BAC Sequence – LE_HBa0029E19

>C12HBa0029E19.1
AAGCTTGAGGTGAATTGTAACAATCAAATGGCTTTATGGGGAGATTAAAGATTGGATTTTTAATAGATTTGAGGGGTTTTGGATTGTGGGGTTGGGTTTG
TGATGTGAGATAGAGGAAAATAAGGAGGAGAAGAGAAGTGAAGAAAAAGAGAAGGAGATTCTTGGGGGTGAAGATCTTGATTTGTTGGTTTCTTCTCCAT
GAATTTGCCATGGAAAACTCACTTTTTTTTTGAAGAAATTTGAGAAAAAAGATTGGATCTTGAATTGAAGTGAAACTTTTAGAAGTGTGATTTGAACTTT
GAACACTGTTGAAGAAGAAGAGGATTTAATGTGACAGTAAAATATTTCACTAAATATAATAGATTTTAATAATTTATATTTTATTAATGTTGCTAAATTG
CTATAATAATAATGTATGATATATATAATTAATTATTTACATTTTATCACTTTAAAAATATTTAAATTACAGAATTTGCTATTATAATAATAATATCTTC
CAATCTAAAAAGAAAATCATGTGGATACATTTGGCTCTTTTTGCAATGTGTATTGAGTTTGAAAATAAGTAAAATAAAACATCTATATATAAAAAATTAA
TAACTAAAATACATTCATTTTTACTGTTTTATAATTAGTTTTTAAAAAATAATTTACTGATTTGTTTTTTCTTATTCCTAGTTAATGTACAATAGAGTCG
AAATTATTATAAGTTAATTGAAGTATAATGTTTGAATTAGAATTTATCAAAAAATGATATAAGATTTGATGGAGTAAATTATAACATCATCCAAACTTAT
AAATCAAAATTGATGTGTTTGTTGCACGTTAAAGAAAGTCGACTTTGAATTTCAACTATGAAAATTGAATTTTAAATTAGTAAATGATACTAGAGAAGCT
TGGTAAAATTGACAGAAATAAAGATAGAGAGTTTAAAATTCAGAAAAATTAATTTCAATTTCTAATATATATATACATATATAATTTATTCAAAGTTCGA
TTTAGACAAGCCATATTTCTGAAAATTTCCTTCTACAAACAATATATCAAACTTTAGATAAAATTACAATTTTTATACGTGATTTTTTAATTTATTTTTT
TTAATTGAAGTAGTCAAATTTAATTTATAAACTTATTAGTTTGCAACTTTAGTAAGGTCCAAAAGTTGTTAATTATGCACTTGGGCCAAACTTATATGGC
CCAAGATCCAACAAATATAAAAAACTCGGCCCACATTGGTGTTAGCCCATAATCCAATAATGCAAAGCCCATGAATCCACATTATACCTTAATGGGCCCA
GCCCAAAATAAATATCAATTTAAAGACCAGCCACGTGGAGACAAATCCATAAAGAAAAGTGACTATATGAGTATTAATATTAATAATATTAAAATTTGAC
AGTTTTTTTTTAATGAATCGTAGTGTTCTAACTAACTTATTTATAAGTATATCGATTAATTTTATAAAATACTTTTCATTTCTGATTACACAAACGATAT
TAAGTAACTTTATTTATCAGTACTAAAAAAGATGAGAATCATTTAATTTTTTTTGTTTGTGCTAGATTTAAATCAATCAATTTCATTGATGAAAAGATTG
ATTAAAAATGACAAAACTTAAAAGGGGATTAAAGGAGTTTAATAAAATAATATTAGTAGGAAAACATTTTTAAACCTTTGAAGGAACAATTGCTCACCAT
ACAAGTCTAAGCCATTTAAAAATTAAACAAAAATTTTTATTTACCTCCTCAATGTCCAATCACAACCCTCCATAGTATATAATAATGCATTAATAAAAAT
AAATACATTTTTAAAAAAATAAAATGAAATGATTGTGCTTTTTTGCACCTCTTTCTAATTTAATTACTTTGAAATTACTAGTTAAGTTTAATAGATAGTC
AACATTACATTATAAACTATTTTAGATCGTTTTAACTTATGACAAAATTTATAATTTAGACGTATGAAATTTGTACATTTTTTGGATGAGTATTATAATC
CTCATTAAATTTTCCATTTTTTTTCTTCAACTTATAAATAAAGTGTTGGCTTTGCATTCTTAGAATGGCAAATTTTAACTAAAAATCAAACTTAATTTGT
ACTCCATTTCTGACATATATTCTTATCTTAAATTGTTATAAAAATTGTCAACTTGTTATGTTGCTTTGTTTTCAATCTTTTCCCACAATGGCAAAATTCC
CATTTATAAAATTTTTTTAAAAAAATATTCATTCTAAGATCATATCTTAGCACATTTGCCATTGTAAGTTGTGTATATGTATCTTCAAAACACTAATAAA
AATTTTCGATAATCTGACAGATATTGTTATTTAGCTGTAAAAAGATCATTACTAATTCCATTTTTATTATTATTAGTGTTTATTTTCACATAATACGTCT
AAAGAATCAATACCTTTTTCCAAGATTATACTCATTACTACAATTTTTATTTTTATTTTGAGAAATGCAACTTCTTTTTTTTTTCTTTTTTTCAAGAACT
AATGTTATAATTATTTTTGGATATGGCACAGATAATTAACAATTTCCAATGTGTTCCTCTATCTCTTCATATACTATGGTAAGAATTCTTGAAGCTCATT
TATCATCCTATTTATTCGATTTTATGTTCAGCATTACTGGTAAAATTATTGTCACGTGACTAAGAGGTCACTGGGTTAAGCTGTGAAAACAATATAAACG
CCTCTTGCAGAAATGCAGGATAAGGTTGTGTTCAATAAGTCTTTGCGTTCTGGCCCTTCTTTGGACCTGACACATGGTGGAAGCTTAGTGCACTGAACTG
TCTTACCCTCTCGTTTATTAAATAACCATTTAGAATCAAAATAACAATAATAATCTTTTTTTTTGTTTGTTTGTAGAAAAATTTGGTTTTCTTGTTCATT
TTAATTGGCTTGTCAAATTCAAGAATATATAGTGCAAGTATATATGGATATCCAGGAAGTTTTAATGTCCTGGATTATGGAGCTGCTGCTGATGGCATAA
CTGATGATTCTCAAGTAAGTTAACTGTTATATATTTGTTCCTTCCTTTATTTGTCCCGATTGATCCAGATTCACATCGCATAAGGCTTATTAAAAGAGGA
AGTGTTCCTGGTTGGTGTCCCACCAGTGGCGTACACAGAATATTTAGTGAGCGGTATCGATGTTTGAAAATTAATAAATAGTAAATAATTGATATAATAT
CATTATATAAATAAAAATGATTTAAAACGTAAGTCAAGTAAACTACTAAATTTTCCTCAATGAGTTTTCATATTTTGAAGTGTATTCATAATAGTCTCAA
TGGATATAATCCTAAGTACTAAATATTCTAGTGTAATTAGTTTATTTTACCTAATTTGACGATAAATAAGAGGTTGAAGGTTCGAATCCCTATAATATTA
ATTTTTTTTCCTGAAAATGTCTCAAAAATAATAAAAAAAAATTCGGCCTTACTGGGACTCAAACTTGAGCATCGCCTGAGGAAGAAATTCAACCAAGTAG
GTCGGTCGACACCCCATGATGTAGGGTGGGTCCGCCCCTGTGTTGCACCAAGTGTCTGGTACCTATATTGTGGCCCCCACTAATCTAGATTCACACCGGA
TATATAAGACTTATTGAAAGAGAAAGTGCTCATGATACCTATATTGTGGCCCCCACTAATCTAAATTCGTGTTGCATAAGGTCTACAAAATGGAAAACAC
TCTCGGTTGTGGGCCCCGACTAGTCCGAGCTATTGCCATAACCCATGGAATGGAAAAGGCAAATAAAATATTTGCATATTTTCGTTAATTCATGAACATG
ATCTATAATGTCTATTAAAGGGGAAATTATAACACTCTTGGTTGTTCCCCAGTTAGTATGCAATAGCTCCATTGGATCCTGACTAATCTGGATTTGCATG
AATCACCCCTAGTTCTAATGTTCACTAACGGCATTGAGGCCCCGGCCTATCTAAGGGCGAAACTTCTCCCTACAATGATTATCTTTTTTCATACACAGAC
CTTGAATCCAAGACCTTCGATCAATTCTTCTTGTTTGTATTCCTTCATTTTCCACTAAATATCAAATATATTTTATTTTTTTTGCTCTAGAAATTAAGGA
ATTAATTTTTTTTTTCCAGGCATTACTTAATACATGGAATGATGCATGTTCATCCTCAGCTGGATATCCTCAAGTGATTATTCCTCCAAATATGATATTT
TTACTTAGCCCTATGACACTCATAGGCCCCTGCAATTCACAGAACATCTATTTTGTGGTATGAAAAAAAAACAAACATAAACCACTCTTTAATATTCCTA
ACAGTTTAATTTCTATACACTGACGGTTAAAAATAACCAGATTACTTAAAATAGACAACTCACTACAACAAACTAGTCAGTGTATATAAGTTAAATCGTA
TTTGAAAAATGTTTGCCCAAGTGAACTATGTGAATTTTCGTGGCTCTTGTAGGTGTCCGGTAGTCTTGTTTCACCGAGCTCACCAAGTGTATGGACCGGG
CAAGACTCGAGTCAATGGCTAGCTTTCAGAAATGTTAGCGGTCTAGTTGTTGGTGGCTCAGGAACCATTGATGGTCAAGGCAAAAAATGGTGGGATCAAT
CATGTAGATACCACCCTGAACTGGTATGTCATAGATGCACTAACTTTCTTTCTCGATAATTGTAGTGTCTGGATCAGCTTGTGTGCACCAGTACATAAAC
GAATATTAGTTCTATTATATGGTCTTTGACATGGATTGATTATTTTTTTTTCCAACTTTTCAGGATGGATGCACAAAATTAGCTCCAACTGTAAGTACTT
CTTGACAATAAGTCGATTTTACATGAAAAATGTTTTTCGGTGTTTGGTTGCTGAGTGAAAAATATTTTCCGATATAAAGATAAATAATGATATATATTAG
CACATCAAAGAATGTTTTGCGTTCTAAATGACTTCTGTCATACCAAAAACCTATGTTGCTCAGACGTTTCAAAAATGTTACCAAGTGCATGTCTGATCTT
CCAAAATCTTCCAAAATAATGTAAAGATCTGACAAGATCGCGACAACATTGTTTGTTAGAGTCCGAGTAACATGGCTATGAAAGAATTTAAAGAGAAGGT
AAAGAAAATTGTTAACGAGTAACAAGTTAACTTAAATTTTTTCACTTCTTATTGCAACAACTACGTTTCAGTCCCAAACAAGTTGGAGTCTGCTATATGA
ATCCTTGTTTCTACGCTTGTTCCACAGGCGTTGAAGTTCATTTTTTGCAGTCAGAGTTCGATCAGTAACATGTACTTTGCAAACAGCGCGCAAACTCATA
TACTTATAGAGAGATGCAATGGTTTCAATGTCAACAATGTAATGATTCAATCTCCAGGAAATAGTCCAAATACTGATGGAATTCACATTCAAGCTTCTCA
AAATGTGGCCATTACAAATTCTAAAATTAGTAGTGGTAATCTTCACTTATCAATTTTTTTTTTATTTTTCTTGTGTTATACTTTAATTTTGTCATGTTTT
TGACTTGATTTAGCTTTGTGATTTACAGGAGATGATTGCATTTCAATTGGAGATTATTCTTCTAATGTCCAAATATACAACATTCAATGTGGACCAGGTC
ATGGTATAAGGTTGTCTTTACTTTATCCTGTATCCGCAATCCACTGGCCAGACTAATTTAGATTCGTGCTGGTAGGTTAACTTTGTGTGTGTGTGTGGTG
GGTGGGGGGGGGGGGGTGTTGAGAACTCTTTACCCGTTAGTTCTATATTCTGGGCTCGAACTAGAGACCTTTGGCTAAGGACGGACAGATGAGTGATCTT
AGTAAGTTAAAATAGGAGTAGAATCCATTATTGCGCTACGTTGCTCAGACTCTCCAAATTGTTGCCACACCTGTGTTGAATCCTCCAAAATGCACTATTC
GTGGAGGATCTAATACACATCCATCAGCATTTTTGAAGAGTCTTAGCAACATAACTCTCGAAATATGCACTGTGCCACATAAACTGGGACAGAGGGAGTA
GTATGTTTTAACTTCTTAACACTAATGAAATATTTTTACTCTGCTTGTATTCAGTATTGGAAGCTTAGGAAAAGGAGGTCATTCTGCTCAAGTATCGAAC
ATTCATGTGAACAATGTTTTCTTCTATGGAACTACTAACGGAGCTCGTATCAAGACATGGCAGGTATATAAATCAGACTTAGCGTATGAAATAATTGAAC
TCAACAGCAGAACAATACTTTTGAAACATCAAACATGATCATTTCACTATGTATCTATATTACCTGTCGATAATGCTGGATTCAGTTGACTGTATATATG
CTCCATCCGCCTCTGGCTATTAACTTCTTACTAATGTCATGATGTGAATAGGTTGGCAGAGGCTTTGTCCGAGATGTCACGTTTGAGAATCTTCAATTCA
ACTCTGTGAAGAACCCCATCATAATTGACCAGCATTACTGTGATGTTCGAGGGGCTTGCAAGGAAACGGTAAACACAGCTTGAATTCCGTATTCAACTCT
TCAGAAATGCTGACGGAAATACATTATCAATACTGTTTCAGACACAACTAGTACATTTTCCAAAATCACAGTTACTCAGACATCTTTTCCCTTAGGCAAA
ATCCGTGTCGGATCCTCCAAATATAGTGCAGTTTTAGAGGATCCGATACGGATGCAACAACATTTTGAAGAGTCTGAGTAACATAGATAAAAACTTACTT
ATGTTTACACCAAATCAATAAATGTATGACACGTATCATGTAGCAGTAAGTATCTTTCTGTTCTGTTGATGAATCAACTGTATCATTAACATTTTCATGA
TAGGGAACTGGAGTGCAAATCAGCAATGTTGTTTACCAGAACATATACGGAACGTCGATCACGGATGTCGCGATAAATTTAAACTGCAGCATGTCTGTGC
CATGTACAGATATAACAATGCAGCTTATACAACTAACACCAGCAACACCAGGAAAACAAGTTAAAGCTTATTGTAAGAATGCTAGTGGACAAGAATATGG
AATCGAACCCGGTCCTTGTCTCTCTGGAATTTGAGATTTTACTTCTCTCAGAATTCATTGTTGTGTGCATAACCTGAAAAGGAGAAGAAAAGTGAAACAA
AATGAAGAAACTTGTTAGTGTTATAGTATAGTATATATGGTCAAGATCCATTCAAACATACTAACTATTGTATATCGCAATTTTTTGTTTGGTCTTGATT
ATAAGCTTGGACATGTGATTGGTAATTGTCGTCTCTATTGTAACATTTGGATATTCGATGGAAAAAGATAGACTTGCAAGTGGTTATCGATATGATTGTG
CACAGTTTTTAACATAATTTATCTGAATGGTAGTGATTTCTGCAAAATCATGAGGGATTGAGCCTAAACACCAGCAATGTACAAGAAATAGTTGTTCAAG
GCAAGGGAAGTAGTCACTCGTGGCTCTCCAATACCGTCTTCATGTTCAGCTGCAACAACTTCAAGTGAGGAAATCCTTCTTCGACTACTTCCTACTCATC
TCCTTCGTAGACATTCTATGATAGTTTAAGGGACTCGAGTTTAGGCAATTTACCAAACACTCTAACTGAAACCTTGACTTGATCTCAACTGACAACTAAA
CACTCCAACTCATCCCTATTGTGTCTCATGGACACCTCATGTTGACGTGACACATAAATATTACTTCTTGCCTTCTGCAATAGCACTCAAAACTCTAACA
GTTCATATCTAGACACCTTAACTTAGTCTACAAATAGACGCTCCAACTCGTCCCTATTTGCATCTCAAGGACATGATCAAATGCTGACATGACACATAAG
TATTGGTGTGTAGATGATTATTCTGTAAAATGGAGTGTTCAACTGACATAGTAGAAACAAGTTGAGGTTTCTAGACGTGCATACTCAAATTAAAGATCAA
ATGTTTACTTGCCAACTGACCAAGTTTAAGTGTCTATTTATATATTATGACAATGTAAAATCAACAATCTGGAGTATTTACAAAACTCTGACAAACGGCT
ATACTGAAGATCATATACAATCAACTTACAGGCCATTTGCACTCACACATTTGGCTTCACTAACTTCTATTTGTCTGTTTGCTTACAAACTCCAACAACC
AGACCTAACAGTGGGAGTTTTTGAAACAGCAAATTTGTAATCTTAACTCGCGATAATCGACTCTTTTTATGTTGTGAACGTATAAAATCTCCTGAAAAAA
AAGAAGATATATTAGATTTCTCATAATTAAGGAAACAAGAGAACATAATTATCCTACTATCTAAGTTGCTATAATATGTATGTACAGCAAACAAGCATTA
GCCTTAGATCTTAAGGATTAAGATGTCTAACCAAGTCCCGCGAGTATAGACCTTAATAGAATCTCCATAGTTGTCTTCATTGTCCTGTTGAATTTGCCTG
GCTGAATACTCGAGAGATTGAAAACCACAGGTTATATCAATTAGAGCAAGTGTTGTTATATCTGCAAATTCTTGAGGGATTGAGTCTAACTCAGAGCAAT
CATCAAGAAATAGTTGTTCAAGGCACGGAAACTGATCACTACTGGCTCTCCAGTACTCAATATTTGTACTACACAGTAGCAAAAACTTCAAATGAGGAAA
ACCTTCATCAGCTACTTCCCACTCCTTGCCGCTGAAGGAATGATCTATTACTTGAAGGTACTCGAGTTTGGGCAATTTACCAACAACGCTCAAATCCTTC
CATGGCATGATTAAATGTCCTTTAAGAGTTAAACTCTTAATGTTTTGTGGAAAAGCATCCGGAGGAGGTAGAAGAAAAGGAGGAACATCAGCTGCCGCTG
TATTGCTGTTCAGAGACCAATATTCATTACTATTTATAGGAGTAAGAATGAAAATGAAAACCAATTCCTCGGGCTGATCTAAGTAGCGAAAATCATACAG
CTCCCTGCAAGTATGAAAGTCTTCTCAGACGCCACCTAAGTGCAACTTCATTAAGTTGGGAAATAGACTAAAGAAAGATGGAGTACAATACCGAGGATTC
CATCCAGAGAGAAATTTCAAATTTTTCAAAGCCGGACCATTCTGTCTAGGTTAGGGATTTTGCAAGTAATTCCAGGGACAATAGAAAGATCTCAGCTGCG
GAAGCATTAAAATAGACGATGGTAATTTGAAAGGATAGAATTGGTCCGACAATGAGGTGGAAGGTGTAGTATAAAAGTTTGCAGATAACATAGGCTAGAT
ATCGATGGAGGTATGTCTAGTTGTGATAAATCGAACTCTACTTCGGGATATAAAGAGCATTCTATTATGGGATTAAGACACAAAGCTAGGTATCTCAAGT
