BAC Sequence – LE_HBa0194N16

>C06HBa0194N16.1
TGCTTCCTCCCAAAACTTCTTTTTGTATTCATTTTTTTGTGTAATGAAATGTGTGATTAGTGCTTTTGATGAATTTTGGGAATTGGGTTTTGCTTAATTT
ATTTTATTCATAAGCTGTTTGAACTGATCTGCTTTTTTTGGGGTGGGAGGAATTGATCATATTTGTTGTTAATGGCTTTTTCTGGGGGAATAGAAGTTTT
CATCTTGGAAATGTCACCTGTCATATTTTGCAAGTTCTTGTTTTTCTGTTGAAATCTTCAAGGAATCTTTACTTGGATCATGAGTCCATGTATGAATGCT
GTATTAATAACTTGCATTTACAGCTGAAAATATGTTGTTATTTGTCATGGATTTGGTTCATTGTAATTGATTTATGAGGTTTAGTGATGGTGATGTTTCT
GTTTTTGCTCAAAATGTTGAGTGTTGTGATATAACAAAGGTTTTCTATACATTTACTGTTGGCACGACTTTTTTGCGGGCTTTGTTTATGCTAATGTACT
AATTCGACCTTGCTTATAATTTCAGCTCCCTCACCAAAGGGTTCAGGAAAATGTGGGAGGTTGTATATTGCGGAGCCTTTGGATGCCTGCTCAACCTTGA
CTAACAAGATTGAACCAACTAATAACTTCACAAAAGAACCATTTGTTCTGATAATCAGGGGTGGATGTAGCTTTGAAGATAAAGTTAGAAAAGCACAAGC
TGCAGGTTTTAAAGCAGCCATTATCTATGATAGTGGATATGGAGATATAATTGCAAGTAATGAACTCTTCCATTGTACAGTTTCTATATTTATTTCACTT
GCTCAAAAAAATTAAGTTTTCTTTCTTTCTTTCAATTATTCATTTAGTTCGTTCTAACTTATATTATGTTTGATGGTAGTTAACGTATCAAGTGGTATAA
CCTGAAATCATATCTTGAGGACGCACTAAAGTGCCCATGGTATCATCATGAACTTGCAAACAGAAACTGTAAAAGCCTAGGAATATACATGCCCAATTGA
GATGGGATATGATTACATCACAATTGCATAAGGACACTATCTAATAGATCGTTGTGAGTAGTTGAATCATAATCTTTAGCGTAAACATGGCTGCATGTGC
AGCATTCTTGAACTCTCTGATTGCAAGTTTTAGAATAAGGTTGAATATATTTCTGATATTAATCATTTAAGTATCAATAGTTCTACTAACTGATTTTAGA
TCTGGAAAAATAAGAAAATTAGTCTGCAAAATAGTTTTGACAAAAGCTTTTATTCGTATCTATCTTACTGGCAAAATGACTTCTTGAACTATTGCAAGGG
AAATCTCTTGCAGATAGCTGTCACACTCTCTCAGCTGATAATAGTTTTGATTCATTGGGGTAGAAGTAAAATAATTCCTTCAAAATAGATATTTCTGGTA
CTATTTGTTCCTTTTTATTTTATTAGGTAAAGAAATAAGCGGTCGGATTAACAAGATTTTTTTCTTGTTCTTTTTGTACTGTTAAGGTGATTAGTTAAAA
TTGACATTGAACTCTTTACTCCTTGCACAAGCCAGCTATCCAACATTCTGCAATTTTGACGCAAACCTGCTGGTTTGCTTTTAATCTCCTAATGCTCTGT
TTATCCCATATAAAATGTTGATGAAACTTCTGAACTGTCAATTGATCAACCCAACTATGCTTCCTTCTCTAACTAGTTATTCATGAAGACTGATAGGACG
ACATATAAAAGGGTTAATTGGATGTTCAATCTGGTGAAGAGAAATTGATCCATGTTTGTCTTCTTTGATTGGCTTGAGCCAGCATGATCCAACAATGGTG
CATCTGAAATGTTCATATCAGAAAACTGACAAACTAGCAGAGCAGTTTATTACATAGGAGCGGGGGTTTTACCCTGTGCGCACCCACAGGGTAGCGGCCG
TGGGTTTGCCTAGTCATAACAAAGAAAACTAGCAGATTAGTTTTGCCTACCCCCTTCCACTAGGAAAATGAAAGGAATTAGGCACAATTTCCCCCCTAGA
CTATGACCGAAGTCCTAGAGACACACCTAAACTTAACTAGGGTCCTATTTACCCCCAGCACTCAGTTGTTCCGTGTTTTTGTGCACCTTTTGTGCTGATA
ACTCATAAAACTTTTGTCAGACTTCAAAAACCATCTTCATCTCTTGCTTTTGAATGATTTATAATTGTTGATTTTTGAGTTAAGTTACCAAATTAAAAAA
TTGTTGATTTTGAGCAAGTAGCTTCACCTCTTCAAAAATAGTTCCGGGTGCATGTCGGATCCTCCAAAAGTAATGCATTTTTAGAGGATCCGACATGGGT
GCGATAGTATCTTGAAGAGTCTGATCATCGTTATTTTGACAAGCAAAGGTTTGATCAGACACATGATACAGTGGCAGGAACCTCTGCTGGTGTGAAGATA
CTGGCAGTTTTCATTTCAAAAGCTTCTGGAGAAGCACTCACACAGTATGCTGGCTCGGATACGGAAGTATGGTTAATCCCAAGCTTGGAAAACTCAGCTT
GGTCAATCATGGCTACATCTTTCATTTCACTACTTTCTATGTCTGCTGTACTTGCAATGTGTTTCTTTGTTCGCCGACATCATATACGAAGAGAACGGCC
ACGAGCTTCTCGTGTTCGCGAATTTCATGGGATTAGTAGCCGTTTGGTTAAAGCTATGCCAAGTTTGATATTTACGTCAGTTGTGGAGGATAATTCTACA
TCAGTGACATGTGCTATATGCCTTGAAGATTATACTGCTGGAGATAAGCTTAGAATTCTTCCATGCCGGCACAGTAAGTTATCCTCATTCTCTCTTTGAT
TTTTGGTACCATGCCAGACTAATCAGTGATCATGGTTGATAAGCACTAATGTATCCCCTTTAAACATGAAACAATTTTAGTGTCACCACTAAGGAAACTT
GACTTGTCTCCCACCAAAAGCTTATGGTAGTTTGACCTTACTGAAAATGCACCCAGCACCATCACTTCTTGCCACCCCACCTCTGTGGGTTCCTACTGGT
GAGTGTGGTATTCTGTTTGTAAGGCGTTTCCATCAGCCTTTGCAATTCATCCATCTCTCAATCTTGTAAATTCCAGACAATAAATTCCCCCCTTTCGCGT
CACCCTAATCTGTTGTACCATCGCCTCTTTCTAGCATGAAACTCTGAATAACTTGGGAGAGGTTGTCCTCCTATACTTCTATGCACCTATGTTGGTCCCA
AAAGTTGACTCTACTTCCATTCCCTACTTCATAGGTAACTAAGCCATTGAAATCTAGCTAACCTTTGATAATGCTTTTCTAGACCTCCATTTCCCTTCTA
CGACTCCATGTTTTCGTGCTATACCTCCCTCCACAATGCGTGCTCTTCAACCCCAAATCTCCATAACTACTTCCCAGTAGTGCCTTGTTCAAAACTCTTA
AGTTCTGTTGTTCCAGGGATATGAGGAAGATTCCAACTACTAATTCTTGGTCTCCGTTTACCGAGTCCCCCAAGCCTGTCATCATAGTTGTTTAGCTCCA
ACTTTGTATCATGATGTAGAGAAGATCATTCATCGCTGTATGCATATTCTTCTACCATCTTGACTTTTGCCCTTTCTAAAGTAGCAGAACAGTTATAAAT
ACAGTTCATACCTGATTTTTGAAATTATTTCATTTTCTGAAGTCTCCTTGGGGGTGAACTATGTGAAAACTAGAATTTATGGTTCCAAGTATCATATTAT
TGGAATATTTCCCTTGTCCCCAGTTGCTCTAATGCTGTATTTGTTGATACATTTCATAGATGTATGTGCACATTCAGAATTTATTTCTGCTGGAGCACTT
GGCCTTTTTCAGTTATTAACTTGTCTTATGGGAACTTCACAGAATTTCACACTATGTGTGTTGATGCTTGGCTGACATCATGGAGAACCTTTTGCCCTGT
CTGCAAACGGGATGCAAGAACTAGCACTGGTGATCCACCAGCATCAGAATCTACACCATTGCTTTCTTCCAGTCTGCGATCTGTATCTTCAGTGTCATCT
CTGAGGTCATCATTAGCATCATCAGAAGTGATACATATAGGCACAGGAGCATCTCGATCACCTTCAGTTTCTCGTCCTCAATCTATCTCTAGCTCTCGTA
ACCAGCATTCACTTTGGTCTTACCAGTCACCACATCTTGCTATAAGCCGGAGTTCACTGGACCTTCAAAATGCATCTTCTCAAAGATCTCGTGCAGCTTA
CTTAATTTCATCCAACTCATTGGGTTATCCTTGTTTATCACCTCTTAATTCAAGATATGGGTCTGCATACATTCCTAGTCCTAGCAATCCCTCGTCGAGC
TATATGGGATCAACAAGTCGGCAGCCTAACCCACTGCATCACAGTGAATCAATTACAAGCTTTTCACCATTTGCTTCAGCTAACTCTCTTCCTGGATGTG
AGTCGTGATTTAATTGATCATGGCAAACATTAATCAAATTGTTGAAGTCCCTTGCAGGGAACTCAGGTTGGGTTATTCTGACCTCAAATTCACGTGAAGA
CAATAGAGCTGATTCGTGTTGGTTGCTTTGACATCTGGACGGAGGAATACAACAGCTAGCTTCATTGCTCAACACTTCTGGGATATTGGTTTAGTAGTTG
ATAGGTTTGATAATTTTGAGTTTTTTACAGAGTGTACATTCTTAAAGATGGGTGTATTACTGTACGCATTGCGCCTTCTTTTGTTTATTGCTTTTTTTTT
TCTTCTTACCCTCGATTTCTCTATAATAGTGATGTTTTTAGCCATGTCCACCTGACAGATGGTTGAGGCCTGTAGTTTGCATGTAAATATGAATGCCCTT
GAGGTGACTAAATCTAGTCTTTTACTTGTTTTAGTTTTTGAATATCCACTGATTTCCAAATATTGCATATCTGTGGTTGAGGAAGTTTGTTTAATCAGCA
ACACCTTGTGATATTGCTTTGTGTGTTTCTACATCCAATTCAGAGTATACAGGTTGGGTGCTCCCATCTGTAAAAGAAGTCCTCAATCATTGGTGCCAAC
TGCCAACTAAGAGCACATGGACTATCATTAATCATCAAACAAGCAGTGATATTAGCTAAAAAAGATTGTTTCAAACACATTTTATACAGTGCTAAAATTA
AATTTGCCTCCACATTTGTTAAATTCAATAACACAGATAGAAGCACAAACTCTTCCCTCCACACTTCTGGTTACAGTAATCCTACAGTATGTTGTTCAAA
TAACTTTAATAAGAAAACAAGGGCTGTGATCGTTGTGAGGATGAAACTTAACAGCACTCTTAGACCTACGTGTAGTTTGGTTTTCCTGTCGAGGATTTCT
CAAGCTAACTATCTGAGGTCTGACTGGTGTAAAACTTAATCTTCCTTGTCTTGTTTCTCTCCAGAACGAAGTGGTTGTCTGGCTTCTGTCTGAGAGGTGG
AGCTGCTTGGATGATCTCCCTCGTCCCTTGTACCAACAGTTAAGGGTTCCTCTTTCAAAGACTGGATAATCATCACCACCGCAACCACAAACACTATGAT
GGTCACTGTTCCCAAACCTATCATTGAGTTTATGAAACCCATGAAAGAACCAGAGCTAATACGTTTCTGTATGATATTTCCGTCTTTGTATCCTTGAATA
AAATGTGTAATTTGGGACCCCTGATCTTCATCTTCAACGCTCTCAGAGCCAACAACCTGTTGCATGAGTAAAAAATTGTAATCATTACGTTAAATTTATA
GTGATTTAGTCAAAAGACACTTCACCTAGAAGTAGATTATGTATAAATAATGTCTCTCTCTTCTAATAAACCACTGAAAATTACTGGTAGATATTATTCA
CAAAAGGCATCTCACAGACTTGGAGAAACAACATAATTAAGTGTCATGCAGTGAAATGATACCAATTAATAAGTACGGTTAAGTACAGTTTATCCCTGCT
GTTTATTTTAGTCAGAACACTAAGCAAAAATGAAAAGTTCATCGTTCACTTCAGTCGATAAGTTGAAAGCACTATATTTTAGCCGTGTTAGACAAGAAAA
AAGTCCAGACTCCAAACTATAAAGTATATTTCCTACACTTGATAAGGGTCGACAAATATGCAATCCCTAGCGGGGAACTGGAAAGGGAGAGAAAAAGAAG
TAAATGAACTTACTGAAAAGTACTCCTCATCGCCATCCCAAACAACCATTTTTGGCAGCTTAGTTTTCTTAGAAACGTCAAATGATTCAGCAAACCCTTG
CCATTGCTTGAACCCAACAAAAACAAACACGAAGTCGCGGTTTGCAGATGCAGCAGCTTTCAGGAGCTTCAATAATTTCTTAGACCTATCATCAGTTTCA
TCTTCCAAAATTGTTAGAATAACTTTTCTCTCATCATCTTTCAGCAATCTCAGAGTTTCTTCAGTAATGGGCAAAGTCAGTGGGAGCAAACTCTGCTTGA
TATAATCCTCAACAAAATTTTCTGTGATCCATAGCAGGAAGAAGGTTCAGATATTCACCATTATTTCGCAGAAATCCCCAAAACACAACTTCAGCTCAAT
TCTTAAATCAGTTTGTTTTTTCATGCAGTACAGAAAATACAGCAAATGTTGGCAGGTTGGAAGTTAAAGCTATTTAACTTTTTTCATAAATAAGCCTAAA
ACAATTTAATCAACTGAAAAGTATAATATAAGGTTATAGTCATGCAATCAAATCAATTACTTAACCACCTAATCAAAACCATATCAGAATTCATCATAAG
AGTCAACTGATGTTTTTGAATGCTTCCTTTTTGAAAGCACTACAACTAGCTCATGATTGATCCCTATTATTTAAGCACATCAGAATCTGGAGTTGCTGAC
TTCTGCTTTTAAGTGACACAATACAAATAAAGGGCCAATCATTGAATTAAAGCAAGTTTTGAAATACAGAGCAGGTGGTACTGTTACTTCTTTAAATATA
ACAAGATTCTGGTTTTCTCAGGACCTTTGTAGGCGATAAAAAAATAATTAATTCTTATTAGTTTCTAGGAAGAGATGAGTAATTTTTTGATAAAGTGAGT
GAGATTTTAATTACTTCCAAAGCCTAAGATAACAGGCGATGATAAGCTAACCTTCAAAGGGGCCATAGAAGATGCTTTGTTCATCATAGTTTGGATGACG
AGCTACCAAAGCAGGTACCTTGTCAAAATCATAGAATTCCATGGTCTTATCCGAGAAATCTTTTGCCACAGAAAACCATGCTCTCTTCTTGTATTTTACT
GCAAAATGTGATATGGCAGATTCATTCAAACCAAAGCCTATAAATATAGGGAAACTAGTGCCGGCTGCTTCAACAAATTCACTAATGGCTGAATCAGAAT
TGAGTATGGCCACATCAGCAGCAACAAACTTCTTCAAGAATCGTACAAGTAAATCTGCTTTTCTTGGTCCATAATATTCTGTTGGAACACCATGCATAAA
TATCTTTAAAGTTGGATATCCACTGCATTGAGATCAGAAAGAGAAATTCAATATCTTCTAATAAAATAAAAATGATCAGTGTCTTTTAATTTCATTAACA
AGAGTCGAGGGGAGAAATAATCAAATTTCCATAAAGCATGTGTTCCTGCAGCTCAGCATTATATTTGTTTTATTTGTTTAAGGGAGAGCAAATAACATCT
AATAAATCTTCACTTCGACGCTTTTCAGTGCTCTCTTGCAGAAAAAAAGTAACATATTGAATTACACGACAGGTGAACTCTTGGGGTAATCCAGCTTCAT
TAGAAATAGAGACGGTACAGAAAGTAGATCAGAACCCAAATTCAAGTCTTCCCACTTAAAAAGCTCAATCCCCGTCCAGCTAGTCATCTCTTTTGTCCAT
CAATTCCAACTATCCTGATTACACTCTCTCCGTGTATGTCACCTGGCTACTCTGCCTCTCCAACAGACTTAGCTAAAGATACTACTTCCTACTCCAGCAC
ATATGCAGACGTATCAGCACCATATAAGTACATCCTAGACAAAGAGAGGGAAGGAACAATATTGATGAAGGAGAGATCCAAGATTGAGAGAGGACAGGAA
CAAAGGAGATCAGATTATTATCAGTGGTAGAATTAATGGAGGTTTAAGGTAAAGGAAAGGAAAAAGAGGACGTGGCAGACGTACGGACAAAGAAAGATAG
ATGTGGCTGGGCCCTCAACGACCTATCAGCATCTACATTTTTTGCTTTTCAAACTTCTGTTGTAACTTGTAACTCCTTTACTTAAACACATCATCTTCTT
TTACACAGGTGAATACGAATCAAATTGCCTATATGGTCAACCTAAGAGAGTAAAAATGAAATCCAATTTTAAAGCAAACAGTTGTGATCACTATCAGAAA
AACAAATGAATACCTCCTTTCTTTTGAGTTCTTGAAAACCTTATTAAACGGAAGCAGATCATACATTGTAAAACTAATATCAGAAAAACGATGTAGTGAT
AAGGCTAAAAGTACACATACTCAATGCCATATTTTGAACCAACACGTTTGTACTTGTCAGCATCTATTTTTGCAATACTTATGGGCTTCTTCAAATCAGC
AAGTATGCTAGCAGCTTTGTCCAACTGCAACGAACTTAAATTCATCAGATTGATACCACGCATCACATAGAATTCAATTCTTGCGCAGAGAAATGTGCAT
ATTAAATGAATCTGAGCGTGGTGGTCGCCGCGCGGGTTGGGTGGGGGGTGGGGTGGGGGAGTCATCTAACAGAGATAGATAAGATAAACATAGATTCTCG
CAAAAAATATGTGATCTTAAGCTTAATACCATATCAATCAAACAGTTCATTACTTAATCGGAGATTATTTGTTCTTATGAGTTCAATCAGACACTGTGTT
GGTCATGTGGGTATGTGGACTTTATAAGGAGATTATTTTGATGATGCGGCCAACCAACTACCCCCCTAAAGAAAGATCTGATAACAATGGTTGCACAAAA
CATACTTAGGAAGCATTTATAGTAAAAATTACTTTCACAAAATGTATGGATATCCGAATCTAGGAATTGGCCAAATGACATAATCAATATAGAGTCTAGA
TAACTTTTCATTGGAGAAGCAATCAACCTTTTTGAAGTTAATTGAAGAGTCCTTTATCGATTAAGGTAGAAACACAACTTTTTTGGTAGTTTTTTTCTTT
GTCCGCCAAAGGTTAGGACGCATGGCAATAAATCACCTTGTGTTTCTTTACTTCTGATGGGATTATAACATGAAACCTTATGGTTCTGAATCTACGTCAT
CAACAGTGCAAAATTAGTCCGTCTATGCTTTTTAGTCTAATTTCGCACCTAAGTATATGGCCTAGTGGTCCATGAACTGGGTGCAAATCTCATAGATCAG
AGTTCAAAACCCAACAAAGACAAAGACCAAAAAAAAAAAAAGATCAGATTTCTACCTTCGCCTAAGCTTGGTGGCCTAAGTCACTCAGTAGTTGTGCTGG
TGGATATGAATAGTGGATACATACAAGCTGGCCAGACACCACCATTGTTAAATAAAGTTTATTTTTAATACTAATTTAGATTACATATCCCAGCAAACGT
ATCATAAAACTAGGTATATGCTTATTCTAGTTTTCAGATCTTAATTCATTCAACTCACTGGCTTTTCTGCTTAGTAATTTGATCAATTATCTCGCATACC
TGATTTACTCACAGTTGAAGTAAAGAAACCCAATCTTATCTATTGCAGTTATACATTTACAATCGTAACTTAGAAAGTTAACTGCTTCTACAACATTCGA
GTAAGATCTCTTAAAAGTAGAGGTCACTACTATATACTTTCAAAAGAAATAAACAACACTGAGTAAAGGAAATAGACCTGAGGTGCAAGTCGTTTGCAGT
GACCACACCAAGGAGCGTAGAAATCGACCAAAATATAATCAAAACTGGAAATTGCAGCATCAAAGTTAGATTCATCAAGTTCCAATACTTTACCGCTGTC
TATGCCCAACTGTTGCTTCTGCTGTTCCGACTCCGCCGCCGTGATGAACGGCCGTGAAACCAAAACTAAGAGGAGGATGACAAAAGACATATTTTTCATC
ATTGTATAGTTGAATAAAAATGAGTGATGGATCTATTCTACACACTTTAAAAATTTTGAACTTTTTTTTTTCTTTTTTCTTGTTTTATGAATTGTGTGCT
ATTTGATTGTCTAATGAGAATTTGGGTTGTTAAAATGTTTTTTTTTTCTTTTCAAATAATTACTACTACTTAAAAAATATATATGTATGGATTTTCAAAG
TCAATTTTGCACCAACTCTAATTTTGCCTTATATATTTGAAATTGTTAATTTAATTAACAATATTGGTCAATATTTTAGTTTACGATTTTCAAATTTAAA
ATTTAAGTTTTATGTGAAATAATAATCTATTCGTAGTTATGTCATTGCCAATAATATATAAGTTAAAATAATATTTTTATTTTAAGAAACAAAGGACTAT
CTCTAATTTGATTTGATTTTCACTCGTATATAATCATATCATAAATTACATAAAAATTGCATCAAGTTATTAATATTATTCCAAAACATAAAAACTAAAA
TAAAATAAAAGGTGTTAAAAAATGTAGAGTTCAACTTTGTTTATTTGTTTTTTTATAAAAATCTTAATTATTTAAAGATTTTTGTTTTTGAGATCTAAAT
CTTAATCTTAATGTATCTTTTTTCTTATTCTATAGTGTTAATGAATTTGAATATTTAAATTTATGGCAGTTTTAATATCGTTCAAGATGCCTATATAAAT
GATAGTTCACTATTACTCTATCTACTATCACTCATAATACATCATTATTTGAGGCACAACTACTACCAGCACCATCATTCACCACTCCTATCATCCACAA
TTACCATCCTTTGCCCAATCACAATCGTCATTATCATCATTCACTAAAATTAATTGTCATCACCATTATTTGTAATCATCACACTCAATCATTTTAACAT
CAACCGATGACTAAATATATCGTCAACGGTCATAATCGTTCAACACAATATTATTCCACTACTAATTATCACTCGTCATCAACAATAACCACGATTAATT
ATTGTTGTCAATTACTATACCATAATACACTACTTACAACCACCGCCATGTTTTAACATTAGATCATTTAATATTTTAGAAATTTATAATTATTATTTTC
AAAACAAAGACGAACAACTCTTAACGTTTAATATTTAAATCTTAATATAATAATTTCTTTTTTTTTTCTTATTTAAAATTAAAAAATGTGAAGTTAAGCC
GTTTGTATTGAATGTAAATATGGTAGGACTTCAATTCTTTGAGGGAAAAAAAGGAACTTTTGATTTCTCCTTGAAATTCCTCGAGAGAACACACAAATTA
TAGATTTTCTGGTGAAATTTGGGAAGTCCCAATTCATCTGTGAACATACAGATCGTTAATTTAGTAGAAGAAAATAGTAGAGATTTGATTTTTTTTGCGA
TGAGTTCACGAGGGCTGCTGCCATTGATGAATCTTGTTAGACTTAATGGAGTTCCAATTCTGCAGCAGTTGCAATTGGAGGAGCGTTTACTAAGGACCTC
