAGTCATAGCCTTTTGGTTGATCACTGTATCTCCAACACCAACAATAG
TAGTACATATATTAAATATTTAATACCAGATTTAAAATAGGTCAAACTTTTGGAAGGTCTTTTTAGTGTAAGCTCCTTGGAAACAAAAATTGCATACACT
AAACAAATCAAAGTATAGTGACTTGTTCAACATGCTTACACATCAGATAGAAACTAATGTCTGAAGGCAGCACTGGAGACAACCGTAGATGTTCAATGTT
GGATCCATGCTATTGACAAGTTAAAATGCTAAGCTAGAGACAACTTAGTATTTTTTTTGACAAAGAGAGACAACTTAGTATTAATAATTTTAATAACACT
TACAGAGAGATATTGAAACAGTCCATCTGATACTTGGGGTTTCAAATATACACCACCAGTTATGTAAGAAGCCTGTTCCCAGATAGATATGCACCATAAG
ATCAGTGAGCCAGAAAATAACTCATGCTGAGAAGGAATAGATTTTCAACCAGAACTTTCAGGTATAGAAATGCTACCTGCTGAAGAAAAGCAGAATGCTG
AGATCCTATTACACATGAATCAATGGGTACCTGCAATAAAAACGCATTGCATTTCTTAGAGTAGGATCACAATATGGAAATCTAAGTCCCGATCCCTAAT
TTTGAAAATTCTACATTTATGAAGACATGTGACAACTTTCTAATTAATCAAGAAGGAAAATTGAAGGAAAGAATTGTTAAATCCTATATACCATTGAACG
TTGAGCTGAGAAAATTGAATTCATGACTGCAACATATCTGCAAAAAAAGAACATGTTTCAGCAGAGAACCTAACAATGAGAAGATTGTAGAAGCTGTGAA
GATCCAACATACTGTCCCGGCCCATCTGGAGATCCATGCAGACACAATATCTGCCATAATTTCAAGCACATTTTCTTAGCATCAATATTCATATCCAACA
TAACAAAAACGGATCAAATTTTAAAGTATAAAACAAGAGAAGACAGATTTTTTTTTCCTAACAACTACCTTACTGATAAATGATCAAATTAACAAACACA
AAAATGATGTAGTAATATCTGATAATATCACATTAAGAAATTGCCAATGAAATGGGACCAGAAATGGCATTTCATCGGGAATGCTAGTTTTTTCTTTTCT
TGATAAGGATGGGAATGGTAGTTTCACTATACCATTGGATAAAAATTGCAGTACAAATAAATCAGGGCACATTGAAGTTTAATTGATGGTTTTGTTTAAG
GTACATAAAACATAGAATAACTTAAAGTATTACCTCACCAAACCCCCTTAAATGCACCTTTGGGGTTAAGAAACACTATCAGAATTAACATGAAACGTAA
AAGGCCAAAGAAATCACTGGAAAAAACTCGAAGTTCTTTTTCCCCTTGGACGAGAGATATTTCCATGGATAAGGTATTTGGCATAATAACATGTTATGCT
TGTAAATGCTAAAGCTTACGATCCCAAATGGATCGACCAGGAAAATTTCACATAAGCATAAAATCTATAAATGTAACTGGATAAACAAAATAATACAAGT
AGAAATTCTCATAACAAATTCCATCAATTCAAAATCCCAGAAGAACCCATTTTCAGTTTCTTGTAAAATAAGGAACTTACCCGAGGTTGTGGATGAAGAG
GCCCTGAACGAAATACCCGTTGAATGTCTAACAGTGCACACAGGTCAAGAGAAACACTTCCTCTAAACAAACGTGAATGCAAAGCTATGCACAATAACAA
ATAAAAACCAGTGGCAGATATAGCTAATAGCTACGGGTTCAACCAAACTCAGTATTTTCAAATACGGAACATGAATACACAAGTAAGAAAAACTAAAATC
TAACCAAAAAGATTAGATTTCGTATCTAGAATTTCAACAGTCAATAAATTCAGTGCTAAGAGCTTCAAAGAATAAACCTAGCAAGTCCAAATTTTGGTTC
TGCATCTCAATAAAAATCATTAAAATTTCACTTCAATAAGAATATAAAAAAAACCAACAGACATGAACTGATTGAGGATACAGCACAAAGCCATAGAAAG
TGCACCAGAAAGCAGCGAAAACCCAACTCCATCAACAGAGTCTTCTTGACTCAAGGACTCATCTTTATCCACAAAATCCTCCAGTTTCTCCAACAAACAC
TCAGCTCTTTGCATTGACGAGGTAGACGAATCGAATACATAATCACATGAATTGTACCCAGTTGCAATCACAACTACTTGGTTCATCTGATTCAGTAAAA
GTATCGAATTCAAGAAAGCAAGAACCTGCATTTCCCCCATACATTCCAGCATCAAAATTCAACAAATGGAGAACACAAAACTATTCATTTTTTTTTAAAA
AAAAAAACAAATTTTGGGTTTTAGGGGTCTTTACGTGTGATATGAATTTAGGGAATGTGAAGGCAGTGTTCTTCATTGAGCTCCAGAAGTAGGGATTTGT
ATCAACCAGAACCATCAATAGGCTCACATCGTCTGAAAGTATTCAAAAGAGATTAATTTTAACACATTTTCCTCTTATTCCACTAACATGTACTTATTGC
ATACTTCAGCTACACAGACAGAGAAGGAGACAGACCTGCGTAAAGCTTTGATGAAACCGGTGTCATGGCCGCCGGTGGAATAAACCTTAATTCACCGGTC
AGGTGTAGAGAGCGTCGCCGATGCAATATACTGTCGGGCTTTGCCTTTTTACTTATATAATGCTTATTTTTATTGAATCATAACAGAAAAAGACTTCGAT
AATTAATTGTTAATAAAAAAAAACATCGTTATCATAACAAAAAGACAGTTTGGCCGAGTGGTCTAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGT
GGGTTCAAATCCCACAGCTGTCAATTTTTTTTACATATTATTTTAATTTTCCCTAAACCCAAACTTTTTACTTTATTATTTCTTATTTTAATTTTCCCCT
AAAATCCAAATTATTATTTTTATTTTTTTAAAAAAAAATCCCTTTATTTTTAATTCTCTATTTTAATTTTCCCTACCTAGGAGTACTTATTATTTTTAGG
AAAATTAAATACACAACTTATTTTATCACATTATTTAAAACTTTTACTATTTGAAAAAATTATAACTAGTCGAATAAATCACTTTGCGTGATATATGAGG
ATGTGAGCAATGTATCAGATAATCGAGATGCAACATATCTGAAACATAGATACGATGTATCGAAATGCTTTGGAATGTATTCGGATTCCACTATACTTAG
GGAATTTTAGTAATTTGAATATAGTAAGAATGAAATATAATTAGCTATTGACATTATATAATTTGCGTAAAAAATATAATTTTTTTTTATTTTCCTCTAA
CCCAAATTAGAAGTTTCTTCGTTCCTTATTTTTTAAAAAATATAACTTTGTATAAAAACTATTTATGTTGATAACAAAGGGGTGCTAGGTTAGCAATCTT
TAACATTGTTGAGACATAAACCCCAAGACTTTACACAAACACTCTGTTCAATCAAGAAAAACACAATACAATGGGTTCGAAACCTTGCTTCATTGATAAA
CCAGTAGTAAGTACAAACTTTTTTTTTTTCGATTTCTTGTGCCAGATTATAGTGTATAAATTGTTTGATGCAAAAAAGATTGTATTTTTGGTTTTGATTA
GGTTCCTGGTGATGTTGTTTTAGATCTTTCCAGCATGACTAACCAAACGATTAAACTGGGTGGCGGCCTCCAACAGGTTTTTCCTCTCAGAGCTTTGATT
TCTGTCTCATGGGTTTATAGATTTTTGTTTGTGGCTCTTGTATATACAAATATTAGCTTAAAAAAAGGTTCTTTTTATGTTTTATACACTGTTCTTGCTT
TTTTTTTCTTTCTGGTAAGTGAGTTGGAATTTTGTTGTTCAGAGCACCAAGAAAGTTCCTTCTCACATTCAGGGAATACATTAATTCTCTCACTGATTTT
GGATTATTACAATTTACTTGTTTGATACACCAAGAACTCAACATTTGTAGGCACATAGTTCTTGCTATTTTGAAAAAAAAATTTGTTCTTTTTCTCTCAT
TCTATATGTATCAAAAAGAGACTTAAAGCTAATGTATTCAAAGCTAGCTTTTCTTGCACTTTACCTGTATATGGTTATTTTCCTCTGTGGATGATAGTAC
TCTATTCAGCATTATACTTACTGTGGCTCTAAGTATAAGGAGGCAATGCATCAAAAGTTTATAAATTTCTAACTGCCTTCAAGATAAATATATATGAGGT
TCTATACATATTTTTCCCGTTTTGACAGGATCATGATGCTGTAACTGTCGTCAAAGCAGGTATTTTGAGATTTTCAAAGCCAAACAAGTACTGGATTGAA
AGCTCACACAAAAGAGTGAGTGGTGCTATCTTTCTAGAATTATCCAAGTATCACTTCTGCTGTTATTTTTTTGTAGATTTTATTGGAAAATTCCAGTTTT
GTTGCTTTTTACAGGTTGTTGGCTAATATTTTAATACGTTTAAAGTAACCTGAAACTATTTCTTTAACTCAGCATCTTCTCATGATTGAAACAGAGATAG
TAAACTGCACTTTGGATTTTCTCACAGTGAAACTCTAAGGGAATGTATATGAAATTAAATAAAGCAGCATGTATTCACTGTTTAGGTTGAAATTTTGATT
CACTGCTAGAATGAATGAGCCAATGTGCGTTATGGTGGATCTGCAAACTTTATATGTCCTCAACTATTGCACAAGTGAGTTAATGCTACTATATTAGAGA
GTTAAAGGAAGATATCCAATTCAGAGTTGCAGAGGTCCTTTATGTTTTTTCTTTTGCTTAGTTAACTCGGCAAAAAACTTATAAAGGGAAAAAAGTATGA
AATTACAAGGTTAAATGTATTGTTTTGAAATATGGACTAACAAGGGAGCTATAGTACTACCTTATCAAATAGGAGCCAAGTACTAATGATTCCATCAGTG
ACTACTCAATTCCTAGATTTAACCCTGCGATACAACTATTTTAGAAATAACCTTGTTCGGTGATAAAAATTAGGATAGTCTCTTCTGGTTGAATTGAAGT
GTTGAACTTTTTTCTTTAAAGAATATCAAATTGAACTTTCTTTGATTTGCTGATCCGCTGTTATTTCTTTACAGTATATACCTACCGTGGGGGATGCTGT
CCTTGGAATTGTGGTGGACAAAAGAGCAGATGTAAGCATTCTTCAGTATTTCAAAACTGTTACTTGTTCTTCTTATAATAAGCAATGCCACTGTTTATTG
TGATAACCTCCTTATTTCGGTTTCTGGTGAATAGTTATGTCTACTTTGCTACTAGCCGTGCCCTTAATTCTACTTTCTGCAGCATGAACTCTCTAACAGC
TGCACTTTTAAGTAATTGAGTATGTTATGCATTTAAGAACTAAATTTTTTCAGTATCTCACTATCCTTTTCTTTTTAATGAGTTTAAAAGTCAAAGCCAA
GATGCTGATATTCCTTTTTTGATATATAACGACCTTAACTTATTAATCTCATCATCTTTTGATGAGTTTCCTTTGATGCTGTCAAACTATCCACTTCTTC
TATTTGCTTTATACGAAAATAGTATAATTGGTGCTTTAACTGGGAGTTTCGTGCTGCTCTGATCTTTTGCTTTAGTGTGTCTTTCTGCTTCCTGTTTTTG
ATCAATCAGATCTATGGTGCACTTATCTAAGACATAATAAGCATCCAATATATGTTGCTCCTAATATTTGAGGGGATTTATGTGAGTTGTTGACTACTTA
GTTTCATTTGTTACAGTTTGGTTGAAGTCAACTGTAGGGTTTTAGGTTCTAAACCACCATGTCTCTGGTAAGGACATATCAGCTGTAGTTGTGTAAAAAG
GGAAGGGTAGTGATGCAAGTCTGCTGGGAAATAAGTTCTTTTTAGAGTATGTGTTATTGACCATATAGAATGACATTCATATTAATGTGGTGGCGAGTGG
TGACTTATGTTGATCATTCATTATACAAAATTACATTCATTGAGGTAAAAAAGTTGGTCCAAAAAATTTCTATCTGTTTCTAGTACTTATGATGAGAGAT
TTCCTGTGTTTGTCTATTTTTCTGTCATTTTCATGAACACATCAAGATTTGTCACAAATGTAATGATGGTCCATGTAGCACGCATAAAATCTAAAAGTTC
ATTGATTCTTATCTGAAACTGCAGATTATGTCATTAAGATCTATGATTTTTCCTTATGAGCTTCAAATTCACTTTTGAGTTTTCTGGCAGAGCTTTTATG
TGGACATAAAAGGGCCAATGGTGGCGTTCTTGCCAGTGCTAGCATTTGAAGGAGGGACTAGGAGAAACATACCCAAATTTGAGGTGATAATCCTAAGTTT
CATGATATTTGAGCTCATATTCTTTGTTCTTTTCTCATCTTATGTTTCATTATGATAGAAAATACTTGTACCAAAATGAAGATATTGTTTTGCAATTTTT
ATCTGATTATAAATTTTTACTCTATGAATCTTGATCATTTGAAATTGAGTGACAGCTTTATTATTTAACTCAAATGGAGATAGATGTATTGGAAGACTCC
ATGTAAATGGGGCAAACTCTCCTCTCCTCTAATTGAGAAGTTTAATTTTATTAATTGCTGGTTGCTTGTTCGAGAATTGCTTGATGTGCCCTCTTCAATT
AGAAGATATCATATTAGTTTGTTGATAGCAATTTAATTTACCCCCTCCCCCCCTTCTTTTTGTAAAATAAGATTCAGAATTTAAGGGGAGAAATTGTGAT
AAATACCTCTGGGAGCAGTTCTTTCCTTCATGTGCAAGCAAATTCCTCAACTACTTGGCTCATAAGTCAGTGCTTGTGCCTCTTAGAAACTGGCCTCAAA
TTGCAAGTTCATTAGTATAGATAGTTTTATGAGTTATTCACACCCACTTAGAGCTTTTCATGTTTCATAGGGGGTGAGGCAGAGTATTTGCTTGAAAATA
TGCCAGCACCGATGAGCCATAGGATTCTTCTTAATCAATTTTTTTTAATGCACCATGTGTATATCAATGACTATTTTCTGATGACCTGTCTTGGAATTTC
AGGTAGGTACTCTAATTTATACTCGTATTGTCAAGGCCAACCCAGGAATAAACCCAGAGTTATCGTGCATGGATGGTTGGTACTTCCTCTAAGTTGCAAA
GAATTTCTTGAATGCCCTAATCTATCTGCTGTTACTCTTGATTTTAATAAAATCATCTTATTCGATACAGCTTCTGGAAAAGCTGCCGAGTTTGGACCCC
TTAAAGATGGCTATATGTTTGAATCATCAACTGGTTTGTCACGGATGTAAGTTTCTATTTTGGCTTTCACTTGCAACAGTGAAATCTTTGGTTTAGATTT
TACTGTAACCTTAACTTGCTCATCAGAATAGAAACAAGAAAAAGGGTTGAAGGTCTTGTTGCATGCTATTCCCTTAGCTACATGTTCATCTTTTTGTATT
TTTTTCCTAGGCTGCTGAGCTCACCAACATGTCCAGTTCTTGAAGGTCTTGGAAAGAAGCTAGCTTTTGAGATAGCTGTTGGTTTAAACGGCCGTGTGTG
GGTATATATAAATCTGTTCATTCTCTATTTATTGTGGTTGATCCGTCCATCTCTTTCTAAGTCTCAAATACTTTTGCCTCTATTCTCAATTTAGATACTT
GTTCTGCTGTAATAGGTAAATGCTGAGCACCAATCGTCAATCATCCTTGCTGCGAATGCAATAATGAACTCTGAGTCCTTGACCTCAGTGCAACAAAAGA
TTATGGTGGAGAAGCTGCTTGACAGAGTAAATTGAACTGGATTTAGCATTTCGACCACATAGCCTCTAGCAGCCAAATGATGTGATGGATAATGTGATTG
TAACCAGACCGCGGAACATAAATGTTACACAAGCTTCTTCCTCATGGACTTTTAGCCTGCGGCTTTCCAGTTCATCACTCATGAAACCGTCCTGCTTGTT
TATGTGATTCTTGTGAGAGTATAGAGAAAAGATGTAACATTATTAGCAGAATTGATTGTCCATGCAAACATTTTGTCCATGGTGTTGTATTTATTCTTCA
AATCAATCTTCTGTCCCTCTAAACAGATTTACATTTTTCGGCTTATCAGTCTCTCTTTTTTCTATTGTGGTTTCTGTGTCAGCCTGCATGGACCTTGACT
CGTTTAACAAGGTACTTGTTACCTTCACCAACTCGGAGAAAGCGGAGCAAGAATATATTTGATGATTTCTAAGAACTTTTAATTATTTTGCCTTAGGTTA
CTATAACATGCAAATCTTAATATATTTTTTTCTTTTTAAATGATTGGTAAATTATGTTACCTCTTATAATTTTCTAGGTAAGAGTACCACACAACTTTAG
CTCTCAAGACTAAAGGGAACATGCTACACTAAACTACATTTTTAAGTTTTAATCTTTTATCTACGTAATAATAACTTTATCAGTTACGTGTTAGACTAAA
AATAATGAAAAAGAAAAAGACAGAGAAAAAGGAGCTTGACTCTTTGAGGGCCATGTTATCTGCAAAGGGTTTTGTCTTCTTGTTATTTTGTATATCAATA
AGCAATTTCGCACACAGAAAAGCTAGTAATAGCATTTGCTTCGAGATGAGCAAAATCCACTTGTGGGTTCTGACATACTATCATCAATAATCAATTCGTC
TTGAGGTAATTCGGTGCCTATTTCTATGTTAACAAAAAAAAAGTTTGGATTTTTTTTCCTTTTCTTCTCTTCTCCTCTAATCTTGGCATGTTCTTTTTCT
TGTACTGTTCTTGAAATTCAGTTCAATAGGAGTTGGATAACATGGCGTCTCAATCAGATTCTCCACCCAACTCCGTAAACGAGAATACCCAGAATCCAGG
TACCCTTTTAGTTGCTTTTCTTTGATGAAAGTTGTTGCTCTGCTACTGTTTAGTTGATTCTTGAATATCAGACAGAAATAGATCGTGATGTTTAGTTATT
GCTGCTACTTTGTTATCTGAAAAGAAGTATTTGCCATAAAGATCGAATCTTTTTGGACTTTATGATGTTTGTGCCTTTTTGTCTTTAACTGGGATAGGAG
CATGTAATTGTGCTTCTTTTTTCTTTTATGGATGGTTGCTACTTTTGGTTTGTTAAGCAATAAAGTAGTACTAACTTGATATTGTTACATCTAATGATCA
TTTGTTTAATACTGTAGCTTGTGTTGTTAGAAGCCGTATGATTTTGGTGTAGTGCAAATCTTCGAGATAATTAGGTTTTTTCTGTGTTCTTAAACATTTA
CCTTAGCAACTAATGACAGGTTTAAGCCTAATGTTCTTAAATAAATGGATTGATTTGATATCCAGTAACTGTATATAATGTGCATATTGATAACTAGGTG
ATTTTGTTTTCAGTGTGAGGCTTCTGAGGATGGTAGGTTCATTAACTAGATAATTTTCTCTACGAGGCTTTGCACAATCATAGATTAGAATGCACCAGCA
AACCCTCTCAACAAGAGAAACGATGTTGTATGAAATAGATAATTTGATGCTATATCGTGATCCAAACTTAAATTTCTAATTTGAAGCAACAGAGAATTTC
ATGATATATCGTAATCCAAGCTTAAATTTCTAATTTGAAGCAACAGCTTCGCAACCAGCAGCTGAAAATCATCAAGGTCCCAAGCCTGAGGCTGCAAGTG