GAATTAAACAAAGTATTTCACTGGGAAAATATGCACATCGAAATGAAGCAAGATTTAGTACTCTTACTAGCTTGAAAGTTAACTCTGGCACGAAGCATCT
GAATGTACCAAACATAACAGAATGAGCCTCACTATTACTACAGCTAAACAATTCTTCCTCATTTTTGATAATGATCCCACCTCGACTCTTGCAGGAATAC
TGCATGGACTGCGGACATAGATTTTGATCAATCTTTCCTCCGGTAACATTTATTTTTTGAGCTTTCCTCAAGCAGAGTTCATGAATCATATCGTGCATTA
TACAACTCATGATTCTTCCATCAACACGTATATAAAACCGTGGAGATTAAACATCTATCAGCAAGTTCTTTTAGACATTTTTCCGCCACCTCTTCTGTGC
TTTTCATCTCTTCTACCTTCAAAAAGCCCTCTACAACGCATAACTCCACAAGTTTATCTGCATAAATCAGGTTATCCTTCGAGAAAATTGCAAAATATAG
AAAGCATGGTTTAGGTGACAAGGCAAATGATGGAAACTCAATGCCAACACCTCCATGCATTGGGATTCAACATCTGTGCTTACCAATGAACTTACATTCT
CAGAAACACTTTGTCATTCATCCAATGTTTTACCGATTTTGGAGAGAAGTCCAGCGATCACAACAATTGCTAGAGGCAAACCTCCTCATTTTGAAGCAAT
TTCTTTCCCAATTTTTTCAAATTCAGGACGAAAACAATCTATCACAAAAACCTTTTCATACAATAAACTCCAACTTTCGTCAAGATTCATGAGGCGCATG
TGATTAGGAGGCTTACCTGAGCTAGCATATTCAGCCACTTTCACATTCCGAGTAGTCAAGAGTATTCGACTTCCATTATCACAGTCTGGAAAACATAGTT
GTATATCATCCCAAGCTCCAGTAGTCCATATGTCATCAATGACTACCAAGTATCTCTTGGTTTTAAGATTTTTTGCAGTTAATCTGCTAGTTGGTCATCA
GGTTCATCACTTTTCCTAGAAAGAAGGCTTAAGAGTACATTTCTCACACAATACTCTTGCGAAACAATAGCTTTTGCACGAATGTCAAAACGAGACATAA
TGCGTTGATCGCTGTAAAGTTTTGTAGACAAAGTTGTCTTCCCAATGCCTCCCATACTGACAATCGAGACTACTTCTAGTTCCCTCTCTCTGCTATCAAG
TTGATCCAGCATCATCCTGCAATGCATTTTCATGGCCAACCATTACATTCTTAAACTCTTAAGTCATATTGAGATGTACTAGCAAAAGTCAATTTTTTTG
CTTTTAGACTTCTTCTTTCTGTGTACATGTTCTGCATCTCCATCCACTTGTTCATCATTGAATCGATACGTCCCACTGCTCGTTTCAAGGAAAAATAAAG
TATCCAAGGAGCTATTTTTCGTGAAATCAGGTTTCTGTCATTTCTTGATTCTGAGTCAACCATATCTTCTGCACTGTATGCTAGTTCCGCGATTTCAGCT
TCTAAGCTTGTTAGTGCATCAAGATCACCTGTTATATAGCAGGATTTCTCCAGAATCCCTCTTAAAGATTCGAGCTTTTCATAGAACGGATGCAAATCGC
GTCCAGTAAGTTGCATTGATTGATGTATGGTTCTCATTAGACATGTAATAGCAGCATAAGACATACCTCTTAATTTCTGCACAAAGAAGAAGGCACAATA
TCTCTCAGTATGAATTGTCACTATTTGTGTAATTTCTCAATTCACAAAAAGCAAAAAATTCAAACTTCCATCACATTTCCAACTAGGTCCACAAGAAGTT
AGTTTCACACTTAATAATTTCAATAGTCAAAATAAAATTTACAAATGAAATCCCATGTGAAGCATGATAATTCTTCTTTCTTGTATTCCCTCCGTCTCAT
TTTATGTGAAAACAACTAAAGTGGTGATGCTAGTTTCACGCGTCTTTTTTTTTTCTTTATCGAGACAACTACAAGTACAACAAACAAAAAGAATCAAAGA
GAATGGCTTTAACTTTTTCCATTTTCAACATCTTCTATTTAGTTTGTCTCCAACATTGATTTTCTTTAATAGTAAGCAGAGCAAAATTAGGGGGAAGTTA
GAAGAATGTAGACTTTCATTCATTTGTTGTTTTATTTTCTGCATTGTCCATCAAATCAGCACAATAGTTGTCTGGTTATTCACACAACAAAGCACTATTG
CTGCGGAAAAAAGCCGTTACCTACCCCATCATTTTTACACATAAGAGATCTGAAAAACGTATATTATTCTATTCAAATTGTAAGTGAGCAAGAGATCTCA
TTTCCTTAAAAAAAAAATAAGTAATATAATAGACATTTTGAACAATTAATATGGAAAAATTAATACAAGAACAGTAAAAGTAAACTATATAGTCACACAA
AAAATATGTTTTAGTAATTAACCCTTAACATTGTCCTGTTCATCATCATCATCCTCATCTTCTTCTTCATCGTCATCGTCATCATCATCATCAAAAAAGC
TAGCAACAGAAGAGGAGAAATGAAAATGTTACACTTGCCAAAATTAAGGATGGCCCTTTAACTTGGCCTCAATTAGCACCAATGTATGTCTTACGTGGCT
TAATACACGTAGGACGCAAATTGCCACGTAGGACACTACATAGGATGCGTATGTCTACTTGTTCAACTTTATACAAGTTCAAGTAGCTACTTGTGCACAT
CGAGACTGTTGGATATATTAATTCTTTCCAAACCAAATAAAAAGAATCTAATACAAGGCATAGCACTAACAATATATAGTTTGGAAGCACAAATACAAGA
AACAATTATAAGAAGTAAATCAAGGAAGATGTCTTACGAACCATCACGGATATAGACTTCAATAGAACCTCCATAGCTGTCTTCAATGTCTTGTTGAATT
TGCTTGGCAGATTTCACAACAGCTTGTGCACAGATGTTTATATCAATTAGAGCAAGTGTGGTTATATCAGCAAATTCTTGGGGGATTGTGTCCAACTTCC
AGCAACCTTGAAGAATCAGTCGTTCAAGGCAGGGAAAGTGATCGCTACTGGCTCTCCTCCAGCAACTTGTTTGAGCATCATCTCGAGTTCATTTTCATGG
CCAAACATTATATTCTCGGGCTTCTCTACAGCATGTTCAGGTATACTAGCTGCTAGAGAAAACTTTCGTGCTTTCAAATATTTGAGTTTACTGTACCAGT
TCCATATTTCCAATCACTGCATCATGAGGGAATCAACGCGTTCTACCTCTTGTTCGGAGGAACAACAAAGTTCCTAGAAAGCTCTTGCTTATTCCTTTGC
CTTTTGTGCAAAAAGAACATTTCTTGATTTCGAGTCATAATTAAGTTATTTTCTAAAGACGACTACAAAGTTTGAACCAAAATTATATGGTTTTGCTGAA
CCTGATCCTATACTCTAGCTCCACCCCTAATTGTTGGTGTTCGCCGTAGTCAAGTAGGAACTGCTGAGTGAAATTCACATCTAAATCTTGAGAGAGACAA
GGATCAGGTTCAATGCCATTGGCGTCCCTACAATAACCAGTGTCACAAAGGCGGAGCTAGCGAATAATATACGAGTTTGATTGTGAACTCAGTTACTATT
GTGTAGTTAACTTGAGATCGTTTTAAGAACCCATAAATTTCAAATCCTGACACATTGACAGAACAAAATATTTCTCAAGTTACGACGAGCGTCATTTCGT
CTACATCTAATCATTGGAAGAAGACATCAATGCATGAGGAGCTGTGAGTACACAATAAGAAACATGATATTTTCATGTTTTTTCTTAATCGTGGTGTGAA
GTTTAGTATCAGATGGCATTTCTGATATAGTATCATCTGCTAGTTCATGTAAACAATATTTATCAAGCCACACAGCAGTGGTATCAAACTGCATAATCGT
CATTTAAAAGATTTTTTTTTTATATCCGTGGTGACCAGGCCAAGTTTGTACGCATCTCGATTAATTCCACGGGATATATGTTACCTTCCATCAGCAATAG
ATATCGTGGATATATGTTACCTTCCATCAGCAGGATATATGTTACCTTCCATCAGCAATAGATATCATGGATATATGTTACCTTCCATCAGCAATAGATA
TTAGGTAAGTCTATCCACCAAAGGTTAGGACAAACCCAATGGCTTTTTTTATTTGGTCTCTGCTAGGATTTGAACCTGTCGTGGTTCTCAACCCACTTCA
TTGACCACTAAGCTACACCCTTGGATACGAAAAGACTATTATAACCATAAAACTTGGTTTTTTGAAATAAGAGATTGTGTGCTAAAAATGGATGAACTTC
ATTTCGAACAAAGTTTCGGACCAGCAAAGAAGCTGAAAGAAACTAAACAAATGGTCCAGATAGAATGCCAGGAAACTAACTAGATCTTCAGAAGCAATAC
AAGTGCAAGAAAAAGGAAAGCAAGGTCTTTTAGATTTAGTTGTTCATGATATAGTACAACTTGAAAACAATATGAAACTAAAAAAGACGACAAAATTCTG
ACCTAAAATTGAAATAATAAAGTACCTTTGTACCAAACTTCCTAATACGAAGGACTTCCAGACCTTTATATAGAAGTATAATTGGCAATCACTAATTCAG
TAACTTAAAACCTGATATCATTGATTACTGAATGTGCCTTGAGACCTAGACATGAGCAGTGCCTTCGGTGAACTTGGGATCTTCACATCTGTACCTTCCA
TCAGGCCCAATGCCAAAGCCCTTTGGATCAGCAAACACGTTCTCGAGCAGCTGGCTACGAACAGGATGAGGGCTTTCATCGGCAAACTCAACAGCTTCTT
CAACCAGTTCATCAATCTTCTTATCAATGGCCTTCAACTCTGCTTCACTTGCCAGGTTGTTCTCAAACATGTACTTCTTCAAGGCACTGATAGGATCTCG
TGCAGCATAATGGTTCTTTTCAGCTGCCAAGATGAACAGATTAAGGTCAAATAAGATAAATCATTGGCTAATAATATGTAACAGTAAAAATGATAGATTT
CAGAGGCTAATTCTATTATAAGCTGTCATAAAATTTATAGCATTTCAAAACTGGAGTTCTGTCCACGAGAGCAATTTTGTTGTGCGTAGTTTTCTTATGT
TGTCTATAATCTATACACTTCATCCGCCGTATACAAATATGGGGTGACACTCATACTTAAAGTTTTGGTCTTAAATGGAAGCAATAGAGATCAAAGGGCG
AAAACATTCATTGCACACACTTTACCAGTGCAATAATAGATTTTCTCACATTACTTAAGCATAGCAATTTCCATAGTCTTCAACCAATTTTTGACTGTCC
GATAGATCAAAATGCAGATATCATGGTATTCACTAGTTCTAACTACAAACAGCACAACAACTAAAAAGCAAAGACTCAACTCCAAACTAGTTGTTTTTTT
TTCTCAAAAAGGGTCAAAAGTGTAATGAAATCACATTTAACAAAGACTACAGAAAAGCTACACGAGTTTTATGAGATAGACTAATAGAATATAAAGAGAA
TGTAATGGTTGGTACATTCAACAAGTTCAAAATATATGCTAAAGCCAGAGTCTGGTACTACTAATACCAGTCGCAGTATACTATAAAGAAATAAAGCTGA
AAGGATTAGGAAAATATAAACTAAGTACACTAGAGACAAAAGGGAATTGGAATTCTCACCAGGGTCACGAAGCTCATCTGGATCGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACTAGATTTGC
TTACAGTAAGTGAATTAACACAAGCAAATACAAAAATAACTACGCTGGTCCAATTTTATATAATACTTTTACTAGCGTTAGAGCTTATTACCATTTTTCT
TTGACTACAACTTTTGGAACATTTATAGATATTTTTCATTGCGGTAAAGATGTGGCACTAGACCCTAACTCAACCCCATGAACTAGCTCTTAAGGGAAGG
ATTGTGCAAGTCCATATTAGCAAATCATCCGTCTATTCCCAACCAATGTGAAACTCTAACACACTCTAACACCACCACCCCCTAACATCTACGCCCAACT
AGAACGTGGACGCGAATCCCAAATATGATACCTAGCTGCGGAGTCCGCCTTCCCTTGAAAACACCTCCCAGAGGGGAGGTTTATAGTACAGATGTACGCT
AAGGAATATTATTAGTAAGACAAACGTATAAAGTGCATATGTACTATAGCTTCAAAAGAAAATAGATCCTTATTCGGGTGTTCTAGTGGTGCCCCCGTCT
GGTCTACTATCGTCTTTTCACCGCCGGTAGACTACTTTGGCCCACCAAATAGCACAGAGTCTAACTCAACCCAAAAGCTAGATCTCGAGGGGAGGATTAA
TTCCATATCAACACACGTTCCGTCCATACCCCAACCAATGTGAGATTCTTACCCGTTCTAACAATCACAAAACGTTGTGCATTAGTTTACTTAGTTGTGA
AATATGTAAATCGTGTTTTCAAAACAACACTTAATCAATATCCAAATTCACACAATGCTACTAATCTTACAGATTCTAAGTATGTAAATTTTATACTCCA
AATCGGAATTCACACCAAAATTGTAATGCTAAATCATCATACTTTTGGTAAAACAAAATATAAGCACTTAATTAACAGAAATCCAGTTCAAAACACCATT
GATCTAAACAATCATAACCCAATTGTAAAAAACAACTCATAAGACCAAAAACAAACATCAATTGTGATTTCTTCCCATCTGCACACAAGCTGGCCTGAAC
AACACAATTATCAAAAAGAAACATTTTTTAAGAAGAAACTAAAAACATGCAAGTACCAGATTGGAGAGTGAGGAGTCTGTATTGGGCTTCTTGTTCTTAA
CAACCTCAGAAACAGCGAAAACACCATTAGATCGGCTTTTCGAGTTCTGAGACGAAAAGGGTTTCTTCATATAGAGTTTCTTAGCTGATCCAAGAAAAAA
GGAGCTGTCTTTAAGCTGATTTCCCAAAAGGGTCTTCTTGTTGTTGTTGTCAATGGATCTGGTGGAGTTGATAGGCTGCAAAAAATTGTTAGCAGCAAAA
GAAGAGGCTGATGCAGCCATGATTACAGAGAAAAACTTGATGTATTTTATGGGATTGTTCAGAAGATGAAGCGTGATATATAAAGGAAGAAGTGAGCGGA
GAAAACAAGAAGGGAAAATGTAAGCAAATTGTTGGATTTAACGTCAAAGAACTCAAAATGGGGATGTTGGACTAATAATTTGATAGAACTATTAAGGCCT
CACCCTCTCGATTTCGTTCGATGTCTAATATTTATATTGTCGTATGATTTATTAAAACTTATAAATAATTACGATAAGATTCATTAGAATAAAATGTTAT
CTAAAAATATTTTCATACCTAAGGTTTGAAATTGAAAACTTTGATTAACTAGGGTTTAGATATGTTTTATTTTTTAAAAAAAATTTATTTTTACTTATTG
AATAATTTGCATTTTATCAATTCGTATTAAATAGCGAATTAATTGAATTCTCTTTATATTGTCATTGAATCTGTCAATTAACTTTGTTGTAAAATTCATA
ATAATTAATTTCACGAAGATTCTCTCTTATGCTTTTGCACATGCGGGTCACTTTTTGTTTAAGTTGAGTAAATCTTTATACGTCTCTATTATCTTTTTGA
GATGTTTATACTTCATGAAAACACATTTTCGATTTAAGATTGTCTCTTTGTCGATGTTACTCGCTTTTTTCTAAAAATTAGTGTCTAATCAAAATAAAAA
TATTTAAGATAAATCAAATAGACCATAATTTATAATAACCAATAATTTAAAATATTTTAATCTTTAAATATCACCAAATTTCAATTTTTATTATTGTGTA
TCTAAGCAAATTTAATCTTCAATTTTATTCTTGTGCTATCTCTGATATATCTAAACAAATTTAACCTTTAACTAATTGATATATGCATAGTTTTAATCTC
TCTAGTTATAAATCTTTACAATTTTAACAAATTATATATCACTACAATTATTTGACTATTTTATCTTATGTTAAGTGTACATTATTTTCTTCATATGACT
GTAATTTAGGCATAATATATATAAATAGACAAAAAAAAAACTAATATACTAATTATTTAATAAATTAAATAATTCCACAAGGAACTAAACAAAATACTCA
TTAGCCTCCAAAAAATTAAAAAAGAATTAGAAATAGAATAATCATCTAGATCCTTCATTCTTCATCAGATTTCGAGTTTGAATCAGTTATAAAAATTTTA
ATTTTTTTTAATATGAGACATTTCACTAAAGATTGAAATTTAATCGAACTTCGATACAGAGCAACAGATGGGTGAGAATTTAAAAACTTTTAGGTGATGT
TTTCCAAGTTTGTACACATCTCGATTAATTCCACGTCACCTCCCACCAGCAACAGGTACTAGGTAAATCTATCCACCAAAGGTTAGGACAGATGGGAACA
CATCACCTAATGGCTTTTTTTTGGTCTTTGCTAGAATTTGAACCTGTCGTGGCTCTCAACCCACTTCATTGACCACTAAACCACACCCTTGGATACGAGA
CGATTATTATAACCATACAACTTGGTTTTTCCAAATAAGAGATTGTGTGTTTGAAATAGATTTTGTTGTTCATAATATAGTACAACTTGAAAACAATGTG
AAACTAATAACAACAAAATTTTGAACTAAAATTGAAATAATAAAGTACCTTTGTACCAAACTTCCTAATAAGGAGGACTTCCAGACCTTTATATAGAAGT
ATAATTGGCAATCACTAATTCAGTAACTTAGAACCTGATATTATTGATTACTGAATGTGCCTTGAGACCTAGACATGAGCAGTGCCTTCGGTGAACTTGG
GATCTTCACATCTGTACCTTCCGTCAGGCCCAATGCCAAAGCCCTTTGGATCAGCAAACACGTTCTCGAGCAGCTGGCTACGAACAGGATGAGGGCTTTC
ATCCGCAAATTCGACAGCTTCTTCAACCAGTTCATCAATCTTCTTATCAATGGCCTTCAACTCTGCTTCACTTGCCAGATTGTTCTCAAACATATACTTC
TTCAAGGCACTGATAGGATCTCGTGCAGCATAATGGTTCTTTTCAGCTGCCAAGATGAACAGGTTAAGGTCAAATACGAGAAATCATTGGCTTATAATAT
ACAACAATAAAAATGATGGATTTCAGAGGCTGATCATCTTATAAGCTGTCATAAAATTTATAGCATTTCAAAACTGGAGTTCTGTCCATGAGAGCAATTT