ATCTCATAACTGGTGTATCGTGAATGACGGAACCAATGAACCCACCATTGTCATGGGGATTTCAGGGTGAGCTATCAATTTTCACCCTTTATTATGGTAT
GATGAAGTTACTTTTTTTTCATATTACTTTTTTTCTAGAAATGTGTCTTGATTGTTTTGTATTGGCGGGTTCGTTTTACAAAGATCAATTCTTTGTGGGT
TGTTATAGCTTTTTGGGTTGTTTTGTTAAATGATGGACTAACTAACCGATAGTTCTTAATAGAATGTGTGATAGTAATTGGTGCCTTTTGCCATGAGCGG
CTTATGTATGTGCATATATACTGAGTTTGTTGTTGTGCTTGATTGGAAATAAAGTTTAGGAGTTTGACACATTACTCCATCCGTCCCAATTTAGGTGATG
TTGTTTGGCTTTGACATGAAGTTAAAGAAAGAAAGACCATTGAATCTTGTTTCTAAAACAAATCATAGATGTTTGTGTAGGTATAAATCATATCTTTAGA
CTTTTTAAAGTTAAATTGTTACTAAGAAATCTCTAATTCTTTTTGGGACTTACTAAAAGGAAATGTGGGTCACATAAATTGAAATAGAGGGAGTATTTGT
TTTTGCTTCATAATTGTACTTTTAGAAGTCTTTTGAATAGTAGAAGTGTCTTTGAGTGGAGTAAGCATTTTTGAAGAGTTTATTTACAATGAATTATTAG
GGTGATTTGGTTGGGACGCTATCTGATTTCTAGGATGTTCACTATTCTATCAACTTCATCTCCAGACATATGAAAAAAAGGTAGCTTGAAAGAAAGGTTT
TCAAGTGGTTTAGGAGCACGTCAGAAATTTGTATTCTGACGTAAACAAGAACCTAGTATTTCAGTGGAGAAGGGCGATGAGCCAGACTCGTTATCCACTG
GATTTCGAACTACGTGCCACTGGAACTGGGGGTTTCTTAGTTTTCACAAGAAAAAGAAGGATCTTTAAGTTGTTCCTAGGTACCATTAAAAGTTGCAAAA
GGAAGAGGCGAAGGCCACTTGTTTCTATATCTCACACTGGATGATGGATGCGCTAGGATGATTGTGGTGTCTCTTTTCATTTACATCTACTTAATTGTTA
TTTTTAGGGGGTGGGGTGGGGGTGGGAGGAATGATACCTTTAATTAGCTCAATAAACAATTAATGAATGAGATTGTTGCAGTTTATCAGCAACTGTATAG
TTTCTGAACAAAAGAAGTAAGCAGATACTATATGAATCAAATGTGTCCCACATGTCAAGAATAATTTGTAAAGATTCTTACTGGTTGATTTAACTTAGTG
GATTTGCAGAATATTAGCATCTGCATGGTTTCTGGAGAAAAAGTAATCAGAGATAAATTTTCTATGAATCAAATATGTTCCACTTGTCCTGAATAATTTG
TCAAGATTCTTACTTAGTGAGCTATCATCTCAACTTATGACTCCATTTGTGTGTCATAAAGACACTGATAACAAGGCCATTTTCCACTTGCTGATATCAG
GTAGACCATATATTGGTTGGAAGCCGTCACTATTAAGTATTACCTACACTTCTGGTGTGCAAATTCTGATCTTTCAGTTTTTAATTTATGCAAGAAGCTA
TTAGTACTTGAATGTCATTGCTGTAACGATAGAACTTTACTGCTGTATGTTTTGGATTATGTAATTTTATATAACAGCATTAACCATTTTCACAGAAAAC
CAGCTGAACTTCTTGAAATCGGTTCTGTTTTACAAGACAAGATTCCAGTAGTTAAGAGGTTTTCTGGAGGTGGCACTGTAATTGTCGATCACCAGACAGT
TTTCATCACTTTCATATGCAACACAGATGCTCTCCCTAGTGTACAACCATATCCTAGGCCCATCATGTCATGGAGTGGCCAGCTGTATAGCAAAGTGTTT
CAAGGAGTTGGGGATTTCTCTCTTCGTGAAAATGGTAATTTTTTTGCTCAATGATATTTTTCATCACTGACTATCCAGCGTATTTGAAGGAAGTGTTGCG
CGTTTTCTTCTTCAAGATCCAAAAAAGAAAAGAAAAGAGAGAGAGAACACTTCACTTTTCACTTGTCCAAAGAAGAAAAAACTACTTGATTATAAACTTT
GTTAAGGAAGAAACACTTGCTTATCCTTTGCTGTATGGTATTGTTTGCACAATATACTAGAAGTTATTTGACTAACAAAAAGAAACTGGAATAATTTGGC
CGACAATGTAGTTGTGCATATACCGGGGTCTAGAAATTAAGGTTGAGTGTCAGTCTGACAATTTATAGTAAGCACTTATTCTATGATGGTGATTGTCCTC
AGATAAAACTTTTACGCCACACTCATGACTCATCAAGGGAGCTTCCTTTTATATAGATTTAATTGTTTCTGGTATATAAGGTTCAAAATCTTTCTTGCTA
ACTTCCTGACAAGAAAGATCACATTCATTGGATGACCACTTGGATGCTTCTTTTTCTACATTCTTATTTCTTATTGTCAGCAATGTTATATTTTTTCCTC
TCTGTGCTGTTGGTTCCCATTTCTATGTACACTGTCTTACTTAGCCTTATAAGAATGGTGAATACTACCCCCCACCTGTCACTATCCATCTGACTGCTTG
ATTTTTTCTTCTTTTTTTTTCATCTCCCACATTAATATGACTTGAGGAATTATTGTTTCATGTTTTACTCATCAACTTTCTTAGATAACCACCTTCATAT
TGTACTACTACATGATCACAGACTACGTTTTTGGTAACCGCAAGTTTGGGGGAAATGCTCAATCTATCACAAAAGGGCGTTGGGTTCATCATACGTCTTT
TTTGTGGGATTATGAGATGATGAACATGGGTTATCTCAAACTTCCAAAACGAGCTCCTGACTATCGACAGGTCTGCTTATACTTTTGCAAGTTCCTTGTC
TACTTGTTAGATAATCTTGTGAGCATGTTTTTAAAGAACTTGATGATGCAGCTCATTTTTTGACATTGTTTTTTTTGGAACACTCTCTGTTGGCAGAATA
ATTTCAGTCGTGTTTAAGATTGATGCCAAACTTTCATTCTTATTGTATGTTGCATCATATGGGACAGCTATGTAATTAACAGAAGGATATTGTTCAGGTA
GTCATTAGTAGAATATATTCATAGCCAATTTTTCTCTTCCCTCCAACGTATAGTACATTACTACATTCTATAGGGAATAGTAATGAATTCTTGCACTGCA
TGAATCTTCTTCTTAGCCTGATGGTGTCAATACCTGTAAGTTAATTCTGACATCGTGGTGAAAAGATGAAGCATGGGTAGCTTCTCCATTTGCACCTTTT
GATCCTTCTTGTACTCTGCTCTCTTATCTTTAATTACATTTGCACAAGTAATAATTACTCTGGTAATGTCTTGACTGCTGCATTATACCATCCCATAATT
GTAGAACATGTTTTAATTTTATTTGACTTTGCAATTTGCTTGATGTTGTTTTCTCATCGATGATAGTACTGTAATCCTGAGGGATTGTAGTCTAAGATGC
ACACTGTTCAATTAGGAAAGTATTCAACTTCTAGGTTTGGAGGATATGGGAAGGAATTTGTTATAAGTTGCAAAAGCTTGATGATTATGCAAGTGAATGT
TGAAGTTCTGGTACAGTTGACGGTGGTACCTTTTGTTGAGATAATTCATATTATGTTGATGATTCTTCTCACATGGTGTCAGGTTCTTGTTACCATTTCC
CAATCTAGTTCAATGCTCGTGACTTTTTTTTTTTCTCAACGTAAGTTGAGTTAAATATTCTCATGCCTAAGTCTATAGAAGTTCCAAGTATATGCAAACT
CATAAACTACTTGACAATTTCTTCACTACTTTTTGTTTGCAAAAGTTACTTTTCTGATGCACATTGAAAATTTGCTTGCTAGTCTCTGAGAGAGTGTTCC
TATTGGTTATTCAGGCAAGAGACCATTCAGACTTTATTTGCCGCATGAAGGATTATATATCTCGACAAGAATTCATCAATAGAACCATTTCTGCACTTGG
CAGCCAGTTTAGCATAACTCCTCCGGAGCTTGAATCATCTGACTGTCCTGATGACACGAAATTCGTGCCCTCCACTAGACTACTAGGAAAACAAGAACTG
GAGGAATGTTTTGAGTCTGAATCTGGGAATGTCATACTACAGTCACTGTAACTGCTACAGGATCTTTGCTTGATGGTGCTACTGTATGCCAATGTACCAT
AATTGATTATTCGCTCGAGAAATACTTTCCCAACTCATTCATGTTGCTACTTTGCTCAGACGAAACTACTGAGAAGAACTACTTTTTTACCATTGTGCTA
AGCAGTGGGCATTGTCTGTAAGTCCTCCATTGTTTGTATACTGCTCTTTTAACTTAGCACATGACATGATAACTTTACAGTTGTATCCCATTTGAATTTG
GACGATCAGGCCCTTGCATTTGCGAGGATCATCAAAACACCTAGAATATAACATGACCATTTCAGCGCATCATTTCCAGTTTCGCCACTTGAAATTTTAG
CCACCTTTTATTCCTTGTATTGTCGCATCATTTATGTCAATATCTATCATATCATACATTATTATAATCATATATTATTATAAGTGGGAAAATTAAAAAC
TCAAAGTTGAATTATCATTTTATCCTTATATTAAAATAATTAGAACAAATGTCATAAAATATAATTAAAAATTTAATAAATAACTCATTCAAATCAGCGT
ATGAATTAAATTCACATTAATAATTAATATTCTATTTTATTGTAAAAATCAAGAGTATACAAAGAGTTTTCTTTAAATAAATTTGATTGGATTAAAATCA
TCGAATTAATTTAATGCAAATTAATTTTACCTATTCAAAAGTTATCCTAGCTACTGCTATAAAATACGTAGCATGGTCTTTATGTAAGTGATAAGAGGAG
GATGACCATTTGCGCCGAATTTACCATATTGAGGAATCATCAGAAAGGACCTGATAGTACCATTCGTGCTGTGTATATAGCTCCACTAGAGACTCTTGCC
AAGGAGCGGTTCAGTGATTGGAAGAAGAAATTCGGAGACTTTATCTCGTCGCTGGAAACTGCGCAAGCATGTTCAGCAAGTCAGCCTTTTCATTATTAAT
GAGTTGCACCTGATTAGTGGTCAAGGTGGCCCAGTCCTGGAGGTGATCATCTCTCGGATGAGATATATCTCAAGCCAGGTTGAGAACAAGATCCGCATCG
TCGCTTTTTCAGCTTCCCTATCTAATGCCAAGGATTTGGGAGAATGGATTGGGGCTACATCTCACGGGCTCTTCAACTTCCCTCCTCCTGTCAGGCCTGT
GCCACTGGAAATACACATTCAGGGTGTTGATATTGCAAACTTTGAAGCTAGGATGCATGTCATGACAAAACCCACATATACTGCAGTAGTCCAACATGCA
AGGAAAGGAAAACCCGGCAATTGTGTATGTTCCCACAAGGAAGCATACTCACTTGACTGCTCTAGACCTGATGACACATTCAAGCATGGACAGCGAAGAC
ACGCCTATATTTCTTCTACGATCTTCAGAAGAGCTGGAGCCTTTTGTTGACAGGATCAATGAACCTATGCTGAAAGAGACGCTCAAATATGGCGTGGGCT
ACTTGCATGAGGGATTGGCTTTTTCGCCAGGTTTCATTCGATTTGTTGTGGATTGGCGACACTGATCAAGATATAGTAAAGACATTGTTTGAAACTGGAT
GGATTCAAGTGTGTGTAATGAACAGCACAATGTATTGGGGAGTACCACTATCTGCACATTTGGTGGTGATCATGGGAACACAGTACTATAATGGTAGGGA
ATATGCTTACACTGATTATCCAGTCACTAATTTGTTGCAGATGATGGGTCATGCCAGTCGGCCTCTTGTAGATATCTCTGGGAAGTGTGTCATCCTCTGT
CATGCACCACGCAAGGACTACTACTACAAGTTCTTGTATGAAGCATTCCCAGTTGAAAGCCATCTGCAATACTATCTCCACGACAGTTTGGATGCTGAGG
TCGCTACTGGAGTTATTCAGAACAAGTAGGATGCTATTGATTACCGTACATGGACCTTCATGTACAGAAGGCTGACACATAATCCAAATTACTACAATCT
GCATGGTGTTAGTCACAGGCATCTGTCTGACCACCTATCACAACTGGTGGATAATACTATCAGTGACTTGGAGGCAAGCAAATGTATCACAGTTGAGGAT
GCCTTTTTGCTTTCACCTTTGAATCTTGGCATGATAGCATCATATTATTGTATCAGTTGCACGAGTTTTAGCTCTTCTATGACCTCCAAAACGAAGTTGA
AGGGCTTGCTGGAAATATTGGCTTCATCATTGGAGTATGAACAGTTGTCTATACGACCAGGTGAAGAGGAGTTGATAAGAAGGTTGATTAATCATCAGCG
TTTCTCTTTTGAGAATCCAAAGTACACAGATCCAAACATGAAGGTTAATGCTCTTCTACAAGCCCATTTCTCTAGGCAAGTGGTGGGTGGAAATCTTGCT
TCTGACCAGCAGGAGGTGCTTGTTTCTGCTACTAGGCTGCTTCAAGCACTGGTTGATGTTATTTCCAGCAATGGATGGCTGAGTCTAGCAGTTCTAACAA
TGGAGGTGAGCCAGATGGTGACTCAGGGTATGTGGGAATGTGACTCTATTCTTCTCCAGCTTCCACACTTCACAAAGGAATTAGCACAGAAATGCCAAGA
AAATCCAGGAAAGAGTGTTGAGACAGTGTTTGATTTAGTGGAGATGGAAGATGACGAGAGGCGTGAGCTCTTGGAAATATCAGACCTACAGCTGATGGAT
GTTGCACAGTTCTGTAATTCGTTGCCAAACATTGATTTGACATATGATGTGCTTGGCAGTGATAATCTGAAGGTAGGAGACAATGTAAGCGTGCAGGTAA
CCCTTGAGCGAGATCTTAAGGATAGAACATAGGTTGGACCTGTTTTTGCAGCCAGATATCCCAAATGATAATATGGTGGCTTGTTGTTGGTGATACAAAG
AGCAACCAATTACTTGCCATTAAGAGAATTTCCTTCCAAAGGAAGTCTATGTTCAAGCTGAATTTTTGCTTCGCCTGTAGAAGCTGGAACAAGGGCCTAC
ACACTCTACTTTATCTCTGATTCTTATTATCTGGGATGTGATCAGGAATATATTTTTACTCTTGAAGTTCAAAAATTAGTTAATAACTAACTAACCTACT
TCAAGAAGTCTGTATATATATACTTAATAAAGGAACTGCAGGAGAAGTCTCAAAAATAATTGCTTCTTCTTCCTCCTCGTCTATCTCTGCTTCTTCTTCT
TCAGTTTTATTCTTCATAAACTAGAGAAATCATTCCATCGTACTTAAAATGATTAAGCAGGTATCAATTTTTCTTCATTTCTTTGTTTCTGAATAAATTA
CACACAGCAATCAACTACTTTTATTTTTCTTCAGTTCAAGTATTAATTGTTTGAATATGGATTTTTGGTTATCTAATACAATATCTTTCATGAAACTTTA
TAGGTGATTGATCATATTTGTAGTTTTTGTTTTCTAAAGTAAAATAAAGATAATTGGTTTTGTGTTAGACGGTTATAAAACAATTAAGAGCTGAAAAGTA
CTTGATTTCAAGAAAGTGAAAAAAAAAACAACTTTCCATGTTTCTCCATTTGTAGGTACTTGAAAGAATTCAATAGGTATAGATTTTTCTTCACAGCAAT
GAACTATTTTTTTCTTCAGTTCTATAAAGTATTAATGGTTTCAAACATGAATTTTTGGTATCTAATACAATATATTTCATAAATGCTTTACTCCTACAAG
TGTTTCTGTCAAATATTTGATTTATACAATCATTTCATAGAGGACAAAATGTACTTTTGTCAAATATTTTGATTCTGCTTGTTCTGCTTCTTGGTTGAAT
GCCCTCCTGCAGAAGCACAACCCCTATTCCCTGCATGTATCTGTTTCTGTCTGTAAACTTCTTGTCAATTTCTTTTGCAGGCAACATGCCACCCGCAACA
CCCTATTCCCTGCATGTATCTGTTTCTGTCTGTATTCTTGGTTGAATGCCCTCCTGCAGAAGCACAACCCCTATTCCCTGCATGTATCTGTTTCTGTCTG
TATTCTTGGTTGAATGCCCTCCTGCAGAAGCACAACCCCTATTCCCTGCATGTATCTGTTTCTGTTTGTAAACTTCTTGTCAATTTCTTTTGCAGGCAAC
ATGCCACCCGCAACATGGGTACGCCAAATGATTTGCCAGGACTTGTCTACACATTTTCCTTAAATACATATTTTCCTTAACGGCTTGTATTATGCTTGGA
AGATTGCTTTACAACTTTGCTTGGTGCTTTTGCAAATGAGGGGCACATTTATTTATACTACTTCCTAGGGACTAAAGTACAATTACTATTTACTTTACAA
GTCCCTAAAATATTTACACTTTGGTCCCGTTTCTAGAGAATTCTATACTACCTTGGGACCTTCTTTAGCCTTCTTGAGAGTTCTAAAATGTTCTAGAGTC
TTCCGCAAACCTCTAGAACAATATCTGCCCCTTTCCGGACACAAAATTAGGCGGAAATTGTGGCGGGACGTCGCACTAGTCTGTTTTCAAAACTCGTTTT
GGTGGAAGAAAACCCCTTAGTTAGTCCAAAGGTTCTATCCTAAAAGTTTTGATGATAACAAACTTATAGCGTTCAAATCTTGTGATTGTAGTGATAACCA
GAAACTCACAAGTAAGTCCACATTCAAAGCCAAGATTGGATCAAAAGTATATAATCAATTTTTTGCTGAATTATAGTCAACCACAGGTGGTATGTTACAG
TCATGGTTGCTATCCATCCGGACTTATATTAATCATTACATGAAAACCAACTGATGGACAGACAGAAAGTTGTTTGGAAGGTTATCTGCAATATTTGACA
ATCATCAGTAAGTCAAAGGAATTGGTTACATAAGGCTGAGTGTTTCCATTGGCAAATGCTTAAACCCCGGTGCAGTCAGAACAAGCCAGGATGAAGTGGT
ATGGTGACCTTAGGGGGACTGAGAGACATGGAAACTAGGTTTACCCACAGGCAGACTTGTATGGCCTTGAGGAGAAGTCTTAAAGATTTGTTTGGTACTG
TGGTAGACAAACTTAAGCTACCGTGTTCCAACAAAACACATATAAACATCTGTTCAGCATACATATCAAATAAAAATTGAATCTTTGTATGAGGTTCAAA
ACATCAACTCCAGAAAACAACAGTTTTATAAATTAACGCAGGGAACAAATAGATATAGTTGAGTCCAGTCACCAGAAAGAGTCAACAAATATTTCTCTGC
ACATGCTTTTACTTCACCAGTGAATTGGGAGGGGCAGGAAGTTAAAAAAAGCTTATTTGCTGAAAAAGGTGATGCTTTTGTTCTTTCTGTTTCTGAAGGG
CATGGACTTTCATGTAATAACTCCAATATGTGAAGCTGGAGTCGGAAATCATCAACCACAGAAGAACTCAAAAGACTTCACTGCATCTATATTATGTCAT
CTGTGAGCTCTAGAGCGACCAGCCGATAAGTTAACTGGTCCGGTGTATTATAATGAGTTTTAGTTCATTATAATGTCTTGCACGAAAGGACTCTTGGAGT
TCTAAATTTGCATTGAGGCAGATGCAGGGAACAATCCAGGTTACTTCTCATGTTTTTTGGTGGAAGGAAATATCACCTGCATGATTTTTGAGGGTAGAAC
TAAAATTTGAAGGTGAAAAAAAAAACAGAATTATCCTAAAATCTTTAGAAGAACACAAATTTGAATTTTCTGTTACAATTTCTGAGAGGAAAAAAAAACA
TGGTTGTACATGTTGAATTCATCTTTCTCATTATGTCATCCTTTTCAAGGCAAAATCTTTGAAGTCGAGATCATTTAATCCTGTGTGAATTTACGAGTTG
TCTCCAAGTGATAAACATTGTTAGCTTTTAGTTTCTGTTAGGTGATAGAATAGTGTATTGAAGTATGATAACACAACAACTGTTGTTGAACTCAATACCA
TCTAAGTTTTCTTATTGTCTTTGTCCACTCTATTTTATTTCGTAGGACTGGGCAGGTATAGGTGCAGATGGAGGAGGAGCTAGACTTTAATCTATCCCAA
AACACTTTCTTCGTGTGTTTCAAAAGGTTATAAAACAAAATATGATACCATTGATTTGGATTATGTTTTTGCGGAGATAAATTTTACCTTGTAAAGTTGT
GATCGATAAAAAGATAAATTTAAAGTAAGAAATTTTGATTAGAACACAAATTGTACTTAATCAATTGGAATTTAATACTCTTTGTTTTGTGGTCCAACTC
ATAAAGAAGGAAAAATGAGCTCACAGTGAGTTTCAAGTTTTCAATTAAAAAAATAGCACTAAGTGGACCCTTTTTTTTTTACATTAATAAAAAAGAACTA
AATTAAGTAACATTTTTCGTAGTTGTCTAGCCAATCACTAAAGTTGTCTTGAAGTTGTCGAACAACTAAAGAAGTTGTCCCGACAATTACAACAGTTGTC
GGACGATTAAAAAAGCTGTCCCAATAACTACGACAATTGTTGGAGTAAAATGTAAAAATAAAAGTTTGGAACTACTGTGAAAACATCTTTTAATATAATA
TATATACTCATTATTTGTCACTTTTACCTAATTTTTAAAATTTGACAAACTAGTTTGTCCCTTTTAATAGACCTTTCCGTTTTAAATTATAATTTATTTA
TTTAAAAAAAATCTTATAAAATTTTATGTCTAATTAACTTATCTCGCATAAAGTTGAGATCAAGATATCTATATTGAAACAAAATGAGTAAACTCAAATC
ACATCAAACTAAAATGATCTATTAAGTATCTAGAAGGTTTATTAAATCAAACAAATTTCAGAATTTGTTTCAAACGGATTTACTTTTTGTTTTGCAAATT
GAAAAGAGAGCACTTGTTATTTTTATTTTTTTTGCTATAATGAAATGTCTCAAAAGTCTTAACATTTTCCTTTGAATGAGATGATATTTTAGAGGCCTCT
AAGTTCAAGCTTCTAAATAGAGTCGATTTTGGAATGGATGTCACTTCAAAATGAAATTTTCACTAAAAATTTGAAGTATTTTGTTGATCAACAAGAGCAC
CAAGGAAGTGCACCAATGCACACAAAAAAGATCATAGAAGCTATAAAGTTACTGAACAAGATGAGAAAATCAAATAAGGCGTATACCATCTTTCAGAATT
TCAAATTATATCTTGAACATGTAACCAAATTCACTTGAAGTACATTTACATGTAGCGTATACATGTTTTCACAAACCACAGAAAAACTTTCAATCTCCGA
GTAATAAGGAAAACAAGAGAAACACAAGATACCCTTCATTCATAATGCACATTCAAACCAGCAATATTATGGCTCTACACAGCAAAAAGGGGAAGGTTCA
ATTGAAAGAGTTTTGGCAAGCTGGAAACAAAATGTAAAATCCTTCAAACAGCTTGGGGTTTAATGATCCTGGTGATTCACAAAATTTTCCGCTAGTTTAT
TTTCTTTCTTTGCTTCTTTTTGTTGCCTTTCTTATCGGGGCATGTGCTTAGAGCAGTTCTTCACATTAAAAAGAGTGACTCATAAAATTCAATCTCTTGG