GGAGCTCTCCAGCTTCTGTGTTTGTAAACTCGGAACCAATTCGGGAGGACCAAGTCCAGAATGCTATGAAATTTCTTTCACATCCAAAAGTTAGGGGATC
TCCAGTCATGTATAGGCGTTCTTTTCTTGAGAGGAAGGGGCTTACAAAGGAGGAAATTGACGAGGCCTTTCGTCGAGTTCCTGTAAGCCACATTTAGATT
TTTTACATTTGATATTGTCTTAAATGTAACTGTAATATCTACATGAAATTTAAGATATATATTGATTTTGTGCCTAAATTACAGGATCCTACCCCAACTG
TTACTAGCACACAGCCAGTTGCTGCTAATGAAGGTAATTCATATTGTTCTCGAAATAAGTTTGGCCTTTTATTCTTTTCTTGAGATTGATACTGTTTGGA
GCCTATGCTTGTCATGTTGTCCTGATATATTGATGACAGATGGGACACAGAAGCCTTCATCGACTAGTACATCACAGGCTGCTTTACAAAATCTGCAGCC
AGCGTCAGCTCCGAGCAATAGCATGAAAAAAATGGGGTATCTCTCTCATTTCCATTGGACTCATGCAGTTATTGCTGTAGGTCTACTCGCTGCTTCAGGA
GCTGGAACAGCTGTACTTTTCAAGGTATTGCATAGTAAAGAGCTTTCTATTTATCATGCCAATCCGTACCATATTGTACTTTTTCTTCTGTCTATTCCCC
ATTTCTTCAGTGTAGATTTATTTTTCATAAGCGAGACATCTCAAACTTTTATTTGTGGTGGTTCAGTTTATTATTAGTTTAGTAAATTGGTTGAACTTAT
TGACCGAAACAAAGAAAAGAAAAGAAAAGAAAAAAAGCCTAATGATTTCATACAAATTACAAAAGGTGGTATTTGATTAATGATGGGTATCTCATAGATG
TAACTCTGGCCTCTCATATGTGAGGAGCTTGCATGGTGATGGAAAATTTGACCACGCCTATATACTCTAGATGCAGGTCATTTCAAAAAAGCGTGTACCT
TAACTGAAGAACTATTTGAAGATTTTTAGTTAACCCTGTTCTGACTTTTGTGTTCCTTCTTTCTTTATTATAAATATCCCTGTTATGAAGATTTTCTTCA
GATTTATTTGGTCTCCTCCGATGCTTTATCTTATTAGATCCATCTCTAAAGTAGGATTCTGGTGCTTATGACAATCTATTGGAAACTTTTCTCATGGACT
ACTCACTATATTTATCACCCACTGTTAAGTGACACGTCCATTTGCAGAAATCTATTATTCCCCGGTTGAAGTCTTGGATACGCAAGGTTGTAATGGATGA
AGAAGAAGATGAAAAAGGTATTGTCAAGGGAAAACCAAGTTTAGCAGAAGAAGCTGCTGTTGCTGCAAAAGCTGCAGCAGCTGCTGCTGCTGATGTTGCC
CGAGCAAGCCAGGAGATGTTGGCATCAAAATCCGAAGGTTGGTAATGTAAATTCTTATGTAATAACAAGTTAAGAACTGGATCTGAAATAAAATAAACTG
AAATATTGTTCAACATTGGTGACTTAAATCTTTCATCCTCTTTCTTATCCAGTGCTTATTTTTTTTTACCATCGATAATCATGTTGTGATTTAACTTGTG
TTCCTCCACAGAGAAAAGGTATTTTGAGGAGCTGACAAGCCTGCTAAACTATCAAGTACGTGAGATGAAATCAATGACAAGTGCTATAGAGAAACTGGAA
GGTGTGCCTCTTCATTTGCTCTTGAAGTAGAAATTCTCTACTTAATCAATAGGTTTTTGCATATTGACCATTTTTTGCTAGTACATGAGATGAAATCAGT
GACAAGTGCTATAGAGAAACTGGAAGGTGTGCCTCTTCATTTGCTCATGAAGTAGAAATTCTCTACTTAATCAATAGATTTTTTGCATATTGACCATTTT
TTGCTTTTAGGGGGTCGTGTAATTTAAAAAGGATGTGTTATGACACAAAAGGGGGTTAGAAAGGAGGTAAATTTTGGCGACCTGCTGAGAAGTAATTAAT
AACTTGATTGTTCATAACTGAAAGAGCAATGGAGAAAGATAGAGATAATAAATTGTGCATAACCTGTATAATTATAGTTTGCTGATTCCAGCTTCAGCTC
CAGCTGATTACTTTTTGGCTCTAGATCTTTTTGGCTCAATAACCTTGGTGTTCGAATGTCATTGTTTATATGAGGTTTTCGTGGTGCTTTACTTGTCAAA
ATATTTTTAGTATATGTGATGATACTTATTTACTTGGGTGGTTTCTGTAAAAGTTTTTAACTCTCAAGCCACAGAATGAAAACTTGTGAACTTGTTCAAA
GAATCATTTGAAGCTTCCTTATGGAGGATCAGGTGGGCTTCACCTATGAGAATTTCTACCAATTCTTCTTTTATTCATCAAAGCTCATCCTAATCTCCGT
CGAGATTACTGCCTTAGCCCTGTCCTATCATCTGTATAATGGAGTTCGTCTAATGTAAAAATGGAATGTAAGTAGGCGAGGGGGCGGATGTAGCCAAGTG
GATCAAGGCAGTGGATTGTGAATCCACCATCATCTGCATACCAGGGGTGGCTATTGACCTCTACATCTCCATAAAATGCATTATAGCATGAATTTTTAAG
TTCTTTCCTTAAATAACGTTTCGGTTGTTGGTCCCTGCAATTCTGGCTATGTTCTTTCTCTCTACTCCGTGAGTTCTTCCTTTTACATATACAGTATTAG
CTTCGTCTTTATTTTAATGTTTTCATTGCCTTGGAATTCTAGCAATCATAAGGTAAATGTCAGGTTCTTTAGATTTTTCATGTGTAGCTTGGATTTTATA
TGTCATGCACTCCCTGACCCTTAGGGTGGGTATCCCAACTCTAAAGGGGAAGGGGAAAAAAGGGATCCAGATCCTCTTCAAACAGGAAGTGGGTCCTAAT
TTCAGTGTTCCGCTCATGCAGGGCAAAGTACTACTTCTGGAAGAATACCTGTTTCGGAACTAGATGATCGAAGAATTTCAGTTACTCAATCTAGGGTAAG
CTGTGTAGCAACAAAAAAGTCTGGATCTTGTAGTTGATATCTCTGTCGACTTTTAGGATTCAGTTTCTAATGTTCTTTTATGCTCCAGCAATCTTATGCC
AATGGAAAAGTAAATGGTGATGCACATTCAGGTTCTACTTTCTGTTTCTAGCTGGATTTTTTTTTTCTCAAATCAATTTTTATTGATGATTTAAATACTA
ATGCACATGAGTGGAATATTTTATACAGTGAGATCTTTGTCACCACCTGCATCTGTTGAACCATCTGCTGCACCCCATCCAAAGTCTTATATGGAGGTGA
CTCTTATGCTCTCTGGCTTGTTAGTGTATTTCCTAACTGTCAAATAATCTATTAGTAATTCATCCTATGTTCTTGATTTCCTTTTGGTTTCCCAAAAAAA
ATAGTTCTGCTTGGATAGATCTGGATCATTAGGTAATTGATGGAGTATGTAGACGGGAGGGCGCCCAGACAGTATTATAGCCAACTCCCTTTAATTATTG
GTCCTTTACTAACTTTTAGCTCATCTATTAGTAATTTCATCCTATGTTCTTACCATTCTAAGAAGCAAATTATGCAACTTTCTGGCTGGTGTGCCAGCGA
TTAAACACTTTCCTGATTACCTTTTGGATTCCCGTAGAGTTTTCCAAATCAGCTTTTGAAAAAAAAAATAGTTCTTACTTGGATAGATTTGGATCACTAG
GTAATTGATGCAGGGAGTGTATGGATGGGAGGGCGCCCAGACAGTATTTTAGCCAACCAGATTATCAAGGATCTCTTTTTCCCTGATCAACTCCTCTTTA
TTTTTATTTCTAATTTCATATGCGAAGATTCTTTAATCATGCAAAAGCATTGGCTTCTCTTCTTCCAAGCTGGAAAGACAAACTTTAGTTAAAAAGAGGT
GCTATATGTGTATGGCAGTAAGCAGTCACAACTCATGAGATCTGATAGTATTATGATTTATGACAGCATTTGGTAATTGTGATAATTCCCCCTTGTAATG
TAGTGCATGCGTCTATCTTTGAACAAATCAATGAGTAGCACCAGTTGAACTTTCTTTCTCTTTAGTTTCAAAAAAAAAAAACTTTATTTCGCTTCAATGA
AGTTGCTAGTAAAATGAGTCAGATGCTTGCTGGAAGATTTAGGTAAATCGGCTCTTCTAACTTCATTATCATTTTACAGATTATGGCTATGGTTCAAAGA
GGAGAGAAGCCTCCCAACATCCGAGTAAGTCCATGGTTCTCACCAGTGGCATTCTTGTATCTTGAAAAGTAATGTTTTCTTGAAGGTTTGTACATTCATC
TTTCGATGCAGGATATAAATGATCAGCCACCAAATCCTAACCAGCCTGTACCTGATCGTGTTGCAGCAAAGCCTAAGGTTTGTCTTGTCCTTCTGTTTCT
TCTACCAACAATGTTGCAATTGGGTCAAATTTGAAGGTTGGATTGGGTCAATTTAAGAATTGTCTCTGCATGATTGACTTTTAAAAAGAACCTTAGCCAC
ATTCTGGCAGCTAGACGTGAAAAATACGATTTACTAATCGAATCTATAATCCTATTTAAGTACTTCTTTTGATGAATTAATCACTGCAACTAGGATATTT
CAGGAATATTGTATGGATTAAGTTCTATGAACACCTGTCACTTTGGTTTGGATACAAGAGTTATGGTTTACTAGATAGAACTTTCTATTCAATACATTCG
GCTTTTTTTCTTGGATTGTCTGGACGAGAGGTGGGATTGGAGACGGGCCATATGCAGTTCACATGTAAGATTTACTCGAAGTGGCAATGATAACCATTTA
ATAATCTGTGCTTGTGAACAGCCTTGGGAAGTTGGCCAGAGTCAAAATAATTCCAATTTCCTTCAATCTCAAGGGAGTGGCGATGGCTTGAATTATGGTT
ACCAAGACAATCTGACGAATGGAGACAATTCAGCACCTTGGTGGCAACGCAAGAATGCCAGGATAACTGAAATCGAAGCTGAAGGTGAACAAAACTTTGG
ATCTCCAGCTGCACCAGTTCAGGAACGACCAATTCAGAGATCATGGGTTCCTCCCCAGCCTCCTCCAGTCGCAATGGCAGAGGCAGCTGCAGCCATCCGC
CAACCTAAAAAGTCTGCATCTCAGAACGAACAGTTGACTGATGATCAGTTGTTAGCTCGTTCATCAGATGAGTTGCAGAGGGTTACAAGAATCTCCGAAT
CTGGTGGTGCCCCTGAAGCTAATGGTTCGAGTTCTGGCCTACAGATGAGTGAAACAACACCAATTGAAGAAGGTGATCAAACTTTCAGCAGCTGAAATAT
CATTTAATTTCCTTGATATAAAACGCTGGGCATTCACTATTGAGGTTCATCACGATCTTACAGCTACACGTTCTTGATAAATCGAGCCTCATTTCGTGTT
TACCCCCAAGTTACATTTATCAACTTTTTGGTATATGGTTGTCTATTCATTACACACTCTAAACTGGCTGCAGACTTAAGAATTGTATTTATATAATTCT
ACAGTTTGAATAAAGGTTAGATTATGTGAATAACATAATTCATGTTCAGTAATTTGGTGGATACAAAAAGTATTCTAATAAATCAAAGTGTGGCCTAGTG
GTCAAATGTAGTCGGTTGAGAATACTTATTCGGTCATCCATGATTTTTGTCTGTCTGTCTTAGCTTTGATGGACGAAATTGTCAGATATTTAGTCGAGGT
AATGCATAAATTGGCCTGACCTCATAAAAAAGGAAAGAAGAAGTGCTCCAATAACATGAATCATGGGGCCCTATGTTTTGGTGAAAGGCACATATCAATT
GCTCAAAAGTAGAACAAACTTCAAAATTATCTACAGGCACCTCATAAGAATCTTATCCTTGTCATTATATACTTTGTAGCTAGGAAGTTCACATGTTATA
TCAGTAAATAGAGCTTCTTTTTTTAACTTTCTTTTTCTTTATTAATTCTAACTTATGACTAAAAATAATATATATTGATATATTATTACTAATTCAGATT
GCAAACAAAGGCACAAAAAGCAAATAACAAGATAAAGAATAAGAAATGTGTACACATCAACTTGATTTTTATACATGAGGTCATTGAAGTGGTTGTTAAA
GTTATTCTATATATGTTAGAATTTGAAACTTCATGATACTGACTAATTCACTGGTAGGCATTATTTCTATTATCAAAAATTATCTAGTGCAAGTATTTAA
TTTATTATTTTTTAAAATGAAGTCACCATATTTCTAAACAAAAAAAAGAAAACAATAAATCTTACCAAATAGGCCACTTTTTTCCAATTGAAAACTAAGG
GCCCGTTTGGATGGGCTTAATAAAAGCAGCTTTAAAAAAGTACTTTTGAAAATGCTGAAACTTATTTTTAAAATAAGCAGTTATGCGTTTGGATAAAAGT
GCTGAAGTTAAAAAAAAGTTGTTGAGGTGTTTGACAAATAAGTGCTGATAAACAGTTTTTAAATCAAAATGTCTGAAATACCCTTAAAAGTTGTTAACAT
AATAAAAGTTAATTAATTTATATTTTATAGCCATAAATAATTATATTTTGCTATCATTCACATATTTCTTTCTCATCACAAATTATTTATAAGAGGAATA
TAAACTTATTATAGATTTTAAAGATATATAATTTGAATAGATCAAAGAACGATTTAAGATTTTATTTTAATTTCATCCATAGGTAATAATAATAGTCTAT
CATTCACATATTTCTTTATTATCACAAATTATTTATAAGAGGAATATAAATTTTTATTTAAGTTATATGTGCAACTTATTTTACATTTTAATAATATATA
ATTTGCATAGATCACTTGAAAGATTTAAGATTTATTTTATTTTCATTCATTAGTAATAGTAATTGTCTATCATCCACACGTGAAAAGGGAAAAATAGAAG
AAAGAGATGTTAGGGTTATGCGGGTAATTTGGAGATTGTATAAAAATATTAAGGGTAAAAAGGTAAAAATGTGGTCAACTTAAAACAGCTTATAAGTTGG
AAAAAGAAAAACACTCCTACCCCAGCTTTTAACTTTTGGCTTAAAATAAGTTTTTTTTTTAAACTTAAAATAAGTTATTTTGAGGATTGCCAAACAACTA
AATAAGTCAAAAATTAGTTTTTAAGTTAGTTTGACCAGCTTTTAAGTTGAACCAAACAAGCTCTAACTAGAATGGACCACATAACCTAAATAAAAGTTGT
GATCAAATTATCCACCCATTAGTTAAGTAGCTTTTTATTAAATAATTAAATAACTTTTTACATAGATAAATTAAATGAGCATTTAAAAAATATAGAGCTA
TTTTGAGAAATTTGGTTAGGTTTCCAAGAAGTTGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCACGCGAGATTTGATATACAAATATTTTATTTCGATTCAATTGTATACAAATTCAAAAATT
TTATACAGATATACAAACACAATCTTTGATACATATATATTGTAGTTACATATATACAATTATGTCTGTCTGCGATGTATACAAATCTGATGCACTATAA
CAAAAATAAAATAGCTATAAAGCGTAATTATATTATACAAACTATAAATATGACATACAAATATATTTTTCATATTTGTCAACCTAAATGTTACTCTTTT
AATTATTAGACACACAGTGCTTTGTTTAAGAAAGATCGTGTGTTAAAAGACTCTTGAATATGTACTTGTCATGTGATCTAAAATATGCCGATTTAACCAT
ATGACAAAATTATAAAGTGGAAATATATACATTTAATCAAATTATTAAGTGATTATTGAGAGTATCAAAGACATTTTGGATTGTTTATTTAGAAATTATT
AACATTTTTATCAATATAACTTAACACCAATTTGTATTATTAAAACAGAAAACAATTTTTTTTTTTTTGGTTCTTTTTTGCGACAGTGATTTTGATTGAT
GGACTAACAGACTAGTATGAATTGGACAATCATATTAATCAAAGTAACAAAGAAGTCTGAACATAAAATCAAATCATCCACTTTTACAGCACTGATTTTT
ATACTTCCAAATAATTATAGCCACGTATATATGTGTTCAATTTTTATTTTTATTTTTAAAAAAAGAAATATAACTTATTGAAATTCTGAATATATTATAC
AAATAAAACTTTTAGATGACAAAAATAATTACTGAATATTGTCGACTCTGTAGATAGGATTGTATAGCGTGATTGATGACATTCCTTTTCTTTTTTATTC
GTATACTTTGTTTGGTTATGAAAAATTAATTCCCTAATTAAAAGTATGAAATAGTTTGAATTATTTGTAGTAACTTTAACGCTTTGTTTGTAAATTTATT
GTATTGTATTGTACTCTATTGTCCTGTATTGTATGGTAGATACAATGTTTGGCTAGACTGTACTGTTTGTTATTTTTTAATAACATTTTAATTGTTTGGT
TTGATCGTATTGTATTGTAATTTATAAATTTACTAAAAAATCCTAATTATTCTAGGGTAGGAGATTTGACTAGATTTATAGAATTAAGATAAAGGGTAAA
ATATATTTTGAAATATTATGTAAATATATAATTAAAAAAAGATATTAAGTAACAATGGAAATACACCAAATTGGTTGTTTCATAAAATAGGGATTTTCAT
TGTTATGTAACAACGAAATTTAACGATACAATACAAACATTTTAAGTAACAATCAAAACAAACATTGTAGATATAGTGACAATACAATACAATACAATAG
GTAACAATGATCCAAACATAATGTTAGGTAGATACCTAAAAAATCATTTGGCATAAGATATAATGTATAATAATTGCAATATAAAATGTAGGATTATCTT
GTTACACGTTTAGTTTGAGGTAATATCAGTAAGTAGTCCTTAGATTACTTATTCCACCATTTTTACCATAATAATAAAATAAATTATCTTACAACTCATA
TGCATAATAAAATAACTTATTTCCAATCAAACGACAGTACGAACAAATATACGCATGCTCAAAGAAAATAATGAGCGAAGACTAATATTGTTCAAAATTC
AAATAGACAAAATCTTCAACTAGTCGGTGGCACAATCTTTCATTGCACACGCCGTTGTGAACTTGTTATATTCGATTATTCTTTCTGTCTCAAATTATAT
AACGCAATTTAATTAGATATAAAATTTAAGAAATATAAAACTTGTTTTTGTAAAGTTTCAAATAAATTTTTGTATTAAAAATTATATATTAATAAAATTT
TAATTTCTTTATATAAATAAAATATTTATAATATGATTAAATATTTATCAAATAAAAAAACCGACCCCAACATGGGTCCATTCATGAATTGTGACAAGCC
GACCGTGCGTCTATCAGGCTGTCGCATTTGAGTCACTTAATTATTTGTATAATATTTAATTTTATTTCCTAATCGTCTACAATATATATTTGGTTCTATT
CTTTTGGACATTAATTAATTATCTATCAATATGCATGCATGTATTCTTTGTTTTTAATTTATTTTATTTTATTTTATTTGAATTTTCAGTGTTTGATGAC
CTTACAAACTCACACACAGATAAGATTGTGTTGACTATTGTTTTGCCCTTACAATTGTGTGTTCATACTCTCTATTTTAACTTTCCAGCATTTGGCTAGC
TATCTATACTCTTCTTTCATTCTAATATTATTATACCGGACATATTATTGTTGTTACGCAGATACATCATATACAGTTAAAATAAAGGAACGTGTGGCGA