TGTTGTGCATAGTATTCTTATGTTGTCTATAATCTATATACTTCATCTGCAGTATACAAATATGCGGCGACCCTCAGACACTAATACTTAACGTTTTAGT
CTTAAATGGAAGCAATATAGATCAAAGGGCGAAAAATGTTCATTGCACACACTTTACCAGCGCAATACTAGATTTTCTCACATTTCTTAAGCATTACAAT
TTCCATAGTCTTCAACCAATTTGTCACACTCCGATAGATCAAAATGCAGATATCATGTTATTCACTAGTTCTAACTACAAACAGAACAACAACAACAATA
AAAAGCAAAGCTTCAACTCCAAACTATTTTTTTTTTTCACGAAAGAGTCAACAGTGTAATGAGATCACATTTAATGAAGACTACAGAAAAGCTACCTGAG
TTTTATGAGATAGACTAACAATAGCGTATAAAGAGAACGTAATGATTGGTACATTCAGCAAGTTTAAAACATATGCTAAAGCCAGAGTATGGTACTACTA
ATACCAGTAGCAGCAGTACTAAAAGAAATAAAGCTGAATGGATTAGGGGAATATAAAATAAGTACAATAGACACAGAAGGGGATTGGAATTCTCACCAGG
GTCACGAAGCTCATCTGGATCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAGAACTAGATTTGCTTACAGTAGAGTGAATAACACAAGCAAATACAAAAATAACTACTCTGTGTTCAATTTTATATA
ATACTTTTACTAGTGTTAGAGCTTATACAACTTTTGGTACATTTTTAGATACTAGTTCTTGACACGTGCATTACACGTGTATATTACACGTTTAAATGAA
AACAAAATTTGACTCAATCTTTGTTGGCTAAATACATATATGAAAATGTTATAGGAAAAAACAATTGTTACTTACCCAAGGGATATATATATATATTAGT
ATCCTAGGACCATCCGGGGGGGGGGGGGGGGAGAGATTATCTCCATACAGGTGATCATCATGGTGGATGTTCAGCCATATGCTAGATTTGTAATAATATA
ACCATGAATAAATAGCAACTCTAGTGATTCATCTTCTGGAGTTTGTTCTTAATATATCGATCCTGATATCCCAAACCATTATTCTCCTATCAAGACCAAG
CATATTGTCCAAGAAGCTAAAATTGTTTCATGCTTTGAACTCCATCCAGCCTGGAAAACTCTCTTTGTAACAATCCAAATGATGAATATGAGTATATGTC
AGTCATGGTACTCATGTAGCCATTTGAATTCCATGCAATGAAGGATATAAGCCTATTTATAGTGATGTAACCCTTTAAATTCCGTACATAACTGATTATA
CTTTTCATTTTCATGCATCCTTTCAAATTTCATAATAAAGTGATCAAGTCTTTTCAACTTTCAAATTAATTGTCAGAAAATATTGTTCAATAATATTATT
TAATTAATTAAAAATTTAATTACTTTTTAATTTGTTGTACGAGCTAAATAGTAATTCAACTTTTTTAAGTTGAGAGCTTTCCACTTATAATAATATATGA
TTTTACTGCAATAAAGATGTGTCACTTGGCCTAACTCAACCCCATAACATAGTTCTTAAGGGAAGAATTGCCCAAGTCCTTATAAGCAAATCATCCGTCT
ATTCCCAACCATTGTGAAACTCTAACCCACTCTAACACCCCCCTCCCCCCTCACATCTAGGCTCAACTAGAACGTGGACCGAAATCCCAAACAGGCATTG
ACGTGGTACTAATACAATGTGAAGATATCACCTGAGCCTAACTCAACCCAAAAGCTAGATCTTGACGAGAGGTTTGCCCAATTCCATATCAACAAACCGC
CCGTCCATACCCCAACCAATGTGAGATTCTTACCCGTTCTAACAATCAAAAAACACTGAACATTAGTTTACTTACTTGTGAAATATGGAAATCGTGTTTT
CAAAACAACAATTAACCAATATTCAAATTCACACAATGCTGCTAATCTTACAGATTCTAAGTATGTAAATTTTACACTCCATATCGGAATTCACACCAAA
ATTGTAATGCTAAATCGTCATACTTTTGGTACAACGAAATATAAGCACTTAATCAACAGAAATCCAGTTCAAAACACCAATGATTTAAACAAGCATAACC
CAATTGCAAAAGACCAAAACAAACATCAATTGTGATTTCTTCCCATCTGCACACAAGCTGGCCTGAACAACACAATTATCAAAAATAAACATTTTTTAAG
AAGAAAGTAAAAAAATGCAAGTACCAGATTGGAGAGTGGTGAGTCTGTTTTGAGCTTCTTGTTCTTAGCAACCTCAGAAACAGCATAAACACCAATAGAT
CTGCTTTTCGAGTTCTGAGACGAAAAGGGTTTCTTCATATAGAGTTTCTTAGCTGATCCAAGAAAAAAGGAGCTATCTTTAAGCTGATTTCCCAAAAGGG
TCTTCTTGTTGTTGTTGTCAATGGATCTGGTGGAGTTGATGGGCTGCGAAAAACTGTTAGCAGTAAAAGAAGAGGCTGATGCAGCCATGATTACAGAGAA
AAATTTGATGGATTTTATGGGATTGTTAAAGAAGATAAAGTTCGATATATAAAGGAAGCAGTGAACGGAGAAAACAAGAATGGGGAAATGTAAGCAAATT
GTTGGATTAACCGTCAAAAGAACTCAAAAGGGGGAACTATTAAGGGCCACCCTCTCGATATCGTTTCGTGTTTGATATTTATATTAAAATTTAATTTATT
AAAACTTACGAATAATTACGTAAAATTCATTAGGAGAAAATGTTTTTAAAATTGAGATTTTCGATTAATTAGGGTTTTAAATATAAAAAAATGACAGTTT
TTATATAATTTGCATTTTATCGATTCATATTTAATAACTAACTGATTGAATTCTCTTTTTATTCTCATTGAACGTGTCAATTAAATTTATTGTAAGATTC
ATAATGATTAATTTTACAAAGATTTTCTCTTATGCTTTTGCACTCGAGGGTTAATTTTTGTTTGATTTGAGTAAATCTTTGTAGGTCTCTATTATCTTTT
TGAGATGTTTATAATTCATAAAATACTTTGATCTGAAATTGTCTCTTGATCGATGCTATTAATTTTTTTTCTAAAATTTAGCGTCTAATCAAAATAAAAA
CATTTAAAACAAATTAAATTGAGTATAAGCTATAATATTTAAAATATTACCAAATTTTAAATTTTGTTCTTGTAACATCTCTAATCTATCTAAGCAAATT
TAACCTTTAATTTTATTCTTGTACTGTCTCTCATGTATCTAAGCAAATTTTAACCTTTAATTAATTGATGATATGCATAGATTTTAGCCCTCTGTTTATA
AATCTCTACAATTTTTAACAAATTATATATCACTACAATTATTTGACTATTTTATCTTATGTCAAGTGTGCATTGTTTTCTGCATATGAGGGTAATTTAG
GTATAATATATATAATAGACAAAAAAGAAACTCATATATTAGTTGTAACTATAAATTGAATATCATTCTACATGGAACTAAAAACAATACTCATTAGCCT
CTAAAAAATTACAATTAAAAATAGAAAAACCATCGAGATTTTTTAATTTTTTTCAAATTTTGAGTTTGAGTTTTGTAAAAAACTTTAATTTTTAATATGA
AACTTTTTTTTGCATAGATTGAGATTTAATCGGACTTCAATACAGAGTAAGAGGCGAGAATTTTATTTTTTTTTTTAAAAAAAAAGACTCGCCCCCGTCT
CACCCCCCAACCCCCCCCCCTCACACCCACACCCACCTCCTTCTTTTTTAAGTATTTTTTTTTATAAATAGACCCAAGATTTTGAAGCTACAAGTCAAGA
AAAAAAGAAGCAGCAAAAAAAGGACTTAACGCTATGCCTCCAAGGAAAGAACCCTGCAGAAATTTTATGCGTGGCAGGTAAAAATAACTAAAAAATTGGT
TTTAATTTCAATCTATATACTTTATTATGCATATATTCATAGGATTCTTGATTAACCCTTGAAACTTTCATGTCAAAGATTCAATTTTTATTTAGTATTA
TTCTTTTGCTAATCGATATAAAGGTGTAGAGTTGAGTAAAAATAGTTTCTTTGAGCATTTTATTGGGTGGGGATGGGGGTGAAGTTGTTTAGGATTGATG
GGAAGTTGGTTGATTGATTGTTGTACTTAATATTTATTATAATGGTTGAAATATCCCAGCTAAGTAAAGTTATGAGCTTTAGCATCAAAGGGTGTTGTAG
ATGGTTAATGAAGTGGGTTGTAAATCATGATGTCGCTAGTTTAAATCCCAATGTAGGTAGAAACACTTGGTGATTTCTTAAAATTTGTCCAGGTCTGGTG
GATAGAGTTATCTGGTATGGCCGGGGTGGGGGATGAATTTAGAAAATTCATATTGCCTTAGTGGTTTAGGATTGATGGGAAGTTGGTTGCTTGATTGTTG
TATTCAATCTTTATGGTAATGGTTGAAAGATCTTAGCTAAGTAAAGTCATGAGCTTTAGGGTCAAAGGGTGTGGCCGGTGGATAATAAAGAGGGTTGAGA
ATCATGATGTCTCATGTTCAAATCCTAGCAAAGGAATAAATATTACTCCCTCCGTTTCAATTTGTTTTTCTTATGATGTCTCATGTTCAAGTCCTAGCAA
AGGAATAAATATTACTCCCTCCGTTTCAATTTGTTTTTCTTACTTTTCTTGTTATTTTGTTTCAAAAAGAATGTCTCTTTCCTTTTTCTGGGAACTCATC
AAGAATGAATGTTAAGCATGCCTCTTATTTACATTAGTGTGGGATAACAGGGACCTACCAAAAGGTTAAATGAAGGGGGGACAGATCCCCGGTTGAACCT
TTTTTATTTTTTCATATATCTGGATATATAAAGCTAGGTTGGGAAGTGAACTCGCGGGAGGTAGGGGGTTGTGTTTCCTTTTCAAATTACATAATATTGA
CCTAAGATCGAATAATAATTGGTATGATATTCCATCTAGAACTTAGAAAGGTGGTGTTTTTGCTGTGATGTCTTAGAAAGTAAAAATGATGTCTTTAACT
TGAAACATAAAAATTCTTAATTTAATTAGTAGTTCTTTATGAGAGTTGAGTAATCCTTGTTATGAATAGGTTCCTTTGTTTGAGTATGAAAAATAGGATC
TGATTGTTGTCTTATTCATCCAGCTGTCAATATGGTGAACGTTGTAAATTTCTTCATGCTGCCCAACAACAACCGAAGCCAAATCCATTTGGATTTGGCA
GTCAATCCACTAATTTTCAGAGTACAAATATGCAGCAGACAAAGTCCAACCCTTTTGGTTTTGGTGTTCAGAGCAACTCCCAGCCAAGAGGTTCTAGTGA
TTTGGGGCTCAAACAGAATCAATACAAGGTACTTTAGCTGTTACTCTCTAATTATAGCTGTTTGCTGCAGATTATTTAGCATTTATTATATTTATTATAA
ATAATATGCTTCCTCAGTACCATTTTTGAGGAGTCCTCTCTCCATATTTTCAATTTTACCTGCTAATACATGCCAAGCGATAATGGCTCTCTAGATATTT
TAATCCTAGACACTAGAATTCATATCATTCTTTATCTTCATGTCTCAACAAGTGTTAACATGTTGTAAGTGCTCAATGGTATTATCTTAAGAGTTGAAGA
AACGGTGGTGAGTCATAAAGATAAAGAATTGGAAGTAAGAAATTTAGAAATGTCCCATGGGTATGGCCTAGTCCCCAATGAAGTGGGTTGAGAACCATGA
GGTCTCATGTTCAAAGCCCAACGAAGCCATCCTACTCCAAAAAATTGAAACGTCACCTGTAGATCTTGACGTCACCCACTCTAGTCCCAAAATACTGAAG
AACATCTGCCAAACTTAAAATCAGACTGAACAGTGTAATAATAGAGGATTCATTTGTTCCAGAATTCTCTCAACTCATGTAGCATCTATTACTTAGATAA
AAGCCACTTCTTTGCAAGTTGTTTTCGCTAAGGCAAGCTTCTTCCTCCGTTTCTTTTTTTGAAATGGTAACACAAACTTCTTTGTTCAACAACCATACAA
AACACGTAACCAAGTGGGGGCTTTTGATTTCCAAACTTATTTCCTATGAACCTTCAGAATTACAAGGGTTTGTCCTGTTAGAACATTGTAACAAGACTTC
AAAGTGAACTTCCCATTCATATTTCCTTTCCGTTCCAATCTGCCATTGCTGCTATTTAAGCCTTGAAAGTTATATGAACCATTGAAAATTCAGTCATGTC
AGGCCTTACATTTTCTTAAATATGTGTTAATAAGAATGTAGCTGTTGTGGGGTTTACATATAGAGAAGGAACAGGATTTTGGTTGACAACATACGAGTCC
TTCTCGTTAATTGAAAAAGAAGTTTCAATAGCAAGACTGCTACGAAATTTTATATGCTATCTGAAGTTTCATCTTTACAAGGCCATCTTTTAATTTCAGC
GAACAAAATAATGGCACTGATGCTTTCTTCATACTAAAAAGTCACATGAATCTTAAGGAAAGGTTGATAAAGGGAAACATATGGAGTTAAATATTTTATA
ATAAGTTTGTGGAGTCCAATACTTACTGTTTTGTATTTGTGGTTATTAAAATTTTCCAATGTACATACTGTTGTCACCAACAGCAGTTTACTGGTGAGTC
AATATTTACGTATGGTCCTTGTAACTTTCAGTATTATTTCTTTATCAGATCAGTGACATATTCATGTAATACAACTATGATTGTGGACTTTTGCATGAGT
ATGTGTAGGTTCGATTCTATCCTGTTTTCTAGATGTTATGAAGAACTAAAATGAATTGATAGGTTTTTATCAAAAAAAAAAAAAAAAATGAATTGATAGG
TTTTATGACAATGTAAAAGTCTAGGTGACCTAGAAGTAAACTCTCCCAGGATTGAGTCATCTGGTTTATCCTGAATAAACTCTTATCAGGTCTTCATATG
CATACTAACTTCTTTTTTTCATTTTTAGCCTTTTGAAAACAAGTGGACTCGTTCTGCAACTACCAACAGTTCTTCATCGCGGCAAACCGACAATCAGCCT
GTAGCACCTAATCACACGTGAGTGCTCTGTGGCACAAACCTTTCTGTTTTGCTTTTAGCATTATGATTTAAGTGGAATTAATGGTTTGTTTCTGCTACAT
GTGAAGCTGCACAGATGCTGAGTCATGCAGACGCCAGATTGTGGAAGATTTTAATAATGAGAAGCCATTGTGGCTGCTTACCTGCTATGGTCATCGTAAA
AAGTATGTTTTAGATCTTAACTTTACTTCACTCACTTTTCTAAATCAGCTTGCGTCATACTTTGAGTTTCTCTCATGAAGAAGACCCATTGTAGATCATT
CTGTTTTGTTTGGCAAGTCATCTAGTTTCTTTAATTAGTATTAATTGGAATATGAAGATCCCCAGCCCTCTCTTTTATTTGCCAATTTAAGTACTCATCA
AGCTTCTTTAATTATTATTGAGAGTTAATGAGTTGGATCATTTGCCAGATAGAGTTTGGAGACAATTCAACAGAGCCCACAGAGTTCTCTCTTCCCTAAA
TGATCTACTACTCAAAGAACGAATCATGCATTAACACAAATACTAGTATCTTTTTAGTTTGTGCCTTTTATCAGCTATTGGCCCCCCCCCCCTCCCCCCC
CCCCATATTTTGTTCTTTCCTAGTCTCAGGCCCAGCCTTCGCTTTCTTCAATGGCCAAGTTGAAGAGTTCAACATCCGCCTACCACTTCTATTTCAAGGT
TGAGCTTGTTCAGTTGAAGCCTGTCTTGGGAGATGACAATTTTCAAATCTTAGTCTGAGGAATTTTGGTTGGAGACAGTGTTCAGGGAAGCGTGAAGCGG
TAAAAAGTAATAGGGCCCCGCTTCACGCTTTAGGCGATGAAGTGCTCACATACTCATTCTAGTCTGTGAAGCGTAGAAGGCTCGCATTGCTTCGCTTCAT
CGCTTGCTCGCTTGCTCGCTTTCTTGAACACTGGTTGGAGAAGTGATTGCACCTTTTCTCTTTCTTTTCAAACTAAAATATCATAGGGTGCACTTGTTGC
AACTCCTCTAGAGAGCATCCTCTTAGTTTCTACTCTTTCTCTATTCTAAAACTGAAAGTAGAAAAAAGAAAAAGATTCATATTTCTATTCTATGGAACCC
TGCATATATCTGGTGGGCCCATATTCAAATTCTATGTACACGTGCCTGTTTCATGAAATTGGTAGATCAAAGAGATTGATCAGCAGTTGCAATTTGTTTT
GTATGCAGTGGTCCTTGTGATATTACTGGTGATGTTAGCTATGAAGAGCTGCGAGCAGTAGCATACGATGATGCGAAACGTGGACAGAGCTTGATGTCTA
TTGTAAGACACCGCCGTCGCTACCTTCTTGATCTGTCTTCTTGGCTGATACTGATTGGTGCAATTGCAAATTGTTTTCATTATTTGAATATATGCATAAA
TGCAATTTACTCTCAAAAATCAATCAAAGAATTCTATCTTATCGAAAAGGAAGACTTTGAGGTGCAGCAGAGGGCTTTAGATTAGTTAAGAGAGATAACT
AACTTAACATGATTCACAACTTATTAGTAAACTCTTATCATTTCATCAGCTAATATCATCTTGTGATTTTGCTTCTAAGTTCTAACAAACCTTTTTCTGT
CCTCGTGTTAATGCAGGTTGAGAGAGAGAGGAGCCAGGTTAATTCTAAAGTAGCTGAATTCGAAAATCTATTGCAAAATCCTTATGCATCTTCATCAACT
TCTGCTCTTAATGCTCAAAGTCCTTTTCCTGGTGCCACACCAAGTGCCTCATTGAGTGCTCAAAGTCCTTTTCCTGGTGCCACTCCAAGTGCCTCAAGTC
CTTTTCCTGGCGCCGCACCAAATGCCTCATTGAGTGCTCAAAGTCCTTTTCCTGGTGCTGCACCAAATGCATTGTCAAGTGCTCAAAGCAGTTTTCCTCC
TTCAGCCTCAAGTTTTAGTCAGTTGGGAACCATACTGAATACAGGGTTAGACTGATGCATAAGAACCTGCATTAGTGCATTTATACTAGAATTTGGCTTT
TTTGATAAGTTAATTTTACTGTTAGCTAAACCAAAATCAATTAGTAATGAGCTAATAAAATCTATCGTAGCAACATCTTCATAACATGATTTAATTTACA
TCCAACAAGCCAGTAAGCTAAGAGATTTACATTTCATCATGTAGATAGCTGCAGCTTTTCCTTCAAACCACAGCTGGTCTCTTTGCTTGCAGACCGTCCA