ACGCACAGTTCTCTTATCAAACTCCAAGACAATGCTTCAGCTCCAAAGATTAATCAACCTCTTTGTGATGCTTAATACAACAAAGGTAATGAGACATAAC
GGGCTAACAAGATTAGAATCACTTGAAATCATACAAGTCCAGATATCAACTCTAAATAGGCAGATTCACTAACAATATTTCTGGTCTCAATTGCCATTTT
TGAAAAGAAAAAAAACGTCTATCAAAGAACACCTACAGTGGCAGAACCACATTAAAGCAAGGGGATTCATATGATACCCCTTGCTCAAAACATTTACTTA
TTATACATGTAAATTACAAGCCAAAAATAATAAAATGCATGATATACAAGGGTTGAATCCCCTGGACTTGAAACACAAGCTTGATATAGTCTAATTATAT
AAAAGTTAGATCGGGCTTGATGAACTGCACCAACACCTCTCCCCCATACCCCAAATTTGCTCAATCTTATATTAGTAAGGGTCAACTATATGAATAAATT
GCGTCAGTTCTACTCTATTTAACTCCATTTCTGCATGCTAAATAGAGTAATGGACACATCCTAATGAAGAGTAATCAAATTATCTTAACACCGGCTGTCA
ACCTATCAAACCCTCCTCATGGCCATCATCAATACACAACCCTCCATGCCCTCGTACCTCAAGTTGGATAACTTTCAAATAGTTCAAAGGGAAATGCTTC
AGCAATTTCATTTGTGGAGTGATTTTTCCTCCTTTTATGTTTATCTCGTTTAAAATAGATTCAGATTCTTCACTCTGATCCAGTTAGTACAATGACTAAA
AAGGTATCTACTTGTTCTGGCATCCTTCATCTTTGTTTTGTTCTATATCATCGGATTTAGAAATAGGTGCTTATGCGGGTTTATACAGAGAACACAGAAA
ACTTAAACATGGATAAGAAAGGGAACAATGTTCTTCCAAGATAACCTAACAAAATTCAAGTATAATGCAGAGCAACTTTAAACCCAAAACATCTCCAATG
ATACCAAATACTCAAATTCACTTCAAAAATGAAATTTTTTTCTTACAAGCAGAATAGTATAAGAAGTAACACTAATATCAATTGTTCAACTTCATGTCAT
CGAAACATAAATTTCAATCAGATTCCCAACAACAGAAGATCTCAAATAATACCAATTAACAAATTTACCCCAAAAATAACATTTTTTTCCTTCTTAACAA
AAAGTTCAACAAACTTACAAGTCAAATACATCAGTGATCTTCCGAAAAACTCGTACTAGCTTCTCCTCCATGATCCTGTTTAGAACAGCAATGATCCCCA
TGATGATGACTCTTTGATGGGTCATTTTCTTTGTCATCGGCATCATCATCATCGCTATCGTCTTCATCAAAAGGCTTTTCTTTGTGGAAAATGCAACATT
TCTTGGAACTCTTCTTGTTGAGGAACTCGTTGTCCACAGTTCCTGCTTTCCACGACACTCTCCTCTTCGGCTTCAATTTCAAAGTTAGGGTTTCGATTGG
TTGCTGCTGTTGTGACGATGATGATGATGGTGCAGATTCCGATGGGTTTCCTAGGGTTAAGGTTACCGTCGATGTCCCGGTCGCCGGCTGTGCAATTTCC
CTCGTCCTTGTGGCCATTTTCCCGATTCTAGCCGTCTCTTTCCCCTTTCTCTGACTTGTGTTTTTTTCTCTGGTAAATAAGAGAATGTAAATTGGTTTTT
AACTATAAAACTTAAATATTTGTCACTATACTTTCGTCAATAATTTACATTTCTATGTCGATTTTACTTTTGTTATTTGCATTTAACATATTTTTGAAAA
TTATTAAATTTAATAAAATCAAAGGATAATATAGTAATATTATATTTATTATTTATTGTTTCTCGAGGAGTGTATTAAGTTATTTTTTTTTATTTGTTCC
TAATTATTTATCTATTTTGAGAAAATAAGAAAAGACAAATTTTTTTACCTATTATACACTCAATTAACGCTTTAAAAAAAATAGAGTTATTTGAAATCTT
AAGTTTTTAATTCATCCATATTATAATTAATAGGGATATAACGATTAATATTACTATGTTAATTATCATTTTCTTAATAGATGTCAATTGTAATTAAGAA
CTATTCTTGGACGAAAAAGTATTTTAATTACTCCCTCCTATTTAACACTTAAGCTTACAAAAATTATGTCAAAAATGTTTTTGAGCTTATTGAGGACATT
ACATATGAGTATGTTTGAAGGTCCTGAATTAAAATAGAAAATTAATTAATAGTTGATTATTTTCTTGTTTTCTGCTTGATAGCCATAGTAGTTGTACTTA
GATCTCTCTTTTTATTGTTGGTATTACTATTATTTTCGTAACTTTTTGCTTTTTAGATATTATTGTTTTTTTATATTTTGAATATCATATTATTTTGTTG
TTATACTGTTCATTCTTATGTATGTTGTATATTGTCTTTTGTTGTTATTCGTCCTTATTTATGCATTTCATTCATCAAACTGATTAGATATACTTTATTT
TAAGTATGTGGTCTATCAAAATTAACTTTGTATCAATAAGATTTACGTATACCTTCCTTCAGATTCTCCTTATAAAATTATACTAAATATATTATTATTA
AAAAAATAATTTATTTTCATATTGCTCAAAACTTAATATCTAATAAATAGAGGTGATATAGTAAATCAGAAATATATTATTTTTATGGGTAAGTTGTACC
ATGTAGTAATGAACTTTTAACAAATAATTCCCGGCTCTAACAATGTGGTGATAAAAAGAGTACTAACAAAATGTTGTATTAACACTTCAACAAACAATTA
GCTTGAAGCAAGTCGGTTATTATTTTTAAAATATAAAATATATGTCTAAATACTAATATATTATATTTAGCTTTGTATATTAAATGATCAAAGATGATTT
TTTTTCTACCATCAAATTTTATAATTTAATCTTAGTCAATAAAATTATACATAGAAAAATTTAATAAAATATTTTAAAATATTATATAAAAATTAGAACG
TAAGATATTAATAAAATACTTTTAAATAGTAAAAACTTTCTAGAGAGTTTTTGTCAAATTATTATGAAAATATCACGTTTTGACTGTTATTTTTAACTTT
ATATATTATTTTGAAAAGTAACAGAAATTAATGAAATTATATACATATTAATTTTTTGAGATGATAATAATTTCAAAAAGTTTAATTCTGATCTTACAAA
ATAAAACAACCACAAAAGTAAGTATGATATCAAATTTATATTATAAACTATATAAAATAATCAACGATCATTTTATTGACATTTTTTATTTAAATGAAAG
ACTTTTATTCGAAGCAAATGATTCATCTTATAAGTAATGATCTTAATCAAGTAACTAACAAAGCATTTGTTTTTCTCCTATTATTAAACCTTAACCTATA
TAAAGAATGTTAAAATATCTTTCAGCTCTCTTAATCTTTTTTCATCAAAAAATTATTATATATTAATTTATTATGGACATAATATGTCAAAAGAAAAGTT
CAGCATCATTTAAAATCTAAGTAGGGAACAACAGTCTTTCCCATGAAAATTCAATCGACAAAGAAATTGAGAACTTAGCTTGAGAGCTACAACATTACAA
TATGTTATGCTTTAGAGATGCAGACACATTTCAAATATCTTTACAAAACTATATTTGTATCCCAAGCAGTCTTCACGTTTTTCTTCAATACGTCTACATT
ACATTTGGCATCAAAGAAGACCTGGAGCTTTTATTCCACAAACAAAACAAAAACAAGGTTGATTTTTAGTAGTAATTCATGAGACCTCGAATTTCCACGT
TCCAGCGTACATATGCCAACAGATGTTATATCGCTTTTTCTATATATTTTCTTATTGCTCACGCTTCAACAATCATAGATTTCCCAAAAAATTGAATTGG
GGATCTTTGTGCATGAAGCAAAACACTCTTTGATATCCATAGCAACCAAACCAAAGGTTATCTTCTTTGATTCAACTTCAACAAACATCAACAAACAAGT
AGATCTCATCATTGAAAACTTTTTACTTTATAGATGATCTAAATAATTTATCGTACGTAACACTCTATTATCCTTATTATGCCTACCGTATCCCACACCC
ATTTTTCATTGTCTAATTGAAATTCTTTAATATCGTTTCTTCTTCGCTTCTGGATAGTAGTCATAAGAAAAAATGATGAATTTCTATCACCTTCTTTTAA
TCATAGAGCTCTAAATTTTTATTTTTTGTATATGGTGCGAACATCCTTTTACAAAATTAAAATCATTTCATATATTAATTAACAATATCAAAATATCTTT
CATATCCCTCAATCAATATCAACCAATCTGTATATGATAGTGAACACTCTTTCACCAAATTAAAACCATTTCATATAATTGTTAACTAAGTGTCTTACCA
CATCTTAGGATATTCTTTTCTATGATTCTTTTTTTTCTTACGTTTTTCACAAATTAGTTAGACAAATTCAAGATTTCAACTAAGCAAAAAAAGGGGAAAA
ATTGAGGCTCAGATGTGAATTTTATCATCTAATTTATCAGACTAGGTTGAGACCCTCTTATCTCACCAATTGCACATTAATCATCACAGCACTCAAATGA
TTGCACCAGCCGGGAATCGAACCCGGGTCTGTACCGTGGCAGGGTACTATTCTACCACTAGACCACTGGTGCTTGTTGTTTTAAAACTACAATTTAATAT
TTTAATATATCTTAACTTTTCAATTATTCATATTGTATAAAATAAAACCAGGTTGACCTAGTATTCTTTTTGATTTGCAGTTCTAGATAATAATATCTAA
TGAATTGATTTGACGAAAATAAAATAACAGATAATCTACATCATTAACCCACATATGAAGTTCTTTTTTCCTTTTGAGAATTTTGTGTTTGTTGACTTGA
AGTAGGGTTGTGCATCGATTGATTCAGTTCGATTTGAAAGTTTATCAATTATTGATAGGTAGACATGTTAATTCATTATGGATATTGATTTATCCATTAT
TAATCGTTATCGATTTAACCATTAAGATTTATACACAAGTTTCTCTTTTATAAAAAATTATTTAGAAATAAGATGTCAAACTAAAATACCATGCATATGA
CTATTGAAAAACTGCATCTTGCTCAAAATCAAACACTGACACATTTTAGAATAATTGAGAGCTTGAGACCATTAGAAATAAATTAAACCCTCTGTTAAGG
ACTTTATGTATGGAATGATATAAATATAGTTTACTAATTTGCTATCTGGTTATCAGTTAACTTGTTAAGAAAATCTCAATCTGTTAAAAATCGATAGTCT
ATATTTAAAAAAATTAGAACCATTAAAAAAACTATTAAATCAATGATTCATTACAGATAAATCAATAATGTTTTTTTTCGATTCGAGTTTGAATAGCCCT
CACTCAAAATTCAATTTAGTTGTATTGTATGTAAATTTTACATTTTTCACAAAAGAGTTTTAATCTTATATTTAAGAAATTTGAAAATAATAAATAAATA
ATTTATGTTAAATATAAATTTGTTAAAAGTCACAACAACAACATACGCAGTGAGGTATATCACTAAGTGGGGCCTGAAATGATAGAGTATATGCAGACCT
TACCAAGTTACCATTATTTTGTACGAGATAGAGTATAAGCTTTTAGGCCTAAATTGAGCAACAAATGTAGGAATTGTAACTTTACGATTAAAGTAATTAA
AGTTTAACTCTATTACGAATGCTAAAGAGAGAGAGAAAAACTCTTTACTGCCTCATAAATGTCTTTATCAATTATCTGTCAATATTTTTAAAAATATAGG
AGTCCATCAATTTCATATGTTTTTTAAGGGATGCATCGGAAAAATAACATCTTTAGTCCCATCATTCAGTACTCTAACAAATCTCCTTTTCATAGATTCA
TTAAGTAAAATATATACATAAGAAATAATCTCTTTAAGTCATGTCGACCTAAATGATCTAAGCAAGTTGTCATAAAAACACTCTATTATCCTTATTATGT
TTGTCGGATCCGACACCCATTTTTCATTGTCTAATTGAAATACTTTAATAACATATCTTCTTCGCCTCTAGATATTAGTCATGAAAAACTATGGATAGAA
ACCATATGAGAAAAGGATTAATTTTTGTCACCTTCTTTTAACTATATAGCTCTAAAAAAAAATTTTCTACATATACTGCTAACAACCTTTCATAAAATTT
AAATTATTTCTTATACTAATTAACAATATTAAAATATCTTCCAGTTCCTTCAATCAATATCAACTGCAAATAATTTCATCAAATAAAAATCATTTCATAT
ACTATCAACAAAATGTGATATCACATCTTAAGATAATCATTTTTATGATTTTTCTTTTTCTTACAATTCTCAATCCTTTCTTCTTCTTCAAGTATATTAA
ATCATTATTGAGGTCAAACAAAAACATGTAAAATAAATTTTAAATAGAAACTAAGAAAAAAGTGGGGAAAAATTTGAGGCTCAGATGCAATATTTTATCA
TCTAAATTATCAGACTAGGTAAAGACCCAAATCTCACCAATTTATGCATTAATCATCACGGCACTCAAACGATTGCACCAGCCGGGAATCGAACCCGGGT
CTGTACCGTGGCAGGGTACTATTCTACCACTAGACCACTGGTGCCTGTTGTTTAACACCTTCAATTTATTTTATTAATTAAATAAACAAGTTACCATTTC
AAATATGAAAATAAGATTAGGTTAAACTAGTATTCTTTTTAATTTGCAGTTCTAAATAATATATTTAATGAATTGATTTGACGAAAAATAAAAGGACAGA
TAATCTACCTCATTAACCCATATATGAAGTTCTATTTTTCTTCTAAGAATTTGTGTTTGTTGAGTAGGGTAGTGTGTCGCTTGATTTGGTTCGGTTTTAA
AGTTTATCGATTATTGATATGTAAAAATGTCATTTCATTATACATATTGATTTATTGATTATTGATCGTTATCGATTTAATCATTAAGATTTTTTATGCA
AAAAAATCTAGAAATAAGGTGTCCAACTAAAATACTATGCAAATAAGTGAAAATTGCAACACTAACACATTTTAGAATAATAGAGAGTTTAAGACTGATT
GAAATAAACTAAACCTCATGTCAAGGATTTTATATACTAATGATATAAATATAATTTACTAGCGGGTTATTAGTTGACTCGTTAAAAAAGCTCAAACTGT
TAAGAATCGACGATGATCTATATTAAAATAATCATAACCATTCAAAAAAGTTACTGATTAAATATTCATTACATATAAATCAATAATATTTTTTCGATTC
GAGTTTGAATAGCCCTAACTTGAAATTCAACTTTGTTGTATTGTATGTAAATTTTACATTTTTCACAAGAGATTTTTATTTTTATATTTAAGAAATTTGA
AAATGATAAATAAATAATTTACGTTAAATACAAATTTGTTAAAGAATCACAACAACATACCCAATGAGGTATGCCACTAAGGGGTCGTTTGGTACAAAAA
TGAATAATGCAGGGATTAGCAATGCAGGGCTTAGTAATGCAGGGATTATTTTTACGAAATGTTTGGTTCATTGTTTCTTATCTAATTTTGTGTGTGATTT
AAATGTTTTTTTTTTAAAAAAACTTTCCAATTATACCCTAGAGTTATTATGAGATATTTCGTGTAATTGAGTCAAAGTAGATAATTAACGGAGAATATTA
TTTTTTTATAACATTTTTAATTAGTTAGGAGAATAAAAATTTTATTGTCATGTTCACTATTTTCTCACTTAAATTATTTGAGAGTAAATAATTGTCATCT
TAATAAATTAGAGTTAATAACTCAAAAGGTCACACAACTATAATGATTATAGAGAAAATTTATTGAACTTTGTTTTGTATCAATAAATTTTAAAAAACTC
TTTATCATAAAATAAAATAAAAATATAAAATAAATATAGAAAAATAAATTAAACTATTTTTATACTCGAGATGTATGTGTGTGTATATATGTATACACAC
TCTTGTTTTAGACTACTTGTGTAATTTTTAATGAACTTTCATTAAGAGACAATATTTTACTTGGAATTGTTCTTAAATTCATACATCAACATTAACATAT
TAGTCGGATTATAATATTTTATATTAATAATAAATAGATTAAGTAATTCATATTTTAGAAACAAAAAATTATATCTAAATAATAAAAGTTGTAAGCTAAT
TTATTTAAATAACTTTATTAGTATAAATATAAAATATAAAATCAAAAAAATAAATTAAATATTAAAAGGATTTGAGGGGTATTTTTGTCTTTACCTAGAA
TAGTCCATGGTATTAGAGCTAATACCTCCAAATGGAAGGTATTAGCAATACATCACATAATACCATGTGGGATGTATTAACTAATCCATGGATTATTTAT
ACATAGGCTTACATTCCTACCAAACACAGTATTAAATTATACCACATCTAATACATGGATTATTTCTTTCAATACATCCTTCCAAACGCCCCCTAAGTGA
GTTTCTGAATGATAGAGTGTATGTAGACTTTATCATTTAGAAAGTTTCTCGTTTCAAGTGCATCAACAAACTACAAGAAGAAGAAGTAAGAAAACATATC
AGTTAATAAGAAAAATATTGTAGAGTTTAATTTACAAGAAAGAAACAATAACATCAACAAAATAACTTTATAATTGAAACACAATAAACAATATATGACA
AGAACTACGAGTGTACGACTAGTATTAGGCAACAATCTTCACAAAGACAAAACATCACTCAATTTCTACTGACCTTCTATCCTAATATGTGACCTCCGCT
CCTTCCTATCCAGAGTCATGTCCCAGTTCTAAGAAGATACACCATTTCTTGTTTAACCACCTCTCTCTCAAAAAAAAAATTAAATTCAACCTACCTTCTA
CTCCTCCGCTTACGCCTTGTAACCAAACCAGTCTCTCGCGCTTCTTCATTAAGGCATCATCACATCTCCTCTTCACATATCAAAATTATCTTAGTCTCAC
TTCTCTCATATTGTTCGTCTAGAGGCCACTCTAACCTTTTTAAATTTGTTAAGAGTTACGTATACTAATTCTTAAGGGATCGTTGAAGTAGTTTGTTATA
GATGAGCTATGAGTACGCTATACTATGTTTGGTAAATTATTTATAGACAAATTAATATTTGATTTGTAATTTGAAAACTGACATAATAAAAACAATGTAT
AAATTACCGGAGAAGGTAGTTATTATTTTACCAATATGTGAAATAATTATATAACTAATAATTAAGTGTACCAAATTATCCCTAACTAGCTACCATAAAT
AAGAACCTTCTATTTATAGGCGTTGGAGCCTTTAACCCTACAAATTGTAAAAGAAAAAAAGAAAAACACTGAGATCTCTATTTAGCACGGAGCAGAAGCG
CCATGGCTTCGTGCTGTTCATTGAGCTTCTCAACAGTCTCTTCAAAGCCTAACAAGCCTTACTCATCACCAATTTCTTCTTCTCTTGAGCTCCCCTTTAC
TTCCCAGTTGCCATTTTCTAAAAAATATTCACTTTATTCCAATCATACCCTTCTCCAAACTCAATGCCGGAAAACCCAATCACCGGATTGTCCCAGTTTC
TTGGTACGTCTTGCAATTCTTTTGACACCCTTTTGATTTTCACGTTCAATTTTGAGTTTAGAAAAGTGAGCCCAGAATTTGAAATTAGTAATAGGTTGTA
TTGAACATAAATGTATATTGAAGAGTTTTACTACGCAGCTGTTGGTTTACAATATATTTCATGCTCAATCGAATGAGATGACTTGAAAGAGTTAGACTTT
AGTTTGGGACTGAGATGTAGTTGATTGATTGTTTTTTTGGTATGGCTTTGTGTAGTGGCTGAGTTTTAGCCAAAAAGGGAAACTTGATTAGTGATTGAAT
TGTATTTTTGTGATTTAGGTTGTGGGATCTGCGAAAAAGCAAGAACCTTTGAGGGTAATGATATCGGGAGCTCCTGCTTCTGGTAAAGGAACGCAATGCG
AGCTCATTACCAAGAAGGTAATGGTTCTTTTTTTTTTCTTCATAGGGACAAGTTGGTTGTTATGATCTTTTATGTTTGAATTATCTTTATGCTGTTCTAT
GTAGGTTTCTCTTTTTGGAATGGATGATGATCCATTGGGATTTTGGTTTTATAATTCTGAATATGAAATCTCTATTCTTGAAAGTTTATCTACTAATATA
AATCGTCCCAATTTCCACTAATATGTGTGTTATAGACCAGGTTGTACAATATAGAGGTATACTTCCATTCATGACTTCTGACCATGGGTGTTTCTAAATT
TGAGGACCAGTTTTTTACCATATTACTGGTATCATTCTACCCAGGACCTCTTATGACTTGACCCTTACTCCATTTGGTTCGTAGACTGATAACACAAGAA
CTGGTATGTGGGGATTGTTATACACTGATTGACAATACCGGCATGGTTAATACCAGTATTAGCTATGCATGTTGTATATCTAGTATAAGTCACAGGGTGA
TACACCTCTTTTACCACAGCCTAAAAAAGCAGAATTATCAGATTTATCTGCACTCTTGTAAACTAAAATCATCATGTAAATTTGTCCAGTTATCAGATTT
GTCTTGAAAAGCATCTTACTAGCATCTGTTCAGCTGTTCCATATATTTACGTTATTTCCTTAGCATAACATGTATGTCTCCTATGTGTATTCTCTTACAA
TTCACTGGTACCTTGTTCCCTAGCCTCTTTATCTTGTTTATTATGAATTCTCATCTGGTTCCTCTAAATTCTCATTGGTGGGTTTGTAATATTTCCTTCA
GCCGAAATTGTCCATATTATAATCAACTTTATCTTAATTATTAGCAAGTCCCTGCTACTTGAACTCACATTCTTCACATTTCTTGATTGATTTAGCTTTA
GTTTGATTTCCATGCTCCTTATTCCTTCCCTTGTTTAACATGTAGTTGTAAAAAGGTATGTTGCTAGTAGCATTTGATGTTCCATTTCAAAAAATGTCTC
TAGTTGCAGTCGATGTTAGTTGCTACCTTAATTACCCATTTTCCTTGTTATGTATTACCCTGTGAGAAGTAATAAATTGAATACCGTGAGCTCATATATG
CAGTACGATTTGGTGCATATTGCTGCTGGAGATTTATTGAGGGCTGAAATTGCTGCAGGCACTGAAAATGGGAGGAGAGCAAAGGAGTATATGGATAAAG
GACAATTGGTACCAAACGAGATAGTTGTAACGGTAGGTTTACCTGGCAAACTGGTTCCTGCTTTTGTTAGCATGCTATTTTAAAGGTTGAAAGAGATCAT
TAGAAAGAGTGTTTTATTCATATGTGATTTGTTGATTCCTTGTTTTAGATGGTCAAAGAGCGGTTGATGTGTCCAGACTCTCAAGAAAAGGGTTGGCTTT
TAGATGGATATCCTCGGAGCTTGTCTCAAGCAGTAGCTCTCAAAGAGTTCCAGCCAAACCTTTTCATTCTTCTGGAAGTGAGGTTCTGCTATTGATATCC
TCTGATTGTGTTCTCAATCTCTTTCTAGTTAAAGCCTTAAGAGGATGAAAAGGATCAACATAGAGTATCCTGCATTTAAAATTTACCTGAAAAAATCTTT