TGTATCCGATGGAATTGTATGAGTTGATACAATTAGGTTGAGTGAATAAATAATAATGTATTTAATGAAATTGTATGTGTTGATATAAATTAGTTTAAGT
TGGTCCATATTTTTACTTTTTGTTGACTACTTTCAAAAGAGGTAAGATCCGGTGAATCGGAAACAATTAATTAAGAATTCAAAACTTTTTTATGGAACAG
ACATATGAATATGCGTGGATCATACCTTTCATTCCACTTCCAGTACCTATGTTAATAGGAGCGGGACTTATTCTTCCTCCTTCAAGTGCAATAAGAAGTA
GGCTTGCGGCTACTACCGGTCTGGGTGGACTGGAAGTGCATAAGTAGTTGTGTCAGCTGTTGAGTTTGACTTCTATTACAGGAGGAGTGCTCTCTCTCTT
CTGTGTCAGCGAAGGAAGGATAAGAGAAATCGGCCGAATGATTGTTATTCCACTTACGATTACAGTGCCTCTATCGAAGCAGTGCAACTAAAGAGGTAGC
GAGACTGACCGCAATTTCAGGAATAGGTTGACTTTCTTTCATTTTTTATTATGGAAAGTGAAAGTCGTTTCGTTTAGTACGAGATCTAATGTATATAATG
AAATTGTATGTGTTGATATAACTAGTTTAAGTTTCAAATAAAATACGTCCAACTAAACTAAAAATATTTACATCAAATTTTAGAGAATGTATAATAAATT
TGAGTGATATATAATTCTCTAACGTAGTATTATGACGAGTATATATATATAGAGAGAGAAGGTGTGTTAAGATACAAGACAAAGCAGACAAAGGAAAGTT
GATCGAATGGTAAGCGATCCTCACCTGAACTTCACTATTGTTAGTCATTACTCAAATAGTTCATTTGAGTTATTTTGGGCCTCCAGGATAGAATATTTGG
GCCTCAAACTATTAAACCAACAAGCACATTTTCGAAAGTGATCCATTAAAGCTTTGGTCTTTTTTCTTATTTATTTTTTAAAAAAAAAAATAAAAATCAA
ATGCTAGAATTAAAGCTTTGGTCCATACAAATTTAATTAAACGAGTATGAAGAGCACGTTTTATTTTTGGGAAAACTATAACTGTGTGTTTAGCCGCCAA
CAAAATTATAGCCAGAAACAACTAATTATTATTTTTTTTTAAAAAAAAAATATATATATATAGAAGAGTTAACCTAAGTAGCATTTCCCCCAACCACTTA
AACTAAAAATAACTTGACATATATATAATATATGTATATATATATTTATTATTAAAAAATTATACAAATTTTACTAATTACATCATATTTTTATTATTTT
TTAAATTATAAAAATATCTTAAAATTTAAGAATTTCGCATACATCAATCAACGTCCCGATACATTGATCCTAATATATTATCTTTATTGATACAATACAC
ACCTATCCCGATCGCTCATGGGTTGAGTGGTGGGTCATAATGGGATAAGATACCAATCGGGTCAAGACCCAACCCAACCAACCCAAATTTGCTTGGGTCA
AAACGGGTTAGGTAATGGATTATATAATGGATTAAGTCCTAACCCAATTTTTAATAAGCTTAATGATTTGTTTTTTTTTTTAAAAAAAAAACTATTTTAG
TACTTAATAAAAATCATTTTTCTTTTTATAATGACTATATATATAATAATATCAAATTAAAAAAAATAGAAAATATTTCGACAAGATTTCTCATGAGTCA
ATTTAATTACATATTAGTCTAATTTTTAATGAATTGAGCTAATAAATGAACCGATCAATCTCTCCTTTTAAATAGTCTTGTTTGTGGGCCGAGTGCAGTA
AAGTTAAACGGGCCTGATAGCTTGGACCTCACAATGGAAAATGGGAGCCCAAAGGGTTTTGTAGAGACACTAGACATCACTTAACTAAAGGAAAAATTAC
GTAAATTAATATATTTTAAAAAATAATTATTGATTTTAGCGATATTTTTTTTATTCTCATTTATGGCAATGTTTTATTAAATTTATAATATGTATTAAAA
GTGAATTATGTATGCAATATATATGAATTATAATTGTTTTTTGAAATATATCATGTTTGTTTGGTAAAAAATTGTCATGTTGTATTATAAGTGTATTAAA
ATGTGGATAAATGTATTATTCATCATTAAATTTGTATTAATGTGAAATAAATTGATTTTTGTAATATGTATTAAACTTGTATTATAAATGAATTAAAAGT
GATTAAGCGAAAAAAAATATTATCGCTATAAATGATAAATATTTTTTATTATAGTATATTAATGTAAGTTTTTCTCAACTAAAAGGACATTAATTAATTA
AAGGGAACTTCAAAACAAATGTAAAGGATCAATTTGTTTTAAACGTCAAACATTTTACTTAATTTAATTAATAAAACATCATTTATTTCTTCTAAGTAGT
AGCTTTAGCTTTGAACTTATAAATAATAATAAAATATGAAATTATATTTTATCATAACTTTTACCTGCAATGGTTAGGCATTAGGTATATATGAATCAAT
CAAATAACTAATATATATATATATATACACAATATACGTACATATCTACTACAATTTCTACATCATATATATATACGCATTGACTCAAAAGTCAATTTGT
AATTTCTACCAACTTTTTTCTTACTCATGATTCATGAAATTCAACAACTAATCTTTTGGTTTTACACGATTATTAATCCAATAATCTTATATATAGTTAG
ATAGAAAAAAAAAACTTCTAATATATATAAATAAATAATATTAAATCGCCACAACTTTAGCTAATTATAGGTTTATTACATTTTATCATAACTTAATTAC
TTGCATATAATATAATGTGCATGCATAAAATAAAAAGGACAACTTTCACATATAGCAAATAAAGAATTTCATATTTGTATGCTAGAATAAAATTTGTATA
ATTACGCTCTATAGTAAACATATAAACTGTATAATTCGCTATACATATACAGTTGAAACAAATTATATAAAATGAAGTATATAAAACAACAAAGAGAAAG
ACACTTTGGCAGAGAATTGTATAAAAACGAAGTGTATAAAACGAATTGTATTATTATAAGTGTATAGAACAATTATATACAATTTGAATTTATATAAAAT
GAGAGGTGTGATCAGTCTCATCCGTGTAAGAATTAGGAATTCCTCTAAGAGAGAAAGACAAAAGAGACTTGACAAGGAATATACAATTGAATCGAATTGT
ATAAAACGAGAAAGAGAGAAATTACATATAATTTGAAAATTGTATAAAACGAGAAAGAGAGAAAGGCAAAAGAAACTGGGCAGGGGAGTATTTTTATTGT
ATAATTATAAGTGTATAGGACGAAAATATATGTACTTGCACGTGTATATACAATTTTCTCACGCTTTATACAAACAGAAACACAATTTATATATTTCGCT
TCTGTTTGTATAAGTGAGAAAGGCGAGGGGCGAACGAGATTTGGGAGAGTGGCGAGCGAGGTCTGGAAGAGGGGAATAAAAATATATGTATTTCTACAAT
TTTCTCTGCTTTATATAATTAGAAATAATTTTTATACACTTGTGTTTGTATAAAAAGTGAGGAAGCGAGCGAGAGATTGGAGGAGAGCGGCGAGCAAGAT
ATTTGGGAGAGAGGCGCCTAACAATTTTTTGCAAACGTTTGCTATGGAGCACAATTAAATTAAACTCTAACTACTCCATTTATTTTAAATTATTAATTTA
CTATTATATACAATTTTCTAAAAAAAAAAAACTTATAACTAAAAGTCTTTAGATTGAAACAAAATTTAGCTAATAGACAATGAATGTTTATTTTTTTTAT
TAATAATATTTATTATTTAATCATTGTCATATTAATGAAATTCAATGCATGCATTATGTCATTAATAAAAAAAAAATTTAGATAATTAATCAACTGAATT
ATTAAGATTCTTCGGTGTTCTTATATGAATAATAATCGATCGTCCCTTGTATAAATAATAATGTGAGATTACGCATTCTTTATTTTATTTGAAGAGAAAA
AAGTGTTTCATCATTATGCAAGGGACTTCAGAACTATCTCAGTCTCCGAGTTTAGCTCGTACAAATCTCAAAGAAATTGCTTCAGGAGATGATGTAGAAG
AAGAATTCGTAGCTGAAAATGAAATTGATTCTGAATTTTCCTTTAATGATAATGACAACCATGAAAATCAAGTACATATACCTGATCATGATGATGAAGA
CGATTTTGAATTTGCTTTTGTGACGGAAGGATCGAATCAATTTTCGCCTATTTCAGCTGATGAAATCTTCTACAACGGTCAGATCCGCCCAATTTTCAAC
AGAGATTTATCGTTAACCGATAATAATTCGGAGAAGGTTTCGACTCCGAAGAAGACGAAGTCAAATCGAGTTTCGTTAAGGAAGCTTTTTAACGAAGATT
GTGCTATTGCGTCGTCGTCGTCGTCTTCGTCGGAAGCCGCAGAGTTACAAGGAATTGCTCCGGGAACGTACTGCTTGTGGAAGCCGAAATTGGCGGAAGA
GTCTCCATCTGATCAATTGCGTAAGAAGAGTAACTCCACTGGCTCCTCTTCTAAGCGGTGGAAGTTACGTGACTTCACTCACCGGAGTAACAGTGAGGGT
AAAGATACATTCGTGTTTTTGACAACTCCGTTCAAAAAAAGAGAAGAGAAAACAGAGATTACGAGAACCGACTCTGGAATAATCACCGGAAAAGTTCCCG
CCGTTGAAGATTTTCCGGCGTTGCGTTGCTCGATAAGCGGAAAAGATAAACGGAAGTCCTATTTACCATACAGGCAAGATTTACTAAGCTTTCTGGGTAA
TGTGAATGGGCTAAATCGAAATTTACAGCATTTCTGAGGCTAATTACAGTGAACGAAATCTTCAGATAATTAAATAGTTAATCAGTGATTAAGCATGGGT
AAATAATATCTAATGGATTATGAATGAAATATTGAATTAATTTAACAGGTTATGTATATATTTAGCATCTTTTTCTTTTTCTTCATATCATTGTGCGACC
AAAGTAATACAATTTAAAATTGCATTTAATTCTTCTTAAATGAAATTAAAGATGTAATTAGTCATTCATAAACTTACGTAAAATCCATCAATACAAGTTC
CGAGGACACCTTTACATTCCAAAACATCACCGTCTTGACTAATCTGACAATCACAAATTCGTTTTGTTATTAAATTTTTACCAAATAATCAAGAATGAGA
TTATCAAAAGCAAAGCCACCTAAGTCTTAGCCATATTGTATAGTAGAATTATATTTACTTTTTGATTGATCAATTATCATCGTTTATTTCGTAAAAAATA
GTTTATAAATTTCAGTTACAAGAAAAATTATGTTCCCTGTTCCTATACTGAAAAAGGTAAAAGAATTTTAGTGGGACGTGAACACAAATATCTAAACTAA
ATAGCATAAATAATTTATTATAACATAATATAATACGAGAAATCATAAAACAATAAGTAACAACTATTCAATTTTAAATTATTAGCCATTATCCGCAAGT
TCACCAACCAATAAAACATTTGGGTCTATTCCAAGTTTGCATTCCATATCCGCTATTAGAGGCGGATTTATACGTGAAAGCACGACTTAGTGTAATAAAT
TAATTTTAACTCAAATTTTATAATATAAAATTATAAAATTTATTTAATATTTATAAAAATATTTATTAATAAACTTACTAAATGAAAAAATTATAATTTA
AAATTCTTGATTTGCTTCTATCATATATTTACAAATAATTAATTAATTTAAATTCACGTAAATTAGATTATAAAAAAATAAAGTACTCTAGATTCCTCCT
TTTAATTATACTCGCACCGATTTTGTTTATTTTTTTTAAATCATATCTTATGATGACAATTTAATCATATTGTTATAATAATTTATTTAGAGAAAACAAG
ACACATATCGACATGTTTAACCACAAACTAATTAGAGTACTACTAATTATCAGAAGACTTATCCATTAATCTTATATAATACATATTTCAAGTGTACAAA
TTGTACCTAAATTCTCAATCATTTACTTCTTGAAGACTTGTTCATAATAATAAACTTTTTGATTGTTTTTTTTCCTTGTCGTTCTAGAGGGTATAGATTT
TTATAATATTGTCGAGAATCAGACAATTTCTTCTTATACAAGTTTTATTAGTACAGTAATTAATTATTCTTGTGTACAAGAAATAGGAAATTCATAATAA
AGCGATTCTCTAAATAAAGAGTCCGGCCGAGAAATTGCTGCAATTTTATCGTTTTAGTTAATATAAAATTTTATATACTGTTTTGAAATTTTTATTAATA
TATTATACCCTTTAGGCTCCGGACTCCTGAATTATTATACTTGGGGCTGAGCCAAATCTTACTAGTTTTTTTTTTTTTTTTAGTATCTAATAATTTTATC
AAATAAAAAATATACTATCTTTTAAAATATTTTTCATGCATCAATTTGAATTATATATTCGTCTGGTTCTAGATGCATGAACTGAATTGAATGAGTTAAA
ATAGACTGAATCAATAAATAAATAGGTCATGGTTCGCTCCAACGTGATCAAATTGAATGTATCATATTTTTACGGACTAATTTTATCATTTCTAATTTAC
TCGCTAATTTCATGATCTAATCAACACTAGACTATTGTCTCTGTTTATTTTTAATTTGTTCAGTTTAAACTTTACATATTTTTACTGAAATAATTATTAA
TTTAAGTATTTTATCACAACATATAAAGATTTCTTTTGCAACTTGCAAGTAAGAGGAAGATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACAAGATAAATATAAAATTCAAATTTCTAACCGT
AGGTAGAGAGGTGCACTCAATCATCATTACATCATATGATACTTTAAATGTCGGTTCACATATCTATATTTCAATATTTTTCACACAAAAATATTACAGT
ATTATATACGATCTTGAGATGGGAACATGGGTTCACGGAACCGAGTGATCACCCCCTGGTCGCCTTAGTATTATTGTTTTACTTTGGTAATTTCTTATCC
TTCTATTTATGTTATTATCTATATTTCATGTTCTTCAAATATCTTTTTTTTTCAATTTAAATTGTCGCTTTAAAATATATATTTAACTATCCAAAGCTTT
TTTTCATTTTGTAATAGTGACAAAAAGGAACCAATCATATAAGCAGCGACAGTTATAGTGTATATATACACATAATTTTGAGAGAAAATATTATGAAGAT
AATTTATCAACTCAATTCTTTTTTAATCTGTTTAAATTTAGTTCAACTTATCTATAATCTGACCCCTCTAAAATTATAATTGATTAAATCGAAATATTTA
ACAATTTTATTATTTATCGAAATATAGAAGAAAAAATATATGTATGAAGTGATTACTTTGGATCTATTAGTTCAAAATTATGATAAAGAGTAGACACTAG
ACATGCACTTTGCACTTTTTTTTTAAACCAAAATATAGTGGAAGCTTTTGGCCATATGATTAGGACACTGATTTATTAATGAATATAATATAATGTTTTT
GGCACTATATATGTTTTTTATTTGCTCCAACAAATATCAAAATTGCCTGCTAAAGTACCCTACTGGTTTGTACTAAAGTATACGGATCGTATTAGTTTTT
ACGTATTATATCTATTAGGCATTTGTCAAATTTTTATAATTGAGATAAAATTTTAATTACGAGTTTAAGTGAATTTAATAATTTTGACAAAATATTTCTT
TTTAGTAGAATAGTTACTCCACGTTCCTATATATATATATATATAGATTATTTTCCTAAAATTCAAGCCTATAGGAGCTTTTACTCCTAAGGCAAGTTGT
AGTCAATAACCTAATTAATTAATTCGATATATTACCCTTTTGAAAAATGAATATACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTTACTAGTGTTTATGTTGAGATAATGATGTAGTTTCTA
ATATTATGTGTTTGTTTTGTTGATATGATTAATGTTTTTTTAATTTTGATCACGTAGATATTAGTATGAATCCGAGTACATTTAGCTAGAATTGAATATC
ATTAGAATAATAAGGATCAATTATATGTATATTGTGGTAAAATGATCATACTAATTACTCCCTTCATCTATTAAGAAAATAATTAATGACGTAGTGAGTT
TATCATTTTATTACTGTTAATTATGAAGTGCATGAAAAATTTTACATTATTTAAAGTAATAGTCATTTAATTGAAGGTATAATAGGTTAAAAGTAAATTA
TCCTTTTTTTATTTATCTAAATGGACAAGTGATTAGGACAATTATAAAAAGAAAAATGAACAAGTTAAAAGGGAACGGAAAGAAAAAGAGGAGGACTGTT
TTTACTAACTTGCTTCTAAAATGTCTTTAAGAAGGGAAAAAATGGATTTTTAATAGTGTAAAACTATTTATTTTGGTAATTTCAGAAGAATAAGATACGG
CTAAAACATCACTCGTTTTGAAACGAAGAAAATAAACGAATTAAAATCCATATATGATCTAGATATTTATATTTTCGCCATTGCTATAGTCATTAGTGAT
CAGTCAGATGTAACATCATCTTTCAAATTTTGGATTTGTCTCTGATAATACTTGTTACTTCCCGGCCACTAACACATACACTAAGCAATTGTACCACCAA
AATTAGGACAAACAATAAGAAATCAACTAAATCACATGATTTTCATATACTATATAATACTCATTGAGCACAATGATATGAAGTAGCTCCCTTTCAACAA
AGGAGAATCTAAGTGTACTTGAAACATTAATACATTATGACACTCAATTCATGCTTGAAAAAACTTCATAATAACATTGACAAAGCCAATTTTAACCAAT
TAATTTCTTCAAAATTCTACTTTTATCTCTGAAATCCAATTTGAAAAGAAATAAGAAAGGGTATAAAATAAGTGGCTTCCTTTCCAAAAAAATAAAATAA
TAATAAATCATAGAATAAAAAGTTAACCAATTGCATGTCCAATTTCACTTTTTTGTTTTTCTGTCTTCAAATAACAATTCATAGTGGTTCAGTGGTCCTA
TTTTCCTGGTCTCCCCTTCTTTACCAGTGTAACACAGTCATCATTTGGTTGCATAATTTGGATCTATGCGAAATTGAATAAAAATATCTTTAATTAATAC
TATGGCTCAAAAATAATTTAATGGATCAAAAAAAAAATTTCTATATAAATATATTATTATTTTCTTATTAAAAATCTTTCTTTTCCTAATAATGTTATTA
GAGAAAGAACATTTTGACCCATTAAGTAAAAATAAAGACATTTTTTAACCAAACTATTAATCCTAACTCGTAAGATCAAAGACCAAACTATTAATTAAAG
ACATTTTTTGTTTGATTTCACATAATTTAAAAACCATTTTACAATTTTTCTATTTTTTTCATGCAAGACAAAAAAAAAAATTGTCCTAGTGTTTTGTTGT
ACACTGATTTACTGCTAATTATAATTCATAAAAGGATTGCTTGCTCAATTGCTAGTTAAAGTTGAATCCAAATGATCCATAAATTTACAACAGTAGGAAA