TAATATGAAGATTGGAATTTTCTTCCAAATCTTTCTCAGTTCCTTTTTTATATAACATCCAGCACTGAAGTTCTTTAATCGTCTTTGGTAGAAATATTAT
TTTTCTCACACATGTAGTTTCTACCATAAATCTGCATATGCTAGAATTTTGGCTATTACCAGCTTCTGACTTCATTTTTTTCAAATTAACAGGACATCAA
CTCCACCAACTAGTACATTTGGGCAACCCAGTCTCCCTGGGAACTCTTTTAAGACATCAAATTCATCTGGGGTGAATGCTTTTTCATTTGGGAATACATC
AACATCAGGTAATTTGACAGGGTTTTCGAGTATTATCAGTTCTTGAGTATGCGTTTTTATTTAGTAGCTTGACTTTGCTTGCAGGTTCCTTTGGCTTCGG
AACCCAAGTCCCTACCCAGTCATATCAAAATCCTTCCACTCCCAGCAGTATTTTCGCAAGCTCTGGAAGGAACTTATTTTCCACCTCTACGACCTCACCA
CATTTTGCTAATCCCTCTGGTGGCCAACTTCCTACTACTTCTCAGGGGCTTTTTCCTGTTGCGACGTCCCCTGTCAGTATCAACTTGACGTAAGTTGCAG
CTGTAGTTACTTAACTTGCCATGATTATTATTTAGACTATGGAGAAGAATTAATCCACCAATATTTTGGCCTTTTCATTCTTCTATTGAAGTTTGAAACC
GTAACCTTATGATGACGTCCTTTTAGTTGTTCTTTCTGATGCCCTCATTTTGCAGGAATATTGCATCAACAGAGGACTTCAGCGGGGATAACAGCATTTG
GACTAAGAAGGAATGGAAAATTGGGGAGGTATGCTCTTAATATTTTCCTTGCTTTTCACCATTATGTATGACGTGACTTCAACAGAGTCCTGGGAGGCTG
TTTCCGAAGGAGCCTCAGCTCATTTGAATCAAGAGACCTTATAGAAAAAGCTAAATATATCATTTTTCTTGAAAACTGCTCGATAGGATTATGGTCATAT
GCAGTTTTGTAATAGTCGAAAAGTATCAAATGTGGTTTGAAATATGATACTGGAACATCAGAGCGCCCCTCAAGAGTGTATACATTTTAGCATTCAGTTA
TGTGTTTAACCAAAGTTGATATATGGTGCATATGCAAGCATGTCTACCTATGTATTTTATTCGTTGTAATACGTTTAAAGTACCAATTTTCATAACATAT
TGAAGTCAGTTTTTACATCCTTGTTGCTTCTTTTTTCAGATTCCAGAAGAAGCACCCCCAGACAGATATGTTTTCTAGGAATGCTTCTGGGACTTGTCTA
TTGAAGGTTTTCAGTTCATATTAGATACAGAAGAAACTCTTTTTTCGCGTCAACGTAGAAGCAGAAAATTTTGGGCATTTAATTAAAGTTCCTACATAGT
TATGCTTGTGAAGAGGGTGTTTACCATATCATCTGAAGAGGGCTAAAATACTGTCTCCTTCAGCTGTTTAAAGAGTTGTAATATCATCATGTTGTTAGCT
TCTGTATGTTCGACACTATTTATATGAAAACAATATCAAATTCAATGGTAGTAATTGAATGTAACCTTTCCAGGAATAACTGATATTTAACTAAAGGATA
AATTTTTTTTATTGAGTGCAGGAATAAAATGGTAATCTAATTGCACTGATCGAGGAGGTTGAGTAGAAACTCTACGTTTCTGAGCAGTGAGCAGTACTTG
TTTCAAAAAAGTTAACAGTTAATAGGCAATTTGTTCTGGATACACAAGACAAAGATTGAGATAGTAATTCTCTTTCAGCTCTAACTAGCATTAGGGGGCA
GACACTTGAGTCTTGTTGACCCTCTCAGTGGTAACTCGTGGCGGAGGCACATAAATTCTTGCTCTTTTCAAAATTTCAGCTACAACCCAGTGCTTGCGCT
TGCTCAGTGGTCTTGAATGATCCAACTTAACCTGAAATCGGAATTTCATCCCCAACTCAATATCTTGTTCCCCAATTATAATCTTAAATCATCACTAATA
AGCTTCAACAACATTCACAACTGTACAAAAATTCAGTAGTATTGATCTTAAATAAGAGGCAGGAAGTTACAAGAACGACTGTCAGATACAACGGAATACT
ATTGAAAGTTCCATTGCTATGACACTAAAGGATTAAAGTAAACCATCTTAACATATCAGTTCAGTTGCATATACCGCAGCTATAGTAGTAAATTTTATTA
TGATTTGACCGGGAAAAAGCAAAAGAACCTTTAATGACATGAAGCAAATATATACATCATCTATACTCGGAATTTACCAAATCTGAACTAAAATTATGCA
CATGGCTTCCATCTCACCACTCTCCTTCTTCCTCATACTCGAGATAAGAAATGTAATTCACACGTGCTAGTATTCAGAGGGAAAGTTTACCTTTTTCTCT
TGTCTTGTATAACTTAAGGTGTAATATAATCAGAAATTCCATTAGAAGAACACATCAGTCAACCACAATACAATTCCAAATTAATTGTGGTCTTCAAAGG
CTATAAGACTATACACTAACCATGAAACCCCCTTCTATATACAAAGTTGCAACCAGGAAATAGCATTATTAATAACATCATTTCTTTTTTTATAATCATG
GTGTATGTGTTTGACCACGCATCATCTAGTTCCACATAGTACCTTCTACCACCCATCAACACAAGTACTCTGTCCAGCACGGCTAGGACACACTGGAAGA
AATCACTTGGTGATTTTGCCTTTGCTTGTGACTGATCCGGAGACCTCATGGTACCCAACCCACTTTACTGAACATAAACTAACCCCCATGGGTGCGGGAA
ATAACATCATTGACAAAATTTTGAACTGAACAATGACGATGACTCACCCACTTCACGTACTAAAAAACAGATTACAAGCATAGAAGATAAGAGAACACAT
CGTCAACTACGAATTTGGAAAAGAAGCTCCACAATGAGTTTAGATATGCTATTTTAGGTGCTTCTTTGTTCTTCATTAAAACAAACAATTACTTCGGAGT
CTCATAGCTAATCTACAAGCTCAAAACCTAATACACTTGAATAACCATTAGCAACATCACTAAAAAAAGACCAATCTTTACCCAACTAATGGTACCTACA
TCCAGATTACCAGAAAGGGAGAGGCAAACGAAGAATTAGGAAAATGAAATGTATCTCTATAATGTGTATCTGTATGAGTAATTTTAGGTGTTTCATTAGT
TTACACAGGAACAAACATGTATTTTGACGCCATTTGCAAGTTAACGAAATCATAATTAAAAAATACAGATCAATATAACATTTTTCACCTAATTCTACAA
CACAAACAGATCACAACTAAACACAAATGAATCTCTATATCTATAACTAGGCTAGGTAATGGGTAAATTTGGGTGCTTTTTTGTTTCATCAATTATACAA
ACAATTATTTTGAAGCCAATTAATTGCTTATAATCAAAAACAAAATCATCAGCAAACTTGAAAAAGGACCATTTTTTCCCAAATCACAATAGAGAGAGAG
AGTATTTACGCGGTCACCGATGTTGCATTCGTCTTTGTCATCATGAGCCATGAATTTGGAGGTCCGTTTGACATATCGATTGTAAACCTTGTTGTGGAAG
AGTCTATCCACTGCCACCACTACTGATTTCTGCATCTTGTTAGACACTACTGTTCCTACTACCGGCTTCATCTTCTTCCGTCGTCCTCTCCGGCCTAAAC
CCTAGGAATCGCAGTACTGAATTTGAACTTCCGTTTACACTGATGAGTGGGCACCATTTTTCTTTTTAATAATTAAGTAATATGTGGTTTTTGCACCCAC
CTAACTTATTTTTATACATTTTAACCCCTTCAATTTTATAATTGTAATAGAATAGATTATATATAAAATTTTCGGCTAATGCACAAATACCTCCAACCTA
TGGCCGAAATCTCAGAGACAGACCTATACTATATTAAAGTCATATCACTCCCTGAATATTTATGAATATTTTTTTATTCCTTTTCGGCTTGCGTGACACT
ATCTTGTGGGCCCAGCGCGTGTTGACATTTTTTTCCAAGATAGTATCACGTAGGCCGAAAAGGGTAGAAAATTATTCATAAAATAAGTTTAGGGGTAATA
AGACCTTAGTATAGTATAAGTGTATCTCTGAAAATTCGGACATAGATTAGGGGTATTTATGCATTTTCCTTAAATTTTATGAGTAAATATCTCAAAACGT
CACTCAACCTTAAAAAATTATGTTGTAAAGTCATTTAACTTTGATTTGTATCAATAAAATCACTCAACTTTGAGTATTTCTTTTATAAAATCACTTGGTC
AAATTTACCATAGGAACATTTTAATATGATAAAGTAAATTAATTGTTCTCCCACAAAATCTCTACTTTTTATATGTTTTTCTTCTTTGCAATAATTAAAA
AAAATACTTCCCATTTTTAAAAAAATTACAATCATGGATCAACGAATCAAGTTAAGATACGAATTTTAAAAAAATTTATTTGTGAAATTATTCTTTAATA
TAATTTATCGACAGTTTTCATAAATTCCTTCGATGAGTTTGATAGATGATTAGCAATGAGATTTGATTGATATATTAGTTTAATTAATTGAATGATTCAT
CTGCCTCTTATAATAATCTTCAACGAAAAGTACATTAAAAATAGATTTGATTTGCTCCATAAATTTACTAAAAAGTTCAAAATTCATGTCAATTGTTTTT
AACTTTTTCATGACTTACAAAATATTTGAGAATTTTCTTGTAAATATATATACTTTAAAAATAATGATTTTATCTTCTAAAAATTTTTTTATGATAATTT
TGATCGAGTGATTTTATATAAAAAAAATTATTCAGAGTTGAGTGATTTTGATATAAAACAAAGTTGAATGACCTTCTGAGATATTTACTTAAATTTTATT
CTACCGATTGAAGATAAAAAATTCATTCTAAAAAAAAACTTAGAAAAATAAATATGATATAATAAATAACTCTAAGAAAACATAGTATCCAATATATATA
TATATATATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTGTTTTTCTTTTCTGTCTTTTAATTATTATATAACATTTTTTACGATGAAGTCATGTCCCGTGACACCCCTTGAGCCTTCCTAGATCCG
CCCCTGCTGACCTATTTATCTTAGCTCATGTCCTCATTAAGTTAAACATGTATCATTACATGTGTGAGGACCTTCGTAATGAGTTGGAAAATTTTTACGT
ACACTCACACTATTTTTTAATGTTCATTATTACATTTTCAAGTCATTTTTTTAAGAATCGCCAATTTTTCTGATTTTTTTTATGTATATTAGCACATGAA
TCTGGCGCCCAAATTATCTGAATTTTTTTCTCAAAAAACATTATAAGGACCTCCGTAATGAGTTGAGGAACCTTTACGTATACTCACACAATTTTTTGAA
CACCCATTTTCGTATTTACAAGTCCTTTTTTAAGAGTCATTCAAATTCCTCAATTTTTCGTGTGTATTAACTCATGATCTAAGCATACGGAGAATTAAAA
ATTTATTTCCCAAAAAACTTTATAAGGACCTCCTTAATGAGTAGAGAAACCTTCACATATACTCGCACTATTTTTAAGGCTCATTTCCGCATTTAAAGGC
TCTTTTTAAAGGATCACCCAATTCCCCGATTTTTCATGTGTATTAGCCCATGGATCTGACACACAGAGTACCCAAAATTATTTTATCAAAAAACTTTAAG
AGGGCCTCTGTAATGAGTTATGTAACATTTACGTACACTCCCACAAACTTTTGACACCAATTACGACATTTACATGCCCTTTTTAATAGTCGCTCGAATT
TTTTGATGTGCACTAGCCCATGATCTGACACCCGGAGAATTCAAAATTTCTTTCTCAAAAAACTTTATAAGACCTCCTTAATGAGTAGTGGAACTTTCAC
GTATACTCACATCATTTTTTAGTTTCAATAACTGCATCATTTTGTTTAGAAAATTTTGGATTAAAAAAATTAATGAGTTATAGCACACGAAAATTGATAA
AATTTGTCTTTGCCATTTTTGGGACTCGTTTGAACTTGAAAATGCACCATTTTTTTCCCGCGGAAAAAAAACTGGTTCCGTTTCTAAAGTCTTAACCGAT
GTCCATGAAAAATTTCAACAATATTCTTCTAGGATTTCCATATAAAAAAGATTCATGAGATATATCACAAAAAATCGGTAAAGTTTGACTTTGTCTACTT
TTGAACTCGTTTGAACTTAAAAATGCATCATTTTTTCCGCGAGATGAACTGGTTCCATTGCTAAGGTCTTAACAGACATCTATGAAAAATTTCGGCCATT
TTGTTTCGAGATTTTCGAATTAAAAAAATCCATGGGCTATAGCACACAAAAATCTGTAAAATCTACCTTTGCCTGCTATGGGGCTCGTTTGAACTTGAAA
ATGCACCATTTTTTCCTGCGGAAGAAACTTGTTCATTTCAAAGGTCTTAACGGGCGTCCATAAAAAATTTCGTCCATTTTATTTAGGGATTTCCGTATAA
AAAAAATTCATGGGGTTAGCACGAAAATTGGTTAAATCAGTCTTTCCCTGCTTTGGGGCTCGTTTGAACTTTAAAATGCACCATTTATCCTTGGGGGACG
AACTTTTTTCATTTCTAAGGTCTTAACGGACGTCCATGAAAAATTTTGACCATTCTTTTTCAGGATTTCTGGATTAAAAAAATCATGGGTTATAGCATAC
GAAAATCAGTAAAATATGTCTTTGCCTATTGTAGGGCTCGTTTGAACTTGAAAATACACCAATTTTCCCCGTGGGACAAACTAGTTCCATTTCTTAGGTC
TTAACGAACGTCCATGAAAAATATCGTCCATGTTATTTTGGAATTTCATGATAAAAAAAATACGTGGCTATAACATATGAAAATCGACAAAATATATTTT
TGCCTATTTTGAGGCTCGTTTGAACATGGAATTGCACCATTTTTCCCCGCTGGACGAACTGGTTCAATTGCTAATGTCTTAACGGACGTTCATGAAAATT
TTTGACGATTTTATTTTTGGGAATTTCCAGATAAAAAAATTCATCACGAAAATCGCTAAAATCTACCTTTGCATGTTTTAGGGCTCGTTTAAACTTGAAA
ATGCATCATTTTTCCTGCGGGATGAACTAGTTCCATTTTTAAGTCTTAAAAAACGTCCATGTTCGAGATTTTCGAATCAAAATAATCGATGGACTAAAAT
CGGCCTTTGCCTGCTTTGGAGCTCGATTGAACTTGAAAATGCATCATTTTCCCTGCAGGACGAACTAGTTCTATCTTTAAAGTCTTAACGGACGCCCATG
AAAAATTTTTGTCATTTTGTTTAGGGATTTTCGAATAAAAAAATTCATTGGCTTAAACACACGAAAATCGGCAAAATATGCCTTTGTCTGCTTTGGGACT
CGCTTCAACTTAAAAATGCACCATTTTCCCCACAAGATGAACTGATTTCATTTCTAAGGTCTTAACGGACAATCATGAAAAACTTCGGCCATTTTCTTTG
GAATTTTCGAATTAAAAATATCCATGGGCTATAACACACAAAAGATGATAAAATTTGCCTTTTTCTATTATGGGATTTGTTTGCGGAAGAAAATGCACCA
TTTTCCCCAACAGGACAAAATGGTTCCATTACTAAGTTCTTAATGGACGTCTATGAAAATTTTTGGTCATTTTATTTTGGAATTTCTGGATTAAAAAAAT
CCATGAGCTATACTACACAAAAATTGATAAAATTTGGTTTCGTCTGCTTTGGGACTCCTTTGAACTTTAAATATTCACCAATTTCCCCAGGGGACGAACT
GGTTCCATTTCTAAGGTGATGACGGCCGTTCATGAAAAATTTTTGGCCTCTTTATTTCAGAATTTCTAGATAAAAAAATTCATGGGCTACACATGAAAAT
TCGTAAAATCTGTCTTTACCATATTTGGAGATCATTTGAACTTGAAAATGCACTAATTTTCTCTGCGGGATGAATTGGTTCCATTTTTATGGTCTTAGTG
GACGTCCGTGAACAAATTTCGGCCATTTTGTTTTAATATTTTTGGATATAAAAATATTCATGGGCTATAGCACACAAATATCGGTAAGATCTGCCTTTGC
CTAATTTGTGGCTCATTTGAACTTGAAAATACATCATTTTTCATAGTGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAATGGCGACTCCGCTGGGGATTAATTAAGTTCTAACCATAAGATTT
GACTGTTTGACTAACTGTTTTTGTTAAAATATTGTTTGTACTGAATATGTTTAAATTTGTCATAAATTGTCGTTGCATTCATGGCATATTTCCAATATAT
ATGTATAGTATATTAAAGGACGGTTTGCGGAACCGCAGTCGGACTTTTTTATACTCACCCTTTTTCGAAATTAGCGGAAATTTATTGGTTCGTTAGGCGT
CCAATGGTTGTCGCGAGTTTCAGCCCAAATTGTCCGTTTGGGTTCCCGGTCCTTTCAAAAGCCACTCTTAGTCAACTAGCGTAAAGCCGAGCCAAAATCC
CGAACGTAAGAGCATTTGAACTAAGACGACCCAACGCCCAAGGCGTGTTGGGCCCATTAGAAGCCCACCTTGTGTCTATTTGGCCTAAATTGCCAAAAAC
GGACAATCATGTTTATGTGTTTATTGAAGGATGTATATGCATTTTAAAAACGCTTTATTGTCCACGGGGTGGGGAGTTGACTAAATTTTGTTCGCTATTT
TTGTAGGATGAACCCGGCACACAAACCTCTGAAAACAAGAATGGTTACTGTCCCTGACCCTTTCCTCAAAGTATGGTGGAAGTTCATGAACAACGAAGAT
AAAGGAATTGTTCAGAAACACATAGGTCATCTTCCGTCGTTGTTAGAGATGAATGCGTGGCCTGGCTTAATTGGAACGATGGTGAAATTCTGGGATAGCG
AGAATATGGTTTTTCGATTCGGGGAAGTAGAGTTGACGCCAACTATAGAAGAAATTCTCATCAGTTATGAAAGTATCGCCATGTGCAACAAAAGGAAACG
ACATCCAGATACAGATCTCCTAAATCCTATAACATGGGATTTCGCCAAAATTAAAGAGATATTGTCATTGGTTAAAGCCGAGTGCATGGACAAACTCCCT
GGTCCGAATATACCTTTCAGAAAGTTATATTATCGATTTGGGCGTGCAAGGGCTTATGAGAAACATGAAGATGAGTTCGTCTCAAAAGAAAAATGAAAAG