GAACGGGAAAACTGTGCTTTTGGTCTGTGAAAACCTAATTTTAGCCTTCAATTGAGAGAACTGTGCGCTTTTGGTTCCTCCTCTAGCATATTTCCCTACA
AGAGTCAGATTACTTCCTTAAAATGCAAAAGAGTATCAAAATAACTTTCTTAGCATAAAAGGTGAATAGTTGTATGGTTTAATAGTTGTACTTTCATGGA
ATTTATCAGTTGAGGGACCAAAAGCTGATACTATCAGTTGGAGGTTTAGTGGGCTTGACTGAATACTGTGATTCGTTAGTACCAAGATTACAACTTACAA
ATAACCAAAAAAAAATTATTTTTTTCCTTATTTTAAATATGATTAGTTTTTTCTGATTCTTTTTTGTTTCACATGTCGTATATTAAACTGCAAGAGGTTT
CAGAATAAATGCACCTTCATCGAGTCATCAACCAATGTTTTAACTTTTAACAGGAACACGTTATATTGTAAATGATAGGTACCTGAAGAGATACTTGTTG
AGAGAGTGGTTGGCCGTAGACTAGATCCTGTAACTGGGAGAATATACCATTTGAAGTATTCTCCGCCAGAGACCGATGAAATCGCTGCAAGGCTTACCCA
GCGCTTTGATGATACAGAAGAAAAGGCATGTTAATGCATGAATACGTACATTATTGTTGCTACAACTGCTGTAGGGCTTTTCCTTTTGTATGAAGCTTTT
AAATCACGTAAACTTTTTTAATTCTTATTTGGTGGAAGCCTACCGTTTGTCCCATTGGTCATTTCTTGACCTTCTAATCAAACCATTTTAATCTATTCTC
CTCCTGGAAATTTTGTTGCAGGTCTCGAAATTTCCATTTTCAACTAAATCTTTCTTTTAGCTATTTCCTTTATCATTCTTGCTGTCCTTTTCCCTTGCTT
ACTCAAGTCGCTTTGTAGATAACTGACTTAAGTATAGGTTTCTATAACATTATAAATAATGTTGTGTGATCAGCTTCATTTTTGTCTAATTTCTTTTTCA
ATTTACCGTTTACAGGTGAAGCTGCGTCTGCACACTCACCGTCAAAATGTGGAATCAGTTCTCTCAATGTACAAAGATACTATATTCCAGGTATTCTTTT
TGCCACAGATGTGGTGCAGTTGCTTCACTCGGGAATGCAGATTGAAACACTCATCAGTCACCATCAAAGTGTGGAATCATTCCTTATATACTTGATTCAT
AGTTTATTGGGTTGTTTGATGGTTTACAAGGTCTTGGTTAACAGGAATATAGTCCATAAAAGACAATGTGGAAGGGACTCGGTGGAAATGGTTCGATGAG
AAAGTAGTTTGGTTTTCTATTTGGCAAAAGAACAATGATATGGTTATAAAATTTCGTTGTTTGACATGTAGGTTACAAAATGATTACTTTAAATTATCTT
CAGTTCATCCAGGTCATCCTTCCTCATAACAGTTGTAAAACAAAGGAAAGCCAAAGCAAAAGGGCTATACATCCTCTTTTATCTTAAAATTTACTCAATA
AGCTAAAGGAAGAGTAAATCCTTTTGAGTATTACATTCATACTAATCAATCTGGGGGGAAATATACTTAATCAAGGACTCCCCTTCCCTCTTCAATGAAC
AAGGATACTGTATGTTCTTTCTTTCCATACGCGTGCATGATCGTGTTGTTATCATTTCCTGGTGTTAAAACTTCCATCTTCTCTGAGCTATTTTAATTTC
AGGTGGACGGGAGCGTTTCCAAAGAGGAAGTATTTGCTCAAATTGATGGTGCATTAACTCAACTTCTTGAAGCAAAGGAGTGAAGATTTGGAACCGTAAT
GTCATAGAGATCAGGAAAAATCTGCAGAATGTACCATGTAATACTCAGGAGGATCATCGAAGACAAAAGAGTAACATTGTTGGTTGCTATCCCTCTTATA
CAAATGTATGAAATGTTTATGTATATCGTATTTGCTTCCAACTATCTATGTGGATATTCATTGAATCAGATTCAAAGTTTACTACAAAACTTGTTTTGTT
GTAAGGCCCAGCTCGCTAGTGATATTGTTAGCTTCGAGTTTACACCTATCCGGCTTTAAGACGTCATTAGGGTGTAAGACCTGCTTATTTATGTACTCAA
CATATCTCATGTATTTTTGCCTATTTGGGACTCTTAATCATGGACATAAATACCCAGATTTCTGATTAATCCAACTTCTGAAGTTTCCAATCACAGCAGA
AAAAAAGTACATTTTATCTTACACAATTCGAACTTTTACATAAAGAAAGTGGAATATCACATCACATGGTATAAATTTATGTATATCAGATACCTAACAC
TAACTTGAGAATTATACTACAGAGCAACTATCAACAGGGAAACCCCAATATAAAAAAAAGAGAAACTAGACCTCAGAAAAATTGTTCCCTTTTTTCTCAG
ATTTGCTTGAAGATCTAAACGTCAAGGGTTCAGCATCGACGAGCATATTGACAACCTCTTTCATGCTGGGACGCAAATTAGGAAGCTTAGTAGTACAAAG
TGTGGCAATTCTCAACACTTTGATCATTTCATCTTGAACAAGGTCAGATACCACCTTTTGATCAAGAACTTTGTTAATGCTTTCCTTGTCATTTAGATGA
GTTGAGGTCCAGTAGACCAAGTCTTTTCCTTCTCCATAGGCTTCTTCTATTGGTTTTCTTCCAGTTACTAGCTCCAATAGCACGACACCAAAGCTGTAAA
TGTCGTTCTTTTCTGTCACTCTGAGAGTGTATGCTATTTCTGTCGAGCAAACATATAGGAAGGTAAATGCAAATTCAAGGATGAAAAGTAACAAGTAGAG
ACAAAATGGTAACTGAATTTAAGGCTTTGTTGAGACTTACCAGGCGCCATGTAACCATGAGTACCTGCAAAACAACTGAACTCGGATCCCCTAGAAGAAA
TTTCTGAAACTTTTGCAACCCCGAAATCTGAAACTTTTGCTTCATAATACTCATCAAGTAGAATGTTGGTTGATTTGATATCTCTGTGAATAATAGGAGG
GCAACAATCATGATGCAGATAAGCAATTCCTTTTGCAGCTCCAAGGGCTATTTTATATCTCTGGTACCAATCTAGTTCTGGTTTGCCAGCCTTGATCTCT
CGGTGTAGTGCCTCGAAAAGATTACCATTTGGCAAGTACTCAAAAACCAAGATATTTGAACCTTCTTTCATTAGACTGGCATACAACTTAACTATATTTC
TGTGCCTGATTTTCCCCAAGATTTCCATTTCCCTTGTCAAAACTTTCACACCGATCCCCTTCCACAGCTGCTTCACAGCTACTGTTCCACAACCTTTCTT
CAAGTCTAACCGATAAACTTTTCCTGTACCTCCACTTCCGATCAAATTGTCCTCATCGAAATCACAGACTTCATCTGCATCAAATTCCACAGGGTGGAAA
CTCTCAAGCTTCCATTTTGCATTTGTTCCCTTGGCTTGCTCCAGTTTTTCTTCATCGTCTATGTCATGACTATGCTTATAGTTTAGGTAACTGACGAGCA
ATAAGCCACCCATTAGAACCGCTAAGGAAAGCAACACAATGCAAGATACCACTAGTTTGTTTAACTTATGTTTAGCAGCCTTTCCACCACAACTGTCCAA
GCCTGAGTTGATCGAGAATCTGATGCTTTGGTCGATACAAAGTCCTTTGTTACCAGCTAATGCCTTGTCTCCTCCCAGCGTTAAAAGATCTAATGATACC
TCTCCTGATAGCTGGTTGTTAGAGAGATCCAATGAAGACAGCTTCAGATTGTCCAAGCTAGTTGGTATTGTACCAGTGAGTCTGTTGTGTGAAAGATTCA
GAGAGTTCAAAGAGGTCATTATTGATAAGGAATTGGGAATGCTACCTGTAAGAAGATTTGAAGCAAGATTCAGGTCTGCAAGCCTAGAAAATTCACCCAA
TTCTGATGGGATAGTCCCGGAGAATGAGTTTTTCTCCAAATGCAAAGATGAAATTTGCTTTAGTTTTCCAAGTTCAGAAGGTATTGCACCCGAGAAGTTA
TTGTTATCCAAGTAAAGCCTTTCCAACTGTGTGAGTTTCCCAAGTTCTTTTGGAAGCTCACCTGAAAATCTGTTATTTGATAATACCAACTGATTCAGGC
TAGTAGCAGCCCCAATTTCCGGGGACATAGTTCCACTGAATTCGTTATCACTGAAATCCACCATCAGTACATTTGGAAGTCCCCATACATCACTGGGAAT
TTTCCCAGAAAGTTGATTCTTACTGACCCTCAATCTCTGTAAAGGCTTGCACGACGAGTAAGTACTCGGAAACTCCCCTGAGAAACTGTTCTCAATAGCT
AGCAAAAACTGCAGGTTCCCATTTTGGCACAAGTACTTTGGGAATCCACCAGTAAACTTGTTTTCAGATATGTCTATGCTATTCAGGGGCGAAAACCGAC
CAAGATTTGCTGGAAATGCCCCAGAAAAATTGTTCCTGTACACGGAAAAGCCATTAAGATGCTGCATATCTCCAAAACCAGGAGGAATTTCACCAGAGAA
GTTATTCATGAATACATGAAAAACTGTTAACTTCTTCAGGTTCCCAATTTCTGGAGGCAGCTTCCCATACATATGGTTGCTAGAGATATCAAATTCCTGC
AAAAGAGAGAGCTCTGCCAGTTCTACAGGAAGTTCCCCTGTCAACTTATTCTGAAACAGCTCAATTTTCCATAATTTTTTCAGCTTGCTTACTGACTTAG
AGAAATTCCCAGAAATCTGATTTCTTGAAATATCCAATGTACCTAGTGCCTCCATTTCAAAAATGGATTCCGGGATTTCTCCTGTCAAATTTGAACCTGC
CAGGTAAAGCCAATACACTTTCTTTAAATTCCCAAGAGTCTCAGGAATTTTACATTCAACAAAGTCATTATCTCCGAGGCCTAGCGCAACCAAACCAGTC
ATATTTCCAACCCAAGATGGGAATTCCCCGGAAAAGTAGTTAATCGACAAGTCCAACACTTCTAAGTTAGTCAACTTAGACAAATCAGGTATCGTTCCGT
TCATGTTATTTACTGTGACATTCAAGACTCTGAGACTGGTGCAGTTGGTAACTTCACTAGGAAGTTTCCCTGATAGTGCATTTGAAGGTAACACAAGAGA
AGTGAGACTTTTGAGTGAAAAGATTGAAGGTGATATCACCCCGGAAAGCGATTTATTATCAAGCGAAATTTCGATAACAAGACCAGTATTTTTATCACAT
GTAATTCCATAGAACTTGCAAGGAGATTCTGAGTCCTTCCAAGAATCCAAGTAATTCAAAGGGTCATTAAGCTGCTCTTTGAAATGCAAAAGAGCCTCAG
TTTCTGATGTTAAGGACTTACATGGCTGGACAAAAAAATTCAAAAACAAAAAAACAGCAAGAATTGAGAGGGAGTTTTGGAGTTTTTGGATTCTGGCCAT
TCTTGAAATTTGAGAAGGGCAAAAGGGTCATTTCAAAGAGGGGACACAAATCCAATCAAGAACTCCATTATTGCCATGATGGGTGTCCATCCAAGAAACA
GCTGAAAGAAAAACAGTGGAAACTCAGAAACCAAAAACTAAGATAAGTGGTATATTAAAAAAACAAGATAATACTCATATCCCAATATAAAAAAGTTGTC
TTTTTAAAAAGTGTTGTATACCTAACAAAATGTTTGTCATGTACTTCATATAACTTTCCAACATGAAATAAAAATTGCAGTTCAAGAAAAAGAAAACTTA
CAGATACAGGAATTCTAGATTATAAAAGATGGGATTGTTGGGTGGGGTTGGGAAGGAAATTAACTTATGTTAAGATGTCAATTTCCCATTTAGTTGTGAA
TTACACTATATAAAAATTTAATTATCTCCCTTTAAAGTGACTCAAAATATAATAGTTTCACCTTATTTTACAGTCTGTCCAGGTTATGAAAGAAGATACT
CATTTACTCCCCAAAAAAATTAGATAGGAATATAACCAAACAAAGAACTAACAACATACCCGTGTGATCTCATAAGTGTGGAATCTGGGGTAGGTAGAAC
GATTGTTTTTGAGAGACCCTTCGAAACATAATTGCAAGAATACTAGGAATATAACCAACAATATTGAAATCTTGGATTTCTATATTTGTAACAATAACAA
AACAACTTTTTTTCCAAGAAAGTTATAGCAAACTACAATAGGCAAACAAGGAACATGGAAATCAACTAATTGACATAAAACAAACAGCTTTCATAATTTA
ACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCTTCCAAGTTGTGTTTTTGATCATACATAAAGCTTCATTTGCACATTGCTAATCTTGGTTTTTGGATGCTTTTGTTGCTTAGTGTTTTGTCCTTGT
GTTGAATGCTATAGAAAATTTACTATCCATCACAACTGGAAATTGAAAGGAAAAGACATGGAAAAGTTTAGCACACAAGACAAAGTAAAATAAAAATTAG
TTATTAGTGAAACTTTTAGCTTTTTCACCTTTTTATATGTCCTTTAGTACAACCTCAAAGTATCCAAGAAAAGAAAAGGGCATTGTTGTCTTTTTATTTC
CAATTTATGATTCTAAATTGACCTAGCAGATAACAATAACACTCCAAAAGTGAAATAGTTCAATTTATCTTTTTCAAACCTTATTCAATGATAATCTAAA
TTAATCGATCAGTAAATTTCGAATATAAATATTAACATGCATGAAGAAATCTTGATCACAAATGTGAGAATTCATTCATATATATATATATATGGATGAC
AACAAGACATTTAGTATTTTCAAACTCTTTCTTCTTGGGAATCTCAAACTTTGCTTATACGTAACTAAAAACTCTTTTAGTAAGTTTTATGTGTCCTCTT
ATGTATTGTTTTGTTATGCAAAAATGTTTCAAAATTTTATAAATTTCACATGGGCCTTTTGTGGCTTTTACTCAAATGCCATTAAAACATCACATGGAAA
TACAGAAGGAAGGGATTTTGTTTTTTTGTACAATTTTTTTTTTTATAAATAAAATAAAAAATAATAAAACTGTACATTTTGTTAACATATTTCAACTTGA
TATCAGATACTAAATCGAATCTCTCACAGCTACCTTACAAGCACATAAACGTACCAAAGAAATAAATAAACATACCCATAATTGTACTAATATTAATTAA
TTTTGGACAAACACATTGACTTGTCCTCACGTTGCATTACATAAAATCCACAAAAGAAAAATTACAATATGAAAAAAAAATAAAAAAAATCAAAGCGTAA
ATTACAATTTCATGAAAATAACTATGCATTAATGAAGACGAAATTGTAACACTTACCTAACCTATATGTAGACAGGGCCATAGCTACAATATTAGTGGCA
TGACAAACTCGGTAGTTTTTGCTTAGACTTTGTATCTGTATTGAAAAATTCATTAATAATTGCAAACCCCACAGCTAAAACAAGCAATAAATTTGCTTTA
GAACTGATAAACTTTAAATCCCGACTCTGGCGATCTAGGATTTTATTGACTTGTGATCACTAGTACTTCCTACTATAATTATTTCTTGATCTTGGAAGAT
AAACAATGGATTCAGAGACTGTACAAGTTCTTTTGCAAGATGTATACATGCTGATGAATCCAAATCTATCACTTAAACTTCTTATTGATGGTACCTTTGA
AGAATTTTTCCAAATATCATCATCATATTGTTGTTGATCATCTTTAGAACACTCCACAAATGCAGCAAAAAATGGATCTTTTCTAAAACTTTTAGCAACA
TTTTTTCTTGGAGAAAACTCATCAAGAAAACTAGTAATTTTCTTGGATGAACCATTATTTCCATTTCCACAAGGTGGTGGCATTAATGGGAGGAGTTGAC
CTAGAGAAGTAGTAGTGTTATTTTTCTTGGAAAATATTTGTTTTGGAATTCCAGGAATTTTTTCCCAAGAAAAGGGTACACCTTTTGGGAATTGAAGAGG
AGTTGTAGGGCTAATAGGGGAGTTATGATCATCAAGAATATCATGGAATGAGAGTGATGATCCAAAGGAAGAGTTGGAAGAGTGAGATGGAGATGAAGAG
AGAGATGGTGGAGTACTCCGGCGAGTCGTCGGTGGCGGTGACCGGAAAAGTGGGGTTGAGAATGTGGTGTCATGACTTTGATGATGATCATCAACATCAT
TTGTTGGAGATGGAGTAGTAAGAGTAGAAGCCATTGATTCTTGATGAAGGGAGAAAATGAAAAGTGGAAGAGGAAGATATGTTGTAATTGTCTCTTTGGT
ATCTTTACTCTCTCCTTGTTATGTGTATATACTAGTGTATATATATATATTGAGAACCTTTTATCATGTTGTGTTTACTATTTTTACTTTCTTTCATTAA
ATAATGTTTGTACGTTTGAGAAAAAGTTTTGACATTTATTGACTCTCTCTTTAACAGAATTTTAGTAATTTATTCAGGTGGTTATCTGGATTTTTACCTT
GTTGATTTGAACTTTAATTCTCCACTTTGTAAATCTTTCCTTCACCCAAAAAGGAAAATATCAAAGTAAGATTGTTCCTCATGATTTTTCGTTTTTAATA
TGAGATCTTTGTATTAAATTGTCCACATTAGATATTCAGTTTTGAATTTGAGGTTATAAAGAGTTTCATATTGATCTCCTCAATATGATTTGAACAGTTT
TCACCTCTTGAATTAACTTTGGAGATTGATTTAAATTCAATATCCAATTTTTAACAGGTCTTTTATTTTTTTTTAAAAAAATAATTATAATAATCCAACA
TTGTGTAGAATTGGGAGCATAAAGCTAAGACACATAATTTGGTTCAGTGTGGTTCATATGATATATTTGATATTCTTTTATATCGTATTCAGATTGATTA
TCAAAATATTTTAGAAAATATATTGCTAAGCTTTTTTAAGTTGTATTTACCTAGCTAATTTATTCTTATTTTACTCACCTACCAAGATAATTCTAAAAGA
GGAATTAAAATGTTTTCTTCGCCCACATAATTAATAATTATATTCTAGATCAAGGACCTACATGTGTACTAGATGTTCTTCAATTTCTTCTCCTTAATCA
TTATAAAGTTTGAGTTGCAATTCAGAAGTAATTACCCCTAGAAAAAAAAAGTAATTAATCAACTACATTTAAAATCGAAAAGTTTTTTTTTTTTATAATT
ATGTTTGTCACAATAATATCATATCAAGTGTAATTCAGGTGAAGAGATTCAAGTTTACGCAAATAGTTGATAAACAAGCACTTTGCAATTATAAATCCCA
ACGAAGCAATGAAGTAGAATCCAGTATATATTAATATAAGTCATGAACTATATTTTTTTTCTTCTCATTTTGATGCTTATAATTGTTAATTATGAAGAAT
ATTAGTATTATAATTTTGGGAGGGGACATAGAAATAAATGTATAAAGAATTATTGGACTCCATCTTCCATAGACTAATTTTTCACCTACCAAATTTTAGT
CAAGAGTATCATAGTTGTCTCATGAATTATTGAGTGGCTTTAAATAATCATTATTCAAATTTCATCAAGCATGGATCTCGAACTACTTTATTCATAATTA
ATCTAACCCATATATGATATATATACGTCTCTTTTTTTTTAAAAAAAAAAGAAGAAAAACCTTGAAAATGAATATTCATAAGGCTGATTTTATTACATAT
TAGTTGAGGGCTCCACATTTTGCTTAATGTTATCATGTTTAAGCGTGAGATTTCATTTTAATCGAACTTTAATATAGAATACTGAAGATAAATTTATTTC
AATTTTTAGTATTACGTTATCGATACTTTAATTAATTAAATTTATCTAATATCAAATCTTCATATTATAATAGTTTGACCATGTGTAAAGTGTAAGGAAT
TATGAATGGTTTCTGTTTTAACGTTGAATTAAATCCAAAGTTCATTTTGTTATCATTTTACGATAGAAAATTAATAAATTTTTATGAGCTTATTTTTCAC
AATGTAGTTATTGTCCTAGAATTACTAATTATAAAACTATTAATCATTATGTTAAAGGTAAATATATAGTACTATTGTGCTAAATTACAAAAATAATAAT
AAAATTCTCTGATAGAAACGCCTGGCCACGGGATTGTCTTATAGCAAAAAAAGAAGAGGATAAAAAGTTAAAAAGGGCCATATTATAATTTGCTAACGCC
ATGCAAACGCAAAAAAACAAAAAACAAAACTCAAGGTGCTCGTGATCTGAAATGATCCTCTTCTTCTGTGAATTTGTCATGTGATTATGGGACCCTATGC
CCTCGATAAATTGTTCAAATTATGAATTCATCTGAACGCAATAACTTTGATTTAGAACATATATATGTATTGAAAGATTCACTATATATAAGTAAGGGTA
ATAGAATCGAGTTGAATTTCAATTTTTAGAAAGATAGAAAAGATTCGAACAAGACAGTCAATGTACCCCAACTGCTATATCCAAATCACATAATCGACTA
GAGTGTAGATACATTTAACAGAGATACTAGATACATTTTAAAATATAACTACATAGGGTGAGAGACGAGTGAGAGAGTCAAATTCACGTGAATCTACTTG
AATAAGATAAATTTAAATTCATATGTATCTGAGATGAAATTTGACACAAATAATAATTTTAAAAACTCATAAAAAATCTCATTATTAAATCTAAATTAAC
AAGATTTATGTTATTTTACGCTTCTTCGTAAAATTTCCACGTAGACGTCTCCATCGAATTTATGTAGCTCATTTTTCATGTATTTATACTTATTGCGTTT
CACGTGCATTACGCTCAATTAAATCAACAAGAAAGAGTCAAAGCGTACACCACATGTTCAGGTTCGTCATATGATTAAATAATCCAGTAACTAAAAATAA
TATATAATATACTTTTTATTACCTAAAATAATAAAATAATTTGTTTTTGTCAAGTTTAAATAGCAAAGTTGTCCCATTCATCGAGAACTAAAGCAACGAA
GCACTCGTAAGTAAACTATATATTTAAAATTTATTATGTGGTTATACCTTTGATAAAGTAGGAAAAGGTTTTGACACTTAGGTGTCGTCGATTATGATTT
GAGTTTGAAAATTTTATTTTGAAGGTATTACGTTGAAAATTCCTTATCAGCAAAATAGAGGCGTATTCAGAATCTTGAAATAATAGGTGCACTGTTATAA
AAAGGTTGATTTATGATATAAATTTGATAGGTTCGATGTTTAGGTTTTTAATATCGAAAACTGTTAAAATTTTAAATTTGTAGGTCTATAGTTAATTCGT
ATATACACACACACTAATTACTACTTATAGAAGCGTTATCTAATTTAGAAAGAAAAATAAAACAAGATAAATATGAAATTCAAATTTCTAACCTCTCCGA
GAGAGGTACATCCAGTCATAATCGCATAATGTGATACTTTAAGAGTCTGTTGATACATCTATATTTCAATATTTTTTAAACAAATATAGCACAACTATAT
ATGATCTCGAAGGGGACCGTGGATCCACGTGAACTCGATGACCACTCCTTAGATACGCCTCTGAGCAAAAAGCAAGGGGATTTCGATCGGACTCGTTGCA