TACTTAAACTAATAACTGTTGTTCTAAGCTTCTTCATACTTCATTTCTCATGAAAGAAGAAAATTGATGTTGCAGCAGCAACCTACCTCCCCCCCTCTCC
AACAAGCACAGATGAACTCTAGTACTTACTAGTAAAAAGATGAAACCTTTGTGTCCGTGGCGTCGCCAAATCACACAGATGGGAAATACTTGTTCAGATT
GAAAGGGAGGGAGTAGAATTCCTCACTTCTCGTGTCAGTCTTGAAGGACTTGAATTTGTCCCACCAGTGCTTGCCTCTGTCCTTTCTTGTCTGGCCATCC
TTTTTGTGCATTGTGTTGTCCAGGAAAAAGGCAACGATACCCGCCACAAAAGCTTTTGATTGAAAGGGAACGTTGGCCATGTCGTTGAACTGAAAGAGAA
TAACAAACCACAAAAGCTCTTAATGTAACATAAGTCAAATGTTAGGACATTCATAAAATGATGTTAATTTTGCTATACCCATCTTGCATGTGTGTGAACA
GGTCCATAACCAGCAACAGCAGTATACTCATTGAAGTACTGTGGAATGGACAAGCCAAGAAAGACGGAGAAACCTAATATAAACTTGGTGCGGAAACTAT
TAAGATTGCAGAACTGAAGAAAACCTAAGCCTCCAGCGCCTGCGAAGAAAGAACATAAGAAACCATAATTCCCAAGCTTTCCATAACATGAAATATTTTG
GGATAGCAGTGATCCCGGGCATATGCTTGCCTTAAAAGATATACATACCTACATAAGCGAAGAAAAGGCAATATAAAGCACCAACAATAGGTGCAGGAAT
TGAAGCAAAGACAGCTCCAAATTTCCCTGATGATAATGTGGTTGTCAAGACAAATCGACAGAGGGTAAAGAGAATCAAGTATCAAGATAACCCACAAGAA
TTGCTCAAACTAAGTGTTAAGAGTGGTGATTTACCGAGAATTGAAAAGAAAATCATGAACGCAGCAGATATCTGAACAACTCTTCTACTGCCAACACGTG
TCAATGCTAATAGACCAGCATTCTCCCTGCATGTACACAAAAGTGAGTCGACTTAGTCAACTATCATAACAAGGCAGTGTCAAGTTGCAGAAGGTTTTTG
TCTGGACTTACACGGATACAGAAGATCCATTCCCAGTGCCAAATAATCCTGATAGTAGAATGCCAACTCCCTGAGGCAAAAACAAAATGTATCTAAATTA
AAGAAAGCAAGGTATGAAGAAATAGCAAATGGTAGGGGAAGAGAAACAATGGCACTTCCCGCGAACCTCATTAAGATAAACAAGATAGATTTCCTCCTTT
TCCAATCTGACCTACCCCCACCCTAAAAAAGAATGAAACTTTAAAAAAATTACTTTAAAAAACTTTTTAATTTTCCCATGATCCCGAAGTATCATTCAAT
GAGGGTGATAGGAAGGTTGCTAAATATACATCCAGTGCACTCTCTCTGCTACCCCCAACTAGTCTGGGAGCATTTGATAAACTGAGTAAGCCCTTATTGA
GCTGTCTTTCTAGCCCCTTGCTTGCATTCAATAAATTATGTACTGTAAAAGCATGATATAATGCAATAGAGTTTAACTTCTATGCACTCGAAGTGTAAAA
GGTATACAGGTAAATCTATTGATATGTTTAAATGGTAATCTGGTAAAAATGATAAATACCATGCTATCGCATACTAAAACTCACTTAATTATGAAAAGTT
TATAGGAGAATATTCCTGTAACAACAGCATTTAAGTGTTTAATTTATGTGTCTAATTTTCCAAGATAAAAGAATTTGTGGCTAAATGAATGGTAGAAAAC
GAAAGACAACGCGTGGAAGAAGAAGATGAATATTTTCAGAAAACGTGTAGGAAGCAAGAGAGAGAATTATTGAGTTCCAAGGCATAGGTCTTTAAATAGG
ATGCAGGAATTTTGGCTGTTCCAATCCCTTAACCACATAACGTATGATATCCACTAACAGAAGAAATATCCTATCCGCCATGTACTGTCACACCCAAAGT
GGATCAACTGCAAAATTTACTCAAATTGGACCACAGATAGACATGTTTGGTAGCAAAATTGCATCTGAGTGGTCAAAGATTTTGACTAATTGTATCAGTT
ATGGAAAGAAAGCATTCTAGTTAGAGTTGGGCGTTGGGATAATTAAAAACAGTTCATAATTCTTACTGTGAATTTATGATGATTGTTGACAATGCTGATA
CTGGATGAGTGTGATGACATTCCAACTTAGTGTAGTTCTCCTAATCTACATACGGCTTCAGATAAACCTCCCTAAAGACTATGCATTTGATTCAGAGTAA
GGCTCCCCTTCAATGAAATGCAGCAGAACTTCCCTTACTATTTTCACTTTTACAGGAGGGCGAGAGGGATAGGAGAAATTTGAGAAAGAAATCATGTTTA
CCTGCCAACCAACACCACGACTAAGTATGGATGGTGGTAAGGGAGTGGCACTTGCATATCTTGCAACTGCAATAAAAGCACCAGTGGACTGAAAACACCA
AAGCACAAGCGTGAAAGGAAGTTAGTTTAAAGCCTATCTCTTTCAGAGCTTATAAGTATCTCTTTTTTTTTCTTCAGAAAAATGGCTAAAAGGAGGTGTG
ACATCACACAAAAATTGGAAAAAGGATGCAAACAGGTAAAAAAAAAAAAAGGGACAGCACAAAGAAAGAGGAAGCAGACGAAGGTTGAGAAGTAGTAACT
CAGAACATCTGTAACAACAACTAAACGTTTCATAAAAACAATAACTGAAGTAGACAAAATGTAAGACAATCCGGATCATAGTGGAATTAGCAAAGAAAAC
AGCCTGAAACTAAAATATTTACAATATCTTTGACCAAGCCCTGACAGGTGAACAAACCTCTACTAGAGCAACAAAACTAGCCATCATCATAGCAAATGCT
TCACCAGCATTGAATGAAGGAGGTCCCCATTGGAAAGGGTAAGGAATACTAATCCTGCAGGTTCAAACCAGCAAACGAAAAGAGAAAATTATTAAAATTA
CAATAAGTTGCCTCGTAATTCTAGAGGAATATTTTCCTACAGGCTAAAGTAACAAATTAAGAACAATACTTAACCAACAAAAACACCTTAATATGAGTAA
TGAACGTAATGGAATGTTTTTCAAACAATATGCATCCCATGTCACAACCATAAGACCAACAGTAAGAGAAGATGAAATGGATAACGAAATCTAATTTTTG
TTATGCTCCATTTTTCAAAATTGACCAACAAACACTCTATGCAGTCGATAATATAAGACTCAGATAGGTTACTTTGGGACACCCACTTGTGCGTACTTTT
CCTAATCTATAGCACCATGACCATATGTGCCAGTTATGCTCAGTGTGGGAATAACAGACCAGCACAGCCAGTTGATCAGTTGTGACTAAACTGGCGATGA
AACGAAAAGCACAAAGCATCATTCCATGCAAAATTATATAGCTAAAATACCTATATGCATCTCTCTTATTTTCTTCTTGTTTATCGTTTCAATCAAATTA
CGCAAGGTTAGTTTAATGGACAAGTACGCACCAATTTCTTGTCTTTCCCAGAAGCTACTGCTCAGAGGAGCCACTGGGATAGTCACTTTAGAGAGGCAAT
AAGAGCATGACATGTTAACATTCTAAATTTCTTAAATTCTAGGACTCTAGAGTGGAAGACAATGGTCTATGCCACATGTCAAAACAAAGTGTTATTATGT
TGAAGATTGTAATGCAATATAGGTTATCAGAAACTAATCCTTATGTCCCAACATAAGCATCTTATTTTCCTTTTTATGCTGTGCTAACATGTGCCACTTC
CCTAGAACACAACTTTTATACCATGCTGTAGAATCATTTTTGAATGTATGTAAGCCACAGAAGCAAGACCCACTCTTACACTTACAAAGTTGTAATTTTT
ACCAAGGAGTTCCGTATCTTTGGGACCGCATAAATGTTAAAATACCAAAAAGATCTGCATATCCACACAAATATTTAACCCATGCCAGTACATTAGAAAA
GTGAAAAATGAAGGAGCGGAGCACGTGCCATTGAGCACCACTAATGAGTCCAGCACGGTCAGTTCTGCAGCTTGCTTGTGTCTTCGGTGGCTTTCCATTG
TAAGCCCCGCCCACAGTGAGTAGGTGTGCATAAATCCATACAATGATCACCGTGAAAAGAACAGCAAAACGATCAAATATATTCTTCCCTGGACGTATCA
GGTGTGCCAGATACTGCAAAAACCAGTGTTTTATTAAGAATGTGTAACTTATATCCTACTATGTAGTGTGTTTAAATAAATAGTTCTCGAACACGTGCAA
CGCACGTGTATTTCATACCATTTTAAACTACAAACACACAATCAATTATGAACCTGTGTGCTCCAAACATAGTCCATGTCCACATTTCAAAATTCAAATA
TGCAAAGACATTCACAGATCAACTTATATCTGAATTTTGAGTTCTATTGCAACAGAAACTTTTCATAAATAGATATTATACTAAAAAGAAGTGAATATGC
TGCTAGCTTAACAATAATACAAAAAGTGTTGGTCAATATTTGTAGCTAAATCAATTATATTGAAATAAGCTTTACGTGAAGTAGACTCTTTTTGGAGGAG
AAATTTAACCAAAGAAGACAAATGAAATAATTGGATAAACCAAACTTATGATACACTTTATAGAGTATCTAACGATGTGAAAAGATTGATCAGAATAAAT
ATCATTGAGAAGATTAAACTATGTACAACCAATAATAACAAAGAAATTTTATATATTAAAATATGAATGAAAAATGTAAAAATAAGTTACTATTGGAAGA
TGAGATAAGAAAATATAATGCGTGAAATAAATTTTAGAGTCCCTACACACAAGTATTGTAGGAATAGTAAATAAAAGTTTTTCTTGGAAAAGTTAAATTT
ATAGAACAAAATTATGGAAACATGAAAATACACATGAAAAATTGAAAGGTCAAATATTATAAAAATAAATATAAAAAAGATTGAGATGAAATTTAATTTT
AAAAGATACATGAATCTACTTTAATTTCTTGTCTTTAAGGAATAATTACTCATTTGTATTTTCTTAAAATTTGTGTGAGAAATTTGAAAGGTCAAGATTT
TGAAAATTATATAAGTTTTAATTTAATAAAAGGGCAAAATGATAATTCAACTTTTCACTTTGGAGCTTCCCAATATATATATATATATATATATATATAT
ATGATGTTTACGAGATATATATGATATCTCGACAAAACAACTTACCTGAGAGAAAATGACTAAAAGGACTAGCTCTGGCAACCCAATTTCAACACATTTG
GCAACCTAAACAGAGATGAAACAAATTCAACAATCATCATTGGATGAATATCAATGCAAGATAAGTGTGGTGAGTTTCTGCTTACCCCAGGAAAACCAAA
CTCATAAAGACCAAAGCCAACAAGAGAAACCAAAGGAACAGCTGAAAGTGGACTCAGAAACCTAAGAATCCACATGAAGTAAAATGATAATCAGAGCTAG
CACACTGTACGAACACAAAGCACTTAACATAACTGAACAGACCTTAAACCACAAGAAAGTGACCCTTAGACTTAGAGAACTTGCTCACAAAGTATAGCAT
AAGAATATCCAAGAGCAGGCAAGAACGTGCATAATTGATGGTATAAAGTTAGGTAGCATTATGAGAAATCGCTCAAATGGAGGGAGAAATCTTGTGATGT
AACAAACCTTGTAACATTGCGCCAGAGACCACTGAAGCCTAGGACAATCTGAAGGGTTGAAGCAACAATAAGGGCACCTTGGGTGGCCCGCATTATCTTC
TTGAATTTCTGAATAAACAGAGAAATATTAACAATAAACTAAGATCCAATATCACCAAGATGAATTGGATGACTTCCTTTGTGTCTCTAAGCGTCTTCCT
GGCTATTAAAGAAGTTAAAGGAATATACACTGACATGAATTATCAAGTTGAAAGTAAACTATTTCTGCATCAGTTTTTTATTCTTCCTTTTTTTTAGATA
AGGTAATGTAAAATTAATTATATCTCAGTACCATATGAGAAAAGAAAAAAATAGCTGAACTAAACCGTCTGTCATACGATACGACCCTTACACCATGAGT
ATAAATTAGTAAGCATCTATTTTTAAGAAAATAAAGGTGTTCTACCTTTTCCTCAAAACATCTCTTTTTCTTTCTATCCAAACAATCCACAAAATATGTA
GAGTAACTGTCTTCTTCAGTAACTTCAGTCTTTTATCAACCCTAGACACTGCTCGGTAGTAAACTTTTAACATCTCCTGGCATGACCACATTACTCCAAA
AAGGTTTAAATTTGTGCATCAGCTTCTTTTGACAATTGGATGGTATATTAATTTGTTTTCTCAAAGTGATATTATGGAAAATTATTGTTAGTGTATGGAT
TTGGTTATTGAAAAAATTGGTACTTGTATATTTTTTACAAAATTGAGAAGTTGTGATTTTGATTCAATTGTTTGGAGAAATACCATTACAACCCTAAAAC
AATGTACACACTTTCATATTGCTGAAATTATGAGAAAAAATGGACTAAACATATTTACAAATAGTCAAAAGGTAACAAAAAGTAGTTGTTACACCATATG
GACCAAATAAAGAGAAAAGAAGAAAAGTGGTGGAGTGATTGTGCCAAGAAATCTGATCAGACAGGGAGTGCAAAAAATTGGTTTAGAATTGGGAACCTAA
ATGACCCAAGAGGGGAAAAACAAGGAAGGCTGTAATTTAATTTCTAACTTTTCGAAAAGGATTTTGGGAGCTGGCCTTTGAGTATATAAGTTAACCAATA
TCTCAATTTTTGTCCTTGACAATCAACCAATAAGTTCACTAGATGATCCAAAGAATAAAGAGAAAATGACTGGTGTTTGAGGACACTAACCGACACAGGA
TCTTCATCATTCCATTGTCCAGAAAGGATAATCGAGATTGTAGGTGCAACAAAGGTATAAGACCCTCCAATCACAGCAGGCAATCTAGTCCCAAAGATAG
ACTGCAACAAGGTGTTCAGCCCAGCGACGAATAGCGATGTCTGAATAACTTGGGCTTTTTCCTCCTGCAACGGGCAGATAGTCTTCCAGTTAAAATGTAT
AACATTACGTGAGGTCAAAAGAGAAACTCATATCTTAAGTAAATAAGTCGTTCAATGTGTCTGGAGGCCTCACATTTCCACCTCCCATTTGGGGAACTAG
AGCTGTAGGAATGATAACAATGGTACCAAGCATAACAAGATAATGCTGAAATCCAAGAAGAATAGCTTCAGCTGCATCCCAACAATTACACAAAATCAGC
TTGGTCCACAATAAACATGGCGAAACCAATTTAAAACATATAGGTTCAATCTAATTATTCTTCACCAAACAGTACCAAGAAAATAGGGTGCACATTTTGG
GAGCTGCTTCCCATATCAAACCAGTTTTAGATTCCAATTTGCTGGCTAGAAACATAAACCCCATGAACCCAAAGCATAACATGACACAGACAAATCGCCA
GTAATTTATCTTTGAAGAAAATAGAAAATGTGAAACCAGAACAAGTGATGGTCAATACACATTGTGTTTAATAACATGCCCACCAGAACAAGTGATGGTC
AATACACATTGTGTTTAATAACATGCCCTCTTATACCGTAACTAAACGGCCCCTTATTGTCTTATGATATATGGCACCCAGGCCTAGCAAACCCAGACTA
CCTAATATCTTACATTAGTTTTTCATGTATAAGATACACACACCCTTGAGATGTATAAATAAAATAGACTCCATCCACAATACAACCAAATTAGTCTCAA
TTTGTTGAATGAAATACAATCCAATGATTCTTCACCAAGAAGTTCAATACTAAAAGAACGGAAACTAAATTTTGTGGAGTATTAAAGCTGCTATTGGTAT
AGTTTTCCCTAAATGCAAATTGTTTGATGATAACTACACATGGCTACATATTTGTCAAACTGTGGAAAGAATGAAACCAGTGGTGAGTTGTAAGGTCGTT
GTCTGGAAAAAACCTACTGAGGGAAGATTCAAACTCAATAGTGATGGTAGTTTTTTAAGAAGCAATAACAGAGCTGGAATTGGGATTATCATTAGAGATG
CAGTTGGAGATCTTGTAATGGCCTATTCAATTCCAATATGTTGTCAAAGTAACAATCAAGTAGAAGCTGAAGCTGTTAGATATGGTGTTCAATGGTGCAA
TCAAAACAATATCAACTGGACTTGGAGATGGACTCTATGGTTATTGCTAATGATAAAAGAAGAGAACAATTCCAACCTTAAACTCAAAGAGATCATCAGG
GAAATAAGGCTCAACATGGACATAGATGAAACACAAGTACGCCATTGTTTCAGAGAGGTGAACCAAATGGCTGATTTATAGGCAAAAATGGCATCCTCAA
GTGGAATGAGTAACTTTTACTATTCTTTTCAATAGGGTGCACATTCTGGGAGCTGCTAGACCCGTTTCAGATTCCAATTTGCTAGCTAAAAACATAAACC
CCATGAACCCAAAGCATAACATGCCATACACCTTTGAAGAAAACAGAAAATGTGAAACCAGAACAAGTGATTGTGTTATCAAGTAGTACAGTGCAATCTT
CAAGAAAGAAAAAAAATGGGTTCACAAGAACCATAACCCATAAACCATATGCATCTAGACTAGCTTGTATGCACCTCGATTAATCCACCTGTTAGCCATA
CTATCCCACATTGTCCCAACCCTTAGCTCCTATGAGCTCACATTAAGTTGAGATTCGAACCTGAACCTGAACCTGAACCATTCATCACTCAGTCGTCTGC
TCAAAGAAACTAACAAGTACCCATTATTACACCCCCAAAATCAAAAAAGATAATAAAAACACAAAGCAATGTAGTGGGGTAGCATAAAAGGGAAAGAGAT
GTAAAGAAACTTACGCCATGGGGGAGGACTAGTAATGCAGTAAGAAACATTAGGAAGCTGATCTTTTGGTGGATGTGGCACTGGTTCACTTGCCTTTGCT
GCTGGAGCTGCTCCTCCTCCTCCACCTCCTGCCATTTCTCTCTCTCTCTCTCTCTTCACAAACAAGTGCAACACCCCAAATCTACAGCACACCCAAATCA
GCAAATCTCTCAGAAAACACTATGAAAAAAGAAAAAAATGTCACAAAAAAGAGTTTGTGGAAGTACCAAGAGAGCAAAAGATGAAGAAAAAGGTTCTATA
GTACAGAGAAATGGAAAAAATGAAGCTCAAAAGGAAGAAGAGTGACAAGAATGGAGCAGCCAGGCCACATGGTGTACTACTACACACCCCACTCGCTTTT
GTATTAATGTAATAATAAGGAAATTTCACTCGAAATTATATTTTACTATTCATCACTATATTTTACGATTTATAATCACTTATAAATTGAATAGAAGAAA
TAATATTTTAATTTTTTAATATTTAAAAGGACCTCAGGAAAACGAAACTTACATCAAAGAAATGTTAAAGAAAAACATTTCTCTTTAATAATTTAAAACG
ATAAGTTATTGATATTTGACTACTAGAAAAAAAGTGATAATTCACAAAATTTTTATAAGCAAATATGGATTATTTCGCATATTACAAGAATAAGTTTAAC
CTTTTTTTGCTTGTTAAAAAAAATTATAAGTTTAAAACCATATAAAAATATATAAATTTGAATTATTATTTTTCCAAAAAAAAAATCTATGAACAAATAT