AGGCGCGTCCCCTTGCATTTGCGATATGTTTGCTCGGCACGATGGTTTTTCCCCAAGGGCCAAAATACACTATTCATCCTAGTGTATTTATGGTCACTCA
TGCCATTTTTTATGGAGTGGATTACAAAACATCGACGAAGTATTACACTTTAGCGCCCATGATTCTGGCCGACATCTACAGGGCTTTAGACAAGTGTCAG
AACGGAGAACGCTTCTTTCAAGGGTGTAATTTGATACTACAGTGGTGGATGATGCGTCATTTAATCAAGACTCATAACCCCAAAGAACCAGATCCCTTTA
GACGATCCGACGAGCTACTTAGTCATGACTGGTGGTTGTATCATAATCGTTGCAACAAGACTGGAGGAGAGAGTTTTTGGTATCCGAGGCTTCGAGGGTT
GAGAGAAGAAGACGTACAATGGTCGATAGATAGTTTGGTGGTAACTAAGAATATGGTGGTTCGAGCTGAAAAGGTCACTTATTTGGTATTTGCTGGGTTA
AGAGGAACTAGGCCATACGCCCCCGGTCGAGTGCTGAGGCAACTAGGAGGGAAGCAAGAGTTGCCCCAGATTGCTGATATGAGGAAATTCGTAACTGACC
ACGAGAATAGGCGAGTGGCATTTTCCGAAGACATGCGTAGGATGTGGAGATCTCGAAGAGTGTTGGGTGAGCCTGTACCAGATAGGTTTCGTCCAGAATG
CTCGAGCGAGTACAAAGAATGGTTGAAAAAGAGTCTCGCTGGAACAATTGAGCCTGGTCCAAACGTTCCTCACATTATTGCCGATGTTGGAGCCAAACAT
CAAGTCCGACTTCACCGCCTTCAAGAGAAGTTTGATAAGAGTGAATTAGAGCATCAACGTCGTCATTCCGAAGATGCCAAAGTCATAGCTCGATTGAAAC
AAGAACTGCGAAGGGCCAGACAATGCATGACAGAGTTAGATGATAGCATGGAGCGACAGATTCATTCGATAGAGGGGTTCAGTCATCAAGAAGGAGCTCG
ATTGGCAAGAGATCATCTCTGGGCGAATAGATATGCCATGTGGGAAGAGGTCAACATCGCCAAGAGGACCAGACTTGGCGAAGGATCAGAGGAGGCATGA
TTTTTACCATCCCCTGCGTGGGACAGTTTTATTTGTACTTTGTTTTGTAATTTATTTTTCAGGACTATTTTCTATTTTATGTTTATCAGACATTTTGGAT
GCTATTAATGAAATTTTATGGGGGATAATAATCGGGTTTAAAAAAAAGCATATACATCCTTCAATTCGTTAGGCCTACCCTTGGCACAAAAGGGTCACAT
GCATGTTTAGGACACGATATATTTGTTTAAATGTTTATGTGTTATGTTGCTTTGATTGAGGATATCGTAAACCCACTCCTAGCCAAAATTCTAAAGAGTA
TACAGAAGCCAACATTACAATTGTCCGACCAAAAATCCCGAGTCTCAAGTTTCTCACACAAAATCCATACCATAAATCCTAAGTACCGCTCTATCATCTC
AGGAAAGTTGAATCACCGCTATGGACAAAGGCAAGAACGTCCAGATGGAGCTCACTGAGGAGGAAGTGCGAAGAAAAATCGAGCGAGTCACTCGAGAAAT
TCAGAAGATTAAAGAGAAAGGGCTTAAGGTAGACATGACCACGACAATCTACAAAGTTGCGGTCACGACTTTGGATGAAGATCTGGCGTCGCAGATAAGA
AGAAAGAAGGAGGTTGAGACGAAAGCCGAAAGCCTAAGGAAAGGTTGAATTTGCTTCGTTTGGAGATACACGAAGGAAAGGCGAGAGAGGCGAAGATAGA
TATTGAAACTGCCGTAGCGTTGGCCAGAAGTGCGGCACTCGACGAGGAATTGGCGATCCATAGCAACTTAAAGGGCAGAAAATACCTCGCCCATGATCAA
GGAGCAAATCACAGTGGCCCCGGCCGTGAAGTGACTGAGGAGGATGATGAAGAAGAAATCGTCTACAAGCCTCCATTTCCGACTGTCTGAAAGGAAAGGA
ATGATGCAGCCACAAGACAAGAAATCTCAAAATGTGGTCTTCTAGAAATCTCAATGTTGTTTTTCAATTCCCTTGTAATCACAACGAAAGAATGAATGGA
AAATTTTCATCCTAAAATCCGAACTACGATGGGCCTGAATTCTCCCCGTGAGATACGTAGGCAGCCTTCTCGGCCCGGCCCCTATCACAGAAAATTTTCA
TTCTTCTCCATGTTTTGAAGATATGAAGATAAGATCAACGGACGTCGAAAGGCAGCTGCAAGAAGAACATAGCTCAACGTGATTCAGCTTTCCCGAGATG
ACGTCAAAACAAACAAATTCCTGTTTGTTCAGAATATATTTCCGTCCTCATTCGTGGGTTAAGATATCCTCAAACAAAGCGACTTGTGTGTTTATCTGTT
TTATGTGCGATATTATGCATTTTGTACTCCGGATATGCACTAACAAATCTGCGTTTGAGTTATTTTGCCTTTCAGGTACATCTTACTGATCTGTGTCGAT
AAAGCTAGCAGATCACCACTACTTCACCAGATCAAAGGGTCCCGCAGATTCCTGCCCCGGACCAAACGCAAATACAGCCATGGGAGACAACGATGAGGAA
GTCAGCCTTACAGATTTTGTGGTGGCTCAACCCACCGCGGCAGATCAAAATGAGTTAATTATGCAGCTGATGCAACAGATTGCCGAAATGAGGGTCGAAA
TGCAAAGAATGCAAGATTTGTCTAATCGAGTGTCATCCTTCAACCCTCCAAAAGATGGAAGACCTCCACTCCACTATCCTCCCTCAAGCACGGAACAAGT
TCAGAACCTTCTCTCTAACCCCATTCAGAATCCTCCAACCATTGACTTAACTACCCTCTATCCCCATCACGCCACCCCATCGTGTCAAGCACCACATCGT
TCTCACAATACCAATCAAATCCTTCATCTTCAGAACCAGAATACTGATCCTCAAAGTTTCCCCCAAGATTATCAAGCCAATCAAAATACCCAGAATCCCT
CCATTATCCCACTCATACCTCAAAAGACTACTTTCCAAATCCCAACTTCAAATGAACCTCATGCCGATTGTTCCGAGCTTGATCACTGTGAAGAACAGGA
GAGAGAGTGGAGGTCAAAAGAAGAGGTACTCAAGGCGAAAGAAGAGATCAGGAAAGTCATGAAGGAGTTACACTATTTTTCCGAAGTCGATGAATTAAGC
TATGAGGATGTATACATCCATCCGAATCTCGACCTCCCAGAAGGGTTCAAGGTGCCAAAGTTTGTCACTTTTAACGGGACAAGAAATCCTCTAACACATC
TGAAAGCTTATTGTGATCAACTCGGGGGAGTCGACAAAAATGAAGCATTATTAATGCGTCTCTTCAGTCGAAGTCTAAGTGGAGAAGCTCGGGAATGGCT
TACGTCACAGGAGTTGAAACAATGGAAAAGTTGGAATGCACTTGCAAAGGACTTCACAGAAAGATTTGGACGTAACATAGAAGATGCCACAGATCGCTAC
TACTTGGAGAAGATCAGACAGAAGTCTACAGAAAATTATCGAGAGTACGCTCTTCGTTGGAGAAAAGAGGCCGCAAAAGTTCAACCTCCAATGTCCGAAC
GTGAGATCACCGAAATGTTTATTCGTACTCAAGAGCCTGAGTACTACGAAAGAATGTTGTGTATGATGGGACAAAAGTTTGTCGAGATTGTCAAAGTGGG
AGAAGCTTTGGAAGATGGTTTCAAGACTGGAAAGCTCACCAAACTCACCGCATTGCGATCTAATGGAAAATCTGCCAGAATCAGTGATATGGATAAATCA
AAAGGAAAATTGGAGGAGGTAAGTACGATCACGGCTACTCATAGGAGGTCAGATTCTAAAAGGGAATACCAAAACCATAATGTCAATCAGGAAAAATTTC
CTCGCCCAAAATTTAGGAAAGCTCCTAAAGTATTTACACCATTGAGGGAATCTCAAACTCAACTTTATGAAAGGTTGAAAGCAATGGGTAAGCTCTATCC
TATAGAAGGAAGACCAGCCAATCCTTTGGGAAAATTTTACAGAGCTGACCACAGATGCTCTTATCATTCAGGAGCCGTTGGGCATGACACAAAGAATTGT
TCAACTCTGAAGCACAAGATACAAAACATGATCAACAACAACTTGATCAATATTGAGGAAACCACCTGAATGGAGGACAGGTTAAATGCTCAAGAGTGAG
TACAAGACATTTCTGAACTGAATCATTTGGAGATATTCATTCGAGAAGAAGAATGCTCAACATTGGCCAATTTTGCGTATGAAGTTTTGTTACCTTTCCT
TTGAAAATGTATCGCACATTTCTAACGAACTACGTCTGACCTGAATTCTCGAGAATGAGATACGTAGGCGGCCTATGTCGGCTTTGGTCACCCCATTTAT
TCCCCTTGATTATTCCTTGTGTTGGAACTACGTTTGACCTGATTCCTGCCTCAACGGGATACGTAGGCGCCACAACGGCTCGGTCATATACCCAGAAGAT
TTCCATTTCTCTCCATAATGGAAACTGGGACAGAATTTTTGAGAGGATCTCAAAAATTCATTTGAAGTTGGACTTCTTTAACAAGTCAAAACAGAAGACC
AAATTCTACGACCTGAACTACGTTCGACCTGAATTCTCCAGAATGAGATACGTAGGCGGCCTTTGTCGGCTTCGGTCGGTTTCTTTGTAAATTTTATTCT
TGTTAACCTTTAAGGGGAACTACGTTTGACCTGATTCCTGCCTCAACGGGATACGTAGGCGCCACAAGGGCTCGGTCATATCTCTCGTAAGATTTCTATT
TCCCCCTTTCTACAATAGAAACTGGGATAGAATTTTTGAGAGGGACTCAAAAATTTCCCAAAAGGAACCTTCTCCTCAGCGGATCAAACTAAAGACATTT
CGAGTTTGCGACTGGGACAGAATTTTTGAGAAGATCTCAAAAATTCCGAGATTTGTTCGGTTACAATGGAAAGATGAGCAAGATGCTAAACTGGGACAGA
AATTTTGTGGATGGCCTCAAAATTTCGTCATGGGACTTCCCCACAAGTCCGGAATGCCTCTGAAATTCATTCGACAAGCGTCGGACTCAAAGAAGCTCGT
TAAGCCTGACATGACATGACTTGGCATTGACTTTTTCGAGATACTGTTTCTTAAAAAATTTCTTGCTTCTCTTAAAATTTTCCCTTTTATATTTCATCTG
TTTGGGCATAAGATATTTTCTTATCTACCAAGAGTCGGGAAATCGGGAAATCAACCGAGGACGTCAAGACAAGGAGCAAACAATCGAAGGGATCGACACA
GATCAGTATGTTTAAAACTGACAATTTTTCTGTGGATGCAGGTTTATAGCTTCACTTCGAAATCGGCCGAATTCTTCCGACTGATGAATACGGAGAAGGA
GAATACTATCTCCAAAGCCGGTGATTTTATTGAAAGCAAGAAGCATTTCATATCTTTATGCCAAGATGCTTGTGAATGTGTTTGTTTATTTCAAGCCATT
CCCCAATACATGAAATTTACAAAGTGCCTGACCAGATTCAAAGGTGGATCAAAAAGGAATCTTAGCGAAGATTTCACGATTTCTATAGAAGACGCTATTT
GCATTGCGTTATCAAAGCAAGATGATTATTGTCGATCAAGACAATGCATTACCTCAGAAGAGACAGCTATGCAATTATTATTTTTATCATTATCGATCAA
GTCAATATATTATTTGGAGGTCGTCTTGCCGTTACTATTCACGGGGGCAATATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAAATTTGCACATCGCAAGAAGATTTTATTCTTCGCTGAAAG
GTATGCATCGCGAGAAGATTCATATCTCGCAGGAATTTACGTATCGCGGGAAGATATTCATGACCCGCAAGAAGACGTACTTGGATAAAGAAAGAGCAAT
ACTTATCCATTGGCCTCGACTGCATTATGTTATTTCTTATAAAAATAAACATCATGGAGAGCATCGAAGATGACAACAAAAGAAGCATCAATGTCGCATC
AGCATTTATTTATTTATTTCAACATCAAGTATGGAATACATTGAAGATGATATTGCAAAACACAAGGCATAAGCTTTATTTGCTGGACGTCAGACCGATC
AAGTCGACGTCGAACATGGAAGAGAACAATGAAGTGTTGACATGGTAAAGGACACTGTCTCCCATCCTAATTGCATTTTTAAGCTGACGAGTTTTATCTC
AGTCTTTGTCGAGAGCATCCAAAAGGATGAATTCTCCAAAAATCACAGGTGCAGACGACATCAAAAAGGATGCAGCACAACGTGGAACTTTTTCTTAGCA
GCGAACTGGGACATAGTCCAAAGAGGAATGTCAAACTCTTAGGACGCGAGCAGAGGAGCGACTTCCACCACAATCGAACCATCCTCTCGAGGCTTACGGG
TTTTCTCTAGTTCTGTCAGTTTCTGTCTTGCGTCCGGAAGTTTTGTTTTATTGGGGGCGAGTTTCCAATCTGAGTGACAATGCGCCAGGAGCTTTGGAAA
TTATGTCCGTGTAAGTTCTTACCTATGGATGTGAAGAGCTCCACATTCATGGCTAAGAGGTTACAAGCCTCTTTTTCATACTCGTTTAATGTGTCACTCG
TCCAAAACCGAAGGTTAGCTAGCATAATAGTTTTCCTTTTCCAACGATCGAGTCGAACTACACACAGCCTGATTCCGAAGGTTTAAGGGTATGTAGGCAG
ATTCAATGTTGAAAACTCGGCTGTATTCCAACATTCGCTCTCGAATTCTATTCTCGAGCATTTCGACACCTTCATAATTCGGTGTCGAGGTGGCTTTTGA
TTCTTTGAAATCGTGCGGTAAATCAAGCTTATCGAACTACAAGTGGCCTGAATTCTCATATAGCCTGAGATATGTAGGAGACCCGTTTGCAAGGGTTCGG
CCATAATTCCTAAACTCTTTGTCAAATCCTCCTTCCTAAAGGCGAGTGGAGTTGGTCAAAATTGGTTCGGTCAACTTCATTTTCCTCGAGTGGCTTGCAT
CCACCCAAGTAAAATGAGGGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGTGAGACGAACTGGTTTCATTTCTAAGGTCTTAATGGAAGACCATGAAAAATTTTGGCCATTTTTATTTGGGATTT
TTCGGTTCAGAAAAAATTAATGGGCTATAGTACATGAAAATCAGTAAAATCTACCTTTGTCTGCTTAGGTCTCGTTTTTGAACTTTAAAATGCATCATTT
TTTCCATGGAACTGACTAGTTCCATTCCTAAGGTATTATAGACGTAGTTGAAACATTTCGGCCATTTTGTTTTGAGATTTCCAAATTAAAAAAAATCGAC
AGGCTATAACACATGAAAATCGATAAAATTTGTATTTGCCTGATTTAGGGCTTGTTTGAACTTTAAAATGTACCATTTTCTCCCGTAGGATGAACTTGTT
CCATTTCTAAAGTCTTAATGGATGTCCATAAAATATTTTGGCCATTTTATTTCGTAATTTCTTGACTGAAAAAATTCATGGGCTATAGCACACGAAAATG
AGTAAAATTTGTCTTTCCCTGCATTGGGACACGTTTGAACTCTAAAATGCACAATTTTTTCATGTGGGACGAACTTGTTTATTTTTTAAGGTCTTAATGG
ACATCCATAAAAATTTTAGGTTATATTTTGAGATTTTCGGATTAAAAAAATCAATGAGGTATAATACAAGAAAATCGATAAAATATGTCTTTGCCTGCTA
TTGAATCGTTTGAGCTTGAAAATGAACCACTTTATCCTGCGTAACGAATAGGTTCTATTTCTAAGGTCTTAATGGACGTCGATGAAAAATTTTGGCTGTT
TTATTTTGAAATTTTTGGATAAAAAAACCCACGAGGTATAGTAGACGAAAATTGGTAGAATTTTTCTTTGCTTGCTTTGGACTCGTTTGAACTTGAAAAT
GCATTATTTTTCCTTGCGAGACGAACTGGTTCCATTTTTGAGGTCTTAACGGATGTCCAAGAAAATTTTTGGCAATTTTGTTTTGGGATTCTTGAATAAA
AAAGAATCATTGGGATATAACGCGCAAAAATCGATAAAAATATTTCTTTTCCTTCTTTAGAGCTCATTTGAACTTTAAAATGCAACTTTTCCCTTGGGAC
GAAGTGATTCAATTTCTTAGGTCTTAAGGGACGTCCATGAAAAATTTTGACAGTTTTTTTTGGGATTTCCACATAAAAAAATTCATGAGCTCTAGCAAAC
GAAAATGGATAAAATCTACATTTGCTCGCTTTGTGGCTCTTTTGAAGTTGAAAATGCACTATTTTTCCCTGCGCAATGAACTGATTTAATTTCTAAGGTA
TTAACGAACATATATGAAAAATTACGGTCATTTTGAGTCAGAATTTCCGAATAAAAAATACACGTGCTTTGCCTACTTTGGAGCTCGTTTGAACTTGAAA
ATGCACTATTTTTTCACTAAGGGACGAACTGGTTCTATTTCTGAGGTCTTAACGGACGTCCTTTAAAAATTATGATCATTTTGTTTGAGATTTCTGGATT
AAACAAATCTATGGGCTATAGCACATGAAAATCGATAAAATCTCCCTTTACCTGCTTTAGGGCTCGTTTGAACTATAAAATATACCATTTTCCTCGTGGA
ACGAACTGGTTCTATTTCTTAGGTTTTAACGGATGTCCACGAAAAAATTTTGGTCATTTTTTTTCCAGAATTTTTTGATAAAAAAATTCATGGGCTATAA
CACACGAAAATCGATTAAATCAGCCCTTGCCTGCTTTGGGGCTAGTTTGAACTTGAAAATGCACAATTTTCCCTGGATGAACTTGTTAAATTTCTAAGAT
TTTAATGAAAGTCCATGTAAATTTTTGGCCATTTTGTTTCAGAATTTAAGGATAAAAAAATCTATGGACTTTTAGCATATGAAAATCGATAAAATTTGGT
TTTATTTTCTTTCGGGCTAATTTGAACTTTAAAATGAACCATTTTCCCCGTAGTACGAACTGGTTCCATTTTTGAGGTCTTCACTAATGCACATGAAAGT
TTTCAGTCATTTTATTTCGAAATTCCCAGATAAATAAAATTTATGGGTTGTAGAACACGAAAATCGATAAAATATGTTTTTGTCTGCTATGGAGCTTGTT
TTATTTTTAAAATGCATCATTTTCCTCGTGGGACAAACTAGATCAATTTCTAGAGCCTTAATGGACGTCCATAAAAAATTTCAGCCGTTTCGGGATATTC
AGATCATAAAATTCATGGGTTAGAGTGCACGAAAATCAGTAAAATCTGCCTTTGCTTGTATTGGGGCTCGCTTGAAGATGAAAATGCACTATTTTTCTCG