TCAAACTTAATACAGATTATATCCTCAATTCTATAGGCGAATGATTAAAAGCAAAGTTTTTACCATGTGCGTATTCAAAAAATAACAATTATGAATGTCC
CAGTGCCAATACCAACACAAGTAATAATTTTTTAAGTCTTGGAATATGAAAAAAAAAATCTTTATATATACTTGTTGGCTCTACTTGGAAAACTGATCAT
TTACTCGTGTAGCACTTTCTATTTTTACAAAAACTTTTTAAGAAGAAATAAATGTTTTGTGCTTTTGGGAGTTTCATAATCACCATAATTCACGTGCAAA
AGGGAGTTGATCCAAGTCTTTGAATTTTCTCAAATAAAATTTAAATATGTATATTTAATGTATATCATATATAGTATGATGAACTCGTGATCAAGCGTTT
TTGTCCCACTCTAGTTTGTTGTCATCATAATCTTGCTATAATTCTGTCTTCATATTATTGTTATTTACTTTAGCTTTACTCCTCCCAATGCTGATTCACT
GTGCATTTTCAATGTTTTATTTGCTTTTTTGTTGTCTGACATTAACTCATTAACCAAGATTTTCCATCTTGTGCCTATAGTTTGATGCATTTTGTAACAT
ATACTATATAGTCTAAATCTAAATAAATACCCGTTTGCAACAAATTTTACAGCGACAGAAAGAAATTACAATCATGATAAAATATGAAGAAACATAATTA
TATTGATAAAGATAACTGTTACAATTCTGTTGATCTATTGATTTTACTCTCCTAAGATTTATCCATGACGTAATTTATTCATGATTCGAGGGTTGTTAGT
GACGCATTTTTCTCGAACTAGAATTTAGATTTGACGTCTCAATATGAATAATCCATCAATTTGCGGAGTATTCAAGATCTTAATCTCTTTATGAAATTTC
CAAGATTAAAAGAATTCAGTATCCATTAGAGACATAAACTAGGGTTTAGGGTATCCTCCAAGAATCCTAATTTGAGTTGAACACAATTTATAGAATTTCA
ACTCAAATTCAACGCATTTTGTAGAGTCCTACAAAATTTCAATATCTACAATACCATTTGATAATTGATACGAATATATAAGAAGCTATATATGGAGTGA
AATATTACCACCAAACACGTTTGTTCGTTTTACTATATAGCTTCATCTTTTTATGAATCGTATATTTATATATAATAATAGAAACATAACTTTTTCAATT
CTAATTGATTAGGTGTATTATATCAACTCTTTAGAGTAATTTATCTGAAAACGTGACGTCCAGTTTTAGGAAATCTTTTAAGAAGTTTTGTTGGAAACCA
TTTTAAGGGGAAAAAAAACATTTACATAAACTGTTGTTCCAAAAAAAAAAAAAGAATTTGTTAATAAATCAAAAGGTTTTTTTCTTAATTCACCAATTTT
TTTTTAAATGTCCTTTTTAAGGATTGGTTTTTAATTATTGTACATATCAATAAAAGTAGTGCAAACAATATACTCATATTTAGGAGCATTATATTCTTCA
CCAACTTCATTTTCTCTTTTCCTTTTTCCTCCATCTACTTTTTCTTCCTGCAAAATAAATAATGTGGACATGCACTATAAAAATTGGAAGAAAAAAAAAA
GAGATATATGGTGGAAAATTAAATACTCATTAGTTTAATTTAGCTATGGTTAAAATTGAGTGGATATATAGTGTGTTTCATTGAATTTGTATTTAGTTTG
AATAATAATTAATAATCTACCAGCTTAGTCTTGTTATTTAAAAATACTCGATTTTAATTTGATCACTAAGAGTCGAAGATTGCTATATATTTTAGAAGAT
TTAGATAGCAAATAAACACATATATGTTGATGAGATTTCATTAAACAAGTTGTGATGATCTATCAAAATTTGACCAATTTTGATAATTCCCCATATGCTT
GATTATCAAAATTTGGCTATTAGCAGATATTGATTGTATCACCTTATTCGTAAAAATATTACTTTTACATGTTATCTTAAATATTTTAGCTTTTTTTTTA
AAAAAAGAAGATTTTGATGTCAAATTCTTCACATCAAATCAAAACCACTCTACTCTCACCTTTGATAATTGAAACGAAAAAAGAAGAAGCAAGAAATAGA
AACAAAATAACTCGACCAAGAGGAGAGGAACGAAACTTTACGACAACTTTTTCGTAGACGTTCGATTTGCATGTGTTAAGCATATAGCTAGCGTTCCTTT
GTAGATTTCTGGATTTCACCCTAACCCAAGAATTTGCTTTATGTAGGGAGACGCGTGCCCGCGTGCTGCAAGATCGAGTTTTACTTGCTCAACGAACTCA
ATTTCCTTTATGTCTTTCTCTACCAGACCCCGAAAATTTATTGAAATATCAAATTTAGAAGAAGACCTCGAATCCACATGAATGATTGAGTTTGAAGCTC
TCAAATTTAAAAGTAAAATTCTGAAAAGTTGGAGGTTACGATGTCAATTAATTACGGTGTGTGGTTATATATAGTTTAATATAATTTGATATTAACTAGT
TATTTTAGTAACCTATTTTCTACCAACTATAAATCCTCTCATAGGATTCACAATTCGCAGGATAATTGCCAAACAAAAAATGATGCGAATCTATTAGGAT
AAAACTTAACCGAAAAAGAAATTTTCAATGCAGTTTACTCTTTCCAGGACCTAATGGGATTCACCCTTTTTTAACCTAAAATATTGAAAAATAGTACGAC
CATCAATAAAAGCTTTTTGCATGAAAACTTGGAAAGATGAAATTAAAGGATAGATTGTTAAATAAATACTATCCATATATACCTTATTTCAAAATGTAAA
AATGTTTCTAGCCTAAGAAACTTTAAATTTATAAATTTATGTACAGACAAACAATATCCAAATAGACGCAAACTCTTTAAAAATTTTGAAGGTTATAAAT
AAAGGACACGAATCATATACTAACGTAATTAAACTTTTGTGGAATGGAAGGATCCACCAATTTTTATTTTGAAGACTCTAAAAGCTGATAAGGATAGATC
AAACTTTTGATGGAAATGCAAAAAATATTTTTGTTAACTGTGTAACTAGCAATCCACGTACTGGTAGTATTACAGATAGTATTTTTGCTAACTCTGTTGC
TAGCAAGTCTGGAACTAGTAGTATTTCGAGCCACCGGTCTTTATGGATACATATTAAGTATTCATAAAATTTCTATTTGAACAAAAAAAAAGAGTGTTAT
ATTAAATTATGTTAGATATGACTTTTTATAGAAATAAATAGATATACTTGTTATCAGAAGTAAAATTAATGATTCTTTTTTCGTTTTAATACGAAGGTGT
ATATATATATATATGTGTGTAACTATATATAAAAATGTGTGTATATATATATACTAGGCTAAGAACTCGTTTGACTTAACTTAAAAAAGATATTTTTCTT
AAAAGTAATTTTTTAAAAATTAAACTTTAAGTAACTTATATTAAGTTAGAAAATAAAAAGTAGGTGTGCTTTATAAATTTTAACTTTTTTTCAAGTCATT
TTATACTTATTTTAAACTTCATCAAATATTTTAAAATTAAAAATAAATATATTTGACCAACATTTAAGCTAATTCAAACAAACTTTAATTAACATTTGCT
ATTTTTGAAAATTTAGTATTTAAAAATAGTCAAATTATTATTTATGTCTGAAGGGGTTAGATTTGACCCTTTTCCATAAGAACCACAGAGAAATTTTTTC
ACAATTGCAATTAATTCAATTTCTTCAAGTTTCAATGTGAAGCTTCTGGAACATAAACTCAAAGCAAAAACACCCAAAACCAATTTTCTTCCTGGAAGGT
GGAAGAAGCCCTAGCTTCTGAGAGAGGAGTTTTATCTATGGAGAAACCACCGTCAAGCTCCCGAGAGTTACAGTGTGTAGGAAGACTCGAAATTGCACGC
CCTAAACCAGTCGGTTTTCTTTGTGGTACAATTCCTGTTCCGACCGATAAAGCATTCCATGATTTCAGCACTTCAGAACTTGTCCCCTCAGCCGAAAGGT
ACGCATTTCCTTCTGTTTTAGCTGGAAAATGTATTTATTTTGGTGAGATATGTTGTGCTCTCCCTTTCTGTTTTATGCCATGGTATCTGATTCCACACCA
ATTAATCACTGGTGTTTGGGGGGATTAAGTAATAGTTGAAAAATTAGTCTGATAGGCGCTCAAGGGTGTTGGTATCTAGTGATCAATGAAGTAGGTTTAA
GAATTGAGAGGTCTCAGGTTCAAATGTTAATGAGGAACTGAGGATTAAGTTGTAGTTGAAAAATTCATTTGACAGGCGATCTAGGGTGTGGTAAAGTGAT
AACGAAGTAGGTTGAGAATTATGAGGTTTCAGTTTCAAATACTAACAGAGCGTAGAGAGCATCTGAAGGGTTACTTCAACTTTGGTGATCAGACATGATC
AGGGCAATCAGTAGCTACAATTGATGGAATTTTGATTGAAACTATTTATAAAAAAGGCCGCATAAAGCCCTACCTGCCTGTTCTATATAGCCGCATTACC
ATATACAAGTTTTCTTCAATGCCATACCAAACCAAGACCTTTCCTAAAAGGAAAGAAAGAACCCGTGTCTCCCCTTTTTGGATACCCCTCTCACCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCGGAGTACAAAAACATTAAGTGACTCTAAGCCTTAGCGGATAGGGTTACTCGGTCCTGTGTTGGTGGGAGATAGATA
TGCAATTAGTTGAGTAACTTAGTATGATAGAGGAAGTACTTGATAGTTAGTGAGTTTGAATTGTTAAAATTTGTGAAGAGTTTTTAAAGAAATGAATGGT
AAAAATTTGGAAACCTTCTAAAATAGTATAAAAAAGGTGAATTGAAACAGAGAGAGTAAAGCACAAGGGTTAGCTTATTTCTAATTGTTTTTGGTTTTGG
AGAAGTTAAAAAGTGCTTTTAAGCACTCAAACTTTAGGCCCAAAATGTCTAGAATAAGCCTAAAACCATAAGTAGGATATCCCCTACTTATGACTTTTAA
CTTGTAAGTTACTTTTTATAAGTTGTCCAAACGGGCAGTAAGGATTGCTCTATTTTTTACCTTCTTATTATCTCTGAACTAATATCTTCTTATGTATATA
TATTTGAAACTGGTAACAACTAATATCAGTCTTATATGTTTACAAAATGGAGGCACTTGTGGTATGGTCTTACAGAATCTTGACAGACTTTTCCTTGAAA
GTACATGGCTTTTAATTACATATGGTCTTCTAAAATTGGGGGTTGGTCCATACTCTCTTCCTCCTAAAACAGTAAATATATGTAGTTATTTGAATAAGAT
GATGGAGAAACTTGGTCCAACATATTCAAACTCTGAAGAATTCTTATGTAATGTTTAACAAAGATCACTTTGCATTTACCACCGATACATAAAAAAGACT
AGAAACAGATACCGTAATCAATGTTTTAAAAGGAAAACTCGTGACTGTACAGTGACCTATCACGAGGCAGATTAATCATTTGGCTAGCACCTAAATAGGA
TATTTGCTAGATGTACGCCGTAGTCATCTTGTACCATACTTCCGTATGCGCCTGAATAATACTCCTTTCATAATTTATGCCTTGGATTGTCTGCTATGAT
AATGTATGTGCCTGATTTTTTTTCTTAAAACGCTTTTGAATATTGGCGATAACTTATTTAATATGTTTTGTTGTATAATATGGTTCAGTGACATAGAATT
GTTTGCTCCCAATTTATTTAAAATATATACATCTTTTCTTTTGATACTTATAATAAGTTCATTGAGTAGCTCAGTGTTTTAGAGCTAATATATCTTGTCC
TTTGGTAGGTAAAATGGCACACCTTGCTCCTTTGCCTTGTAAAATGCTGGTCAGATCATAGAATATGAAATAGATTAAGGAACAAAAAATACTTTGTTGA
CTTGCAATGTCAATAAGACCAGGAAAAAGTTGAATAATTTTTTTTTATGATAAAGAGCTGTTACTCCATTACTTTTGGTAAATATAGCTTTGATTCCAAA
AAACCCACCTTTCACTTCCTCTTATTTCCAATTTTTCGTTGCACATTACCAAATATGTCCGCATTTATAAATCTTAGAAGACTGTGGCCATTAAAGCTGG
ACCAAAACTTGAAGGATTATATGTTTTGCATTGTATACCAAGGAGGAGAATAGAGTAACCTTCTAACTTAAGGGACCTTTTACGTTAGAACTCTTTGCGT
TATGTTATATTACTTTAAAAAGGTCTTAAGCGTTCTTGAAGTGTTCCCTGATTAGTATGGGTGTATCGTCTACGGCTCTACGCATCCCTCTATTTTATTT
ATGCAAAGGGGTTTGCTGCAACAAGGCGGGTCTAACGTCTTGAATCCATGATCGTCAAGTTATAAAAGAGCAACTCTATTGTTGCACCAGGGTCTGTTGT
ATTGCATTTATTATGTACCATCATTTCTGTTAGAGAGACTCACAATGTTGAAGAAATTTTCTCACATTGAACTTAAGACATATTGCTATTGTTGTGAATG
ATAGTGATTAGATATCTTAAACTTCAAGTCTTTGTAGAAGTACACTTGTCTTTTGTGCATGTGATGAATTAGGTGTTATTTGAATTTTGAGTCCAAGTGT
TCTCTTTGTCAGAGGGAGGGTGTTTGGATGATCTTGAATTGTTCTATTCAGCTCTTTTTTGATAATAATTTTAGGGTTAGAGCTCCGAGGTATCGGATGA
TTCCCATTGAGACTGATCTCAACACTTTGCCGCTGCTTTCGAGTATTCCAGATAAGGTACTCCCATTAGTGGCTACCCAATCAAGGACGAGTGCAGGTAA
TGACTGTTAGTTCTGTTATCTATTTAAATTTAAATGTAACATTTTTTAGCTTGTATTGTACTTGTACTGCTTTATTAACTGTCAATATGCTTCGCACCAT
TTATAAATTACATTGGTAGGACTGATCAAATTACTTGACCCGGCTTCACATAACTTTTGTGGACTTCACGAACAGAAGAGTAGTGCTAGTTCTGCAACAA
GTTGCAAGTTTAAGAATCAGTACCTCAAATGTTGTCTTTTTGAACCGTTTGCTTGGTGATGTTTTGGGGTTTAGAACGTCATATACTGTGATTAAAAATA
TGTATTTGAAAAGAAAATCATGTATGCTGAGGACAGTTCAGTAAAATATTTACATCACTCTGCATATGGTATCAATCAGGATCCGTTTGATCTCCAGATT
ATGTTCAACTAATAATATACGTGCTAAATTGCAGTACTCCCATTTTTCCTTTCTTGTGCTGCAGCTTGAACTCCTTGACTTTACACATTGTTGCGTTGCT
TGAGAAGCAAGAAAAATAATTTTGAAAATAAAGACCAGAAAGAAGTAAGATGGACTAGATGACTGGAGGAGTATCTCATCATTCTGAGTAGAGGATTTTC
TATTATGAAAGGAAAGGAGCTGCTTATTAAGTGGTAGAGAGCCAGAAAGAAGGTGGTGATTGATTGCTTTGTTAACCCATTTTCAGTGGCTGGAGTGTAT
TTTAAGCTATCCTTAGGATTTGCTTTTGCCTTGCTGGATTAACTATGACTATTTAGAGTCATTGTTTTTAACACACTAAAATGGCCAGTACCTTCTCACA
TCCTTACTTGAACATGATCTGTTCTATAGGCTTGTAGCACTGTATCCTTGAGTTTAAGGAGATAGGAAACCATGTCTGGTGGATGAACCATGACCAAGTG
ACTAGAGCGTGATTAACAGCCCTTATGGACCCTTGGTTGGGTATTGGAGCCATAAAGGATTGTTCTCAACCCTGCTCTTACATGGCTGGGATGGTCTCTT
GGAGAGTGGACAGACTTCCAAACTTTTTTGAAAAAAGAGAGGTTTGTACTGTGTTTAGCCAAATACGAACAGATTTGGATATTTAAGCATGTTCCCTTTG
CTTAAACAGAACTAAATATGATATATTCTATAAGGGAGCTCATTTTTATATTTGGTGGTAATGGTAATACTTGGGAAGGATGCATATTACAATCAGGATA
AAGTTGGGGATTCAGAGCAAGTTTTATGTTGTTTTTGTGTATTTGTGTTGATGGAGCAAAAGCTTGTAAAATCCTTAATATATTGAGGTGATCAATGACC
ATGACACATAGAAACCGAAGTACTTAAAGCTGGGGAATAACTTTTTAAGACTTGTGAAAGAAGTGGAAAGTCAACCTTAATCCTTTTTGGCACTTGAGGA
GGTGGTTTTGTTATTTAATATGTTTTGTAGGTTATAGGTAGCATCTGCATGCAGATAGCTGGAGTTTGGCCATGTAGGTTGTTAGGGTGGGTAAAAGTCC
TAGGTGGTGAACAGTTCCAATCTTTCAAAGGAAAGAGTGCTCTGTCCAAAATATAAATGGAAAGTTTATCATAGCTAAATATGGTGAATTAAACCCTTGG
TGTACAGAGATCACAACAAAACCTTATGGTGTGGGTGCATGGAGATCAATTAGAAACTAGTGGTCACAGATGGAGACAAATTTATATATCAAGGTGGGTA
ATGGCACTAAAACAAAAATTTGGAAGGCTGTTTTGATAGATCAATCCCCTCTTAGGGATCTCTTTCCAGATCTTTTTCAAATTTGTGGAAATCCTGATGC
CAATGTTCGTGATTGCTGGACTGAACAGGGCTGAGATCTAGTTTTAAGAAGACTTCTCAATGATTTGGAGGTGGAAAGGGTGGTTGAGATATTAGGGATG
CTAGGGTGAGTGACCATCAACGCCAATGCAGGATGTGGTGGAAGCTCAGCAAAGATGGCCTTCAACAGTGCTTACAGAAGAGGTCTCCAGGTGATGGCAG
GGTGACCAAAACACCTCTGGAACTATCTTTGGATGGGGGATATTCCTACAAAAGTGAAATGCTTCACTTGGCTAGTGATAAAGAGAGCTTGTTTAACACA
AGAAGTACTTCAGAAGAAGGGTAGACAGCTGGTTCCTAGGTGTTTCTTATGCAACTTGACAAGTGAAACCAACAGCCAACTCTTCTTGCACTGTAATTAC
ACTGCTCAAATCTTGTTCCTTAGCATCCCAAATCTGAATTGGGCAATGCCAGAACGTGTTGAAGAGCTGGGTAAGGAGAGGAGGTACCCAGAGGCAGAAG
AGACGGCGGAGGTTAATACTGTCATGTATATGGTGGTCAGTTTGGAAGGGAAGGAACAGTAGATGTTTCAACAATAGATCCAATTCCATACACAAGGTCA
AATGGAATTGTATAATATATCTACTTTTTTGGTGTAAACAGTTGTGTATAGTAGATACAGATCAAATTGTAGATTTAATAGGAAGTTTGTAATTGACACT
TTTTGTTGGTGGCCATCATGCCCTTAATACTGAAGAATACAACCTTACCAGTTTTAAAAAAAGAAAAATAGAGTAACACTCAAATAATAATAATGCTGTT
CAAAATAAAAAATAAGTCTTTTTTTCTGCCACAAGAGGGCCTTCTGTCCCCCTTTCTTTACATACTAGCCATGGAGGGTCTTAGAAGGATGATAGCCATG
GCTAAATAACTCAACTGGCTGGAGGGTTTCGGTATTGTAAGTAGACTAATGCATAGGCCACCTCTGTTTCTCACTTCTTAGTGGCTGATGACACTCTCAT
TTTCTGTGGTGCTAAGAGGTCCCAGGTCCAACGCTTAAACATTACTTTGATGTTCTTTGAGGCACTCTTGGTGTCACATTGGCATGTTTAAAAGTTCCAT
TTATCCTGTTAATTTGGTTCTTGAGTTGGATGAGCTGGCTGATATTATGTGTTGCAATACGAGTTGTTTTGCAACAACTTATCTGGGACTTCCTTTGGGT
GCTAGGTATAAATTAAATGAGATGTGGAGTGGGAATGTTGAGAAAATGGAGAAGAGATTAGCTTCCTGGCAACAATATTTTTTTTTTGGTGTCAGAATAA
CACTGATTAACAGTGTTGTCGATAACACCCCTACTTATTTTATGTCTGTAATTGCTATCCCATCAGAAGTCCTTCTGCAGCTCAACAAACTTAAGCATTC
TTTCCTATGGGAGGGAAACAACAAGGACCATATATTTCACCCAAGACAACATAAAGAAAAGAAAAATCCAGTTCCCAAACAGATGCTATATGTGCAAAAA
AGAGGCTGAAACCCCCAGACACCTTCTTCTTCATTGTGATGTGGCCTTAGAATTATGGAGTATTTGTTTTGTCTCTCTGGCATCAGTTGGACCACACCCC
TCACAGTTACGGATGCATATGAGAGTTGGAGCCTATGGAAAGTTGACAAAGCTATCAAGAAGATTTGATTATGATACCTGGTTGTGTTTTTTGGTGTATT
TGGTTAGAGAGGAACAACAGATGTTTCAATGGAGAATCAACTGCCTTAGGTATTTTGAAGACTAGGTGCATTGCAAATTTGTTTATTTGGTCCAACTTGT
ATCCTACTGTTAATGCAGAACAACTTCAGGATTTTACTAACTCAATAGTTCTGGCTTAGATAGTTTGTATAGTTAGCCAGAGATTTTTTTGTAAGCTCAA
ATGCCATATTTGTAAATCTTGCATCTTCTTGGTTCTTCCCAAATCTGTTTTGGGGTTAGAGGTGAAAGACCTGGCTCTGCACAACGAAAAGCATGCTCCT
GAAATGGCACCAGAGATACGATCAAGAAGGAATGAGCCTTGGGAATGTGGTGATTCAAGCCAATTATGGCAAAGATTGTCATTGGGTCTCCGACATCAGC
AGACTCCGTCTTGGTTGTGTATCTGGAAGGAAATCAGGAACATGCGGCCCGAGTTCTCAATGAATTCATCTTTGCAGGTGGGTGATGGGAATCATATTCT
TTTTTAGGAAGATGTATGGCTAGGCCAATCAAATCTGCAGGAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAAAATTCCTTAAAAATTTTGTACCGTGATACTTTAGACTCTAGTGATACA
TGATAAATGATATATGGTAAGTTTAAACTGTTAAGAAAAAAATGAGGAAAAAATGGTACATTTAAACTTGTTAACTAAAATAGCTTAATTTAAGGTAACA
GATCATTAATCAGCATTAAATCAACACGTAATTGGATATTAATTTCAAATTTTGAAAATCAAAGATTATATCATCTATTTTGAATACATTTTTTATGAAC
AGTCTGTTAAACTTCGATACACAACAAATTCATGTATCAATGCATCGTCTAAAACACTATACACACTGATTCAAAATGTATCAGCAAGCACACTTGATGG
ATTCAAAATGTATCAATGCATCATCTAAAACACTATACACACTTGATGGATTCAAAATGTATTAGCAAGCACACTGATTCAAAATGTATCAGCAAACACT
TCATGTATCAATGCATCGTCTAAAACACTATACACACTGATTCAAAATGTATCATCAAACATACTTGATTGCGCAGTTATTGAAATTAATCACTGATATA
TGATAAAAAAATTTCAAAAACCCTTGATACATAGGAAATCATATGATACACATTTAATTCATATATCAAATCATATACTAAACATTATAATCCACTTAGT