TTGTAAGAAATAGAAATTAATGAAAAGAATCTTGAAACCCCCCTCCCCCTTCCTGTGTATTAGTTTAAGTGCTAAATTATCTTTATTACTTTCAATAAAA
ATAGTTTATCTTTTGTCAGCAATCTGACTAAGGTTTTTTTTTTTAAATCTAAGCCTTGTATTTTAAAATTTTATATACTTCAAATAAAAAGAGGATTAAC
ATTTATTCTAATGACGGATTTGTTCGTACAACAATCTCAAATTAAATTAAGCACAAATTCCGATGCAAGACAAAGAAAGTTAATGCAAGATTCCCAAACA
CAATTTTATTTTGAAATTTAAAAATGTTTCAAACCTAATTGATTTTCGCTCAGTCCCATATTAGATGAGCATTTTATTAAAATTATTTATTTCATTTTAT
TCGATAATTTATTAAATTATGATATAAGTAATTATTTTTTCAATTTTACCCCTATAATTAATATGACGTTTGAAAGTTTAAAGAAATTTCGAAGTCCAAG
AATATTTTTTTAGAAAAAGCTAATTAATACTTCCTCTGTTCCTATTTAGTTGTTCACTTTAGAAATGACACACATATTAAGATAGCAATAATTAGCACAG
TGAAGTTATAATTTTACCTTATTGATTATGATTTCAAAAAATGATGAATTAAAACTTGGAAATTTTCAAGAAGTTTAAATGAGGGTATAATAGGAAAAAA
ATTGTATTTTCTTAATTTATCAAAATGGACAAGTAAATAGGAACAGCTAAAAGAGGAAATAGGGACAGAGGTCGTACGAACTAAGAGCAAAATCATTAAT
AGATTTAAAAATGATCAATTGATTACTCCTTCTGTCCCTATTTAGTTATTCATATTTCCTCTTTTGGATGAACCTATTTACTTGTCCATTATGACAAATC
AAGAAAGGACAAAAAAAATTCCTATTATACCCTCATTTAAACTTCTTGAAAATTTCTAAATTTTGATTCATCCTTTTTGAAATCATATTTAATAAGGGTA
AGATTGTAACTTCACTATGTTAATCATTGTTGTCTTAATATGTGTGTCTTTACTAAAATGGACTACTAAATAAGGATAGAGAGAATCATAATTTTTAATT
ACCGTGTAAAATAGAAAATATACACCTCTTATAAAAACAAGAGTAAAGTAGTTTAATGAATTAAGGTCACACTACTCGATATTTATTTTTTGGAGACATT
CTCAACGTATCTCATAAGAAGAAGAAAATAAAAAGACAATTTAGAAGATTATGTCTTTTTGTTTTCATTTGATCGTAAATTTTATTAAAATTTTAATGAC
TACGATTTCTTTTTTTTTTGGTACATAAGAATATATTAATTGAAAGCAAAGCCTTTAGATTAAATAGAAGGGAAAATGCACAAGCATCCCCTCAATTTAT
GTCCAAAATTTTAGAGACATATTTGTACCTTTTATGTTTTTATACATTAAAAATTACACGATATTTAATAATTTTAGAAATTAATTTTAGGTTTGGTTTA
TCCTACGTTTAATTAAAATAAATTGTAGATTCATTTCAAGATTATACTGTTATTTTTATTTCACATCAAGAGCTCATTTAGTACGAGGAATAAGATATAC
TTAATCCCATATTTAGTTTTGTATGAGTATGTTTAGTTATGACAAAATTACATGATAACTAGTTATGAGTCAGTTGTCTCAAGATTATAGTGTTCTTTTA
TTCCATATTGAGGATAGCACAACGATTTTCAATCTAACAAGCCTAAAGAGTGAGGAACTCACAAGATTAGTTCAACCATTTTTCTGTGGGTCGGAGTTGC
CCGAATTCATTACACATATTAACCTTGTTTTGATTTCAAAAAGAAATTTGTGTAAGAATTCAAAGAATTGAGGCCATGAGTTTGAGCAATTTTACTAATA
AGGTGATTTTAAGACAGCTTCATGAGAGGATTGTTAGAGTGCTTCCAAATATTATATCTCTTAATCAGTCGGGTATTGTAAAAGGAAGAAGCATAATGAA
AAATATTTTGTTAGTACAGGAGATTATACGGAATATACACCTTAGAAATAAAAAGGTTAATGTAGTGGTAAAGTTGGATATGACTAAGACATATGATAGA
GTTGCTTGGATATTCTTAACAAAAGAGCTAAGGAAGTTTTAATTCTAGAGGTGATAATAAATATTGTTTGGAGATGAATTTCGGCTAATTGGTACTCTGT
ACTAATTAATGGATAAACTCATTGCTTCTTCCACTCAACTAGGGGACTAAAGCAAGTGGGATCCATTGTCTCCAACCTTGTTCATTATATCTGGAGAGGT
GTTATTAGAAGTCTTTTAGCCAATTCAATGAGCAAGAATCTTTTAAAAGGATTTGGAATGAGAAAATAGAGTCCTAAAATAAATTATCTAGATGACACAA
TTTTATTTGGATCAGAAGACAAGGCATTCAGTGATTTAAATAATGCAGGTTTTGAGGGATAATGATACAGCGGGGGACAAAAGGTCAACAAAGAGAAGAG
TTTTTTTTACTTACACGAAAAGACCCATTTAATAGTAATAATAAGGATGAGGAATTTGTCTGGTTTTAGGCCTGGAAATTTTCCTTTTACATACCTTATG
TCCTATATATTATGGACGAAATGGGAAAAACTACTTTGAAGGGGCTAATTAAGAAGGTTGCGGCTAGAATCTTCATATGGCAAAATAGATTTATGTCCTT
TAGTGGAAAATACATTTAAGAGATGAACTATTTATATTAAAGCTTACTTACCTGGAAGCTATCGAACTCGCGCCTCAGGCCGGTAACTCAAACCCTTCAG
AAGGAGCGTCATGATTGACTGCGTGAATTCCACACGTCTCCACCAGGGTACACATCTACAAAATAAGAATTAACAGGGAAACTAGTTGAAAAAGACACAA
AATATGATAAAAATGCCTTTGTGAGCTGAAATATCACTTCGTTGATCATGGATGTAGATATTATGGTCCAGAGGCAGAGAATGATCAAAGATGGGGAAAA
AGAGACGAGAAACATGGAGGCAGAGTAGAAGAGACAAAGAGAACTCTTATAAGGAAACCCTACTGTTAGGCGAAACTTAACTTGTCTATCCTAATTTGGG
CCAGCTAACATTTGTGTAATTTGGGCTTCTTTAGCCCGTTGATGTAAAAATTGTTGAGAATAAAGATGTCAAAATGGATTAGCTCAGTCCAACCCAATTC
TAACGGGTTAGAGAGTTAAATGGGGTAGGACGGGTTGAACCTTTTAATTAAAGGACCAATAAAATACCAACCCAACCCAGCCCTAAGCAGGCCACAGATT
CAGAAAGGTTGACCCTTCAATTAAAAAATGGACAATATTGGTCTCTTATATTGAGAATAAAACATTGGTGTTTGATGATTACGGCATTAATACATTCATA
AGTTCATTCGTAAATTACGCATACTTCAGTGAGTACTTACATAATAGCCAAAATACAACATTAATAAAATTCATCCAAGCAAAAAATATTACATAATCAC
TATTATCATAAACGAGACAATAAAAGAGAAATGAAAAATTAGGCGTAAAACTACAAGTAAAAGAGGCCAACTATTCATAGTAATATTGGAGTAATGAATT
TAGGATAATAAGAAAATTTTATGGTTTAATGACCCTAAAATGTAAAAGATATGCAAAGAAGTTAAACTTGTTTTTTTATATTTCTATTTCAAAATTATTT
ATTGACAAAATCTTAAGAAACAAATCACTACTTAAAATATATACAGTAAATATTTTTAAAATTTAAACCCACGAGTTGGCTTACGAGGCTTGCGGGTTGG
GCATACGAGGTTAGCGGGCCAAATGAGGATGAACTAAAAAATCTCGTTTCTAAATGAACTGAAAAAGTTAAGCCCAATGTCACTTAATTAAATAGTTGGA
TTGGGCCGACCCGCTTGGCCGAGCTCATTTGGACAACTTTTGTTGAGAAGAAATAAACGAACACCCCAGTCTAAAAATGAATTATTTTTAGATGTCTAAA
GGGTGAAATGAGAGAAAATATTGAAAATACTTTTGAGCTTATTTTTATTCCACATTGAGAATAGAATAACGATCTTGAAATAACTAATATTGGAATAATT
ATATTATGAATAACATAATCTTCAATCAAACAAGTCTAAAGGGTGAAATAAGACAGAAAATATTTTTAGGGGTGTATTTTCACTCATGTTGCAAGATCAT
AGGGTATATTTGAGTTCAATTAATGAAGTAAGGAAATACTTTAAAAGATTTCAACAATTTAAGATTAAATTAATAATTCACGTCAAATTTAGATATATTT
TTAATACTTTTGATAATATAATTCTGAAATAACTTATTCTCTAACCAAACAAGTCCTAAAATCATTAACGGGCCATGTGAGTTGTAAGATATGGGCTAAG
TTCAGTCTTGCTTACAAGGCAGGCCCATATCATATTTTTCAGTACTTTTTCCGCCATTTTCTAAGTTTGTATAAAGCCCTAAAAAGAAAGATAATTTCAG
TTCAATTTTCAACTCATAATCCATAGATTAACGCATCAATTTTGTCTCAGAAAAAGGTTAATATCTCTTCCAAATTACTTTAATTTGTTTTTCGATGAAT
TTTTTTTTCCAATTTTTGTTTCAGTAGAGGATTTAGAATTGCCATTTTCATGGCCTTACGAGTTTTTTGTGGTTCTGTTGTTGCAGAGAGTGGGCCAATG
AAAGTCAAGATTTTTCGTATCGTTTTGTGGTTATATCACTGATATGAAATGCTTAAACGAAGGATATGAAATGTATATATGTTAATTTTATTGTAGCAGA
TTAAAGTGCAGTGAATTATAGCAAATGTTAGGAAATAATTTCTGTTATAAAAATATAATTTTTACAGTCTGAATATGCAACTAGTTTGATTCCCACTTCG
TTGGATTACGCTGAGTACGTTGTAATTAGTGATTGGATATGCCTTATCATGTGATCTTGGGAATTTAGTATCATTTATTTCAGAATTTTGTTGGATAATG
TAGAGCCATTGAACTTCTTAAGATTACAAAGAAGCATTCTCGCTTGCCCTTTGGTCTTTTTCTTCTGAAAATCTACTTTTTTTTTTAAAAAAAAAAAGTT
ATTAGGTTTGAACCTTTCACCTCAACGGTGACTTCAATTTATATTCCATCAATCATTTCATGTTTTTATGAGGTGAAGACGTGCATGTTCTAATTTTTTT
AAGTAAATGGAGTTTAAGCTTTATGTTTCAAGTTGGTTAGATGCTTTGACAGAAGGATATGTTGTGATATTTTTTTGGGATATAGACTATATCATGAATT
TTCCCTTAACCAGTTCTGTTGTGTTTTTTGCTGGGATCGTGAATAGAGTACGTCCTCTTCATGACATTTGGAGTTTAATAGAGTAGTTGGCTGACTTTAG
AATTGCATGATGTGATTACTTCCTTGGATATTGCAGATGACACACAGTTGCTTCATGGACATGGGAAGCTCAATATGAAACTTGTGGTATATGTATGATG
GCTTTTGATGGTTGTTGTCCTGATTGCAAACTCCCTGGTGATGATTGTCTACTAAGTAAGCCTGTATATCCCTCACTGAAAATTTTCTCAGTTAGCTACT
GAAACACCATTATCACGTAAACCTAGTGTATCTGTATATCCAATGAGTTACACCAATTTTTATATATTTACATGGATAAATTATTATGTTTTGTAGATTA
CATATCGGAAGTGTCTTATAAGTTAAATGTATGTGCATTGTCGAGATGTATTTGCCTTTAAATTTTGAGATACATTGTTGATGCAATTGGTGGAATGATT
CAAGCATCAGAATATATTGGTTCCTAAACTTTGCATGTGTGCCTTCCAATTGAGGCTATTAGCTTGCTGGTCTATCTTTTCAAGAGAAGAAGGAAAAATG
TAATTGTGCATTCATCATGTGTTTTACAAAATGGGGAAAAAAATCCGATCTTTGTTTTCGAGGTTTACATATTTTTAAGTCGATATTACTCATGAACACA
AGGAGAGCTATAAAGTGTTCCCTGATAATATTTGTAGTCCTTTATTCTAGTGTTACCTATCACTGTCCTACTGGATGACATAATTAGTTTTAATTTGTTT
GATTTGGTGGTAAGACTGGAGAATGATATAGTAAAGGGTATGTTTTTTTTGTATAAATAGTGAGTGTTTTACTGAAAACATGGATATTCTCAGAACTTAG
TACCCACTAACTATATAGAACTCCTTCAATCTACAGCACTTTGTTTAAGCACTCAACGGAGAGAGCAATACTACTTTAGTTGCACATTGTTTCTATTACT
GTACTTACCTTAGTATACCACTTTCATTATGTCTTGTGTTTGTCAGCAGTCTTTTTAGTTAAATTTCATAACTAAACACCCAGTTGGTGTCGAAGGAATT
TGCAAATAATGTTTGTGAACCGAAACGAGTCATCCACATGCATCAAACCACTTTGATAGCTATAAACATGTTAATTTCTCTCTACCAAAAATATGAATGA
AAAAGAAAAGAATTTTTGATGCTGACTGAAACAATCTTTTATATATTTCGTTCCATAAGTACCAAAGAGGACATAGTAGTAATGTTTCCTAGGCTGCCCT
CCTTTAACATTTGATTGTATGAAGTGAGAGCAGTTGGTCCTATGAAGCATGAACACTTGTCTTCCTAGTAGGATTTAAAATATTGTCTCGCCCTATACCC
ATCTCTTCTCTTCCATGAACCAAAGGCCATTAGGATCAGCCTGTCTTGCTAGCAGAATTTTATAAATCACAAGATAAAAGTAGTTTACGTTGGTTTTATT
CTATGAATAACTTTATATTTTTAATAGCGATGGTGTCTGGGCTAGTTTGTGCGCACCTCGACTAATTCTACGGAATACCTGCTACCTGCGCACCTCAACT
AATTCGACGAAATACCTGCTACCTGCGCACCTCAACTAATTCTACGGAATACCTGTCACCTTCTACACGGAACAGGTACCAGGTAACTCTTCCATCCAAG
GCCTAGACAAATGGAAAAATTACCTAGTGTTAGTATTTTTGTCTCCAATAGGGTTTGAACCTGAGACCTCATGGTTATTCCCCCACTTCAATTACCATTA
GGGCACACCCTTAGGTGCTCTTACTTTTTCTTATCCAACTTCAACGAAATTACATATCCAACTTGTATTGCAGAACAAATGGCAAAAAATATGCATAGAA
ATTAAGATAAGTACTCCTAAGAATCAGAAGCACGTTTGTGGAAACTGTTGAGGCGAAACTGTGATTATCTGAAAAATCCTGCATCTATGGGAACTTATTC
AAGTATTACTGGCACTTGAAGCCTATATTCATGCCTAAAATAGAAATCAATCTCTAACATGGATAAAAGTTAAGTTAGTGATACAGTGTGATTTTCCAAG
CTTCTATTAGAGTAGATAGACATTGAAGCATGATCAGTATCACAAACATCTCGCAGCTAGGGCAAATCAAATAGGTACTTGACATTTTTTTTGTCAAATT
TGAGTCAGCAATATGAACTAGTTATAGCAAGATGAAGTCAAGCAGGTGAAATGCTCTGTAACACAGATATATAATAAACTAATACTGATTCTCAAAAAAT
GCAAGACCCATGGCAAGTATTTGTAGTAGTATTTTTTTGTTGACAGCTTATGCTGAAAATATTTGACCAAAATACTCAATAAGCTGCTATAACACACCCT
ATATTAACAAATTATCTTCAAAGTCTCTTTCAAAGCCTATATTTTAAAAGGTTCACTTGTATTATCTGCAAATTCAGAAGGGGAGAGAAGTTGTCTTGAG
AAAGTTTTTGTTGGCATATTAAGATGCTAGACACAGAGATGATGGAATGGAGGATAATTGGACAGCTACTGGATGTATCACAAGTTTCAATTATAAAGTT
GTCTCTAGTACAACTACTAACAATCTTACGTGGACAAAACAAACTCCTATAAGATCATCACGTTGACTCTATTAAGAGACCATGTGAAATCTGCATTTTC
TTTATACAATTTTCCAATATTTTTAGAATATAGAACAAAAAGTAAAATTATTTACTTAGCTTTGCATCCTAATCTCACAAACCCTTAGCCCTGGCCACCC
TTAAACCCAAGAAAGAAAAACAAGAGAAAAAGGTAGTCTTTGGTATCTCTCTGTGCCTGTACAAGGCTGGTAAAAGGTGATGAAATATGCCTACCCAACC
CGAAGTTGGGAGTGGCCAGTCCATCAGATGCCATGTTTTTACTAGCAATACTCAAGTTCTTGTCTGCAGTAGTAGTAAGTTAACCTGAACGAAGCATTTT
AATTACAGGGGAGGCATGATGATTGCTAAAAGACTGTGTACACATGTCAATTTACTTTCTCCCATTTTCCCCATGTTTTGTTTATTTAACAAATTCATAA
TAAATGTTAATTAGACAGCAGATTAGGAGTTCACTGGATTTTGAAAATGTGGAGAAAGTGGCATTTGATTGGATGAGAACAGTGACTATTGGTTTTTTGA
TATGGTTAGGGTTCAGCATCTTTCCGTGGATAGCATTTATATGACCTCTGATGGAGTCTGGCCCTTTTTTAAAGCTATTAATGTTTTGATAATTTACTCG
TCTTTGCAGTATAGGGTGTTTGCAACCATGCATTTCATCTTCATTGTATGTTGAAGTAGGTGAATTCTCAATCTGCTCAAGCACATTGTCCCATGTGTCG
TACTGAATGGCAGTTTAAAGAATGAACAAAGATTATGTGCACCTTTTTCTCATCAATGGCAGCAGAAGAAATGAACTCAAAATTTTAGTCCACAACTAGG
ATTCTCTCTTTCATGCCTCTTGAGAGAAGAGGTAAAAGAATGCTTGTTTTCTATTCACATATTTCAGTATTACAGTGTGCGTGATAGTGTGATATTATAG
CGAGCATAGTTCTGCTCATCCCCATATACAATTATCAGTTTAAACCTCGGAACCAGGTGCAGAAGTTGTATGAGCGATCCATCCGAATGAGGACAAGATT
CAAGCTTAGCTTCTTATATTCTTTCTATGTGATAGATGTGAAAACCAAACAAGACTGGTGTTTGATGATATGTAAGTTGGCTTCATGTTATATAAACGTG
AGAATCATTAAATTAGTGGTCATTGTTTGGCACAAAATCTGGCGTCAACGTGTGTGTATTATATAAAAAGACATGGGCAAGTAGTCCATGTGTATGAGTC
AGTTTTTTTTACAAGGGTACGTAGTGCTTTTGTACCATCTTTCTTGCTTTTTTCTGACTAAAAAGCAGATTTGGTAGCTACTGCCTAAAGCAAAGCAACT
TCTTTGGCAGCAGACTATTCCTTTATTACTATTTTTTTTTTAATGACAAGGAAAACTCGTTGTCGCCACCTTTTTGGTGCACACAGGGTAAAACCCCCAC
TCCAATGCAATAGCTTACAAATTATATAGCAAATCTGGTGCGACGAGCTCGACCCAGAAGACAAATCTCTTACTTTCGCTGGTAAGGAATTTTGAATTTG
AGACCTCCAACATGGAAGTCCCAAGCTCAAACCAGTAGGCCATTTCGAAGGATAAAAATGAACTCCTTTATTACTATTCTTGCTTAGGTAGAGGGTTAAC
TGCTGACATTTGCCCTCTTTTTTTTTTTAGGGGCTATTGTTTTTCATTGTTACCAAAATGAATTGAATTTCTTTGACACAATTAATTTTAACATCATTTA