GCGGGACGAATATGTTCCATTTCGAAGGTCTTAACGGACGTCCATGAAAAATTTCGATCGTTCTCTTCTTGAATTTTCGGATAACAAAAATTCATGGGTT
ATAGCACACAAAAATTGATAGTTTCTTTTCCGCGAAGGATGAACTATTTCCATTTCTGAGGTCTTAACGGACATTAATAAAAAATTACGGTCATTTGTAT
AGAATTTTCTGAATAAAAAAAATTTCAAGTGCTATAGCACACGAAAATTGGTAAAATCTGCCATTGACTACTTTCGAGCTCGTTTGAACTTGAAAATGCG
TTTTTTTCTCTGGTGGACAAACTTGTTCCATTTCTAAAGTCTTAACGGACGTCCATGAAAAATTATGATAATTTTGTATAGGAATTTCTTGATAAAAAAA
ATTCATTGTCTATAGCGCATGAAAATCGATAAAATCTACCTTCGCCTGCTTTTGGACTCCTTTGAACCTGAAAATGCACCATTATTTTCCCTCAGAATGA
ACTGGTTCAATTTTAAGATCTTAACGGATTTCCATAAAAAATATAGGCTATTTTATTTTGGGATTTCCCGATAAATTTTTTTATAGGATATAACACACGA
AAATTGATAAAAATGTGTCTTTGCCTGCTTTGAGCTCGTTTGAACTTGAAAAATGCACCATTTTTCCCATCGGGTGATTTGGTTCCATTTCTAGGGTCTT
AATGGACATCCATGAAAAATTTTGACAATTTCATTTTGTGATTTCCAAATTAAAAAAATTCATGGGCATAACACACGAAAATTGGTAAAATCTGTCTTTG
CCTGCTTTCTGGCTCATTTGAACTTGAAAATGCATCATTTTTTCCTCGCAAGACGAATTACTTCTATTTCTAAGGTCTTAACAGACGTCCATGAAAAATT
TCGGCCATGTTATTTCGGAATTTCTGGATAAAAATAAATTCATGGGCTATTGTCCACGAAAATCAATAAATTCTATCTTTGTTTGCTTTGTGCTCGTTTG
AACTTGAAAATGCACCACTGATTTTATTTCTGAGGTCTTAACTGACATCCATGAAAATTTTCGGCCATTTTTTTTCAAGATTTTCGCATAAAAAAAATAT
ATGTGCTATAGCACACGAAAATGGATAAAATTTGTCTTTGTGTGCTGTGACGCTCGTTTGAACTTAAAAATACACCATTTTTTCCTGTGGGACGAATTGA
TTCAATTTCTAAGGTCTTAATGGACGTCCATGAAAAACTTTTGTCATTTTATTTTGGAATTGTTGGATTAAAAAAAACAATGGGCATAGCACACGAAAAT
TGGTAAGATTTATCGTTGCCTTCTTTGAGGCTCGTTTGTACTTGAAAATGCACCAGTTTTTCTCACGGGACGAACTGGTTTCATAAGGTCTTAATGGACA
TCTATGAAAAATTTCGGCCATTTTATTTTAGAATTTTCGGATCAAAATAAGTCAAAGGGCTACAACATACAAAAATCGATAAAATTTTCTTTTGCCTTCT
TTGGGGCTCGTTTGAATTTGAAGCGAGACAAACTAGTTCCATTTCTAAGATCTTAACAAACATCCATGAAATTTTTTGGCTATTTTGTTTCATTTTTCGG
GATAAAATATCAATGAGTTATAGCACACGAAAATCGATAATATCTGTCTTTGCCTGCTCTGGGGCTCTTTTGAACTTTAAAAGGCACCATTTATCCCGCA
GGACGAACTGGTTTCATTGATAAGGTCTTAACGGAGGTATACTAAAATATTTGGCCATTTTTTTATGGGATTTCGGGATATAGAAAATTTATGACTATAG
TACATGAAAATCGGTAAAATATATCTTTGTCTATTTTTGGGCTCGTTTGAATTTGAAAAGACACCATTTTTACCGCGGGATGAATTGGCTTCATTTCTAT
GCTCTTAACGGATTAGCATGAAACATTTTGATTATTTTGTTTCGATATAAGAAGAATATATTCATGGACTATATATAGCACACGGAAATTGGTAAAATCT
ACCTATGCCCTCTTTGGGACTCGTTTGAACTTGAAAATGCACCATTTTCCCCCGTGGGACGAATTGGTTCCACTTCTAAGGTCTTAACAGACATCCATGA
AAATTTTTGGCCATTTTGTTACGGAATTTTCGGATTAAAAAAATTTCATGGGCTATATATAGCATATGGAAATCAATAAAATCTTTCTTTGCCTGCTTTG
TGACTCGTTTGAACTTGAAAATGCACTTTTTTCATTGCGGGATGAACTGGTTCCATTTCTAAAGTCAAACGAACCTCGTAGAAGGCAAACCCCTCATTTT
ACCAATTTTCTTGTGCTATAGTCAATGATTTTTTCGGTGATCCAAAATTCCGACGTCTTTTTTGCCCTTTTTTGTGTGGTCTATCAAGACGTTAGATAAG
GAGTCAGTTGTGTGTGACAGTCAAAATGGTCTATTTTGAAAGTCAAACAAGTCCCCAAGCACGTAAACCCCCGATTTTATCGATTTTTTTGTGGTATAGT
CCATGGATTTTTTGTGATTCGGATTTTTGATGTCTTTTTTGCCCAAATTTTTCTTGGACGTTTGTTAAGATATTAGCTATGAAACTAGTTGTCCCTGACA
CAAAAACAATCTATTTTCTAGGTCAAACGAGCCGCGAAGTAGGTATACCCAATTTTGCCCATTTTCGTGTACTATAGAATTTTGATCTCTCTTTTGCCCA
AATTTTTTGTGCACGTCCATTAAGATGTTATCTAGGGAGTCAGTTGGCCTTGACGCCAAAGACAGACTATTTTGAAGGTCAATTGAGCCCCGGAGCAGGT
AAACCCCTTATTTTATCAATTTTCTTGTGCTATAGTCCACGATCTTTTTTGATGATCCAAAATTTCGATGTCTTTTTTTGCCCAAAGTTTTTGTTGACGC
CCGTTAAGATGTTAGCTGCGGAGAAAGTTGGCCCTAAACGTCAAAAACGGTCTATTTTGAAGGTCAAATGAGCCCCAAAGCAGGTAATCCCCTCCCCCCC
TTGATCGATTTTCGTGTGTTATAGTCCATGAAATTTTTGTGATCCAAAATTCCGTCGTCTTTTTTGTCTAAATTTTTCGTGGATGTTCGTTAAGATGTTA
ACTATGGAGCCAATTGAACTTGATAGCCAAAACGACCCATGTTCAAGATCAAACGAGCCCTGAAGCAGGTATATCCCATTTTGCCGATTTTCATGCATCA
TAGTTCATGGATTTTGTGACAGGAGCACCCAAATTTTTTTCTCTCTAAAAACTTTATGAGGATCTATGTTATGAGTTGAGAACCTTTACATATACTCACA
CTATTATTTAACGCCCATTTCCATATTTACAGGCCTTTTTAGAATTTCTTAAATTTTTCAATTTTTTGTGTGTTTTAGCCCATTGATTTGGCATTCTGAG
CATCTGAAGTTTTTTTCTTAAAAAAATTATGAGGACCTCCGTAATTATTTAGGAAACCTTAAAGTACACTCACACCATTGTTTTAATAATTATTACCGCA
TTACAAGCTCTTTTTGAAGAATCGTTCAAATTTCACAATTTTTTGTGTGTATTAACCCATGGATCTGGCGCACGAATCACACAAAACTTTTATTTATGAG
GACCTCCTTAATGAGTTAGGAAACCTTCACGTATACTCACCCCATTTTTTTAACGCTCATTTCCGTATTTATGAGCCCTTTTTAAGAATAGACCTTTTTC
TCAGAATTTCTTTGGCCTATATCTCTCCTTAAACTCATTATAGCCAACTTATCACACTTTTTCATTGGGGCATGCATCTGTGCATATTTTCTTCATATAT
CTGAATTATTTCAATCTCACTTTTCTCATCTTATTCTTTACGAAGGTCCGTCTCACTTTATTATGAATATCTTTATTCTTAATTATTTTATCTCTTCTAC
TATACTAAAACATCCACTTCAATATTCCTAGCTATTGGGAATAACTTGCTAGTAAATAATTAATCTAATACGAATTTTAGAATCATGTCTAATGTAAATA
AATCCTGATTTATAATCACTAATCTATGACATTTATGTAAAATATAGTGTTGATTAAGCAAATATGTACACACCTCAACTATTTCATTAGCTATTTGCCA
TTTTTGTGTAACTTTCTCCATCAAAGCTTCGATAAATGAAAAAGGGATTACATAATCTCTTATACTCATTTCACAATATAATCTCTTACGCTCATTCACA
ATATAAATAGAAGAAAACGACTCTATCAAGATCTTACATGTTTTACTTCACATATTTTTTGTATGTATGTATTACTAATCTCCTATGAAAAAAAGATTTT
GCCAATTCAACATCTTTTGCCTCCAGTTTTCCTCTTCCTGTGTAGCCGTAGGACGAGGGCAGCACCTGAAACGCGCCTTTCTGAATATCAGTCATGATTT
CTGTCTCCCTGCTGCCTCGAGCGTCTTGTCCACTTGAATTCGAGCAACACCAAAGTCTGCAATCTTGATTGACTTGTCAGCAGCAATCAGTAGATTGTCG
GATTCTAGATCTCGATGAATAAGATTCAGACCATGCACATGCTCCACATCCAAGACCAGCTTAACAGCTAACTTCAATGGCACAACTTGGTTTTGCAGGA
ACTGACACACTGATCCCCCTCTTGTATATTCAGTTACAATACACGACTCATTGGCTTTACGACATGCACCAATAAATCGAATAATATTTGGATGCTTTGC
CAACATCGCGACCTCATGCTGAAATTGCTGCTCCATAAAGTGAGCCTTCGCAAGATCAATCGCAGTGCAGGACGAGATAGCTGGCATGCACCTCGACTGA
TTTCGGGGGATACCTATCACTTTCCTCCACCAACATGTACCAAACAACTCTTTACCAAGGCTAGGACAGATGGGAAGAAGCCACCTAGTATTAAACTTTA
ATTAAAACACAAAATATTCATAAAAATGAACGATCAAAGGCAAAATCAAGGAAGAAAAAAAGTAAATTAATTTACCTCGATTGTGATTATGACTCTACTT
GTTTTCCGACGCCGATCAATTTTCAGACTACTGGAGCTTTGAAGAAAGATCGAAGTAAAAACTAAGAGAAGTAACACGAGAAAAAAAGAACACATAGAGA
GAGTAATGTATGAGTACGATTTACATGTGTGAGTACTAGTTTATATAGGGACTACTTGTATTAGAATTGTTCGATAAATTTCATTTTGACCCTTGAATTA
TGATTTATTTCAATTGAACATCCAAACACATGAAATTGTGTTTTTATTATATACTTTTGGTTCAAATTTTAAAAGAAAAAAAATTACTACAAATGAGATT
TATGAGTTCACACTACAAATGAGATTTATGAGTGTAGATAAAAGTCATACTACAAATGTGAATGTATTTGGTTAGATTTAATGATTTTTCCACTTTTGAT
TTAAGGAATATAATCATAATTACCACAATAAAGCTAGTTTTAATAATTTTTTCCACTTTGAATAAAAGATAGTAGTAACAAATAAGAAGAGGCATGAGAT
GAATTTGGTGGTTGGACAACTCAAATATTGCAAGCTAGAATTAATGAATTTTTCCACTTGAATTTAAGGAAAATACTAATAAATACGAAAGAAAAAAAAA
GGCAAATTTTGTGGTTGGACGAATCAAATATCGTATGTGATATTTGATGAATTTTTCACTTTCAATTTAAGGGAAAACACTAATAAATAAGAACAACAAG
GCAAATTTAGAGGATGGACGAATCAAATATCTTAAGCTATATTTTAATGGATTTTTCCACTTTTTGAGTTTTAGAAATTACTAATACATAAGAAGAGGAA
AATAAAATAAAATTAGTGATTGGACGAATCACTGTTTTATTTGAATTGACACACTTCCCCCTTCACTAAAAACTTATATCACACCACCCGCCTTCTTTCT
CAAACTCATGATAAGAAGTGTATTTCATATATCATACTTCTAAATACTCACAAGGAAAGTCTACCCTTTTCTCTAGTCATGTATAGCTCAAGGTGTAGTA
TAATTCGAAATGCCATTAAAGAATCAACCACGCACTAAATGCCATTAAAGAATCCCAAAGTAACTACCGTCTAAATGGAAAACCTCTTAACCATGGCAAC
TCTAACTTAGTCTTCACAGGCTTAGCATAATCAGACTATAACCTACCATAGACCCTTTGTTATCCGTAGTTGGAATTGGTAATAACATCATTAATAAAAT
TTCAACTGAAATTAGGGAGAATTCACCAATATCAAGTACTCATAAACAGATTACAAGCACAGAAGATAGAAACACATCGCTAACTAAGAATTTAGATAAA
AAATGGAACTCTAAAACAAGCCTAGGGATGCATAAATTTAGCTGCTTAATTACTCTTCATTGAAACAAACAATCATTTTGTAGTCTTGTTGTGAGTTAAC
AAGCTCATAATTTAGAACCGTTGAATTCAGAAACCAAAATAACATCAGCAACAACATTCCCACGAAAAAAACAACTAATTTTTAACTAACTTCATATACC
AACAAACAGACAAGAATTACAAAATGAAATGAATCTCTACAATGAGTCTATATGTTTAATTTTAGGTGCTTTTTTAATTTGCATTGAAACAAACAACTAT
GTTGAAGCCAACTGCAAGTTAGCAAGCTCATAATTAAAATTGCTAAGAGAATCAAAGATCAAAATAACATAGTCAGCAAACTGACGAGAAAAACGATTTA
ATAACAACTATATGTATATATATATATATATATATAAAGAGAAAGAGAATATTACGCGGTTATCGATGTTGCATTCATCCTTCTCATCATGAGCCATGAA
TATATAGGTCCGTTTGACATATCGATTGTAAGCCTTGTTCAACACTGTTGTTCTTATACCGGCTTCATCTTACTCCGTCGTTTTCTCCAGCCAAAACCCT
ACCAATCACAGTTGAGTTTGAAGAGGGTGTTGTGTACAGAGTCTTATCCCCCCCCCCCCAACCATGTAAAAGTAGAGAGGTTGTTTCCGATAGGTCCTAA
AACATATCACAATGTGTGCTGCACTGATAAAACTATCAGAGTGTAACAAAGGAAACAAGGCTGCAAGCATAGATGAGTATTTCATATAATTCAGAACCTG
ATACAACTTTGAACAAATTCAGCAAGCCAACTAGTCGCTGTCTTAAATCCACAGCATAGAAATGTTTAGTTTTTTCGCATAACTATAACCCTTTTTCTAT
CTGAAAAGAGATTGTGCCGGATAGATATTATTAACTCAAAATCAGTTTTTCAATTCAATGTCTTTTGCCTCCAGTTTAATCTTTCCCAGTAGCCGTAGGA
CGAGGACAGGACCTGAAACGTGCCCTTCTGACATTAGTCATTATTTCTATCTCAGCCGCCTCAAGCATCTTGACCACCTGAGAGAAAGTTGGTCGCTTAT
CGGGGTCAAAATCCCAGCAGCAGGTCATGATATTAGATAAGACAGGCAAGCAATCATTGGGGATTATTGGACGGGCGCCTTTGTTGACAACAGCAAAAGC
GGCCTGCACAGCAGTCATGCTCGGGTAAGGAAGCAACCCTGTTATGAGCTCCCACAGAACAATGCCAAAACTATAAACATCAACTTTCTGGGTGTATGAT
CGGTGCTGGAGCATCTCCCTACAAAACAAAGTCAAACGCTTAGACATCCACAACAAAACACAGATGTTATTGCTAACAACTTTGCGCATCATTTTCCTTT
TTCTGAATCAGATTGTGCCAACCAAGGAGATCATCCAATAGATATCAATAAATTTTCAACAGTATGACAATCAGGTACTAACGCATGAATTAATAAAATA
GTCAGCCTATACAAGCACCGTAACACATAACACAAACTGTAAAATATATTCTTACATACCATATACCTGCTTCTAAATTAGTTTGGCGTATCATAATACA
TATGAACAGATGGCGTTTCATAATACATATGAACAGACTTGGCAAATCAAGCCCATGTGGACACCCCTGCCCACTAAATAGATTTAATGCTTTTGTTTTT
CCTATCATTCTTGGAGGTGATGAGTTCTAGTGGAGAAATCCGAACGGTTTCAAATATTCTTATTCTTCAGCAACTAAAGGTAACATGTGATCCATATTAT
ATGGAGTATGGACAGGTAGGTTCTATAGAGTGGTGGTTAGACCGACCCTGTAGTATGGGCAGGGGCGGATTTAAGAGTAGTCTGCTTGCTTACTTGGAAA
AATTGTGATTAAAAGGGAAAACAGATAAAAAAAGATATATAGTACAAAGTGATACTCTACATATTTGTGTAGCTTAGTTGGTAAGTCTTAGCTTTTCCAA
AGATGAGGTCGCGGGTGCGAACCTGCTTAACCTCATTTTTTATACAAATTTTCTATTTTCTTTCCTTCTTTCTCACTTTAGTATAAATTACCATTTTATA
TTATTTTCTCCTTTCTCACTTTTATATATATATATATATATATATATATATATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTACGCCACCGAGTATGGGGCAAAGTGTTGGCTTATTAAGAAAT
CTTATGTTCATAAGAAGAAAATCATTGTGATGAGAATATTGAGGTAGATATTGTGGGCATACTAAGAGAGACAAGATTAAGAATGGAGATATCCTGGACA
AGGTAGGAGTGGCCTCCATGTTGAACAAGATGAGGGATGTGAGACTAAGATGATTTGGACATGTGAGGAGTATAGACGCCTCACTCCTCATAGGAGGTGT
GAGATGTTGGTAGTGGAGGACGTCATGAAAGGTAAAGTCGGGCCACAGAAGTACTGGGAGGGAGTGATTAGATGAAGTGCATCTAGATCTTACTGAAAAA
ATGGCCTTTGATAAGAGAGTATAAAGGTCGCGTATTAAGGTAAATTGTTAGTTGGAAATTGAGCATTCTCTTGCTTCCTGATTAGCAAGTTTATTTAAAG
TTTAGGGCCTTTTCAGAAGAAAGCTCTATCACAACAAGGTAAGGGCAACATTGCATACACTCTACTCTCTCAAACCCCACAAGTGGGATTGCACTAAGTA
TGTTGTTGCTACTATTAAATAGGGTGGACCTAGAGTATTGGGTATAGGTTCACTGGAATCCAGTCAATAAATAAATAGAAACTATTTGTTGTGATCTACA
AAGTAAGTTATTGGTCCAACAAGATAAATGGGAACTTGCTTAAGCTTTATTGCCCTCCTCATTGAAGGCTCAATTCCCCGTATCATTGGGACTGATAATT