ACTTATGTATTAAACCTATTGTCTGATACATGATAATAATTTTCATAATTTTTTGATAATAGGAGGCATGAGGTGGAACTTCAAATTGATGGATCATGAG
GACGGTCCCCTTGTTCCCCAGAAAATATTGGTTGCTGTCAAACAATATTGGACTTTGGGTGACACCAACTCCACATCCTCACAATGAGATGCCACCGAAA
ATGTTGTCTGACCATATGAACTCGTATGGATCAGCAAGACCAACATCTTATGAATACAAAATCCATGGTTATGCAAGACATTCAATAACAGATGCTGGGT
TAAGAAGAAGAAAGACGATGATGGAGTAAGAAAAATTGAAGACGTGATGGAGTAAGAAGAACAATAAGAACGGGAGAGAAATTGTGCAGTTTTTTGAAAT
TTCAAATTTTTTGAATTTTGAAATTCAAAATTTCAAAATTGGGTGTTTTAATTAAAATTAATAATTCAAAATCCAAAAACTGATTTAGAAGATTGAGTGT
TTTAGTGGAGAAAAAATAGGCATTATATTGGGGGATTGTGTATTATAGGAGCGAGAATGTTATGTATCTATACAATTCTACTAAAATTAAAAAAAAAGAG
AATTATGTAATATTTAAAAAAAGGAAGGGAAAATTAGAGAATATAAAACTTATAATTGTGTATTTAAGTTATTTTTAACAAAGAAGGTATACCTCATACT
AATTGGGCTATCAGTACACATCATTATTGGGCCAAACATGGCTACCTCATACTATTGGGCCAATATCAAACATGGCTCAGTCCTTTATCAATAGGAAAAA
TAATTTACATTTTTTTATATATAAAAAATTTACTGAAAGATAGGTAATTAGCTCATAAACTAGTGATGTTTGTCTTATTTTATATACTCGCCATTGTCCT
TCGTTTCTAACCAAACATATTTTGAATCAATAAAAGGAGGTCCTGAACTTGAAAGGTTTCAAAAGAAAAATCAAGTTAATTAGAATCTTATATTTAGGTT
GAGATGAACTTAAGATTTCAAATTTACACGATATTAACTATATATACATAAATCAACTAAATTAAATTTATTCGCATATATAACTATCGAATTTTTATAA
CACATTATACAAAAAATGTTTTTTAAAGGTGAAAAGATAACTTATAACATATAGGTACTCAATACTCATGTAGCGATAAATATTTGTTATCCCTAATTCA
AGTAAGTTATAGTTGATCATATAAATCATCAGTTTCCCGCTCATCGTATCTCCATTTAAGCTAATTTCGAACCGAATATATAAAATAAAAACAAAAAAAT
CTAAGTGGTGCATTTATAATGAAAGACATCTAATTGTTTTAGGAGGAAAATTAAAAGTAGAAAATTGCTAGTCATTTTCAACACTTTAAATTGAATATTG
GCTATGATTATATTGGTAGGAGACCACTTCTTTCATTGACATCACCTACACAACCATTTAAGTAATTTTATGAACTTGATCTAACACATTAAATATATAG
TAATTCAATTATTGATGTACTCTTATTAATGTAGCCATGGCAATTTTTCCTAATAGTGGTTAGTAATTATAAATGCTTAATTTAGATGTGTTACTTTCAC
AATTATGTTATTTGATGAAGTAAGGCGATATATAAATTATATGTACACTTACTTAATTTTCAATCAATCATGATAAAAAAAAAAAAAGATTATTATCAGC
GTTTGAAATCACATAAAGATCAAATAAAAAATCATCACGTGCACCGACAAACTTGTGATATTTTGTTCAAATCAGTGTTTTTATTTAATATTTTGGTAGT
TGACAGTTGACACTGCAATTATGAAGAAATGGTAAAGTTAATTCCCTGTTCAAATGTGCAAAAACAAGCTACTTATGTAACGAAAGGCTAAAACTTAAAA
CATTATGTCACGTTGGGTCCTCTTCTATGCAAAGTTGGGCTGGGCCCAATTTTGAGGGCCCAACAAGAAGCATACAAGGTTGTCAGTGTTCACAGTTTGG
TTTGTATCCTTTTTTTTATTAGAATTAGAAATTAGAATTAATTGAATTGATTATTAAAATTATTAAAAATCAAATCAAATCAAGTATAATAGATATTATT
AGTTTGATTGTTGTTAATACTAGTTCAGTTGTTTGATTATTAGTTTTTAAACAATGTCTATATTTTTCTATTATTATCTCTTGACATTGAAGAAACAAAT
AAAGCTATAAATTTTATTAAAATGATAATAACATTAAATTGTACCCATATATTTAATTATGTCATCTCTTAATTAGGATTGGAGGCTTTTATTGTCCATG
CATTGAGTATATGATAATTTTGTGCAAGTTAGAATACTAAAACTTCATCTTTCTTATGACATGAGAAAGACTGACTAATTTTTATGGAAAAAATTATAAG
ATTCTTAAAATAGTTCATAAAAGTCAATATATTAGATATAATTATAAATTTGACTTGCTCGTTTTTTTTTTTAACCAAACCAAATTCAGTTATTGTTAAA
CCATCCTAAAAAAGTGATACTTTTAGTTCGATTTCGAGAATTTGCGCACGAAAGCTTTAATTTTTTTAAATAAAATTTATATATTTGTAAATTAAGTAAA
AAGTACTATAAGTCATAATAATTGATAATTTTAACTGTTCAAAAGATTTATGGAAAACTTACCGTCAAAGATATAGACTTGTTTGAATTTTGAAATTCGA
AAAGTGTCACATAAAATGGGATGAAGGGAGTAGGATAATACTACTATTTTAGCCTTCAATTTTATTATATTTAGTGCTTTGAGAAATGTGTTAGTCTGTT
AAATACTCCATCCGTCCAGAATTGTTTGTCATGATTTCTATTTTTAGAGTCAAACTATAAAAAATTTAATTAACATTTTAAAATGTATTTTTTCATCATA
TTAATATGCAAAAAATTGCATATTTTTCATACAGTTTTAGAATGTCTCATTTTTTGTTTAAAATATCGAATTAATGTGATCTAATTTAATTTGGAAAATT
AGTCATATTGACTTTCGAAAAGTACAACATGACAAACAATTCCGGACGGAGAATATAGTATTTAGTAACAAGTATAAAATAAAAATTTAAGAAAAATTAT
CTTCTAATTTTTTACATTAGATGATTATTTTTAGTATACTAAATAACTATTGTTCGACGGACGAATATATTTAATTTAATAATCATGAAAAGTTGCACCA
CTTAAATACTACACTCCCTTGTCGGTGCAGAATTTAGAATTAATTAAGTTTAGTTGCTTGTGGCGCAAGCAGGACCACACGTACGCTTCGTGCATCTTAC
TACATCACATCGCAATTAAAACTTTCCCTGGTGAATAACGGATCTTGCGTAATAAATGAGATTATTTCTTTCTCAATTAGAGATTTTAAATTTAAATTTT
ATATTTAAAAAAAAATTACACGTAGGAGAATCGACTCCTCTCGAATGGAGTCTTATATGGCATGAATTCAAAATAGCAGGGCCATGCTATGAATTCGAAA
TAGAAAAAAAAAGGTTCCTACTATTTTTCGTGGAAAAAAATAATTATATTACTCTCTTTCCCTTTCCTCACAAGAAATCTAAGAGAAAAAAATTATATTA
AAGTTGATTAATTTAATCTCTTACTTATTTTTTTTATGAAGGTGTAGTTATTGGAGATTAATTTACATAATACAATGAAATACTATATTAGGAAAGTGAC
GCAAAAAAAAAAGAATTGTTTATACTTTCATTTTGTGTTAAAAGTATCTTTTAGTGGATTGTTTTAGCTCAAACTTTTAGGTGCAACTTAAGTGGCAAGA
TTGAGGCATTTGAGAGGTTTAAGTGTCACGATCCAAATCCGGGCCGCGACTGGCACCCACACTTACCCTCCTATGTGAGCGAACCAACCAATCTAAACCT
TAACATTTCAATATAATATAATAAAAAGTAATGCGGAAGACTTAAACTCATTAAATAAAGACCAATTCATTAACTTCTAAAATTCAACATCTATTATTCC
CCAAAATCTGGACTCATCATCACAAGAACATCTACGATCAAACGACTAAACTAAGAGTATTTTAAAAGCTAAAAATACATAAGAAGCTAGTCCATGCCGG
AAGTTTAAGGCATCGAGACTTGAAGAAGAAGATCCAGTCCAAGCTAGAAGCATTAGCTCACCCTGAATTTCCGATGCAGTAAGACTGGCTTGAATTATTG
TTGAGTTGAAGACGATGGCACGTTTGCTGCACTCCACAAATAAACAAGAAGAAAAACATAAAAGTAGGGGTCAGTACAAACCACGGGTACAGAGTAGATA
TCATCGGCCAACTCAAAATAGGGGACAGTATATATCAAATATTATCGTAAATCAACTATAAAACTCAACATATAGCAACAACAAGTACTATAATCATCAA
TAAGTACCATCAAGTTCATCCATGAGGGCTCAAGTCTCAACACCATACTCATTTGGGAATTAAGTTTATTAAGTTGAGTATATTATCATCTTTCAAGATT
CATTATCTTTCCTCCTCTTGTGTCGGTACGTGACACTCCGATCCCCTACTACTATGTGTCGGTACGTGACACTCCGATCCCCTAATTCTATGTGTCGGAA
CGTGACACTCCGATCCCCTACATGTGTCGGAACATGACACTCCGATCCCCTACATGTGTCGGTACGTGACACTCCGATCCCCTACATGTGTCGGAACGTG
ACACTCCGATCCCCTACATGTGTCGGAACGTGACACTCCAATCCCCTACATGTGTCGGTACGTGACACTCCGATCCACTAATACTATGTGTCGGAACGTG
ACACTCCGATCCACTAATACTATGAGAGGTTTAAGGTTTTACTTATGTAATAGGAAAATGTACGAGTATTCCCTCAATTTATGCCGAAAATTTTAGAGAT
ACATTTATATTATACTAAGGTCCTATTATTTCTCTGAACTTATTTTATAAGTAATTTTCTACCCCTTTTCAGCCTAAGTGGCACTAGCTTGAAAAAAAGT
CAATCAGTGTTGGGCCCACAAGATAGTGCAATATAGACCGAAATGGGGTTGAAAATTATTAATAAAATAAGTTCAGGGGTAATAGGACATTAGTATAGTA
TAAGTGTGTGTCTGAAATTTCAGGCATAGGTTACCCCGAAAAAAAAGTGGTTGAAGAAGTTATTTATATAATGATACTATGCTCCCTGGTTTCACTTCAA
TAATATGAATATTATATTATGTGTTTGAGGTATTCAATTGAAACAAATTATAATTAGAATATTTAAATAAAATTTATTTGACAAATTTAAAAATTTGTCA
GATGTATTATATATATAGCTGAAAAAAAACCCTATTTGTTTGGAGATTATATGCTGCTACATAAAGTTCTGTTTATTTTAGGTTTCGTTAGTAATTAGTT
GATTTTTTTCCGAATATGAAAATAGCAACGCAAGTCAAACTGATTGGATATTTCTTCTTTTTATAAAAAAAAAATAAATTGAGCTAATAAAGAGGCTTGG
ACGCCAATCTTGTCAAGATTTCATGAATACATTTTTACCATTTAATTTTATATTAGTTTGTACTAATTAATTAAATGTTTTAAACAATATAAGTGATCAA
TATTTTTGTACCATAATAATTTTTTCAAGTCGGAGAAATTTGAAGGGATACTTGTGAGTTACGACACTAATCACTGGACTAAGAAATTATTAGAGAAAAT
AACACTGCCTGCAATTAAAAAATTTAAGAGGAGAGGAAAGCAAGATATAGAAAACTTTATAAGATCTAATAAACAAGTAGTTATATATCCTAAAAGTCGA
AAATTTCTTATTTCAATTTTTTTAAAAACTATGAATAGTCTGGGAAAAAAAAAACTTTGAAAATCATCTTAATGAAAATCTTGATGCTTAAGCATTAATA
CTAGGGACAAACCTATATTAGAAGAAAAATCTATGATCTAATTGATTGATCAAAAAAAGGTTTTAATTAAATCAGTAATTAGAACTGTCAATATGGGTTA
ATCCATCTCATTCGGGCTAATTCATACAAGCTTTGACATTTTACGGATCAGGCCGGACTAACCCATTTTTTGTGTGGGCTGGAAAATGATCGCTCCAACC
CACAAGTACGTGGGTGGCTTGCCGAGCCAGCCCATTTTTTAAAAATTATAAATATTTTTTAATTATTATTAATTTAAATTATAAATTATAATTTAAATAT
ATCATCATAAATATCGACAAAACAATATTACACGAGGTTGATGTTACTACTTGTTAATCAAATTGACAAATAAAATTGTCTTTATAAAATATTTATTAAG
TTAAGTTACCATTTTAAAAAATAAAAAAAAAATCTATTAAGTTTTTTTAAGTATAAATATTTAAATAGAAATATTAAACTAATTGTTTTGAGTTTGGACT
TTCGTCAATTTTAAATTTTAATATTATATTACATTTTTTAATTAAATTTTATTGGCCCACAAGCCAGCTCTACTGGTTTTTCTCAAGCCTCTCAAATCAA
CATGTTTATTCAAGCCCGGGCTAAAAGTTTTTTTATTAAATGAGCTTCAAAAATATTAATCTAGTCCTACTAAATTTCAGATTAGGTCAAGTCGGCCCAG
CAGACCTAATCCATATTAACGATTCTACCATAATTAATATCATAAAAAAAAATTTAAATGTATTTACAATACATCATGATTACCCATGAGTGACGTATAC
ATATATGTCCCTTTTTTGTTGTGATAAATTATTTATATTTTTTTAAAGTACCTTTTTTAGCTTCAAGAACTCTGGCTAAATGCAGAATTTCTGGAAGAAC
AAGATGATTACAATCAAATGCACAAATAAACTCAAATTCAGTAATGCTATTGATTGCTCTCGGCCTATATTTATACAATTTTTAAATACGTCAGTACAAT
TAACTATACAAATAAACTCAAATTTAATAATGCTATTGTTTGCTCTCCATCTATATTTGCACAATTTTTAAATACGTCAGTAGTGAGTAAAATCTTACTT
ACTCTTTATTCAACATTTGTTATGCTTTTGTCTACGTAAGATTTTTTATCTTAAATAGAGTTATATATTCGATCTCCTAAAATATATTATTTTGAAAATT
TCAACTCACTTTTTGACATTTTTTTAAGAAGGTTGGCCGTTGGTGACTAGACTACTACTATATTCCATCATTTTTAAACAAGTGGTTTTTTAATTTATTT
GTTGTTTTGTTCTAAAATAAATGATGTTTTAGATTTTTAAGAAAATATTGATAATCTTTTAATTTTATGCTTTGTTAAATAAGAAAGTTTCACATAGCTT
AAAAAAAAACTATTAAAAGATTACATCTTTTTTCGAGATATGTAATTATTAACTCTATGCTGATAAAAATTTTTTTATTTTTTTAAAATAAGTAAGCAGT
AATTTCTTAAGAGGTGTGTCCAAGCCAAAAAATACGATTTATTTAGAAACTGAGTACCCACCCAGCTGCTAGAATCAGCATATTATAGTAACTTTCTGCT
AAAGATATGCTTAAATCAAAAAGAAATTTCATTTCACTTGCTTCATTGTTCCCTCTTTCATTAGCAAACTTGCAGACATGTTTCTAAAATAAGAAAATTC
AATTAGTGGACTGGATATCCTATGGACAACATTGAATATAAATCCCGAAGAAATTCTGAGCTACGAGAATATCACGTCATTTTAAGAGTATTTTTAAATT
ATTTTAATTCAACAATTATTAATAAAGTCAATAATTTCGAAACATATTGAATGAAAATATAGAGAATGATGACATGGGATTCGTTATATTGTGACTTTGT
TGGTCTACGACTTATTTACTAATTTTTATCCTTATCTTTGAGGCATATATATAAAAAAAGTCAATAGACATGTATTATTTTCACTTTTATTGAATCTATA
TCCTTACAAAATGATGAGAATTTTAGGTTAAATGTGTTGGATTTAATAATTAATATGGCACCACATGACATAAACTAATGACTATTTTATGCATTTACAA
GACCTTTTAAGTCAATTGGCTTCCCATTTACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGGGCGTCAAGGGTTCATTTGAACCTCTATATATTTGTTCATATACTATTTTTCAACAACTTAAA
TCAAATGTGAGGACAACAACATAAAAATATACAAAAATTGAACCAAATGAAACAAGTAATACCATAATAAAAAAATATGATTATTAGACTATTACTTTCA
CTAATTACTAATCTTCCATCCTAATAATCGACTTTCATATTTTTTTTTTAATTTTGAAATCATTTTCCTATTAAGTTACAATAGACGGTACGCTGTTTAA
TTATCGCAGACTATATCATATAAATCGTAAAGAAAGGAGGCATTATTTTATGTAAATTTATTAGAAGCAAATTTAATTTTTATCATGGTGATCTCAGAGT
TGTCTTCTCTTTTTCCTGGTTCTTCCAAAATCTAAACAGTATGCTTATATTAGTCTTCCATGACAATATTAGGTCGAACAATCAAACAATTTTACTAATC
TAACCACCGGTAGATGAAAACTGCCCCTTCAAGACTACCAATTATCAATTTCAGATCGATTATTTTGATAACCCCTTCCCCTCTCTCTCCTTGAGTGACC
AAGGGAGGGAGAGAGAGAAAAAAAAAAGGTGATTTTTTTTGTGTATTCTTGAACTGAAAAATGCAATTGAAATCTGTCAACACATTTGCAATCACAATCA
TGTTGGGTTTTACACTTATCATTCTATTCTTCTCTGGATTTCTTGATTTCCCACTTCACACTTCTTCTTCAATCCCATCAACGAAAAATCAAATCTTGAC
CACCATCTCAGTTTCCGAGCCCGACCCTTTTAGTAACTTGTTGAGCACTTTTAAGAAATGGGATTCTCAAGTGGGTTGTGCTAAGTTTAGGGGGGAACAT
AAAGGGTTATTAGGAAATGGGTTGTTGTTGGATTCTTCTTCTGGTTCTTTGCAAAATGTTGATGATGGTGAGTTGAAGTGTAATGAGCTAAAGATGGATC
ATGTGAGTGTATTAGTTAAAGGGTGGACTTGGATTCCTGATAATTTGGATAATTTGTACTCTTGTCGGTGTGGGCTTAGCTGTTTGTGGACTAAATCTTC
GGTTGTTGCTGATAAACCTGATGCTTTGTTGTTTGAGACAGCTACTCCTCCTGTTGAGGTATTCTTCTTAATCAGTGTTAGCTCTTTTATCCAAATGATC
ACTCAATTAATTGTTATTATCTCGGGAATTCATGTTTTATCAATCTTAGCATGAATGAGTTCTTTGTTTTAATCAATAGTGATAATGCATCTAGATAAAC
CTATGTTTCTACTTTGTGGTATTTCCTGATTGTGTGGATTTTGGTTCGTTACTGTCTGAGGCTTTAAACGTCTATAATCCCTATGACAATGTCAGCTTAG
CTCCAAAACATGACAGAATGAAGGCAAATGATCTATTAGCCTGATAAGACTAAGTTGCCGTTTTACACTTACATTAGTCAGGTGCTTGTGAAGGGCTTCT
TATTCTGCTTAGTGTACGCCCGTGTGAAATAAACGTGATACATAGAGAAACTCTGGTGTCATAGAACCTCATTTCTCGTCAAAAAATGTAGCAAAATGCA
AACAGATGACTCATGTATCCTACACCCTACTAATTTGGGTTGAGGCAGGGTCGGAAAAACTTCCTTCAACCTTGAAGGTATGCTGCTGGCTTTGCGCAAA
TGAAAGGATCTCTCCAAATAAAATTGACGAAATGTCTAATATTGTAAGATCAATATTGAACCTTGCTGGTATCAGTATATGATTTCTTATGCCCTCACCA
AATGCTCTGAAGAAATTATCTAACTATGTTTAATTATGTGAAATCGATATATGTGAGTGCACTAAGCATTTTGAATTATCTACTTCTTATCAATATTTTT
TCTGCTCATGTTTAGCTTCTTGTTAGTGGTTACATTCTGGGTCGTCTCCATCCTAAATTGGGTTTTGACCTGACATACTCCAGAAATACAATCTTGAAGC
GTCAGTTCCTCTTCTCCTCAGCCCTGCAGCTCGTTGCACATCCTTATTGTTAAACTTTCCAAAGCTAAATAGTGGAGCTTGCAGCTATGATTTTTCTTTT
TTGCATGGAATGGAAAATGAAACCTTTTGGCCTTCAGTTTTCGGATAGACTAACCCACAGTCACTTATTACTTACGTCTTACATACATGTCTCATAGACT
ATTGTTTTCAAATAGAACCTCAAGCAGCGATCTTGACCAACCAAATGGTTATCTTCCACGTATAGTTATTAACGTATGGAAAGAATTGAAAAAAATAATA
ATTTACCCTTTACTTGTAATGGTAGGATGATTATCCGGCTCTCTATGATTTTGGTAAAAGATACACCAGTGACCAGGCCCAAATGATTCATGATTCTTTC
TTAGTTTAAATCTTATTTATGTATAAGGTGATCAAGGCCTTTCATTCAATTGTGATGAAAACCTAAATAGTTGTCCATTGTACTTGCTATGTTCTGTGAA
ATATTTTTGCTATGAATTGTTCCAACTTACCAATTCGTAAGTCTACTCATACAATACTGTGACCTATGCAAAATTCAAGTTCTTTATATGACTATTTTTT
TGGATTCTGCACTTTTTTTTATGTTCTGGGATATAGGTATGTGCTGTAAGAACTTGTTAGGAAGTTAAATGCAACAATAGTTGTTGGCAGCTTGTTAGGA
CATCAAAGATAGCTATTTATTCTCATAGATGTTGAAGTACAGGCGGATAGAGTACCAAGTTTTTATTTAGTGGTCTTGCCACTTCTTCACTTTGTAATCT
GCAGAGATACTCTCCGCTGGACCTAAGACTTAGTGCTTAAGGTTTCACTTCCCCCAGTTGATTCTGTTTTTGCAGTTCAAGTTTCTTTTTACCTTTAATA
ATTGTATTCTGTATGATATCCACATTGCTGCTTTCGATGCTATTATTAGAGGATATGTGGGATGAGTTATTCGTCCTAAAAGTAGATTCTTTTGGTTTGT
TATGGTTTTTAAGCACCTTAGTCAATCAGTAAATCTTCCATTCTTTATTTTCTGGTCATGTTTACACGTGAAGCATTTCTTTCTGTGAGGAGGTTCATCA
TGTGAGAAATGCCTGATCTATCTTCTAGCTAAGTTTCTTTCTTAAGAAGCCGCGTTTATCAGAGAAATAGTCTCTGTTGGAAAACATACTCTGATTCTAT
GAAGTTACGCAAATTATATTCAAATAGCTGTTATTTCAGCATTAATCTCTGGTCTATTCCCTCATCCTTTATTTTTAAATCTCTCCATTTAATGGAGGGG
AGAACTACCTTTCTTCTTTGCTGAGATCCCCGCGGTAAATCTGAATTACGTAAAACTTTTACTGGTCGCACACAGTATGCATTTTTTTCTTCACTCCAAC
CTCCTCACAATTGTTATTTAACTTATCAGAGACGTCGAGGTGATCCATTACGTGTATACATGGATCTTGAAGCTGGTAGAAAGAAATCAGGGTATGAGGA