AGTAATAGTTGAGAACTGCGACGTGACATATGATAACAGCTTCCATCGCGCATAAACAAAGGAAACAACAAATAGAGTGAAAGACACATGAAATTCGATG
AACTATTTATCGATCCTACATTTAACTTGTAAACGCGTGGTTAAACAATATTAGGAACTTCATTGCCAAATTACATATATGCCCTTTATGAAAATGGAAA
ATTATTCCCTTTTTTGGCCTTGTAGAATAAGCGACCAAATTAATCACCCACCCACCCACATGCGTACGGAACTAGAAAACACAATGGGTCAGTGGTGAAT
CTGATGCCAAACAAAATATAAGGAAAAAAATGAATGAAAAGTGAGAAATAGGGAGAGAGAGAGAGAGAGTTGCTTTCTTAGAGAAATTAAAAGTCAAATG
CCTCACGCCACATCTCACCCGCATCTGTCAACTCAACCCGTGTATCTATATTGTTCGGATTCTTTACTGAGATTATTTTTTAAAATATTGGGAAATTTGT
TAGAGTGAATTTGGTTTTGACTTTTGAAATGAAAGTTTATTTCATAATGAGTTAACATCATCTGAGACCCATATATGATTTGAGTCGGTAGATAGAGTGA
TAGTTGTTACTTTCTTAATGTCCCTTGTTAACGAATAATTGATTGATGTTCGATGCTGATAATAATGTCTGTCAGCGTCTCATATAGGGTTTGAATTGGT
GGATATAACGATAATTGTTACTTTATTAATGTCCTTTGTGAAAAAAGAATTAACTTATGTCTACTAAGAATCACGTCTGTCAGTCACACGTATATAATTA
AAATCGGTTGATATGATGATAAATGTTACTTCATTAATGCCCATTACGAAATAAGAATTTGACTTATGTCGTGAGCGAATCCACCAGATATGTTTTCATA
TTGAGATAGTTAGAAAACCTTATAACTAGTGCTACCTCTATTTATAGTATTGAAATTTGAACAAGAGTAGAATAGAAGAAAGAACTTGTCACATTGAAAT
CCAAGCAATAGTAGAATAAAAGAAAGAACTTACAATCGCATCTTCCTCGAATAAACGACGATCGTCTATGATCTCATGGCTGACCTATGAAGTGTACAAG
AAAGTGTTCCGGCATGACTTCAAAAGAATCAAAAGAACCAATTAGAACATCCACACATCCAAATCAAAGCGCTATAAGCTGAAAAATTATTCATCCAATC
ATCGCGCAACGCGTGTGCACTCTCTCCCCCTTGAAAGACCGACCACAAAAAACACTCGTATAATCGAAGCTCCATAAGTTGAAAAATTAATCATCCAATT
ACTGAGCAACACATGTGCACTCTCTCCCCTTCTTGAAACACCGACCACTAAAAGCACTCCTATAATCAAAACTACTTATAGCAAATACTAATTCGATTTA
TGTCTATCTTTTTTGAACGTCAATCAGAGAAAACACTGTTAAATACGACGATAGTAAATAAAAAAGGAAAAAAATAAAGGCCTGCCAGGTGTGTATAGAA
TTAGCCTTTTTAGTTTAAAAATATTTTATTTTTTAGTGAGTGCAGTCACATTCTTTAGCACCACATCATCAGTTGTAGCAGTCAGTCACAAAAACATTTC
AGTCTTTTTAACTCATCTTTTGTGGGTCCCACATAGCGTTATCAATGCGTCTGCCCGATCTGCCCAAAATCCCCTGCCCGTTTTCCCCTAATCTCTACAA
CCCGAAACTTCTCAACTCGAACAAACAACACTTTTCCTTTCATAAACACTTGGCCATTTCAGTTTCTTCCTCAAATACTCCTACTTCGTATTTTTTCACT
AATTAAATTAAGGTTTGTGTATTATTACAGTATTTGTTTATGTTTTTTTGTTTGTTGGTGTTTGTTTTTTATGTGGAAAGATAGGAGGAGTTGTTTGTGT
ATGAATTGGATCTAACAATTTTGATGTTTGCAGATCGGTGAATTGATGTGTTGGTGTTGAAATTGAGTGAAGGAAGTTAGGGTTTTGGGGTGTTAATTGG
GCGATCGAGGTTTTTATCGGGGTTCTAGGGTTGAAGAAAATTGGGGATTTTGGTTTTGTTTGAGGAATTGGATGGTTTAATTGATGGTTGAGAGTGAAGT
AAGTGGGGAAAATGCAAGGGGAGTTCTATTATGCATGGGAGGATACAGAGGGAACAAGGTCAGGTTTGTAAAAAGGGGAGTGGAAGCGGTGGTCAGCACA
TGCCGGCGACGACTACAAGGAGGACTGTAGACGTCGGTGGTTCATCTATTGTTAATACTGTTACTGCTGATTCCTTCTGTAAGGTATTATCTTGATTGCT
TTTTTTTTTCTATTTCTTTTTCTTTTATGTGCCCGTCTGTTCACTGAGGGGAGTTCTGTAATAGTGCATAAAAAAGATAGCTGTTTTGTTCCGGCTGGAG
TTCTTTTGGAGGTTGTATCATTTTAGCTTAGCTTCTTGTGGCGTTATGTGATAATATGCTCATTTGTTTGCTTTCTGTTTGGTTATATTTTGCAGAGAGG
TGTATAGTTTGGTATTTGGTGCGGGAATGTGTTCTTTAGGATTATGTTATCTTCTATTCATCCACCATCCGCACTTGTGCATCTTGAAAGCTTGGTGGTG
GTCGTGTTTGGTTGTTAACTACTTGGTTGTTGCGTCTTTGTGGGTGCAAATACTGGGATTAGATAAAGCAAGCAGTTAAATTGCAAATATACCTGAAACT
AGTGTTCTCCAAATTCTGGGTAGATAAGTGTTGGTTCTACAATGATGAAGTACTGTCAATACAAAAAAGTGCCTAGAAACTATGGAAGTGTGTTACTATA
ATTTTTTGTTCAGAATGAAGAGGATAAGGGTTTCCCCCCTTTCTATGTCTTTAACTCTATCAACATCTCTCACTATTGCTTTTTAGTTCATATATGTAGT
TATCTTCTGTGTAGTTTTCTTATGTTTTTTATGCTGTTTGTAGTTTTCGTATATTCTGTTAGTTTAATTGGTATTTTTTATTCTGGTTTTCTTGGTGAAG
TGAATGTCATCCTCTCTGCAGGATGGTCGCAAAATTCGTGTGGGAGATTGCGCTTTGTTCAAACCACCACATGATTCACCGCCTTTCATTGGAATAATAC
GTAGGCTTAGATTGGGTAAAGATAATAACTTGCAATTAGGTCTTAATTGGCTCTATCGTCCTGCTGAGCTGAAGCTTAGCAAGGGCATCTTGCTGGACAC
CACGCCCAACGAAATCTTTTATTCCTTCCATAGGGATGAGACTCCAGCTGCATCATTACTCCATCCATGTAAAGTTGCATTCCTTCCTAAAGGGGCTGAA
CTTCCAACAGGGATATCTTCATTTGTCTGTAGGCGGGTTTATGACATTTCAAACAAGTGCTTACGTTGGTTAACTGATCGAGATTATAATAACGTAAGTT
ATCATTTCATTGCTTGACAGTTCAGTATTCCTCTGCTAAACAATGGGAAGGTAATTTGTTTTACAGATGAAATAGATAAATAGGGTTGAAATGTTTAATG
GAAAAGGGAGAGAGAGTCTGTCTTGTTCTTGGATATGTTTTTCATGGGGTGGTTGCTTGAAATGGTGCGAGAACAAGAGGAATTGCGAAACTTTCAGGCA
TTTTTTTTGTGATCTCGCATATTGTTTCACTTATCAAATATTATTTTTCCTCTGCAGGAACAACAAAAAGAGGTAGATCAGCTGTTATACAAGACACAAG
TAGAGATGCATGCAACAGTGCAGCCGGGTGGTCGTTCTCCTAAACCGATGAATGGTTCTATATCGTCGTCACAATTGAAAACTGGTTCTGATAATATACA
AAGTAGTGTAGCTTCTTTTCCTTCACAAGTCAAGGGAAAGAAAAGGGAGCGAGGAGAACAGGGCTCTGAGTCCATCAAACGGGAACGTTCAGTTAAATCT
GATGATAGTGAAAGCGTCTTAAAATCTGAAATTTCTAAAATAACAGAGGAAGGAGGACTTGTGGACTGTGAAGGGGCTGCAAAGCTTGTTCAGCTCATGC
AACCGGATAGAGTGGACAGGAAAATGGATTTGACTAGTCGTTCGATGCTTGCAAGTGTTGTTGCTGCAACCGACAAATTTGATTGCCTTGCTAGGTTTGT
ACAGTTAAAGGGTTTGCCTGTGTTAGATGGATGGCTTCAAGATGTTCATAGAGGGAGGATTGTTGAAGTTAGTAATAGTAAGGACGGTGATATCTCCATT
GAGGAATTTCTCTTGGTTTTGCTTCGAGCACTCGATAGGCTTCCTGTGAATCTTCAAGCACTACAGATGTGCAATATTGGTAAATCTGTTAATCACTTGC
GCCAACATAAAAACATGGAGATTCAGAGGAAGGCGCGAAGCTTAGTTGACACATGGAAGAAACGCGTCGAAGCTGAAATGAACATGATTGATTCTAAGTC
TGGCTCAAATCAAGCTGTCACGTGGCCCTCTAAAGCACGACTGCCTGAGGCTTCTCATAGTGGTGAGAAAAATGCTGGTGGTTCCACTGATGCAACAAGG
AGCTCAGTTACACAGTTTTCTGCATCCAAGACAACCTCAATCAAGCCTACACCAGTGGAAACTAATATGAAGTCTGCATGCTCTTCTCCAGGCCCAATAA
AACAAGCATCACCTCCTTCATCCGGAAAAGTGGGTCAGCCAAGAATTTCAGCTTTTGGTTCCAGTGATGTTCCTCTGGCTAGGGAAGATAAGAGCAGCAG
TTCTAGTCAGTCTCACAATCACAGTCAGTCCTTATCAGGGAAGGAGGATGCAAGGAGTTCAACTGCTGTTTCAATGAGCAGCATCAAGATCTCTAGTGGT
GGTTCTCGGCACCGCAAGTCGATAAATGGTGGTCCTGGACCATCGGTTTCTGCAGGTCAAAAAGAAGGTTCTACAAACAGAAGTTCTTCATTGCACCGGA
ATCCTACCACTGAGAAGTCGCTGCAGTCTGCATTGAGTGGTGAAAAAACGGTTGATGTGCCAGCTGTAGAAGGGAGTTGTCACAAATTGATAGTAAAGAT
ACCAAACAAAGGCCGCAGTCCTGCGCGGAGTGTCAGTGGAGGATCATGTGAAGACCCTTCAATCATGAGCAGCCGAGCTTCTTCTCCTGTGCTTTCTGAA
AAGAATGATCAGCTTGATCGTAATTCTAAGGAGAAGAAAGATGCATATCGATCAGATGTTACTATTAACGTGAATACAGAATCATGGCAGAGCAATGTTT
TGAAAGATGTACTCACTGGATCTGATGAGGGTGATGGATCACCTGTTGCTGTTCTGGAGGAAGAACGGAGAAAAACTGCTGGTGAGGGCAGGAAATCAGC
TGAAGTTGCCAAACCTGGTTCTTCATCATCAGGAACTGAATTGAAGTCAGGAAAGCTGCACGAAGCTTCATTCAGCTCCATGAATGCATTGATTGAGAGC
TGTGCAAAATATTCTGAAGCAAATGCATCCATGTCTCTAAGTGATGCTGTTGGAATGAATCTGCTAGCCAGTGTAGCTACTGAAGAAATGTCCAAGTCTG
GAAGGGTTTCACCTTTTGTTTCTCCCCAAGGAGATAGCCCTTCAGGTGGGGAGACCTGCACAGGTGATGAGCTTAAGCCAAAGACATCTCCTGTAGATAG
TTCTTCAGGTAACCATAGTGGGCGAAATGACGGTGATGCTAATGGTGATAAAGAGAAACAGTTCGTTGTTGCTAATACGTCGTGGTCTGAGGGTAAAGTA
CATGCTAATAGAAGTGCAATGACGGATTTTAACAGAGAAAGAAGGCCCTCTTCATCTCCTTCTGAAGAAACAACCACGGGAGAGTGCTTTAATTCATCCT
GCACTGATTCACAGATGGCTGGAAATTTGAAATCAGGTGTTAATGAGAAGTTAGTTGAGATGGCAAAGTCTGCTGCGGCTCCTTGCAATGTATTCGAAAA
AGCAAGTGATGGTGAACAGAGCAGACAATTCCATGAGGAAAAAGTAATTTCCACTAAGACACTTGATAATGTTCTAGATGGCGAATCAGGTGGACATGGT
AGTTCAATAGGAGAGGACAAAGTCACTAATGGCCTTGTAAGCATAGAAGGCTTGAAACGACCAGTTGGAATTTCTGCTTTTAAATATGAGGGCGACGACA
AAAATGATGTGAGTAGGGTGTTAGGTGTTGCTAGTACAGAGGTGAAACCGCCTTCAGTTGTGGTGAAATCTGAAGCTACAGAAAGAGGTGACAAGGAAGA
GTTGCAACAAACTGGTTCTAGTCGAGACACTATTGCAGGGAAAGGTGGACATTCTGATGAAATGGATGCAAATAGTGTTTTAAAGTCAGAACAGCCAAAT
TCTGATAAAAAGACTGTTGATACTTCAGTTATTGAGGATAAAGCCGCATCTGAATGTAATTTAGCTATAAGGAATTTGACAAAGGATGAACCTAAAGCTG
AAGAGATGACGAAGCATGATTCTGGCAGTGGATTACTTACTAAGAAAGAGACACCTGGATTTTCTAATGCAGAAGTGGAAAATTTGGAATCAAGAGAATC
TAAATACTCTGGTGTAGAGGCAGATAGACCAAAGGAATGCGTATCCATCAAAGGGGAAAATTCTTCAAGCTCTGCTGCTGCTGCCCCAGATTCAGCTTCA
AAGATGAAGTTTGACTTAAATGAAGGTTTTATTTCTGATGAGGGGAAATATGGGGAGTCAATCAACTCGACAGGCCCTGGGTGTTTGTCGAATGTCCAAA
TAATGAGCCCATCAACATTTGCTGTCTCTTCTGTTTCCAGTAGCCTTCCTGCTTCCATTACGGTGGCTGCTGCTGCCAAAGGACCTTTTGTCCCACCAGA
AGATCTATTGAGAGTCAAAGGGGAGTTTGGATGGAAAGGATCAGCAGCCACAAGTGCATTTCGTCCGGCTGAGCCAAGAAAACCCCCTGACATGCATTCA
AATTCCATGACCATCTCTGTTACTGAAGCTTCCTCCAGCAAGCATGGTCGACCTCCATTAGATATTGATCTGAATGTAGCTGATGAAAGAGTTTTGGAGG
ATATAAATTCTCAGGATTGTGCTTTAGCAATAGGTTCTGCGGTGGACCATATAACTAATCTTGTTTCATCAAAAAATAAATGTTCAGGCCCTCTTCGTAG
TTTTGGAGGACTTGATCTCGATTTGAATAGAGTTGATGAACCTAATGATGTAGGTCAATGCTCCTTGAGTAGCAGTCATAGATTAGAGGGTGCTGTTTTT
CCCGCAAGAGCATCTTCATCCAGTATCTTGCCAACTGCAGAAGTGAGGAGGGACTTTGATTTGAATAATGGGCCTGGTGTTGATGATTCATGTGCAGAAC
AGCCTCTATTCCACCAGAGTCATCAGGGAAACATGCGCTCCCAACTAAATGCTTCTAGCCTCAGAATGAACAATCCAGAAATGGGAAACTTATCATCTTG
GTTTGCTCCAGGGAATAGTTACTCAACGATGACAATTCCATCAATGTTGCCTGATCGGGGGGAGCAGCCACCATTTCCAATAATCCCACCCGGTGCCCCG
CGAATGTTAGGTCCATCTGCTGCTGGTTCCCCTTATACTCCAGATGTTTTCAGGGGTTCGGTATTGTCATCATCACCTGCTATGCCTTTTCCCGCTGCCC
CATTCCAGTATCCTGTGTTCCCTTTTGGAACTACTTTCCCACTTCCCTCTGGAACATATGCTGTTGGATCAACCTCTTATATTGATTCATCCTCGGGTGG
AAGACTTTTCACTCCGCCTATAAATTCACAGTTGCTAGGTGCTGTGGCACCTCAATACCCAAGGCCTTATATGGTTTCCCTTCCCGATGCTAACAGCAAT
GGAGCCACCGACCACAACAGAAAACGGAGCCGGCAAGGTCTGGATCTGAATGCAGGTCCTGGAGCTGTGGACTTGGAAGGGAAAGAAGAGTCAGTTTCGT
TGGTAACGAGGCAACTGGACGAGCATGGGAGGATGTATCCTGTAGCTGGAGGTCTACTGAAGAGGAAGGAACCCGAGGGAGGATGGGACAGTGAGAGTTA
CAGGTTCAAGCAATCACCGTGGCAGTAGGAATGCAAAAAAACCTGCAACTTGGCGATCTTGAAGGTGATATGAGATTCATTTACTTGTGGTTATGATGGT
CTTCTTTATGATTTAAACTGTTAACCATTTTTGTCAATTATGATGTATAAGCACTGGAAAGTGATTAGATTCTAGGGATGTGCTTGGAAATACTTCGTCA
AAATTGCATGTGACCTGCTGTGGTTGAGCTGCTTATTTGTTTGTTTACTTTCCTTTTGCCATGTAGTTTTTGCTCTTTTTTCGAACTCGCGTCCCTTCTG
CCGGCCTTGTACACATGCAAGAAGGTGTTTGACAACTCATAATCTTTTAATTGTAGTTTTAATTGATCGGGAGAAAATGAAGATAAGTCAAAATTTTGGA
TATATATATTTGGGATCTTTCTCCTATTATCAATTAACACTTGGGGTGTTTCTCCCTCCTGAAAATGTGATTTTAATATGCCGTTAGGATATGTGTCATC
TTTAAACAGAGGAATGAGTAGTTTCGTTCTGTGGAAAGTAATGCTTTGAAGTGTTAAGAGCTTGTGCATAATTCTTAGTACCATATTTTGAATTTAAGCA
TGATGAAGTATATTTGCTTCCTATTTGGTATGACACTTCCTTTTTTCCTTGCTTCTTGCAGTTGTCAAAGGATGGACTATGGTGGGCTCCTCACAAGTAT
CAGCTTCTAGTATGCTCTTGTGGTTGTGTGATGTGACCAATGATGTGTTCAGTCCCCAACCACTATTTCTCTCAATGTATGAAAGGAAGGAGGATTTCAA
TGGGTTTGTGAGCACTTTTGTCAACCGTATTGTCTGGGTGGAGACAGATGAGTCTTCCCTCTGTAAATATTTTAACTGTTGGAAGGCTTGAGATCTGCAA
CACCCGGCAACTGCGGATAAGTTGTCTTATCGTTGGCCAAGATATTGCCAGTGGAGGTTGGATTTCTGGACAGAGTAAAATGGAATGCCTTCTATGTTCT
TTGTTGCTAATGATCTTTCTTGCTCCCTACTTTCTTGGCTGTTCTCTCCTCTTTTTTGGCAATTACATAAGTATAAAGAGGTTGACACCAAATTTTGGTA
CTAAAGTGTCCACCTGCCATGCTTTTATTTAATACAGCTGCATTGTACCTTAAATTCACTTGGTTCCTAACTATAGCTCTAGTCTGATTCACAGATAAAA
GACTACTTCAAGGTTATATTATCAATGCTGAGGGGAGAAGTCTGTTTTACCTTCTAGCCATTATTTGTGTATAAAATGATTCTTGAGAGCTAGAAAAAAG
AATACTTTGGTTCTGTTGAGGAACCAAAAGGTGTAGAATTTGGAGCATAGGTTATCGAAGTCTACATACTGTGATGGTTTCTTCCCTTGTGTTGGCTGAT
AATTATCGGAGTGGGAAAAATGAATGAGTAGATCTCTACTATTGTCTTCGGTAACCTAGAAATTCCATGTTAATTAGGTAGCCTAACCTCAGTCAGCCTT
GAAACTCACCACCTCTGTCTTGCTCCATCTCGAGTAATATCCAACCAAAGCCTTGGGGGAGGTTAAGTTAACACATAACCAGCCGTTTGCATCCCTTGTA
TTTGGTATATCTGCTTTGGTTCTCCATAAATCTCATATGACTTGTCTGTTCGTTTAGCTTTTCTTTTTCCTGCTCCAGCTAATTCACCAGAATCGGCCAG