TTTAAATCCTAAATCCGCTTCTCATATGGACTTGTTTGTGACTATGAATTTAATTAGATCTAAGTATCATTATAGGTATGCACATTTTTTTGTAAAGTAT
TTGTGTATTTTGAAGAGTACATACAACAACGACACACCTATTGCAATAAGTATGTAATGCGAAGGACCGATATAACATAGCATGTGAGGCACGAAAAGTT
AGATGTCAGAATACTGAGTCATAATCGGCCTCATTTACGATCTCAGTAACTCAACAAGTTATACTAATTGATTGATCATTATGGGGTTTTAATGCTCCTT
TGGTTTCAAAAGATCTAGTTCAACATATATAAGGCATTTGTCAAATCGGGTGTAGCAACATGTGTTGTAAGACTTAATACCAAATAAGTCATTCTTCTTA
TCGGGCATTGATTTCCTCGTGTGTCACATAGCTTCCGCATTTTTGTTCAAAGCCATCTCTTAAAGAAATTTGAAGTATGGGATTACTGCTTGAAGCAATG
CACTTCGGATAAGTTGTGCTTTAAAAAATGACGCGCAAAATGATTTTAGCGAGAAAGGAACTAATAGCCATTCTGCTTCACTTACTTCTTATAGCCATTC
TGCTTCACTTTTTGCTTCAAATTACTCCATGGACTTTGTCGGTTTTGGTGTTTACATGAAAGCGGATGGCCTACTTGGAATTGAATCGGCCATTAGAGCT
AGAACTTTGAGGTCACGAGGTGAGAATTTCATCTTTTAATTGTATTTAAAGCTTCAACATTTAAGTTATTAATCTTTTAAAATTACTCTTCTATAGTTGA
ATGGTGGATGCAATTTGGTCATAATGTCCCAAACTTGCAACAGTTTGCTATTAGAATGCAAAGTTTAACTTGTAGCGCATCCGATTGTGAGAGAAATTGG
AGCGTGTATGAACATGTGATAAACTATATTACATTAATACATTATTACTAATTTAATTGATACCTTAATCATCCCAAGTCAACCTGTTAAGTACTTTCTA
CTATGTGCAGATTCATAGTAAAAAGAGAAATAGGCTTGAGTTGACACGCCTCAATGATCTAGTGTTCATCAAATATAATAGAACATTGGCGCGTCGTGAC
AATGCTCGTAATACCATTGATCCAATTTTGTTGGATAGTATTGATGAGGCAAATGAATGGTTAACTGGAGCACCACAAGATCACCAAGATGAAGAAGTGT
ACGAAGGAGAAAGTCTCACTTGTGGTGACATTTCTATGGCAAGTGGTATTGAGGAGAATATTTATAATTTTTGGGAGAGTACTTTAAGGGGCAAGGAAAG
AGGAGTTGGAGGTTCTAGTTCGAGTCGAAACCTCGTTGATGAGCCTTCTGATGATGAAGAAGATGATGACCAAGTAGAACCCTTGGTTATGGCACTTGAA
GAGTTTGAGGATCTTGTTGAAGAATGGGAGTTTGAGTCTTTGTGATCTAATTATGTTTTTGATTTTTTGTTTTATATGTTATGACTTATGAGTATTATTG
ATTATCTATCTATAGAGTTATTTAATATTTTTTTATTTTTATACTAAATGTCGCTTTTTTTAAAAGTGTGTGCTTCACTTCACGCTTCTCTTCCGTGAAG
CGAATCCTCATCGCTTTTTTCCGCTTCTCGCTTCCCAAAAACAGTGTTTCTCGCTTCATATAAGACTACTCTTAATAATTGGAGGTTTCAACAAATGATT
CGACTTCATGAAAAGACTACTAAATTTGTATATGATTGTCTAATGATGAAAAAAGTCTATGTAGTAACTCAACGGAGAATCATATCATTGTTGTAGCGTC
TAGTTTTTGCAAGGCCCTTCTAGAATTCCATCTAGAAACATCCGAAGAAGAATGAACTTCTTTCCACCTCAGAGAAACTAAAAGTGGCATACTTCATTTT
TTAAAAATTAAAGTTGGGTCTAAAAAAAGCAAACCAAACCATAACCTGATCTAGCCCAAAACACCTACAGCCTGTCCAAATATGAAAGAAATTAAAGAAA
TGAACCAAAAGGAAAAAACAAAAAGAGAGATGGTTGTCTTCCAGCTTGAGCTTCCATCTGCCATGGAGGACGAAGACGAAGCGATTGCCTTGGAGTGAAA
TTGACTCATCAACAACTGCAACCAGCTGAGTTCGGTTGTTTCCACATAAGGCACTCTAAATCTCATGGAAACAAATTTCATTGTATACTTTTCAATACAG
CTCGAACAACTCATATAAGAATCGATCTACTCCCTAACTTACTTTAATCTTGTAACGCCATCCTTGAGCTCCATTTTTAAGTTTTACCCTTTCCAGCAGA
TTCAGTCAGAAACCCTAACTAAGAAACCACTGCATAGGCCAGGGACCCATTCTTACCCATACATTATTCTAAAATAGCTTCACTGCTTTGAAGAAAGAGG
TAATGCTAAAGACGGTGCAGGAAGATCGATACTCACGAAGGAGAGAAAGAGATAATATACTTCCCATAGAATTTCCATTTACATATTCGACAAGAATAGA
ATTGTGGTTCATATCTCTCAGACACATCCAGTAAGTGAACTCACTGAGGTAATTAATGTCTTAGACCCCTTTTCAGATAAACGCAACTTTACTCTATTTG
AAAATGGAATCCAATCCAACTTGCAGATATCTCGACTTCATGTAACTATACCCACCAAGGTTTCAGGTTTAGGCATATGGGAAGAGTACACTTGGTGTTT
TCTGTCACTGGGATGATTGAACCCTAATCTTCATTGACAACTAAGCGAAACCCTTAAATGTGTCTAACTTGAATCAAGTTACAAGTCTTGGACAAGAAGG
AAGAGGAAAAGGATGGAAATGAATTGAAAGAGAGTAAGGTCAATCAACTCTTTAACCTCGATGCTTTTCACTTCAGTTTTTAGAAAAATTATTCAATAAA
GAGAATCCAACATGCTACAACAACATACCCTATGAAATCCCACTCAATGGGGTTTGGGTTGGGTAGAGAGAAAGCAGACCTTACCCTTGCCTCCTAGAAG
AAGAGAGGTTGTGTCCGGAAGATGTTTGGCTAAAGAAACATGTAACAAAGTAATTTAAAATAAAATAAAATACATAAAGTAATGCAGACAGAGAAAACAA
TAGCCTAAAAGAATAGGATAAAAGGCTTAAGAGCTCTAATATAGGATTTGGCAATAAGCTCAAACAGGATCAAGACAACAGATTTGACAAGGCTGCTATA
GAGTCTAGATGCTTACGGAGCCATCCAGCGGTAAGTGCCAGTTTCTGGTGTCATTCCTTCAGTTAGCACCTCAATCCGAGCAATACCGAAGTCTGCAATC
TTGATTGACTTGTCAGCAGCAATCAATAGATTGTCAGATTTTAGGTCTCGATGAATGAGATTCAGACCATGCACATACTCCATCCCCTTTGCCACATCCA
AAGCCTGCTTAACTGCTAACTTCAATGGCGCAGCTCGGTTTTGTCGCTTCGCGAGGAACTGACGCACTGATCCTCCGCTTGCATATTCAGTCACAATGCA
TAACACCATGGTTTTACGACATGCACCAACAAATCGTATGATATTTGGATGCTTTAAATTTGCTAGCATCCTGACCTCATGTTGAAATTGCTGCTCTATA
AAGTGAGACTTCTCAAGAGCATGTTCTGGCCTCTCTAGAAGCTTAATGGCAACATCTTCACCATTATAAGTTCCGTTATAGAGCTTCCCAAAAGAGCCTT
GAGCAAATGCTTGTCCAATGGTAAGCCTACTCAAGTCAATTGTCCACTCATCACAAATCACAAGCCCAGTGGTGGGGAATTGAGGATCAACCAAGGCTTG
AGCAAGGGCATCATCGCTCAACCTAGAAACTCTCCCCCCGACTACGCTAGCAGCGACAGAATAGTTACTGTGGATATGATTACCCTGCTGGTTTAGAATA
TCAGTGTGAGAACCATTTGAACCAACACTGCTGTTATCCACTGCCATTGCACCAGAACCACTAGCATTGTTCATCCCATAACCTTGAATAGACATGTTTG
CCCTTTGCCAATCTTATGATAAAAAACTTGCGACAGTTTTGATTCAAATCTACAAGTCCAACAAATGTCGGAGCCCCGGTAGTTTTTCTGATAAAGCAGG
TACAGTAGAAGAGCTTCAATCCGGCTTATTTGTTTTGCATAAAGATTTCTAAAATCAAGCCGTACCTCAACAACCCTGAAAAACATAAAAATTGAAAAAG
GTTAGGTTCATCAAAATCAATTCTTCTATGTAGACCTAGAAGGTCAAACGCTTGTGAAACTGAGTAATCATGTTTCCTCTTTGATGAAAAACATACTAGA
GGTAGGAAGCAATTATCTCCAACTTCAACTTTCACCACTACAATTTTCTTCCGATTATAGGGGGTTTTGCAAGAGGAAAAAAATGTCGGAAATTTTATCT
CCATATCAAACTTCCGAAGGCAAAAAAAATCCAAAATTTAAACATAGTACAACTTTCAGCAGAACTCCACATCATAGAAATTAAAAAAAGGCTAAACTTG
TCACAAAAAAAATAGATCTAAAAGGACGAACGAGAAAACATTACTCCAATTTCAAATCTTTTTTTTAGTAAGAGTGGTGTTCGGGCTTAGTTTGCGTACA
TTTCGACTAATTCAAGGGGATACCTATCACTTCCCACCCGCAACAAGTACCAAGCAACTCTATTTACCAGGGCTAGGACGGATGGAAAGGAAGCACCGAA
TGTTAAACTTTAATCAAACCATAGAATATTCATAGAAATGAACGATCAAGGGCAAAATCAAAGAGAAAAGTAAATTTACCTCGATTTGAATTGAGATAGA
AAGAAAATGAACCACTTCTATTCTTGGAAATGAGGTATATGAAGAATGTGATGACTCTACTTGTTTTCTGATGCCGATCAATTATCAGACCACTGGATCT
TTGAAGAAAAATCGAAGTAAAAACTGAGAGAAGTGAACACGATAAAAAAGAAGAACACAAAGAGAGACTGATGTATGAAAAGAATTTTCTTTAGCTAAGA
TAAAAGAAAATCTCTATAATGTTTTTTTTTGCATATGGTGTATTCAATCGCAAGATACATGTGTGAGTAAGAATTTATGTGGGACCTACTTGTATTAGAA
TTATTTTAGTGTTTAATAAATTTCATTTTGACTCTAATAAATATGAGGATAAATTTTAAAATGTTCTCCAATTATTAATTATAAATGTCCTTAATTATTT
AAAAGCTTAGTAAACATCAAACAAAATACATGTGCTTGAGATTTTTTCTTTATTTTAACTATAGTTAATCAGCCAGTAAGTTCACATCAAAAAAGTGATT
TTGGAGTGTGGATTACAAATGCGATTTTGAAAGTGAATGTATTTGGTTGTACATACAAGTTAGATTTAATGAAATTTTTCCACTTTTCATTCAAGGAATA
TACTCATAATTACTACAATAAAGCAAGATTTAATAATTTTTTCCACTCCCAATTAAAGATAGTAGAAATAAATAAGAAGAGACACAAGAGAAATTTGGTG
GTCGGATGAATCAAATATTGTAAGCTAGATTTAATGAATTTTTCCACTTTGAATCTAAGAAAAAAGTAATAAATAAGAAGAAACATAAGACAATTTTGGT
GGTTGGATAAATCAAATATTGTAAAATAGATTTAATGAATTTTTCCACTTCTAATTTAAGAAAAATACTAATAAATAAGAATAAGAAAAAAGGCAAATTT
GGTGGTTAGACGAATCAAAATACCATAATTATATTTAATGATTTTTTTCCACTTATAAATAAGAACAACAAGGAAAATTTGGTAGATGGATGAATCAAAT
ATCTTAAGCTAGATTTAATGCATTTTTCCACTTTGAATTTTAGACATTACTAATAAATAATTAAAAAAAATAGTATTTGGACGAATCACCATTATATTTG
AATCGGCACATCTTCACCTTCCATGAAAACTTATATCCCACCACTCTCCTTCTTTCTCAAATTCATGATAAGAAGTGTATTTCATATATTATACTTCCAA
ATATTCACAGGGACTTTCTACCCTTTTCTCTCGTGTTGTATGGCTCAAAGTGTAATATAATTTGAAATGCATTAAACAATCAACCACAACACGATCCCAG
AGTAATTACAGTCCATAATGGAAATCCTCTTAAGCAGTGTCGCTCTAATTTAGTCTTCATAGGATTAGAATAATTAGATCATAACCTATCATAAACCCCT
TTTATATCCATACTCCATAGTTGAGACTGAGTAATAACATCATTAACAAAATTTCAACTGAAAATGTAAAAAAAAAAGGGAGAGATAGATATCTGTGTAT
AAAGTAAAGTATTTTGTTTTTAGTGTTTATCATTTTGTGTCGGTTGAATATCAGCCATATGTAAAAAAGTATTGTAAAAGTATGTCGGTCAATAATAAAA
AATAGGCCATTAGTAACAGTAAGTTTTTTGTTTTTTGTGTCGGCCAAATGTAAAAAGGCCAAGTGTGAAGTAAGTGTCGGTCATTTTGGCCAAAGGTGTA
AAGTTTTTGTGTATAAATAGAGGGTTTTCCCTCATAATAAAATCATCCCCCTTTCAAATACATCTCTCTCTCACTCTGAATCCTTTTAATTCCGCTTCCA
CCCCACATTGGTATCAGAGCTAGCTAATAAAATTAATAATTATGGAACAATCTGGAGTTACAGATCTACAAAAACAGGTATACACTCTTAATTTATGAGT
AGCTAAATAGATTTATTTCTGAAAATCTCTTGTTGATTATAATTGTTTATCATGTCTTAATAATGTTATAATAACCATCTTTAGAAGGTTTGCTACAGAA
ATATTCTTCGAATAAGTATGCCCAGACTATGCTATCCTAAAGTTGAAACCGAGTTGAAACCGGTAGGCAAGAAGGCCGTTTGGGGGAGTAAACAAAGTTG
AGGCGCTGTTAGGGTAACTAATCAAAGAAAAAAGCTATAGTAGTGACTAGATGAGATGATTATTAAATCATTATTATTTCATAATAGGTAAGTATAATCC
ATTAAGAGGTCGGAAGGAATAAAACTTTTAATCAAAATGAATAAGATGAATAATTATTTAATAGATGATGATGATGATTATAAGATATTACTACTCTATA
TACTAAAAAATCTTAGTACTGATATAAAAAGAGAAATTTATGACAAATTGGTAACATATGAAATAATAGAAATAACAACCCAAGGTTGGACTGAGTTAAC
CATACAGAGTATACAAGATGAACTTTACTATGATATGTATGATTTATATGATGATCTAGATATATTTACAGATTAATGATAAATTACGAATACTTAAAAT
ATTGGGTAAAAACCATAGAAAACATATATCTACTTGAAAAATTACTAATTGAAAATTTATTCGATTATTTAAGAACTCGAGAAGTTGAACATCTAGAATA
TATTATAAACAATGCTAATGAAATGCAAGGATTAGATCTACTTAAAAGAGAATATTATAGAAAGACATTTTATGAAGAATAATATAACACCAAGCAAAGA
AACTAAAACAACAAGAACCAAGATAGATAAAAAGGTACGAAAGATATGGAAAAAATTAAAATCCTTGTACATAGAATATGAACTATCACAACTTACCAAA
ACAAACAATGATAAGAAAAACCATTTAATAAAGATAATTTCAAAAACAGAGTATAAATATGTATGTTATTTAAAAAAATAACATGGACAAAGAAATATAT
AAGCAACAATTGATAGAAAAGATAGATGAAAAAAGCAAAAAAATACAACATAGAAAAGAAAGATTAATAGAAAATATATTAGCAGGAGTATGTAATAAAT
CAATACTAGCACAAAGAAAAGTTATATTTATGTTAGAACTAGAATTAGATTGTCTTGAATATAAGTTACAACATAATATAATACATAAATTATAATGAAC
AAAGAAGAATTTGCAGTAGACGAAAAGACATATGAAAATCAAGACGGAATGATAATAAAAATAATATTTTCAAATTAAGGAAGAAGATATAAAAAAATAG
GAAATAATCTATACTTGATGTTAGAAAAAGAAACAGCAAGATTAGAAGATAGTTTAACAACCATGATAAGAATAACAAAAGAAAATGAAGAAATAGACAA
ATCAAGAGAAATAAAAAAAATAAAAGTAGAAGCAAAACAAGAAGTACAACATTAAGAAGAAATAAAAAATACAAGAATAAACGAACTAGAAAAAGAATTA
GCAAGGTTAAAATTGTTATATGAAAATAAACAAAAAGAAAAACAGATAGAAAAAGAAAAAGAATTAACAAATAAAATAAACGAGATGGAACAAAAATTAA
ATGAAGATCTTGAGGTAAATGAAGTAAATGAAATAGATGAAAATGAAAATGACCAAAAATCATAAATAAGTGACATAAGTGAGACATATACAGAAATTTT
AGAACAGGTAAATAAACTAAAAAAATTAGAAATAAACACAGGAGATATGAATAGACCTAGTACGTCAAGAGTTAAAACTCCAGATAATAGTCCCAAAAAT
AGTCCTAGAGCTAGTCCTAGATGGACACCACCAACTTATTATACAGAAAGTTATCAGCAATCAGATAGAACTAACGCAATATGGAACAATAGATTAAATA
AGAATTGGACACCAAAATCAATAAATGAACAATATAATTTTTTAGATCTAGATTGTGTTACAGACATAAATAAAGCAATATTAATGTGGATAGGAAATAT
ATCTAAGCAACGAATAGATAACAAAATAGAAACAACAAAAACACCGAGATACATAGAAAGAACATTCGTAGGAACAACAAGATTATGGATAGAAAATCTA
CCCTCAGAAAGTTTAGAAGTACTTAGAAGTGACAAGAAAATAGATGGATCTCCATCAGCAACAAATATAGATATACTAGATAAATATGAGTCAGCAATAA
GAAATGAATTTGGAGGTATGACTACAGATATAAGAGAACAAAACAGAGAAAAAATAATAAATAGACAACTTATGACAAAATTAGCTATATGTAAAATGTG
TTATATAGAAGAATACACTTGTGCATTTAAAGAATATTATTACAAAGCAAAATACAATTTTGATGAAGCAAAAGAAATAAGAAAACAATATTTTACGAAA
TTACCAGAGTCATTTAGTACAAAAGTAATAAAAGATTGGAATGATGAAGGATTAGTAGATACCTTAGGAGCTAGAATAAAATTCCTATCTCAATGGTTTA
CACAATTATGTGAAAGCCAAAAAGAAAAATTAAAAATGGAAAAAGTACTAAATAAAAATTTAGCATGTTGAAAAAATAGAATGGCACCACAATTTGGATG