TATATTTATTGGCTATCATGCAGAAGACGATGTCCAGTCAACCTATGCGGGCGCACTTTTTCATAACAATCGGAATTATCACCTTTCTCCTTATAAGAAC
AATGTAAGTCAAAGACCACTTTGTTCCTTTTAATTTCCTGTACCATATTCAGTCATTGAGCTTAATGATATTACTTACTTATTCTTTACAGTGCTTGTTG
TAATCTCCAGTGATTTGTAAATTTGTAGGATACTCTTGTTTACTGGTCTTCATCACGTTGTCTTCCTCAAAGGAACCAGCTTGCCAAACGTCTACTCAGC
TTGCTACCCTCCCATTCATTTGGCAAGTGCCTGAACAATGTTGGAGGTCTAGACAAGGCACTCTCATTTTATCCTGAGTGTATCAAGGATTCTAATGAAG
CACCCAAATGGTGGGATCATTTGCATTGCGCAATGTCACATTACAAGTTTGTCCTTGCGATTGAGAACACCAAGACAGAAAGTTATGTAACAGAGAAGTT
ATTTTACGCACTGGACTCTGGTGCAGTCCCCATTTATTTTGGTGCCCCGAATGTCTGGGACTTTGTACCTCCACATTCAATAATTGATGGAAGCAAGTTT
AGCTCTTTGGAGGAATTGGCCTCGTACGTTAAGGCCATTGCTAATAATCCAGTAGCTTATGCAGAGTACCATGCTTGGAGAAGATGTGGCGTGCTGGGTA
ACTATAGAAAAACACGGGCAGCTAGTCTGGATACCTTGCCTTGCAGGTTATGTGAAGCCATCAGTAAAAGAAATGGAAGAAATGCAAAAGCCTCTTGACT
ATTCAACAGCAAAGCTACAGGGTACTAGGCTTTAAATTGTGTACTTAGATCAACTAGTGTTGTTTCTAAACAGTGCATGTCTTGTTAGGACTTAGGATAT
AGTGGCTTGTAGAGATCTCAAACCCTTACAAATTAATACTACATAAATTTTGGTCTAACAAAATTGAGCATTCGATTTCCACCAATATTCTCCTTGATCT
GTTCACAATGGCGTATTTTTTGAACCTAGAATTCGTCTCGTCTCCAGAAGTTAATAGTAGTATCAACTTTTTTGCTGGTAAATTAACCTATTCGGGGAGT
ACGGTTTAAGTTGGGTTGTTAAGTGTCGTCTCGTTTTCCTTTGGGATAGGCTTGGGTATCTGTGTTTTTTTCGTAGTTTCTTCTTCTTCGATTTAGAATG
TTCATGTAATGCTTTCCTTACTATTTTCCATGGCTTTTTCACTTTTGTATTTTATGTGTCCAAAAACTGCTTTGAGAATGCATTTTTTTTCTTTTCTTGA
TTTGAGTTGAAGGTCTATCAGAAATATAGAAGCACAAGCACCGAATATGAACAATAAAGAAGCCTTTTTAAGAAACTCGCACTAGAGACCACTGAACACT
TTCTTCTTTTTTCAAGCATCCGGATCTGAAACCAAGCTTAAGATAAAATAATCACAACTATGGAAGAAGAGGAACCACATGAAAAAAGCTTTCTTTGATA
CAATTCGATGGGAACTCAATTAGCCATATAGTATTATGAAGTACAAGGTACACAATATGTTCCTGATATATTCAAAGACAACTGCAGAACTGATAAGGCA
GAGGCCAAGTAACAATCTCATGACTAAGCCATTACTAAAATACATACAGCTTGAGACTCTTTAATGAAAGTTTTCGGCATGAGCAAAGAAAGCTGGCAAC
TAACCAAGGATTTAACTAGGCAACGAGCATTTTTTCTGAGAATGTCCCAACATATGGCATCGACCACATTGAACGACTCTCTTTGGACGCTTGAAACTCT
CTATGCGAAGAACCTTCTTTTTGGGCCTGCCAGGAGGACGTCGGGTTTTTGGTGGTCGAATTATAATATCAACATTTGCTCCCCCACCGTCTGTACCCTC
CCCAGCCTCATTCCACAAGCTCCTATCAGGAATTGGATATATCATTTGTGAATAGGTTTCACGATAACTGTGGACCGTGAAACAAGGCTCGGCAAATAAC
TGGGCATTCTGCCCACAAGAGATAAGTGCAGCAGCAGCATGTGCACACGGCACACCAAAGAGTTGCCAACGGCGACATGAGCACACACGACTTCGTATGT
CCACAATATTTGTCCTCTCAGTTGATACAATCTCAAATTCAATTTCATTTGCTCGTAGAACTTTATAGCAGCGAGCATCAGCAATTGCTTCTGAAATTCT
CTTTTCAGCAGATGGCACGAGTATCGATGTCCACCTCATGCCCATATTTCGGCGATCATTAGACCATGATGTTACTTGTTGGCGGATGTGCTCCATCATC
TGCACAACAGGAAGTTCATGACACTCTAGTGCCCAGTTATACAACACTTCTGTGATCCCCAGTGAAAAATGACCATATCGTAACCCTTCAAAAAATGCAA
CAGCCCACTGCTGCGGATTGTAATGGTGAAACCATTGTAGCACATCTTGTGAAATATCTACCATCTCGGAAACTTTGCTCTCAAACTCAGATGTGGTTAG
TGCATACACTGCATTCCAAAAAATGTTCACTAATTTCGAGTTCTTAAATGTATCTCGAAAGTTTTCACTGATATAACGTAGGCAATAACCATGAAATGCA
TTTGGAAAATGAGTCTCAACTGCCTCAACCATACCAGCTGATCTCTCAGAAAGTATAGTAAGTCTTGGCATACTGTCCGTATTTACACCCAGAAGTTTGC
GTAGCTCCGACATAAACCACATCCAGTTCTCATCACTTTCCACATCGACAACAGCTATTGCCAAAGGAAACAATGTATCATTAGCATCAACAGCTGCAGC
ACAGAATAACAAACCCAGGTACTTCCCTTTTAAATGAACTCTATCAAGTTCCAAAAGTGGCCGGCAAGCATTTAAAAATCCATAAATTGCTGCACGATAT
GAGATAAACAGTCGCTGGAAACAATTCTCCTGTCCAGTGGCAATTGATGCAATGCTCCCTGGATTAGTCTTCCTTATCTGTTCACAATATGCAGGAAGAA
GCTGATAACCTTCTTCAAAGGTTCCATGTAGAGCAGCCATGCTGCGCTCCTTACCTCGCCATGCTTGCATATAAGACACAGCAACCCCATGTTGACTCTG
GATATCCTGCAAAATCTCCTTTGGTTTATACTGAGGATTATCCCTCACCCGCGATTCAACTGATCTTGCAACCCAACCCACCGATGCTTGCTGATGGTGA
AGGCTCTGAACCCCCTCACATGTATGCTCACCATGAAGAGTCCTTATCGTAAATGTAGGAACTCCTGGACATTTTGACACATGAACACGCCACGGACAAC
CCTCTTTGGAGCACTTAGCTATGAATCTACTCCTATCTGACTTTACTATTCGAATTTCAAAATGCAACGATATCGCTATCTCTTTCAAAGTCCTTCTACA
AGTATCAACATCCGGGAACTCTTGCCCAATCGCTAAAGGCTGGTCAATCAACACACTATTAGAACTGGGTACTACAGTAATCTGCTGACCGTTTGAATCA
AGTCCTGATCCTAACATCTCACGTACCGATTCCAATACTTGCTCATTCGTATGAGACCCCGATCCTAACATCTCATCTACTGATACCAATACTTGATCCC
CCATAACTCTAAATACCTTTCACCTTGTTGCTAAACTCAAACCATCCCTCCTTTCACTTCAACCAAACTTTCCAAATGGGTCACTGATAATCTACATATC
ACTCCAAATTCAGTATCTACCAAACGACAGAGGTAAAAAAAACATCAAATGGGTATCATTCAAAACTCACCATCAAACCATCAAATTCAAATTCTCATGC
TTGCATATACACATGATACCATCAAAACATCAAATTCAATTCTTATGCTTCCATAGACACTAATCATCAGTAAAAAACTATACATTTAAAAACTACATAT
CCCATTAACAAACAAAAAATGCAGCTCAAAAAAAGCTAAAACTAGTACCATACAAGTCAAACTCAAAAACAATTATCACATAACACAAAAAATACAAAAC
AAACAACTACAACTCAATTCCAAACACAGAAATCCCAAAAAATTACAGAAAGGGTTTTCATGTTTACCTGAGATATACTGCTGCAATTGTTGAAGAGATC
TAATTAGGACACAAAAGATGGACACAATTAAAGAGCTGAGCTATATAAATGGATACAATTGAAGATGAAGATTATGAAGAACAAGATGAACAGTATAAGA
ATGTAAATTTGATGAATTTGGAGGGCAATTGGAAAACCCTAAAGTTGGAAAAAGATATGCAAAATATTTTCTCACAACGGCGAGAGAGAGGGTTAGTTGG
GGAATTATGGATACAAATATGTGACGTACAAACAGCAAATAGTTCTAATGACATTTATACCCTTGAATTTCTTGGAATTTGAGTGATGTTTTGGTTTAAT
TCAATTATTTCATTTTTTGAAATTAATTGTTAGTGAAAATCTAGACTCTTTTATAATTTATAGTAGGAAATTGGATTCTACCGTTGAGATTGGACGAGTC
AATTAGTATACGATATTTGAAAAGTATAGCAAAAATTAAAGATGTTTCATTAAAAGACTTACTTTCCCCGCCAATTCAAAATTCAAATATAACTGAAATA
ACTTACTTTTCGCGGCAATTTAAAAACAAGCAAACTCGGACGATCAAATCCTAGTCAGCACTCAACAGAATAGTGTGGTGCGGTGCATAGTAACTTACGA
TATTAAAATTCAAATGTAACGAAAATATTCAATTTTGTCGTCAATTTTAAAACACACAAAACTCATGTAATTCGATCCTAGTCAACAGAATGACGTGGTG
TGATCTAAAGTAGGAATGTGAAGAAGTTCAAATGTAAGAGTAATAATCAACTTTCCCGACAATTTGAAACAAGCATAACCCGCGTGGTATGATCCTAGTT
ACAGAATATGGTGCGGCGCCATAGTAAGTTACAACAATAAAATTTAAATGTAACTGAAATAACTAATTTTACGTCTATTTTAGAAAAGAAAAAAATTCGC
AATCCTAGTTAGCAGAATGACGTGGTGTGACGCAAAGTAAGAATGTTGAAAATTCAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTTGTTCTGGAGTGGCAAGGGAAGACAAGATTGCAAT
ACAGTTACCCAAAGCAAACCACCTGAAGTCCATCCTTGCAGGACTAACGTTTCCAATAAAGTAACCTCCACGTGTAGGCACAAAATCAAATACCCACTCT
GGGATTGAATCAGGAATAACATTAAACTTATTTACTGCTGTGTGAGAATACTCTTCAGTTTTATAGCGATATATGTCATTTAACTGTTGAAAGTCGAGCC
AAAAATAACTTCGCATATGATAACTCAAGGCATGCAGGCGCTTCACTATTCTCTCAATGAATTCTTTCCCTTCTGTATCGTGCTTCAACATGGCCAATGC
AGATCTCAGTGCCATGAAGAAGAGAGCTTGGATCTCAATAGGATATCCATAAACACCCTGAAAATCAACCACAATAAAAATTAGTATCCAATTAATGTCT
TTTCAAGAAAAAAACATCAATCATGGATCCTAAATTTTGGAGGCAAGAAAAAGTTGTGTTACTGTTCTTTTAAGCATAAAAATCTAGTCCTCTAAGAATG
ATTAAGGAAACTCACAAGGGCGAGAATTTCAGTCTCTTAGATTAGATCCATTTACTATTAGAGTTTTCCGATCATTGTCAGATATCAGACAAAACAATAG
AGTACCATAAATAAAAGGTTCACCTCTAGACATTCATTGACTTGAAAAATTAAAATTTTTAAAGAAATTTGTATGTCACGGATAACTAAGCTGGAAGAGA
AGCTTCAGAAATGATGAAACGTAGCAATTCAACGCATGAGGTATAACCAGAAACGGTTCAATTAGGCCATGTTATGGTTTCTCATTCTTAAAAAAAAAAA
CACTAAAATTTCACTAGATAAGCTGCGTTATGTTTAATTTTCTGATAAGGCAAAAGTTTTATTAAAAGGGTTCCAACAAGGTACTAAAAGGTTACGTAAA
CAACATAAAGCTTTAGAAAGAAAAACAGACTACTAGACTGTTCTATCTAACAATTCCAAGAAATCCATTAATTGGCTCAAATCATATGGTCGCACATTAT
GCCCATACAAAGAAGTAGGAAAATGTAAAAAGTCAAAAAGTTGAAGAAAAGGGAGAGGAAGACAAGGAGTTTGTTTCCCCTTCAACAAAGAAGAATATGA
GCTGCGTGACAGCCTTTTAGGACTGAAACAGAATAAATCATCTCATTCCTCCCTTTCTGATTCTCTATTTTCTTTCAGCTTTATCATTAATTCCGTTCTG
ATTGACTATTCCAAAGTCAATAAAAAGCAGTAACTGCTAAAGACGAATGGGTTGTAATTTTCACAAAAGTTACTTGTCTGAGAAACTAGTAGATTAGTTA
AAAGCTCTAAATTCAAACATCAAGAGTGTATGTCCAACGCTTGAACATAAGTTATGGACCAAAATATCAATATCCTGAACAATTGAACAACAATTGTCGG
GGAATATTAATAGCTCAGGTGGTTGGTTACATGAACTCTAACAGAACATCATTTGAAGAGGCTAATGATGCAAACAATCTTTTAGGGAGCCAATGATTCA
AAATTTTACTGTGTTATACGTTTTGTTGACAAATCTCCCACAAAATTTAGCCTGATCTGAGGGATGTACAAAGTGCTAGTTTCAACTTAGAATAGAGATC
TACACTAAAAACATTCACTGAATTCTACTAGAGTCTAAAATCCATTTACTATGCATTAGAGCTCATGTCACATTGTCACAGGGACAAAGAAAACAAAGCT
AAAGGTCACTAGACAATCTATTGCAAAAGTTCATTTTCCGACTAAAAAGTTTTGTATAACCATGAAACATAAGATGAGAATGCATAGAAGAACATAAGAA
TACACATCTAAATGAATCCTAATCACAAAAATTGAAAGAAACTAACTCCTTATTTATAAAACCAGCTTCAGCTCTTGTTGCTTATAAATTGCTCCAATCA
TCTACGCTAAACAGGCTTTATATCACAATGATAAGAAGAGATCCAAATATATTGAGAAGGTATGATGACAAAATGTATTACCATCCTCCTATCAATCATT
GAGCATCCATCAGCACATAGCAGAGTTGGAAATGTGTCGAATCCTTCAGACAAACACAAGCTCAATATAAGTCTCATCCCCTTTTGGCACTCTGTTGTTT
CAGAGAGACTGAGGTCTCCAGTAGATTTTGTGTAAGCACGGAGAAGAATTATCCACCAAAACCCAGAATCAACAGGAGCAACTCTTCCAATTGCACTCTC
ACCAAAATCTGCTACTATGGTGTCTGTCTTACGAACAGGATCATGAAGAACCTTGAAACTAGCAGGCATAACCCCTTCTCCCAGCTTGAATCTATCTACT
CTTTTTTCCCATCCCTGAAGCTGAAGTGTCTTCAACAAGAAGTTCTTGACTATATCTGGCTCTCCATTCATCAGGAAGGCCAAAGCACTAGGCACAAAAT
CTCGAACAAAAACCTACACACCAAACGAAATCTTCACTAGATAAATAATCTGATAAAACAGATATTATTATACTCCTTATCACATCACTGTACCTCACTC
CAAACTAAACCCAGTTTCGGCATCAATATGACAATATCCCAACATTAATATGTATGGCATCAATAATCAACGCACATTTTTGTTCAAAAAATTCATACCT
GATCATAGTATATGATACCAATATTATGCAAATTACTAAATCAAAATCATAAAGAGGACCAAGATTCTGTAATACTTGGATTTCATATTACTGACCTGAT
CATAGTTGAGGACTTCTTCAGAGGCATGGTCAATTGCCGCTATTGTACCGACTGGTTGACCACGAAAATGAACCATAGTGCGGCGTAGAGCATCCCATGC
TTCAGCAACCATCGGATGGGGCTCAAAAGAGTTCCGGGCTGATGAAACTGGGGTGTCCAAGACTGATTGGCCAGGTGAGGCACTTTCATAATGATCTAAA
CCTCTAGATAGGCCAATGGACAACTCACTGAGTGACCTCTCATCAAAAGATCTCTTCCTCTCTATGTTTAGCCTTGGCTTGTTTAGAAGCTTAGAGAGAT
CATAATCATCTATTTCAGAAATGGAGCAGTTGGAGCCCACATTTCTCAGTCCAGTTTCTTCCATGGTCACCTTAAACCTTCAATCCTCCTGAGTACTCTG
TATCATAAACAATAACACCTTTAAGAACAAAATACAGGTTGCAGCTCCATATAGAAATACAAAATTGTTATTTCTTCTTAGGAAAATAATGCACCCTTCG
GTTCAATTTGTTTTGTCTAGTATTGACTAGGCCCTGAGTTTAAGAAAGTAAAGAAGACTTTCGAATCTTGTAATCTTAAATTAAAGATATATATAGATTG
TACAAAAATGACTTTTAATCTTGTGGTCTCAAACATGTTGTGTGGGAAGTTAGAACTAAGGAGTTGCGGAAAACGGAAAAAGGGATTTTTTAAAAAAAAA
ACAGATTAAAAAGGTAAGTAAGACAAACAAATTGAAAGGGATGGATTAGCTACCTGTCAACCCACTAGCACTCTGGGTCGCACTGAAAGAAGGAACTTTA
CACACACAATACTGGTGTTTGTGAGCATGCATTTGTATCAATCACTTAACTATGCCCAATGGCAAATTAGTTAGATCGGCTATATGAATCCATTCCAGTT
CATCCGGACCCACTTTTTCAATACTCAGAAGTAATTTAAGGGCACACAAATAGATACATAGACGCAAACATACATACATGTGTGTGCACATTCGCTCAAG
TATGTCAAAAGACATATACGGAACTTCAGAAAATCACATATAACTAGAAATCATAAGCATTAGCCCCTTTATACTACAATCCAAGTTGCAGACCGATATA
AAAACACAAACTTGATATCGATCTATATTACTTGATAATTCTCAACCCACAAATATTATCTCGCATAAAAAGGAAAAGGTGCTTTTATGTACATAAAGTT
GGAATATTTAGGTGCACATATGTACACACACATAAATAGATGGTCAGGAAGTCCAGAAAATCACTTAGTATCAAAACCCGGGACGAAAATTGTACAGAAC
ACGAATCTCTGTAACATTATGGCTCAACTGAAAGCAAAAAGCGAGTCGGTAAACAATAGCCATCATCCAAGTTCCCAACCATTATACAAAGGGAGAAACA
AAGTAAGAATAATAAGGATTTCACTATTCAATCTTATCCAAAAAGACTACAGTATCCAATAAGCAATAATGCAGGTCACTAGTAATTCCATTCCCATAAT
CAAAATAACCTTATCCAGAAAGAAAAGAAGTACACACATTGAACTGCCACTATTACCATAAATCAAGCTGTTCAGATTTCTTTTCCTATAGAATGATGTT
AATTTTAGAAAGAACAAAAACATTGGATTCTACAAAGGAAGCTCATACAAAAGATCAAATCTCCATATCCCAATTCAGAGAACAAGCTGCATATTACAAA
CTTAAGATCCAAATATAATGAAGAAGATAACATAATGTAAATAAATTAAACACATAGTAAAAGAGCTTTCTGAGAAGCAAATTAGATCTAGAGCTGATTT
TGCACAAAATCAACAATACACACGCAGAAAATACAAGCTTTTAGAGGAAGAAGATAAATATGCAGAGAAATATGTATAAGAGAGAGAAAGAGAGACTACC
TTAGATAGAGAGAGAAATGAGAAGAATGGAAGATTTTCCGACGATGATGATGGCCGGAGCGCCGGCGAGATCGCCAGATAAAGAGAGAGAAAGAGTGTGA
AGAAATGGAGAAGAGAAAAAAAGGGGCCAAATGTTAAGAGGTGTTATTTATAGACTAGTAGAATTAAAAAGTTTTGGCTATAGTGGGTCCTACATACAGC
TGGAATATATATTTGTTTAGGATAAATTGGCAATTGATAAGTAAAAAAGGAAATAAAAAAATAATGATTTTTACCCTTTTGGCCTTTCAAGAAGTGTATA
AAAAAATTATGGAATATATTATAAGTATATGGAGAATTGGAAGGTTGGTAAAGGAAATTAGGTGACACCAACCATGAAAACTAATTTAAATCACAACTAA
CATATCGAGTGCAATTCTACAAATAAAATTTAAAAATAATAGTATATAAATAGTTTTACTTTTCAAATAGAGGAGTTATTTTCGATAGATAAATTTTTTA
CTCAAACAAAAAATATAAAAATAAATATATAAATACAACAGTAAAGTCAATTAAAATAATAATAAAGAAAAAAGATATTTCTTTTATAGAAAATAAAATA
AAATATTAGTATAAAAAGCTACCAAATTTGAAAATAAATAAGGGGAAAAAGAATATTGATAACTTTTTGCTCTAGTTAGGAGCATAAATAGTTTTTGTAG
CATGATGGATCTAATTATCGAACTTGTTAAGTAATTAATTTTCTATCTTTTTCTTTGTTTACAAAATTTTAATATGGAAATTATGAGTAAACACAATAAT
TGTTCTCATCATAATTTATTTTCTTATTTTTAATTAATGTGAATGTAGAACATATAAATGTATTTTGACTCGTTAGATTTTAAGAATATGGTTGGAAAAA
AATAAAATAAAATATTCTTTTTGAAATAAAAGAACAAAAAATTAATTATAAAAAGAAAATTAAAATAGAACAAGGATTTCCGTGAGGATATTACGGGGAA
TAGCAGGTGAGAGATAGTATCAAAGCACGAGGAAATTGCCGTGGAGCGAAACGACACAGTTTCGACCATTTCTTTAGACTATAATACAACTTGACTTTAT
TTATTCCATTTTTTTTATCCTCTTTAATTTTATTACTAGTATTACTAGTATTATTATTATTGAGTCCCCACTTGGCTGTCCTTTTTTGAATTCTACTCTA
AAAAGTAAAAACTCACAACTAAAAGATTAAAGTTTGGGGAATGAGAGAAGGGGGAGTGAGTAGGTTTTTTTTTAAAAAAAAAATAAGAGTATAATAATTA
TGACTATATATTTAAATTTTCAAATATATATATATATTGAGATTTTAAATCAAAATTTAATTATTTTATAAAACTTGATCTAAGTTTATAAGTTGTAAAA
AAAAAAAATTTAACATTTTTAGTTTTGCAAAAAAAGAAAAAAGAAACTCATGCTCGACATGAGAAAATTATCCGTACTAAATAAAAAATAGATCAAATAA
TAATAATTTACTATTATTGTTGACTAGTGAATCTTTAAAAATATATATAAATTCAAAAGTTTATAATGCAAACATTTTTTTATAAAATAAACACACAAAT
AAATGATTTATTGAAGCAGTGTCTTATGATTTACTATCGCCTTGTTTTGAACTATGATTTAATCTTTTGCTAAAAATGTATAAAATTTGAGAAATTTTTG
ATAATGACAAAACTTGTTTTTTCATGTTAATGAGAAAAAAATACAGCTTAAAAAATTCAAATTTTATATATAAATAAAATTTTGAATTTTTAAATAATTT
GTATCATATTAAATGTCCGAACAAACTCCTTTCTATCATGAAGGAGAAAAATCTTGGAACTATGTGAGTTGTTTTACTTATTTTGTAGTAGTAAGTAAAT