CTTTGGCATCTCCATGTGGACTTGCAGTTTGCTGGTCATTTTCATGAGGTGCCCTAGTTCTTCATCGATGCAGAGTGTAGTGAGATATATAATTTCATTC
GGTACCAAAGTGCTTTTGGAATAGAAATAAACTTAACTCAGTCACATTAGTTTTCATGTATCTGTTGAAGTATTTGATTTTGATCTGTAAGATGCAGCAA
ACACAAGGCATCGATGAATCATGTTATAGGCCTAGCTGATTGTATTTGTTCGTTAAGATGTTACTTTCCTTCTGGTTGTGGGGAGAGAAATTGGTCTTTA
GGACGGATCTCAGAACCCAGTTTCCCTTTAAACAAAAGATAAGTGCTTGATATCGATCTAGCAACTTTATTACCTCTGTGTTGCTAAAATTGATCTTTCA
ACAACCATTTGTATGTACAGTGCTTGAAGTAATACCAAGTATGAACTCAGCAATTATCACACAAAAAAAATGGATATTGTATTTACAGTGCATAAAGACA
AAAACAAGTAGAGACAAGAGAAGTAAATTAAATTAAACAACGAAAAAGACATTAGACAAATAAGACCAACCACAATAATATTTTTTTTGTTGGTAGAAAA
CTTATCTTTTATGATGAGCTGTTGTTTTCTTTGCCCCACTACTGAACTGTAAGGGGGATTGAATTGTCTCGAAATTATACGCTGAGACTAATTTATGATT
GACGATAATATAAATTTATCGATCGGTCCAGTCCAATCACTGTCAAATAGTATAGTACTTGCGTTTGCAACTCAAACGAAACTGGGCCCATCTTTGCCCA
AGTTACTAGACGCCGGAATCGATGCGTATCTCGTCGAGAAATTCCGAAGTACCAATTCCTCCTCCTCTTCTCCGTTATTCCCTCGTCCTTCATCGAAGTT
CAGTGAGTAACTCAAAGGATCGTATTGGAATTTCGCATTCCTATTACCGCTTTTGTTCCGATGGAACCGACGGATGAAAGTCTTCCATCTAGGTCCGGCG
ACGATCTCCGACCATTCACGAAGCTTCTTCAAAGCGTTGATTCCTTTAGCCCATACAGATCCCTCCTTAACCGCACCGCTACGTAACCTATGCCACCAGT
CAAACTTAACGTATTTTGTTAATTGATTCGGAGAACGGAAAGATGGGAAGCAGAAACAACGGCTACGTCGTTGAAATAGCGTTTCGGAAGTATCGATACT
TGGCGTTTGTGGATATGCGTGAGGAAATTCAGAACCTGCCATTGAAATATGGGTTAATGCATTGGCTGGTGATTAGAGAAGGAGGAGGAAGAAAAAAAAA
TGGTAGCGCTTAATAATAGAAGTTTGGGTGATGAGTATATTTGGTGGGAAATGATGTAATCCATGTTTTTAAAGGGCCCTCTAGGTAGATAGATAGATAG
ATATGAAATATCTAATTTGATTCATTGGAATTTTTCATATATTATGTTTTGGATTCGATATTAACATCTTTTTGTATAAATATTTATTTTGTGTCTAATT
ATGAATATTATGAGATAGTAATATGGACTTAATTATGAAATTGTAACTTAAAAGTTACGCGTTAGTCATAGTGTTATTGTTAACTTAGAAAGCTTTTCAT
TATAATTCCTAATCAATTCAAATGAAGTATTATTGTTTAAATCTTAAATTTGTTGTTGAGCAACAATAGCATTATCAACAAAGATTGTAATGTACGGATA
AATACTTTTTCATATTTAATTATAAAGTATTGATTTCACTATTTTTAAATACAATTTATGTTTGTTAAAAATGTTTTACTCTAAAGCTGAATATTATCAA
TAATTTACTTTAATTAATATTAGATCAAATAAAACAAAACGAAAGCGGTGGATTAAAGTTTTTAACTTACTAGAGCTGAAAAATTATGACCAAAAGGCCG
AAAAATATGGGCAAAGACCAAAATTTATTCTGTAGGTAATATATAGGAACCTCTGCAGCTTACCATTACCTGGCCTGTTCTTCTGCCCATTTCAACGAAC
GATCAAATTTTTTTTTGCTTTGTAGAGATTGTTTCACTGTATATGCACAGGTATTGCGGCGGAATTCTGAAAATAAACAGAGATGCCAGGGCCGGGACCG
CATATGATGTATACATTGGGTTCAGGATTAGGATTGATGAGTGTATCTAATGGCCGGTTTAGTCCTCATCACTGCGTTACCTATTCCATCAACGCTTTCT
TTGGACCGGACATTGGATCTTTCTCTGAGTGGCTTACATCAACCCTTGGGTTAGGAAGTGCTTTGGGTTATGCAATTGAGCCCTGGATCCATGACCCCTT
TTATCATATACTTATTCTTGGTATCCCCATGTCCATGCTTTACAGCGCTCTCTCCAAATTTCTCCTAAAGAAGGGATTGCTCGATTCCATTTCAGGGGTT
AGCCTCCTTAGCTTTTCTTGATAGAATTTTGTGTGGGGGAATTGATGGAATTGTGAATTTTGAGAAAGCTACTGTTTTTAGGACATGGGTGATTCTGTTT
CGTTTAATTTCGTAGCTGAATTGTGTTTTTTAGTCTTGATTCCGTTCGTTTCTGGGGTCAGCCCCTAATCTGCCAACTTCTCTATATGTTTGTTTTACTA
ACGATTTCGTCTGTGTAAATTGTTTGCGTTGTGAATTTTGATTGCTATTGGGGTGTACCCTTGGAGAAAAACTACTGTTTCTAGGAGGACATGGCTAACT
CTGTTTTGTTCATTTTTGTTGTTCCCCTTCCTTTGCTGATTCTGTTCCGTTTCTGGGGTTAGCCCCTAATCTCCCAGCTTCTCTATATGTTTGTTTTACT
AACAAATTTGGTTCAATTTTGTGTGAGGGAATTGATTGAATAGTGAATTTTGATTGTATTGGCATGTCCCCTTTGAGAAAAGCTACTGGCTTTAGGAGGA
CATGGCTGACTCTGTTTCGTTCGTTTTTGCTGTTCCGTTTCGTACCTGATTGTGTTTTACTATGCAAACAGGTTCCGCTTACAAGGAAACAGTGTCTTTT
CCTGGTGGCTGCTGGCTCTTTGTCACATTTTTTCTTGGACCATTTGTTTGAGGTAATGTCTGATCATATATGGAGTCATGTTTCTTGTGAGCTACATTTT
GCTCTGGCCTTCTTATGAAATCTCTGTGCAATTTCTGAGAAAATGGTAGCCATTAGTGTTATTGAATGGCAGTGTAGTATACTAGTATAGAACTGCAAAC
AAGGTTTAGCACCAGTAGCATCCTTAATGTGCCTGCGAAAATTTTTCACTGATCCTCGTTTATTGCGAAAGCTATCAAAGCCATGCTAGTTCCATAGAGA
ATTTTTTTTTCTTTTTTTTTTCTTCTTTTTGTTTGATCAGTCGAATTTACTGAACCTGATGGCCCAAGGAGATTGTGAAGAGGCCTGACAATAGTATATT
TGTTGATCATTGAATAGTTTGCTACACACAAGAATTTGTATGATATTTGTGCAAATGCTTGATAGCATGTCTTTATTCTTTATACTGGCTTGAATTTGGT
TCTTGAACTGGTTAATAATTTTGTTGGTCGAGGAGAAGCTTTGTAAGTCCACATTGTATAAATACTCTTTTGTTATTAAGAAAAAAGAGTAGACCTATCA
GTCTCTAGTTCTAACAAATTGCGTCTCTGAAGAGAATTTTGCCGTAGCAAAGATAGTTTTGGAGATGTAGTTATATAAGTATCTTCCCTTGTCAAAAATA
TACTTTGAGATTAATCAGCTTTTCAAAATTAGCTTCTACAAGTTAATTACTTTGGTTATGGAGAATTGGAGGAACATAAATGAGTCACATCTGTAAACTT
TCAGGCATAGAATGAGTTTAACAGGGACCATGAAGGGGTTGCTTCCCTGTCCACCAGCACGAAGGAAACTTACACAATTATACATTAAGAAATTAAATAA
GTTCCAATTATCTTTCGAAGACGCATCCCTTTCTTGTAAGAGAGAAGGTTTTAGTGTGTCCTGTCAAGGCAGTAGGTTAATCCTTGAGTAAAGTTATTGA
AAAAACTCCAAAGGCCTGAAGAAGGAAGGTGGCAATTAGACGTTGTTTGTAGTATAGTAGACAAAGGAGGAGACTTTATTACTATTAGACGTTGTTTGTA
GTTCATATGCCTTAATCCTTATCCCTTTAATCTCTCAAGAAATGTCTATGTTGATCTCAGAATCACCTGGTTTTACTAAGACAAGATTGGAGACCACATA
TCAAATGCTTTTATCTTTATAAGTCATAAATGCAGAATAAAAAATTTACTTAACAACAAAATGCATCTTTTCTTTGAGATCAGCGATAGTCCTTTCTATA
AGTTCCTTGTTCCTCTTGTAACAGGAAAATGGGAAGTCTACTATGTACACTTGGATATTGAGCACAGGTTGGTGGGAAGGGCGCGCACCAATCAATCTCG
ATGCTGTTGTTGTGGTTTGCATTCTATGTAGCTGCTTGATTGCTGACTTTATATACATAAACAGGTGTTTGCTGATGGATTATTCAATGAGATTTTCAGC
TGCTTTCTCTGTCGTTAACATGTCTTATTTTTTGTCGTAATCCTCTTGCAGAGTGAAGCCGCTCAAACTGCTCAAACTACGAGTTATCAACTCTGTCAAA
CTGATCTTGGTAATTGCTTCCTTATACTGTTTATGGTGTGCAACCCAAATATACTTGGTTCAACCTCGTCGGCCAGCAGTTGGTGAAGAGGCTGATCTTG
GAGTTCTTGTGTTTATGACAATATATTTTTTCCTCCCTCATTGGCTATGCATTCAGTCCATGAACTCAAGAGATCCCCAAGATCTTTTGCCCTTATGACT
ACATGAAATGCATAGTGACTAGTGACATAAAAAATCTCAAGGCTATAATTGATTGAACCCAAGTCCAGCAACATTTTGTAGAGGAGCTGAACTAGTCAAT
TTTCGCCGTTCCATTGCAGCATATGTTGCTCTTTAAGGTTCCTGGTATCATCTAGGCATAGATTTACCTTGCTTTCCTGGCTCCACAAAGTGTAGAGAGA
GTGATTTTGGAGCTGCATCCTTTCTTCCTGGGGATGATAAGTTAACTGTATGGTATCGAAAAAACGTTGACGTTATAAGGTTTTGTTGATAAAAAATAAC
TTATGCTAGCTCATATTTATACCTTCATTGTGCATTGAAATAAACAAACTGGAGATGTTACATAAATTAGCTCCTCTTGGTGTGTTCATTTGTTTTTTTG
TTTCTATGTCCGGAACCCATATTGGAGCTCCGACTAAATCTGGATCGCGCACCGCAGGGCCCATTGCGCTCCCAACATGATTTTCTCCATACCTAGAGCT
CGAACCTGAGACATCTGATTAATGGTGAAACACTCCCACCGATGTTGATCTGTTCATGTGATTGTGTAATTGCAACTCTCTACATTTTTGCTCTTCTTTA
GGTATCATCAATTATGGGTTGATAGAAAATGAGATTAGAATGAAAATGAAATTGTAATAGTTAACCCCTTGGGGTGTTACCTGCGTGAACACATGATATT
TTGTGTATCGAGAACGGTAATAGTTAGAATAAGTAAAGTACTTTAAAATCTTTAAAGTTAATTACAAAGTAGCTTTAAGTTTTTCTTTTTTAATTAATGA
ACAATGTGAAGAAGACATAAGTTAATATGATCATGCAATTATTACTGTAGTGGTAATTCTATCATTTTGACTTCGACAAAATTTACGTGACCACATTCGT
TTATAAAAATTTGAACCTTATCATTATCAGTATAATAAATAATATAAAATTTTCTTTTAATAATATTAAAAGTACTTTACAAGATCGTATATTATATGTT
TTGTCATACACGTGCTGAAAAAGTTAATTAATTTAAATATAGATCATTAATAATAATCAAATGCTAAACCTCATGTTAAACTTACCTATCATGTATTTGA
TTAGTGGCAAAATGCAGCCATTTGACCAATGTTTAACTGAGCCTGATAAAATTTAAATTTGGGAATTCATAATTTTAATTTCAAATGTGTAATGAGTTCA
TTAAGTACATACTATTTTGTATAGGTAGACATAGTGAATTAGCAATTGGACAATTTATTAAACGATATATGTGTAATGAGTACCTCTTCTAAAGTCATAC
TGCATATTTCTTGTCGTTTGGTAAATGGTCGGAATGAATTCACTCCCATCGATCACATTTGTCACGACTGATGTCTCAATCGGTCAACTATAGAAAATTG
ACCAATAGTTCTTCTTTCTTTCGATAAAGGTTAACAGTCCTATTCAAACGTTGGTGCATAAGTGCAGACTAGCTCAGTGTATATTACCTTTCCTATAGTT
TTGTAATTTAGGAATTTCTGATTTTAGAAAGTAACTTCCATGGATAGGGTAAGTGCTTGTTATATGAGAAAAAGTTGTTATGTGTTTATTTTCTTTAGAC
AAATAATTGTCCGCTCAAAATACAAAGTAGAATCGAAAGAAATTAAATTTATGATTTCTATTATATAAATATAATAATTGAGATAATAGAGAAGCAAAAA
TAACAAAACGAAAAGCACCAAAGAAAAAATTCAGATCGGTTTAAATAGTTGCCCCCATTCCCAAGAAAACCTCGTGAGTTTAAATATAAAGTTTCCTTCC
AGAGCCCAGAAAAATTAGCCATCCGTTAATCGTCCATTTTTGCAGCAGACTGTAAGTTCGATTATTCATTTTTCTCTTTGATTTTCAATTTTTACTTTGA
AGGATATGCATTTCTTTTCTGTTTTCACTTGATAGCAGCTTAGCATCTGGATTTTCCTTTACTTTTTTCCGATCTCAAAGTTATTTGTTGATGGTGTAAA
TTTGTCCTCTATGTTAGTAAATCATAATGGCAACCGAACAACCAAAACCAGCAACTGTAGATGTGAAAATGGATCTGTTTGAGGACGATGACGAATTTGA
AGAGTTTGACATTGATCAAGGTGAGTTAACATTCATTAATTTTAGTTTTTATTTTTATTTTTCTCGTGATGATTATCTTTGCCTTGGAATTTGAGATTTA
GCATCGTTTTTTGTTTTTTTTGAGTGTTAATGGAATCATTATACTTTTATATATAAGGTTTATCTAACTGTGCAAACTCTGCCTATGTGAGTTTTGCGAA
TAATAGTTGATAGTAAATCCGTTTTGAGGAGGATTGATTCAGTAAGTTGGCATCGAACTTTGAAGTAGTCAAACTATGATGAGTACTTTGAATATTGAGT
AGAGCTGATTAGATGAAGAGAATTCATTTGACTAAACTCTTAACTAGTTTGAAATCGACTATTTTTGGTTGATAACTGTGCAAATTCTGTTTGTTTGTGA
TAAAGTCCTGTTCAAAAGGAGTTTTGCATGAATGCTGTGTTGCACCTCTGGTTGCAATACTTTGAATTTCGGCATTGCTGATTCTAAAAATTAAGAGATT
CTTGCTAAATGAAATGAATAAACAACATACCTGTTATACCGTGTCACTTCAGAAGAATTTTGAGTTTGTTTTGTGGGTAGTTTGTTCCTTTTGTTTGCTT
GCAAAGTGATTTTGTTCCTGTTGGTCTTGAGCGTCATTGTTTAGTTGATTCAAGCTGCCTCACAGCCGAAAATTGGGACAACACCCAGTCATATCAAATT
AATAGGAAATTTGCTTGTTTTATTTCTCTTGACACTATTAAGGGGTGGAGGTGAGTAAGTAGTTGTGTGTATTGCCTAGTTATTTAATATGGAGATGAAT
GGTGCACCAATAATAGCCGTCTGTTCTTGTTTAGTTTTCTAATAGGGCTCTTGGAGATGGTAAGTTTATTTTCAAACCTCTCAGTTCAAGATGCACAGGA
AGACCAAACTCTTGGAGATTGACAATTTTGCAATTAATAGTTCACTCATGCTTATACATATCTTAACTGCTTGATCTCCCCATCTTCAGTCATGCAAGCA
CTAGTCCCTAGGGCTTCGGTCTAGTGGTAAAAGTGCAACATGTGATATGTGAGTTAGGAGAACAGCATGGTTTTGAACCCAGTACTTGGTGCTAAGTTAG
AAAGGGTAAAGGGGTGGTCCCATTAGCCATCAAGGTTTTATTGTGCACCACTGCCCTCCAGAGATTTCTTAGTTATTAAAAAAACTTCAGTCATGCAAGC
ACTAGATAGGTATTCCTCTAACTTATCAAATGTTAATCCATTGTGTCTGATTTTGGTACTTGGTTCCAAGTGAAGTTGGTACTGATTTTTTGCATCTATC
TTCTCAATTTGGAGAAGTGTTAATCATCGTAGTTTGAGACTCTATGACCGCTTTGCCTTTCTGATTAATTTGTCACTTTGCCTCCTCGTTAACATGTGCT
GTTTTCAGAGTGGGAGTCGAAAAAGGAAGGGAAAGAAGCTACCCAGCAGTGGGAAGATGATTGGGATGATGATGATGTCAATGATGATTTCTCTTTACAA
CTGAAAAGGGAACTGGAAAGCAACACGGAGAAGAAATAACCAAACCTTCACAGGATTGTTTCTCTTTCTCAAGATTTAACCACAGATATCTGTTTGCGTT
CATATATTTCCCATTATGTAGCACTCTTTGTTTCACCAAACGCGATGAACGTCAGTTTTCTTAATCTGTAATGCAGTTCTCTATGAAGATAGTTTTAAGC
CGAAAAAATGCTTAAGCTTGGTCTTATGTTTTACCATGCATGTGCAATTGTTTTTGGTCTGAGTGTGAAATGTATATCACAAATAGTTGAGAATTTATCA
TCCACGTATAATATAGTTTAACATTTCAAAATGTTTTTTAAAAAAAAAATTATGATGAAATTGGTTGTAAATTAATTTAGTGGATGAAGATGATCGAAAA
AAGAGGCATGTCAGTTAAGAGGAGAGGGTAAGCGGCAAGTAATAAGGATCAACCATTCATTAACTAACCTCTTAACAAAGGCCTATAAAAGTAGAATTAG
CTGAAACATTTTGTAAATATTGTTGCTGTTTGGATGCGTGGCTGCCTAAAACCAAAAAAAAACAATAAAACAATAACAGCCTCCATGCAAATCGCAATTT
TCAATAATTAATAATACTTGCCATCTCCTAGCAATAAAATTCGTAATTCTAAAGTTAAAAAAATTTAAAGATGGCAGATCCAGACACCACTAGGACGGTT
GTAGGAATCATTGGTAATGTCATATCTTTCTTCCTCTTCTTGTCCCCAGGGTAAGTTTCATCTCTAATCTCTTCTTCGCGATCGATTAATTTAATTCTCT
CCTTACTCAAGGCTCAAAAAAATAAAAAATTATCGCTATTTATGATGTTTCGCAGGCCAACATTTGTCCAGATTTTGAAAGCAAAGTCAGTGATGGAATT
CAAGCCAGATCCTTATATAGCAACAGTTTTGAATTGTGCAGTTTGGGTGTTTTATGGCATGCCATTTGTTCACCCTGACAGTCTTCTTGTCATCACCATT
AACGGATTTGGTCTTGCTATTGAGTTACTCTACGTCTCAATCTTCTTCATCTACTCCGATTGGTCTAAGCGAGTATGTACATTACTGTCTATGTAAAAAT
TACTTCTTTTTTTTTTCTTCTAAACATATAGAATTTAACACATTGCTACAACGTACCTGCCTGCAGCAAAAGATCATAATTGCTTTGGTTATTGAAGCAA
TCTTCATGGCAATCCTCATCTTTGTTACATTAACATTCCTCCATGGAACCAAGGATAGATCAATGCTTATCGGGATTGTGGCTATAGTCTTCAATATCAT
CATGTACACCTCACCACTGACCGTCATGGTAAGTTACATTTATCAATTCAGTCAGATCTTTCTATAACAACGTCAAAAGCAACCCCCACATGCACTAATA
TAATCTCTTTCGTATTGAGCAGAAGAAGGTGATCACCACCAAGAGTGTAAAATACATGCCATTTTACTTGTCACTAGCAAACTTTGCTAATGGCATTGTT
TGGGCATGCTATGCACTCCTCAAATTTGATCCTTATATCCTGGTACGTGGTGTAGTTTATTACTCGTTCCGTCCTAATTTATGTGAAAATGTTAGTCACT
AACAATGTCTTTTTTTGTGTGTGTGTGTGTGTGATTATAATAAAACAGATCCCCAATGGATTGGGTTCATTGTCTGGATTAGTGCAGTTGATCCTCTTTG
CAGCATTTTACCGCACAACAAATTGGGATGAGGATGAGAAAGAAGTTGAACTAAGTACTTCCAAATCCAACAAGTCAGATGTCTGATAAACAAAAATTGC
AGAGATGAAACTCCCACACTGTTTTCCAAGTGTGTGTATACACATATGGTGTGATAAAGAGAGAAAAAGATAAAAGTCTACCATTTTAACAGTATACTCT
TGATGTATTTACCCTGCATTTTCACTTTATTTCTTTAAAGCAAATCAGTTAATATATGTATGAGATCTCCAATTGTAGACATCTTTTTCATATGGCAAGA
GTTGATCATCTCACCTGACTTCTATATCTCGTTATCTATAAATTTCCTTTCTTATCGTTGTTAAGTGAACATATACGTAATTGAGTTGGTGTACTAGTAA
GGAAGAGTTGTGTACTGAGCTTATTATCGAATGTCATTCCAAATAGAAGTAAAAGAACCAACAGATATAAGATGGACTAATATTTGGTTGCATCACTTGA
AATGTTACAAGAAGCTGCAAATTCCCTCATTTTGTTTTGACTATTATCCTTGTGTAAATCATACATAGGAGAAGGTGGAAGTTCATTTGAAATCCAAACC
ACCAATGTCAAATATTGGGGAAGATTATATATTTAAAAGAAGTAAAATCAAACAACTACAAGTGAAATGAAGAAAATGAAAAGAAAGGTATAAGCTTTAC
ACCATCTAATTGAGAAATGCAGCGCAATTTGCCAGCCAATATCCACAATCACCAGGAGAATCTGGTACTGTATATAAGTTCAGGACTCTGAAATATTTGG
TAGTTGAGATAGAATTAACCTACTTCTTTATATGTAAAGCTGCACGGATCCTGAGTGTTCAAGGTCCACGATGCTTCCGGAAACAGAAACAGCCCTGTTG
TTGATCAACAGGGATCATTCCCCCGCCTTTGGATGTGTCAATAGCCTCTATCATGGATACTACCTCATCCATCTCAGGTCGCTTATCAGGATTAGCGTCC
CAGCATCGTTTCATCACATTAGCTAGGGAACTTGGGCAACATCTTGGTATTTCTGGCCTCAAATTCTGTGTGACAGAGCATAAACCACATTAAACGAAGG
GAGCTCGAGAAAGTGCTAAACTAAGAGACTTTACCTGGCGAACCACGGCTGAAGTCACTTCTGAGAAACTGAGATCAGGATATGGCATGTCACAGCAGTA
TATCTCCCACAAACATATGCCAAAACTATACACATCGCATTTCCTGTTGTAGGGGTTGCCATTGAGAACCTGCAGTTTAAGCACACATATCAACAATGCT
CAACGTCATATACAGCAATGTGTTATTCTTGGATCACATTTTTATTGATTGACTTGATTTTGGGGACTATAGCCCTTAATCCTTACCATTCCTCTTCCGG
AGTTATAAAGGAAGATTAGGCAAAAACAAAAAAGATGTTGTAACAAATATTCAACATAGAGGTTTAACATTATCAAATTTCATTTTATAGTGGATCAATA
GGCTTAAGTGCATTGCAGGTACACTGAGATAGCGAGAAAATAGGTCTATATGCGCTAGAAGTGATTAGAGTATCAACTAATGGACAGTGAACAAACAAAC
AGACATAAATTGAAGTTATCTGTAAGAAAGGTAAAAATCCTACTCCAGTTAAAATATGTACCTCAGGAGCCATATAGCCAAGGGTTCCTGTCTCCCCCGT
CATGTCATTAGGATTAGAGGCCTCAACTCGTGCAACCCCAAAGTCTGCAATCTTTACAGTACGTGTCTTGTCCAACAGCATATTCTCTGTCTTGACATCT
CTGTGCACAATCTTCTGAGTATGAAGGTAACTTAACCTACAAAGTTCAATTGATTGGCCTGGTTGAGATGAATGACAGATCGTAGATAAAGACCTGGGCG
TTAGAAAGGAAGAAAAGAAACAAGGTACAAGTTACCCTCTGGCCAAATCAAGTGCAATCTGCACTACAACTTTAAATGCTAGCTTCTTTCTTCTGTTCTT
GATAAGGTAAGATTTTAAGGCACCGCCCGGAAGATATTCCACAACAACACAACATATATTACTAGGCATGCCAATATGACCATTTTCTGTTTGTATATTT
AGACCAGAAGCTCCCATGGTCGCTCCGATGAACTATATCACATGAAAGAGATGATTTTATTATGTAATATAAACAGTTTATTTATAAGCTATGATTACAT
CTAAGCAACAATCACTCAATCAGTGCGTATGCAGTCTCTTGTAGAAATTGTGTTCATGCAAATGATCGACATTTGAATGAGATGAGAACCTGGACAGAAT
AAAGTTCTATATTTCTCATAGTTTTAATCATGTTCAATATAAGCTACTAAAAAGTACTACTAAAAAGTAACACATCGAATCATCCGAACTTAATGAATAA
AGATTAATAGCAGCCCCTAAAGTAGAAAAAATGTAAACTTCGACTTGGAATTCTTTCTTACCAATAATGGCATGAGAAAGATTCACATAACTCTTGGCGT
CACTGAAGGAGCACGCTTTTTCCTTTACTTACATAAGTTTCTGCTACATCAATGAATGAATTATCTGAGGTAAATCACATTACTACTAGAGCCTTGGCAA
TGGTGTTTTAAGAATAAAGAACTCTGCACTCCCTGTGCAATGCGACAGCTCAAATGCAGCGAATTTTCAGAGTTAGCAAATTTAATAAGAACTCAAATTT
ATTACGATTTAAGAAAGAATGACAGAATTGAAACATCGCGATAACATTGTAAGAGTGATTGTTAAGGCTAAACTATAATCTTCCATTCAAGCTGACCTTC
AATAATACGTAATTCAAGAATTGTAATGTTTTTGTTATCGTTTCCTGAATTTATTTGGTGGCATCTTTTCGTACAACAGTTACTTTACCGATGTGAAGTT
TCTTTCTCCCATCACCCGCTGATGGTTGAAAGAGGTGGTTTATACAATTGAACAGGATATTAGAATCCCCTGAGTTTTATGGTCGAGTGCTTGGACCATG
CAAAAAGAAATCAAGATGCACACATAGGGACGTTCACGACTCAAGTACATAAATAAAAATGACTTACATAAAAGTTTTAAGGATTACAGCACAAAATTAG
ACATATACTCCAGGCATATTTCTATTAAGTTTAAACAACAAGCAGCAACATCCAACAAGCTCTAAACCCTTCCTACACATTATGAGTTTTAGAGGCTTAA
CGTCACCTTGGTTACATTAGGATGGTCAAGTTTATGCCACACTGAAACTTCTTGAGTAAAAGCTGCCCTTAGTGATGCTATTTCAGCTTCTGTTCTGTGT
CCCTCTTCCCCCCAGTCCAGAAGTTTAACTGAGTGTCACAAAATAACTCACGTGTTAACTAAAAGTTACATTTTTCCTTTTAACTGGTGCCAAATTTTGC
AAATTGAACCAGGAAAAAGGGCAAAAAGAAAAAAGAGCAAGTATGGACAATGTTAATTCCCTGTAGCAATGACTATGACAATGACAATGACAATGACAAT
AAAACTAACACTGCAATAAAGAGGGAACAGGAAAATGAGATCCAGAATTGTAATAGATGTCATGCATTACTTTAATACTTAAATGAGTAACAGATTGGTT
CACATGAAAGTTCAGATATACAGCAACAAATGCAAGACACAGCCAAGTTAATGCCGTCATCTGCAACTTGCAAGAAATTCAACACAAACCCGTGCCTCTA
TTCACGGATTGCATAAGAAAAAGCTCAAAATGACTAACCAGTATTCAGCAAAATCCAAACCCCTCCACCCCCAAACACCAATCAAGAAAAAGGATTAAAA
AAATTAACAACAAGAACAACCCCAGAAAGAAAAAAAAAAGTATCATTATTCCAGCAGCTTAGAGGAACCCCACGAGCTTAAAACTGAACCCCACAGGATT
AATATGGACCTTAACACAAAATTCCACCACACAAGTAAAAAAAATCAAATCTTTAGTATTTGCAAGAACCATTTTTTACCATTTTGTCATATTAAAGCTA
AATACAAGAAATTGTATGGTTTAAAAGATTATTTTGAAAATCAAGAACTGACCAGCAACATCTTGACCATCATAAACGCCACGGTGGACAGTACCAAAGG
TTCCACGAGCAAGAACAGTTTTGATGATGAGCTTTGAAGGGTCAATTTCCCACTCATATCTTTGCCTAGGAACAGATGAGCTAAACAGAGAGAGGTTGGG
GTTGGGGTTGGGGGTGGTGGGGTGGTTGGCCACTGTAGCAATAGAAATGTTGTAGTTAATGGAAGAATCATCTTGTGGTTTCTTCTTATTCTTATCCTTG
TCCATAGTTCTTGCTCTGATAAGATGCCTTTCAAGTTGTTCATCCAAGCTCTTCAAATCAATCTGATCTGCTCTCACAAACCCATCACTGCCCTTCTCCA
TTTTTGCTTCTGCAAAGTTGTAAAGATTGGATTTTTAGTAGTTTCACAGTAGAAGAATTGAAAAAGAAGAAGAACAAGGAGGGCTTGTTGGGGGTATGTA
GTGTAAAGAGAGAAGAGTAGAGTTTGTGGTGTAATATGTTTGTATGGAAGAAGGGGGAAGAGAAGAGAGCATTATGAGCAGAGCAATGTCATGTGGGCAC
ATGGAATTGCCTCAAGACAATGTGTGCTCTTTGACCCACCAATCTCCTAAATCTTTCTTAATTAGATGTCTCGATTTCCGATTTCCAATATAGCACCACA
CTAAATAAGTTTTATTCTCCCTATCTGAAATTATTGTCATGTTATTTTTATCAAAAGTTAATTTGAATAATTCTTAAAGGTCACACTAATTCGATATTTT
AAATAAAAATATTAGATATTCTTAAACTATATAAAAAGTACTATAAATTATAAATTTTTACATATTAATATTATAAAAAAAAATACATCTCAAAATATTA
GTCAAAATTTTTATATTTTAACTCTAAAAATAGAAACCATAACAAACAATACTGGACGGAGGAAGTATTCTAATGAATTTAAATTAATATAAATATAGAA
TATCACACTAAAAAGAAAAGTAGATTTTACATAAATTTTAAAAGTTAATTGCATCTTATCATTCATGCTTAAATAAAAGATCTCGGGTTTAAGCCTTCTT
GGGTATGAAGTTTTTGTTAGGGAGTGTTTTACTCCCAATGTGGGGCTTTTCGGTTCGAATTTAGTCGGACTTCAATGTGGGTACCGAACATCGAATGGAA
AACCAAAAAAATTATTTATTCCTGCTCTTTTTCATACTACAAAATCTCGTAAATTTGGTAGAATCTGGATACTTTCCGAAACGTTCTTATACATGAGTCT
CGATTTTGAATACATCCCTCAATGTTATGATACACTGCGTCTCGATTTCGATATATCACTTTATGTCTTGATACGTTATGTATGTCTCGAAACATTGCGT
AAAGTGATTTATCCAAATAATACATTATGTAAACTAATGTCTTGATATAACACATGTGCCCCGATATATCATGTAAACTAATGTATCCGATTAATATATC
ACATAAAATAAGAATTTCGTAATTTTTAAAATAATAGAAAATTTTAGAGAATATAATAAAACATATTTAAGTAATCTTTCCGATAAAAAGTCTAATCTTC
TTTTATGTGTCATCAATATAAATAAATAACTCATACAATTTCAAATCTTATAAATAAGATAATGCAATTATCCCCCATATGTAAAGATGATATAACAATA
TGAAAAAAATAGTACTGCAATATATATAAAAAATAAAATTATATTATTAATTCGGTTTAACAAATTTTAGTAGATTATTATTTTTATTTGAATTTCAATT
TGCTATATGAAAAATCACATGTTGTCAAACGTTTAATATAAGAGTGAAAGATAATTTATTTTTATGAATGCATGAAACTTAGGACACGTAATATTTTGTT
AATAGACACAAATTATCAGTACAATTAAAAACAAACCTTATTTAAATATAGATTCAACTTTTTTATAAATAAAATATGTATATCAAATATTTCTAACTTA
TAAATATATACTCTTAATTCGAGTTGAATAGGTAATATTTTTAATTATCTTCTTTTGTTATGAACTCGTTTAGTTTTTAACAAAATCATAAGTCCTCCGT
GTTTTAGATTATTTTTTTTAAGGAAAAAACAAAACAAAATTGATTAGTTAAAACCTCGCAATTTAATTATAATGATGAAAGCAATTTTTTAATTGAAATG
TCAGTGTTGACCTTTGTTGTCCCTTTTAATTTCAACATTTGATTGACCAATACTTGATTTAAAAGTTTACTGACAATTGTTGGGTGTTAAGTGGGCAAGT
TTTATTAAACAAATTATTTTATTTTAGATTTTGTTTGGTGTGAGAGATAAATAATATTTTTACCGTTTTATAAAGAATGATCTAGTTTGACTTGACATAG
AATTTAACAAAATAAAGAAGATTTTTTATCATGTGGTCATAAATTAAAGTTATATATAAATTTGTCCTTTAATCTTGTGGTCTTAAATATACCACGTGAA
AATTATTACAAAAAAAAAAGAAGAGATCACTCTTTTTAAACAAACTAAATAGAAAAGGAGTTCATTCTTTTTAAAACGGAGAGAGTAGCTAATTGTAAAA
AAAATCATATTTAATTGAGACAGAATTGTGAAATATCTTACTTTGAAATTAATCACCATGATTTTTATAGTATTATTTTTAAGAAAACTTACATAAATAT
ATTATATTTTAAAAATATTTATGATTTATATTAATAACAGTTTTTTTACTTGATCACTTTTAATATATTTATAATACAGTTTTAATGCATATTACATAAT
TTATTTTTAATATATATTGTAGATTTAACATAATATTACTATGCAGTGTTATAAATTGTAATAAATGAAAAATATAGCTAAAATTAGTAATTTATTTATT
AAAAGGTACTCATCCGAGTGAGTTTTCCTTTTTAATCTAATATTGCGGATAAAGTAATAATTTCAAAATAACTTATTAGCCGAGCCATCATGACTTATGA
GTACTAAATAACGACTTTTTCTGCATACCAAAAAAAAACAACGGTATTAAATAGATTGTTTATAGATCAATCTGTGTTGAATTATTTAAATAACAAACGC
TTTTCAATTTTAACTAATGAAGCAAAAAGGTGAAAAAACTGAATAGACAATTAGACATATAAATGTATGTATGTATACATACAACTCACTCTGCAGCATT
TACTCGATTAATTTAAATTTACGTCAAATAAATTTGCATACCTACATTCAACTCTTTGAGATAAATAATAAATCACTAATTTTTTGATTTTTTTTTCTTT
TCCCCACTTTTGGCAATAATTGAACCATCATGTGATGTAGCCAACAAATATCATATACAGCATGGATAAGTATTTCATTTCAACTGTTCATTTTTTTTGG
ATTTTTTTTTTCTTCAACAACCTTTTCTTCTTTATCATTAAATGAAACACTTAATTACTGTCTCTTATCAAACAGAATTTGTAACATTATTTTTGCAATA
TTCATTACCTGTAAATTAATCCATGTCAAAAATGTTCTACTTCTTCATTAGGAAACAAAAAAAAGTTTTTTCCACCGATCTTTATTTTTGATATATTTTT
ATTTGGAGATTGATTCAGAGCTTTTATTATAAATTAAAAAATATATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTTGACTGTATATATTATCATCAATAAAGGAGATTTGAATGGCTGTGATT
TTGTCAACTTTGGATTTGTGGTTTGGTGAGATACATCAGACGGTGACAGTTATATTGAGAATATTTGGGTCCTCGATAAAGAGTAAAGGCTAATGGGCCC
AAATTGGGCTTCAAAAACAAAAACGACACTCTAAATTGTGGACCCGGGTTAGAATTTGGGGCCCAATAGACAGTATGGACCCTTTTTCTACTTCGACTCT
TACAAGCAAGGCATATATTCTCTTGTATGACGTGTCATTTCTAATGACCATATATATGGTGTTAGTAACCACGTTGAATTTATTGTTCAAGATCATATAA
GAAATAAAGAAAATCACAATATTTTTACTCGAACAATGTGATCGCATGTATGATATAACTAGTCGCGGAGCCACATATAGTTAAGAGGTATCGGTCGATA
TCCCTTCGTCGAAAAATTGCGTGTAACTAGAATGAAAAATTATTTTTTATGTATATATTACATATTGACACTCCTTAGCTTCTATACGATTTTATTTCTT
AATATTTTGACACCCTATAAATAAAATTCTAGCTCCGTCACTGAATATAATGTACACTTGCTTCATAGTTAGTAATGTTGAAATCACAATGATTTAATAT
GAATTGTGAATTTATATTCCAAGATAACTAGATTTGAATATAACATGAAGTCGTACTATCTATTTTTGTTTGTACTAATAAAATGATAGGCTATTCGATA
TGAATCGTGAATAACCTAATAGGATAGCTAGGTGTATACCATGAAGTCAATCATATCGAGATTTATCATGATTTACGTGATAAAGTTGCTAATAATCACT
TTAGTAATCCAAAGAAATTACATTAAACTTATAAAAGATCATTTTTTACACTAATATCAAAGTTGGGGATCATCAAAATGTAAATAATACAGCACAAGAT
GATCGACTACTCTATTCCTCGGTCCCATTTTATGTGGTTATCCTTTGACTTATTAAGTAAAAATAACTAGAGATTTTTGAAACTTGTGATGTAAAAGAAT
TTTTATATATTTTTGTGGGTGAATTATTACGTTAACGGTAAAAGAGAAATTTTATTTTTTTCTTCTAATTTAGTAAAGTGACATTTTATTTGGGGAAGAT
CAAAAAGGAAAAAGCGTCACTTAAAATGAGACGGAGACAATATATTTTTATGTTAATTTTCGACCTTCAATTCTTTCTGTCTCTTAAGTGAAGAATGTGT
CATGTCATGTTTGATCACATCTCCCCAATTTTTATTTGACCTACCTCTACGTTTATTAGAACCTAAACGCACCTTCTCTGTACATGTTCAAATCATTACA
TTATTATTTTTCTAATTTTATTCCGTATTACTTCATTTTTAATCTTGTCTCTCCTGATTACACATGAAATTTAGCCCGCGGCTAGAAAGAATGTAATTAC
AAGTGTTTTCAAATAAACAAATGGAAAGTAATATAGTGATAATGATATAATATCATATCTTTTGTGCTTTTCAAAAAGATAAATAAAATAAATGGTTCCC
CTAAGCCT