AAAAAAAAATTACTATCTCAAAAAAATTATACATAATTTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGACTCTTCATCTCATACATTTCTAGACAAGACTTGTCGATACCCTAAACTTAGCT
TCTTGAAAGATAAGATTACATGGGGTAACAACTCTTACCGACTCAGTCATACTCCAATTCATCTGGAGTTACCGGTCGTTTAAGAGGGATGATAGACTTC
TTTTCTACATCTCGCGATAGTGCCTTTCTCATATCTGAAACACCAAACAGGAAACAATGGTCATAACAGTGACATCATAGGAGCAAAATGCAAATGGAAA
CTATATCACAGTAAGATGCAGCAACTTACCCAAACCATCTTCCTCCCCTGAGTAATAGCGTAAAACTCGCCTATATACTACGTAATCAAGCTGGAAAAGA
TGAAACAGTTAACAGGATTAATACCAAGAATACATATCCATCCAGATACAACTACAACAAGAGTAATCTCAGGAAAGGTTACTACCTTCTCGTACATCTT
TATAGCTGGTGTGTTTGATGCTCTCACAAACAAGTCCACAAAGTAAGCCTTATCGCTACAAGAATAAAGTCCACCTTAGTGCCAAGCTTGGACAGCATAT
CACACAATTATAAAGATCTAGTAGCCACAAACATCGGCAAAGTTTACAAAAAATGTCATTGTTCTAGCCTGACACTAACTTTATACCATCACACAAAATG
AGTGATTTGATCAAATTAAGCCCGTTATAGTTTAAATAGAACAAAGTTCAGAACTAAACTCTAGGAAGTTCAAAAGAAGAGAAGGTTACTGATCTCACTC
TACACTCCATCATATTATACTTCATGTTATCATGCAAAGACTGGTGAAGCCAAGTAGCAAAAATATTAAAGAGAAAGAAAACAAAGCTGAGCTCCACAAG
GTTAATTTCTGCTATGATGAAACTGATCTAATTGTATCACTTCACACTCAACTTTTATGCCATCACACGAACTTACATAACTTTTTTTTTGAACCTCGTA
ACTTCATAATATAAACTTTTTTTAAAAAAAAAAAAAACTTAAAACTTACTCAGCATAACTATGCCTGGAATAACAAGACTAAGGGAAGTAGGATACCACT
TTCAGTATCCACCAAACTGGAAAAGAAAGGAGGTTCCAGTATCCACTGTACCAAGGTCTGAATAAAAGCACCTAGAAGGCTAAAATGATGTATTTATTCC
CTAAAAAAGGCAAAGGACGTGCATAGATTTACGACCCAAAATTTGCAGTACTTGTACAAGTATATGGTGTTACTATGCATTCATTAAATCAGTTAAGCTT
CTATGAGCAGAATTCACAATGTAACTACACAATTTCTGTAAGCTACAATAACATACAAGGAAGTAAACCAGAGTAGAAATGTCTGTAACATGATTTTAGG
AGGTCTAGTGAAACAAACCACAAGCTAGATTAAAACAAACAAGTGGGAAAACTGTAAACAAACTGCTCATGCCAGGTGAAAATTAAATACAACTCTGTGG
TAATCTGCAAGCCTATACATAAAAAGAACGGTGAAACAACAAAATGATAAATTTGGAAAGATGAATTCCAATAATGCAACCAGAGTTCATGAGCCACAGT
TTTTACACTGTATAGGTTCTTACATCTTATCACTGACTTCTTCCAGCAGGTACATCAATTTCTTGGCTAATTGCTGCCTCCGATATTCAGGAGCCACAGT
TACTGCAGTAACGTGACCATGCCAAGATTCACCTTGCCCTTCAACTTTTCCCATAACTGTACACATGAGCCAGACATTAGTTTTTAAAAAAACAAATGTT
TTCTTAGGAGTAATTTTTCAAAACATTGATAACATACCAAAATGCACCAGACAGTAACCATAATAAGACAACTACATAATTGACATTCTAACCACTTTGT
CGCCCATGAAGAGGCCAGAATACACCAGCCGGTGCCAAACTAAGTACATAATTTACATTCTAACCACTTTGTCACCAATAAAGTCCGACATTTTCCTTTT
TAAAAGAAAACCAACAACGAGTAAATGAAACCTCTTCACGGAAGGGAGTATAAGAGAATGATTACTTGCATCTGCCTTGGACCTAGGATCTGTTGCTGGA
AATTTTCAGAAACATAGTGTTAGCATCTAGGGGAATAGAATTAGTGAAATCCGCCTACACCAGCCCATGAAATCTACTTTCCATCCCCAATTCTTGAAAG
AGAAATGAAATTCAGAATGCTTATCCTTGCCATTCCTTTCTACAACCTATTGTTTGATCTAAATTCAATCAATTTTTTGCCAACTATATGACAAAAAAAA
AAAAGAAGCTATAAAGTCAAAGTTAATGTATACCCTGCATCAAACAGTGCTGCTGAAGAATATTCCTCGAGAAAATCCCATTTCCTCCATCCACCTTTAG
AAAAGAATTTGCTCTTGAAAAAGAAGGTAAGAGTTAGGGGAGAGCTTTAGGCATATTATTTTCAATTCTTGCAATTTTTGCTTAATCTTCAGATTTTCTG
TATTCTTAAAGGACTCTAGACTCTTTCTACTTAATTGGCTCCTATCTACCACCATTTAGTCCTACCTTCAAGCTTATATTTGATATTTCTAATTTACTTA
ACTCAATCTGTATATAAATTAAATAATCATCAGTCGTCTGCTATATCACCCAAAAAAGTGATGAACTTTAAAATCTACACTGGAATAACTCACTGTATCC
CATGATGTGGCCGCCGGGAGCTTTTGCAACATGGAAATAATCCGGCCATCTTGCCATGTAAGTCATATAAAATGACATGTTGAACTGCAGCAGATATTAA
AACTCATCTTTAATTATAACATAAAAGGCACTAAAAATCATGCTAAAATTCATCCAAAATTCACAAAACACTACTACAGATCATGTTAAAACTCCTTTCA
AATTTCAAACAGGCATTCAGAATCATCTTAAAACTCGTTTCTAATTCAGAAAAAAACTACTAACTATACAGTTTTCGTTAATCATTTACAAACAAACAAA
AAACTAAATTTAGGGGAAAAAGAGAGGGTCAATTGGCTTACAGTTTCAGTAAGATGATCCAAATTCACTGACGCGAAGCGAAGCAAGTCATTGCAGCTGA
ATCTACGAATCGTCGTCATGCTTTCTCTCTCTTCTTCGTCTCTTTCTCTCTCTACGGAACTCTTCTGGTAATCTGTAAGGGCGATAACCAGTTAATGGAC
CACCGATGCCCCTTTGTGAGCATGACGGCCCAAAATAGCATACACCCGGCCCACAAGGAATGTTCTTGGTATTTTTACAATAAACTCTAGTTTATAAGAT
AAGTTTTATACGATGATGACCTAGTTGGTTTGGTGGGTGATCATCCGTGTGATCGATTTCATCTCAATGCCTCTTGAATCAAATCTGTCATATGAAACTT
GTCTAATGCGATTATTTGCAGGCTATTACACTAAGGAATGTTCTTGTTAATTTTACAATAAACTCTAATTTATAATATAAGTTTTATACGATGATGACCT
AATTGGTTTGATGGGTGATCATCCGTGTGATCGATTTTATCTCAATGCCTCTTGAATCGAATCTATCGTATGAGACTTGTCTAATGGATTTTTTGTAGGC
CATTAACACAAGGAATGTTCTTGTTAATTTTACAATAAACTCTAGTTTATAACATAAGTATTATACGATGATGACCTAGTTGGTTTGGTGGGTGATCATC
CGTGTGATCGATTTCATCTCAATGCCTCTTGAATCGAATCTGTCGTATGAGACTTGTCTAATGCGATTATTTGCAGGCTATTACACAAGGAACATAATTT
TTTTTTTATGGAGAATTATTGCAAAGAGTCACTATCATAAACTTAATTATATTCCATAGTTATAGTTTGCATATTTACAGGTTGTAGGTACAATTTTACT
TGTATAATTGAGCTACTTTTATATAAACTCAAAGTACAAATTTTTAAAACAAAACACACATATGTAAACTTTAAACAGATATACACAATTTATTATACAA
ACGTCTAAATTGAAGTGTGTGTGTGTATATGTTGTTTGGTGAAATTTTGAGTAGCATTGTATATAAATTATGTTATCCTGTAGGAGATGGGCTAGTTGCA
TACTCTTATTGATCAGGAAATGGAAGGCCCTAGCAATTTGGCATTTATGATATGAAAATATCATCAACATTTGGTTATGGCAGTCAACATCCCATAACTA
ACTAACCGAATTTGGTCTCCCTCTCATTCACTTAATCTGCCTGCATCCCTCCTTACCTTGTTTCTTCTCTACTTTGTTCACACATTGAAGAAGAAAAAAA
AAACAGTAGCATCATTTGTTTCTTGACTTTATACCACTACACAGTACGTCCATCAGTCTTTATGATAGCTAGTAAGTATATTCGTTCATTCTTGACGAGA
GGTTTTGAAATTTACATGACGGCCATAACAGACATCATGATCAAATTTAATTCTACGTCCCATATCTTTTATTTTTTAAAAATTTATATCATTTTAAAAT
TTCTTGCGATTTTTATTAATAATATAATTTAAAAAATGCTTTAGAGGAAATAAGTACAAGCAAGCAAGGAAAGCTAGCTAGGTCTTACCTTCCTAGCTAG
TTTTGGGTGATTGGATTAATTAATTAATTAGCATGTCTTTGACACATGTTGAATAGTGTGTTATTAGGGATCTCATGCTATTGCGTGCTCTGAACTTGTG
TTTACCTAATCATCAGCATGTACTTGCAACTTACCATGCATAAGATGACCATGAGAATAATGATCAATCAGACATCATAATATATATTCAAATCTAATAC
ATATATACATCTAACATATGATGAAAGACATTGAATTTGAGTTCGAATATCATTGGCTGTTAGGTTCGGAGTCCAATGCACAATGCATGATGATATAATA
ATGACCTAGAAAACGTAACGTAATGTTTTGTTACAGTAGGACGTGAAGTTTGAGCCGTAGTATATGAACATGAGTTTGAGTTTCTATGCTAAATGAGTAT
GTTCACCCAAATCCCAATGTGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCAGTTCGATTTTAAAGTTTATCGGTTTGATTTATTAAATATTAATTTGTTGAGATGCTAAATCGTTAACGATCAT
TAAGATATTTGATTATCGGTTATTGGTTTATCGATTTTGATAGTTATCGGTTTGGTTATCGATTGAACCGTTAATATTTGACATACAAAAAAACTATTGA
AAATCACTTAGAAACAAGGTGACAAACCAAATAAATCATGCACGTGAGTTCACATATTACATTTTACTAAAAAAACAAACACTTTTATATTGTAGAATAA
CCAAGTGTTTGAGATAACCAAAAATAAAAGTAGGAAACCAAAGTCTAAGTAAACTTTATATACAAAAATGGTAATATATATACCTATTTAATTTACTATC
GGGTTATTCGTTAATCCGTTAAAAAAAACCCTCAAACTATTAACAACAGATAACTCGATAACAAAAAAATTAAAACCGCTAAACCAATAACCCAATATTA
AAAAATCAATAACTTTTTCCAATTTAGATTATCAATTTTATTTCGATTTTGAACAATTCTAATAAGTATAAGTAACATTTCGGTTTAAAACAAAAAGTTT
CACATAAATAAAACATAAAAGAAATATTAAATATATAAGTGAGCAGTCTTTATTTAAGAAACACATTTTAAAGTTATACAGATCTAAGCCAAACCATATA
ATATCACTTTTAACACAACCATAATGACTAAAAGGTCATGATTATGTTATACAAGTGACAAATGTGTGATCTATCTCAAATTAAGACCCCATATGGTAAG
CAATTCTGGTAAAAAAATAATATTTGGCATGCTTTATAAATGAGATGAGAGGCTTATCCCTAACATAAATCTAAAGTTTATGATTCAATTAATTTTTTAA
AACTAAAATATATAGGATTTTCTGAGTTCTTTAATTTAATTGTTTGATTATATAATACGTACTAAATTTAAGCATTAATGACAGACAAATTTTATAAATA
AATAACAAAATTTAAAGCTGATTTCTTTTAATAATAGATTATCAAAATAATTTTTTATTTACGAACAACTTAGTGATGAAGTTAGTGGTAGTTCCGAAAA
AAAGTATGAGATAGTTGTTTGAAATTATTAATCAATACCTAGTTTGATATTAAATAATCGATCTGATTTTCGGTATATATTGACTTGTAAAATTTTTAAT
ATGAATTCAACTCTTTAACTTTATTATTTTCTCACTGTAGTATCAATTTTCTTTTAAATATAAGCTTCTTAAAGAGAAAAAAAATAATAGATATATACAA
TGTATAAATTGTGTATACTTTATATTAATATTATATATAATATACATATCTATAGACAACATATTCAATCAAAATATTGTATAAAACTATATTTCATAAA
TATCAACTTAGATGATCAAATATACATTTCGCAAGTTTTCGCTTTTCGGTTATATCTCCCCTAAGTCATAAACGCATAATAATAGATTTTCTTTAAATTT
TTGTAACTTGTTCCTATAATGCAGTTTGATTAACTCAACATTCTCAATGAAATTTTAATAAAGAAAATTTCATATTTAAAATTATATATATTTAAAATCT
CAAATTCAATACTTATCATTTTATTATAATCGCACGCATATGGTCCAAACGATAATTGGTACCTAACAAAGTTAGGTGATGTGTTGGGGGGGTTTGGCAA
GGCCCAACTCTCCTGGGTAATTGTGGCACGCAATAGCATTCTTCAACCGTCAATAACGGCATACATGGCTGCATTTGTGGACCATTTTCGAAAATGAAAC
AAAAATCACATCACATACCTAAACAAGATATGAGATAACTATTAGATAAAAAATACTAGAAAAAATTACTTAAAACACATAATTTATTTTTTATTATATT
TTAAATCGTTTTTTATCATTTTAAAAAAAATTATTAAAATCCTATTACGCGATTTATCTACTAAATAAATTATTTTACATAATGTATTGGTCAGATATAT
TATTTTATGATATACCAGGACACACGCGATGTTACTTTACATGATGTATTAATCGAATACATCTCTTTGCGCGATACACCGAAATGTACACAATGTATTA
GGATGTTGAGTTATGTATACAAAACTAAGATGTGATGTATCAGGACCTTAAGGGATGTTAAGTTTTGGGTTGTATCCGAATTCCATCAAATTTAAAGAAT
TTTTGTAATTTGAAAAAGAGTAGAGATAAGATGTAATTAACTCTTAGCACTATGAAATTTGTGTAACATGTACAAAATATTATTCAAATTGGATCCAATC
CAATATATTTACCCAGATTGTATCCACGACCCAAACTATTTACCTAACTGCCCCTTGTTTTATTCATTGAACCATTGCTTCTTCATCTCAAATTATATCA
ATATACTTTAATGGTATCTATATACAGTAATGTCATCAAACAATAATTGAACAATCTTTTCACTGAAACACTGTTTGTTTCTTCTTGATGCCATCAAATA
TACTCTAAGGGGTTGTTACGTTTGAAAACAAGTTAGATAAGATTGGTTATGTTGTGATAAGTTATGTTGGGACCAGTCATAATGGATAAGTTATGATGAG
ATTATTTCTTATTAATTGTTTAATTTGTTGTATTCAAAATAATACGCATTGCATATATTTTAAGAACAAATTGTTTTTATTTATAAAATTACCCTTACTT
TAATTTATTTGTTATTTAGCTTAAGTGCATTCCTATGATGGTACCTATGTATTTTTAAAATAATTTTTTTTCTTATTTGACTTTAAAATAAAATTTTTAT
TTTAAATTTATCAAAGTAAAAGAAAATCTATGTGAAATCAAAATATATATAAACATAAAAATTAGTCAAATAGATTCACATGTAAAAGTTATAGATATAT
AGTATAGTTTTTTAATATAAAAAAATTAAAGAATTAACATAAAAATAACGAGTAGTGAATATTATTATACATGACATTAAAATAATGTAGCAAAGGTGGG
ATGGGTGGGGGAATTGGGAGGACATGTGCTAATATTTTTGTTTAGTAAAAAATAAATGTTTTAGATCTTTACTATAATTTTGTATTACATGCTTTTTTTC
AGTAATATCTTTTGTAAAAGAATTATTTAAGATTCAGGAGGTTGAAGATTTTTAAAAATAATTATACATAAATGTGAAAATTACATACGGTTTAAATGGA
TATATTTGTTATTTGTATATTTATTTTAGAATAAATTATCTTCAAATTACTAAACCAATTATCAAGGGAAGATAAAACTTAAAGTTTTACANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTGAGAT
TTTGTATTTCATTTAACTAGTCAAGTTAAATACAAATTTATATATATATATATATATATATATATTATTAATTTTGAGGTGTGATATGTCACACTGTATA
TTTTTAATTTTTTGTTGGTCAAATATACCTTGAACTTAAACATGGATTTAAGGCTATTTAAATTGTTCAAATACACGAACCTTATTTTTTTTATAAAAAA
ATCAAGTGGTCAATCGACAAACTACATTTATAAAAAAAAAAACCAAAAAAATCAATCCAATATAACAGCTCATACATGGAGAAAAAATTAGTTTATGAAA
TCATCAAATTACATGGAATAAATTTGGAGAATTTAAATGAATATTTATAAATATTTTCATATAAATAAAAAAGAACATTAATTACAAATAAAATAATAGA
AAAAAAATTTGAGGATATTTTAGTCATTTTGGAATCTTTTCGAAGGATTGCTAAACCTTGAATTAGCTATTCCTCCATGTCCTAGGGATAAAATAAGACC
TTGTATGAGGTATAACTAATCTATGGATTAGGTTAAATAAAGTAACCAAACAATATTTTTGTTGGACTAAATTTTAATCCATGGATTCTTTGGATTAATA
CCTCCTACCAAACGGGTCCCGAGAGTCTCGAGCTAAAGTGAATAATATCACCGGTAATTAAAATTAAATAATTATATTTAATGTTAAGAGTCACCTTGTG
TGTACTTATCAGGGATGGAGTCACCTTGTACGAAGTGAGATTCATCCGAACCATCTTCGGCGGAAAATTATATTATTTATACATGATTAAAATATTTTTA
TATGTATGTATAGTAAATGTCGAACCTCATTTGTCTATTTCATGTGTCTATGTCACCAGATTTTAAACCCCCTACCTATTGAAAATTCTCGCTCCGTCTT
TGGAACCTGCTATATCAATAAAGATGTTAGTTTCAAATTAAGAGTGGAGGTGTGTTTTATCCGTGCCTTTAATTCGCAATTATTTCTAGGTGTATAAGAA
AACAACCCTTAAATTAATCTAGTGTTGAATTTTCAAGGAACATGCTGAATTCAATGCGAATACAAAAATAATATTGTTTTTTTTTTTAAAAATAACGTTT
AGATAACTGTATTATTACTCCGTTCCTCTAAAGTAAAATACAAAACGAGGAGAGTAACATAGACCAAACCTCCTACCAAACAAAAGCTATGATGAGTATG
TGCAAGTGAGCAAAAGTCCTCCATAACTAACAAATCAACTTATATATAAAAAAAAAGTCGATTTATCATATCTTTTCCCAATAATACAGATATACATAGA
GTACGGAGCTTAAAGGGTACAAAATATCAACAAAAATTTTAAAACGATATATAAAATTTTATATTAACCAAAACGGCAAAATCGCTGCATCAACAGCGAT
TTACTTCACCAGAAAAAGCAAAATCGCTGCCGAGGCAGCGATTTGGCAAAGTGTGAATTTTTTTTTTTAAAAAAATGAAATCACTACCTAGACAGCGATT
TTAATTTATTTTAAAAAAAGTCGCTGCCTAGGCAACGATTTATAATTTATAATTTTTTTATTTAAGGAAAGGCAGCAATTTTTAAAAAAAAGATTTTTTT
TTTAAAACGTGGAAGTCGCTGCCCAGGCATCGACTTTTATAAAAAAAAAAATTGAAATGTGCAAAGTCGCTGCCTGGGCAGCGACTTGTATAATTTTTTT
TTTTAATTTTTAATTTTTTTTTCTTTAAAAAAATGTGGAAACAATGTGGAAATTTTTTAAAAAAAGATTTTTTTAAAGCAACAATTTTATAAGATAAAAA
AAGTTATAATATTTTTTTTTATAAAATCGCTACTTTAAATTTTATTTTTTTAAAAAAATTATTTGTGGAAAATCGCAGCGATTTACATATTTTTTTAAAA
AAAATTATAAATCGCTGCGTAGGCAACGATTTAAAAAATTTATAAATTTATAAATTGGTTAATATTTTTGGAAAATCGCAGCGATTTTCATATTTTAAAA
AAAATTATAAATTTTTTAAATCGCTGCGTAGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAATATGTAAATCGCTCAGCGAATTTATAATTTTTTTAAAAAATATGAAAATCGCTGCGAT
TTTCCACAAATAATTATTTTAAAAAAATAAAATTTAAAGTAGCAATTTTATAAAAAAAATATTATAACTTTTTTTTATCTTATAAAATTGCTGCTTTAAA
AAGAATTTTCTTTTAAAAAAAATTCCACATTGTTTCCACATTTATTTTAAGAAAAAAAATTAAAAATTAAAAAAAAAATTATGCAGCGACTTGCACATTT
CAAAAAAAAATTTTAATAAAAGTCGCTGCCCCACATTTTAAAAAAAAAATTCTTTTTTTAAAAATCGCTGCCTAAGTAGTGATTTCATTTTTTTTAAAAA
AAAAATTCACATTTTACAAAATCGCTGCCAAGGCAGCGATTTTGCTTTTTTCGGGGAAGTAAATCGCTGTTGATGCAGCGATTTTGCCGTTTTGATTAAT
ATAAAATTTTATATACCGTTTTGGAATTTTTATTAATATTTTGTACCCTTTAGGCTCCCTACTCGATATACATATATATAGCATTTATGGTTGAACTATA
TTACAAATATATATATAGTGTATATTTCAAGAATTTGGAGGACACGTACCCTTAAAAAACAATAATGCAGATTATACGTATATATATTAAAAGGCCCATC
CTTTACTTTTCATCTATATTAATTAATTCGTATAGAAGGGTACGATAATCGATTGTCCGTATATATATACACAGTATATATAGTCCTTTTTTGTATTATA
CCACTTGAAATTATAATTATTAAAGTAAGGGGGGAAAAAACATGAACTATAGGATATAGGATAAAATAATATTTGTACGTTGGGCAATAGTTGTATGAGA
TTCTTTGTGCTTCTGATGAGGGAGCATTTAATTTGATTTTGAGTGATTATAAATCACATGTATGATAGGTTGGACCATGGTGTGTAAGCTTACCTATCAC
AAAATCTCTTTGGATTTTAAATGTTTCATTTTCTTTCAAATAATAAATATCTCTTTCTACTATT