TACAAATAAAAAACAAAAATCCAAAAGATATAAAAATTATAGAAAAAATAAAACTAAGTATAAAGATAAACAACCAAGACGAAGGTATTATATAAAAAAT
TATAAAATAAAAAGACCATATAAACCAAAGAGGAAAATATCCCAATGTACTTGTTACAATTGCGGAAAGATAGGACACATAGCTAAGGATTGTAAATTAC
CAAAAGATCCAAAAAGAAAACAAATAGCAGAATTAATCATAGACAATGAAAAATATATGCAAATAGAATACATAGACTATGAATTAAGTGATAACGACAG
CATATATGAAGTATCAGATATAGAAACTGAAAATGAAGAAGAAAACTTAGATAATAAAATAGAAGAAGAAATATAATGTCTGAAAACGAAATAATATCTA
AAGAAAATTATGAAAATGAAGAATTATCACACCAAAAGATTATATTTGATAATACAGTTTTTGAACAAATAAAAGGAAAAAAATTAGATTTAAGTGTTGA
AAAGATACTTGAAATACCTACATTAAAAAAACTGGTTTAAAAGACAAAAAGAAGAATACTATGTAGTTAGCCAAAAAGAACACGTCATAGACTGTAAATA
TACAAGCGGAAAAGCATATATACCTATAATAAGCAAACGAATAATAAATAAAGAAATACAAGACATAAAAAATAAAGCAGCTATAAAATATGTACATTTA
GGAGGAACAGAAACACTAATAAAAGCTTGTTTCAGAGAAGGAATAGATACACCCATTGAAATATATTTAACAGATGACAGAATAATACACCCTATAGAAA
AAACTGTAATAAGTGCAGTTAAAGGAAATTTAATATACCAAAAATTTAAATTTATAATAAGTGCTAATTATACAGTAGCATTAACAGATACAAATATAGA
TAAATCATTGGTATTATATTGGAAAATGTCAGGAATAGAGTTAACACCAAGAAGTAAGGTATTCACAGCAAGATATAAAAATCTATATATATTAACAACA
AAACATAAAATAACAGCAAAAAATAAAATTGATAAGATAAAAATAGAAAATCCTTTTGAAAAAATAATTACTGTAATAGATAATAATGACTATAGCTATA
AAGAAATTGATACAGAAGGAGATTTGAAAATAGTAAAAGAAAGATTAAGCACCTCAAGTACACCAAATACAAGCACATTAAATATGTTGACTAGAGCTAC
CTCATCAAGGATGAGTACATCTAAAAGAAAATATGAAATACCACAAAATTTATTAGAAGAAACGACGCCATATCATTATTTTATAACGGGAATAATGGAC
CAAAGAAAATATAAAATCTTGATAAACACAGGACAAGAAGAAAATCATATAACAAGAGAGTTAGTATTAGAAGAAGAAATTATAAAAACAGGACACATAT
GCCCTGGATTACCTAGTGAAATAGTAAATACAAATGAAGAAACAACAGAAAAAGAAATAATTATAGGAGGAATTCCATCAAAAATACAATTTAAGATATA
CGAAGGAAACCATAATATCGCGTTAGGAATAAAATGGCTAGAGAAAGTTAAACCATATAATATAGAAAACGAACAATTAACAATAACATGTCAAAATAAG
AAGATAATCATAAAAAGAACAAAATGAATAATGAAAATATATATACTCGCAAAAATTATCATAGAAGGATACCACAACAGATATTATACCCCTATGATAG
ATACAGGAGCAGAAGCAAATATATATAAATATAATTGTTTACCAGAAGATAAATGGGAAAAATTAAAAACACCAATGATAGTAACAGGATTTAATAATGA
AGGAAGTATGATTAAATATAAAGCAAAAAATATAAAAATACAAATATGGGATAAAATATTAACAATAGAAGAAATCTATAATTTTGAATTCACAACAAAA
GATATGTTGCTAGGGATGCCATTTCTAGACAAATTTTACCCACATATAATAACAAAAATACACTGGTGGCTTACTACGCATGTGGCTATAAAATAGGAGC
AAAAAGAGTAAAAAATAAACAACGAAAATCTATGGAATGGATAAAAGGTAGTGAAAAAATAAATCAGGAAATGGAAAATATAAATGAAAAACAAATAACA
CAATTAGAAACCATTATATTTACAATAGACAGAGTCAGAATAATTAATGAACAACTAGAACAATTATATAATGAAGATCCACTACAAGGATGGGAAAAAC
ATAAGACAAAAGTAAAAATTGAATTAATAGACGAAAATAGTATAATAACACAAAAACCATTAAAATATAACTTTGATGATTTACAAGAATTTAAAATACA
TATAAATGAACTATTAAAAAACAATTACATACAAGAGAGTAATAGCAAACACACAAGCCCAGCATTTATAGTTATAAAACACAGTGAACAAAAAAGAGGT
AAAAGTAGAATGGTTATAGATTACAGAAATTTAAATGCCAAAACTAAAACATATAACTACCCAATACCAAATAAAATATTAAAGATAAGACAAATACAAG
GATACAACTATTTTAGTAAATTTGATTGCAAATCAGGATTTTACCACCTAAAATTAGAAGAAGAATCTAAACAATTAACAGCATTCACAGTACCACAAGG
ATTCTATGAATGGAATGTATTACCATTTGGATATAAAAATGCACCAGGTAGATATCAACATTTCATGGATAACTACTTTAACCAATTAGAAAATTGCATT
GTATACATAGATGACATATTATTATATTCTAAAACACAAGAAGAACATATAAGATTATTAGAAAAATTTATACATATAATTAAACATTCAGGTATAAGCT
TAAGTAAAAGTAAAGCAGAAATAATGAAACCACATGTAGAATTTCTAGGAATACAAATAGATAAAAATGGGATAAAAATGCAAACCCATATAATATAGAA
AATAATTACCCTTAGCGAAAATATAGATACAAAAAAGAAATTGCAATCATTTTTAGGATTAGTAAACCAAGTAAGAGAATATATACCAAAATTAGCAGAA
CATTTAAAACCACTACATAAAAAACTTAAAAAGGATGTTGAATACTATTTTGACGAAAAAAGATAAAGAACATATAAAAAAATATTAGAAAATTATGTAA
AAAATTACCAAAACTATACTTTCCTGATGAAAGTAAAGCATTTACATATATAGTTGAAACAGATTCAAGTGATCACAGTTACGGAGGAGTACTAAAATAT
AAATATAACAAAGAAAAGATAGAACATCATTGCAGGTATTACTCAGGAACATATACTGAAGCACAAACGAAATGGGAGATAAATAGAAAAGAATTATTTG
CATTATATAGATGTTTATTAGCATTCGAACCATTTATTGTTTACAATAAATTTATCGTAAGGACAGATAACACACAAGTAAAATGGTGGATAACTAAAAA
GGTAGATGATTCAGTTACAACAAAACAAATAAGAAGATTAGTATTAAATATATTGAATTTTACATTTACAATTGAGATAATTAAAACTGACGAGAATCTC
ATTGCAGACTACCTCTCAAGAGAAAGATACAATGAAAGACCTATTGACTATAATGACAAATCTATGCCAAAAAATAGAAAAGATAGGAGCAGATGTACAA
GATCTGAAAGGAAAAACTAACAGTCAGCAGCATGACTATAAACATGCGGAGCTACGTCGTTCGGCGGACGGTAAACAGCCAGAACTAGAAGGAGACGTTG
GAAAACTCCAAAAAATCCATAACAAAGTTTGTTTAAATACAGCTGCAGGTACGAGCAAAAAAGATAGTGAGAAATCAAAAAATACAAATTTAAACCAACT
ATTCATAAAACCATTTATCCAAAAACCACAAGTACAGATACCCGTGGAACCACAAACATCCACATATGCAGTTAGTCTACAGAATGACAAAAAGAGATAC
AACTACATTACGCAGTCCTACATCAAAAACATATACAAAATCAAGACATATTTAAACTTGAACCCAAGATCTACGCAAACAAAAAACCCCGAAGAAGACT
ATATAACCCAGAAGTTATAGGGATATAACAAACTTATAGCACAACCTAAAACCAGTCCAAATTTAGTTAAAACATGTTATAGCTATGGACTACTAAATAC
AGTATATACATATACCGAAGAAGAAATAATTGGAATACCGGAATTACATAGAGCATTTGTGACATATAAGAGAATTACTAAAGGAAACCTATTTTATATA
AAATTCTATACAGCACCAGCTGAGATATTATACGAGGAGATAAAGTCGCCAATACAAGTTGTAAAGATAGGCCTGACCAGAGATATGATTATACCGGAAG
AGATAGAGAAACAAATCAAGATATCAAAGATAGAAATACCAAACTTTTATGCGAATAAAAGAATAATTGGAATAGCAACAATTATACAAGAGTTATCCAA
TAATTATTTAAATGGCAATGCTATTTGGAGTTATTATGCACGAGATCAAGTAATGATTTATTCGAACTCCAAAGAGCTAAGGAAATCAGATATGGATGAA
GTCCAGCGATGGATTTTGTCATTACTAAAGCCAGAGGAGCAACCAACTACAAGAGCCTTGAAGAAGGAATTTATTTCAGAAGAGTTATTAGTAAGATATT
GTAAACTTATCAGCAACAAATACCCAGATCATAGATGCTCCAAGTGTAACGGAGAAGATAACGTAATACCAGCAGTTGATTTGGGATAATGACAAAAGAA
ATAAAGCAAGCTAAATCAAAAAAGATTCATACAAGATAAAAAAAAAGGGAGAGATAGATATCTGTGTATAAAGTAAAGTATTTTATTTTTAGTGTTTATC
GTTTTGTGTCGGCTGAATATCAGCATATGTAAAAAAGTATTGTAAAAGTATGTCGGCCAATAATAAAAAATAGGCCATTAGTAACAGTAAGTTTTTTGTT
TTTTGTGTCGGCCAAATGTAAAAAGGCCAACTGTAAAGTAAGTGTCAGCCATTTTGGCCAAAGGTGTAAAGTTTTTGTGTATAAATAGAGGGCTTTCCCT
CATAATAAAATCATCCCCCTTTCAAACACATCTCTCTCTCACTCTGAATCCTTTTAATTCCGCTTCCACCCCACATTGATATCAAGGAGAATTCACCAAT
TTCATGTAATAAACAGATTACAAGCACAGAAGATAGGAACACATTGCCAACTAAGAATTTAGATAAAAATGGAACTCAGAACGAGTCTAGGGATGCATAA
TTTTAGCTGCTTCTTTATTCTTCATTGACATAAACAACCATTTTGGAGTCATATTATTAGTTTACACGCCCATATTTTAAAACAATTGAATTCAGAAACC
AAAATAACATCAGCAACAACATTCCCATGAAAAAAAATCTAATTTTAACTAACTTCATGTACCAACAAACAGACAAAATGAAATGAATATCTACAATGAT
TTTAGGTGCTTTTTTTAATTTGCATTGAAACAAAGATCGAAGATCAACTATTTTTAAAAATTGCTCAAAATAACACAATCGACAAGTTTTCATAGAGAGA
GAATATTTATGCGGTCGCCGATGTTGCATTCATCCTTCTCATCCTGAGCCATGAAATCAGAGGTCCATTCGACATTGTTGTTCTCACTACCGGCTTCATC
TTACTCCGTCGTCTTCTACGGCCTAAACCCTAGGAATCGCCGTGCTAAAATCACCGTTTACAGCCAAAAGCATTTCACTTCGAACGACGTCGTTTGCTTT
TAAACCTCTTTGCATTCTAATGTATAATATATGAGTTATATGATGGCTTTTGCACCCACCTAAGTTATTTTCTTATACATTTTGACCCCTTAAATTTTAT
GACGATAACATCAACAACATATTCGATGTAATTTTATGAATGGGATCCGAAAAAGGTAAAACGTACATATACTAAGTAGAAAGTTATTTCCGAAAGACCT
TTGGCTCAATTAACGCATACTATCGTAATTTAGGGGTTTGGAAAGGGTAAACTATACGCACACCAGTTAGACAGGTCATTTTTGAAAGACCCTCGACTCA
AACAACACATGTTAAAGCAATTTGATTAAAAAACATACGAAAGTAAAGAGGACATAATAATTAAAAAAAAGCATCGCATTGTATTTGAGAAACAAGGAAT
ACAGTACTAACAGTCAAATAATGTGATAATTGAAGCACATGAGATAAGGAGAATTAACAAAAATAAAGATATTGCCAATGAACGAGGAAATATATATGGT
GCACCAAATTACCACCAAGCTTATTCCGTAAGAAAGTGAGATAACGCTGAACTATATACTAACCTTTTATTGTCGTAATATTTATGACCTTCATAACTTC
GTTTCTAAGATCATGTCCTCTATAAGCTAAAAATGCATTTTATCCTATCTATAATCACTTCTCCCCTAATCAATGGCGTGTGTATTTGCACATCTCCCCT
TCATATGTTTGAAATATCTTAAACTCACTTCCTTCGTTTCGTCTATTATAAAAAAAATCACTTAATACATTTTTTCAAATATATTCATTCATAATTTTAT
CTTTCCGATTTTACAGTCTAATCATATCCGCATTACACTAAAATAATGGATCCTTGCCATGATGTATGGAACTAGAAAATCCCAAAACATAGATAACCAA
TCTATGTCTTCGATCAAATTTGTACGTACCTCAAATATTTATTAGTTATCTACAATCTTCGATGAGTATAATACCAAGTAAAAATAACTATTTTCCAAGC
CTTCAACATACGCTGTGAAATTTCAGAAGTAGAGTCAGAAAGAGGGTGGTGTGTATAAAGTCGTACCCCTACCTTGTGAAAGTATTCTGATTTTTTTTAA
TAGACCCTCGGCTAAACCATATCACAAAAGATATGAAAAGAAAATACACTAATAGGATAATGAAGAAAAGTAATAAGATAATTGAAGATTTAGAAGAGTG
TCTATTTTTCAATAACAAGGCAAAAGAGTGACATTCATCCTTCAAAAAGAGTTCTGAGGAAGTTATGGTCTCCAAAATCAAAACTATACAATCTGAAAAG
CTACCATACTTCAATACAGCAAGTTTGCACACTTGCCATACTGCTCTGGAGGCAATTTGTATTTTCTCCTGTACCTATATATCTCCTGTACTGATACAAC
TATCAGAGTGTAACACAAAAAAAGGAGGCTGCGTGCATAGATGAGCATTTCATGTAATTCAGAACCTGCTATATATTTGAACAAATTCAGCAAACAAAGC
CAAAATCTGACATGCATAGATGCACATCAGATATCCTGTATTAACAACGAGTCGCTGTCTTAAATCCACGGTTTTAAGGAAAAGATACAAAATACAGGAG
AAATGTTTAGTTTTTTCTCATAATTATAACCCTTTTTCTATCTGAAAAGAAATTGTGCCGAATAGATACACATGGCAGACTCAAAATCAGTTTTACCATT
CAACATTTTTTTTGCCTCCAGTTTCCTCTTTCCCGAATCAACCTGTAGCGGTAGGATGAATGCAGCACCTGAAACGTGCCTTTCTGATATTGGTCATGAT
TTCTGTCTCAGCTGCCTCAAGCATCTTGACAACCTGAGAGAAAGTTGGCCTATTATTGGGGTCAGAATCCCAGCAGCAGGTCATGATATCAGATAAGACA
GGCAAACAATCAATGGGGATTGTTGGACGGACGCCTTTGTTGACAACAGCAAAAGCAGCCTGCACAGCAGTCATGTTCTGGAAAGGAAGCAACCCAGTTA
TGAGCTCCCACAGAACAATGCCAAAACTATAAACATCAACTTTCTGGGTGTATGACCGGTGCTGGATCATCTCCCTACAAAACAAAGTCAAACATTGGTG
GTCCACAACGAAACACGGATGCTATTGTTAACAACTTTGAACATCGTTTTTTTTTTCTGAAAAGAGAAGAAACCAGACACACTTGCCAGAAAATTCACAT
TGTTAAACAGGATAGGATCTGCAGAATGTGAATGACTAATTTCTCTCGAGTAAACTTGAAAAGTAACTTCATTTCTCAGTTAATCAGAATCAAAATTTGA
GTATACTAGAATTGCATGTAGTGTCAGAGACTGGCTGTAGTCTCTGCACGTATACGAGTTTTACCAGATATTTAGATCTGGTCCCCACCTGCTTTGGCAA
AGATCATTCAATATCATATTCTTTTTTGGCAAGATCATTCATTATCACGTCAAATTAACAAATGCAAACAGATTCGTCTGTCTATTTCGCCAAGGAAAGT
CTAACATGCATACTAGCCTATTATCACACAGAGAAGAACTATATTACACTGCCACATCATCCACCATCCCAGGGATGTGGTGTTTCATGACTGCACTAGG
TCACCAAAATTATCACCACTCACAAGGTCAACCTCCTAAATCCTTTCTGATCGCAAGCATTTCAACAACATTTCATTGCATCTTTATAGTAGTAAATCCT
TCTATGTCTGGCATTACTTACTTCCTATAGCTAGTGCGCTTCACTTCTCTCTTTTTGCTTCAAAATCATGGACCTTGTCACATTTTGCATTTCTCGATTC
TAAAAACACTACTCTCGGTAATTGGAGGTTTCAAAAAATGATTCAGTTTCATGAGAAGACAACTAAATTTGTATGTGTTTGGTACTTCTTATTACTTACC
CATAACTTGTATGCTTCACTCCTAGCTTTACACTTCAAACTCCACGAATCGCCTTTTGCTTTTAAAAACACTTCTTTCCAGGAAGAATGCTCGGAGGTTA
CAACAAATGATTTAGGGTCATGAGAGTCAGTACTCCACTTCTGCGTTTCCGTAGAAATTGAGATAATCTTATGGATGGAACAAGTTTATGTAGCAACTCA
ATGGAGAATCCACATAATCATTGTAGATTCTACAGAACATCACCTAGACGCTTTTTATGCTTTTAAAATGAGGTCTCTTCGTAAAGAATGACCGAAGGTT
CCAACAAATGATTAAGATTCATGAAAGATTGAGCGAAATATTCCACTTCTACCTTTCCGTAGAGATTGAGATGGTCTTATGATGTAGTAACTCAGTGGAG
AATCACATGATCGTTGTAGACTCTAGTTTTTGTAAGGCCTCTCCTGGAATTCCTTTTGGAATCAGCCAAAAAAGAACAAACTTCTTTCCAACTCAGAGCT
AGCAATTGAGTTATGGTGTAACCAGTTTTGTTTTTGAATTCATTAATAAGTCACTTAAATATAACAACTGCATAAATAAGTTTGGAGGGATAGAAGTGTT
GAAACTTAATTATGTCTAAGAATAGAACTTATTTAGATTTTCCTTTTTGATAATCGAGAAATCCTCGAAGAGCACTAGTGCATGTCGATGATGATTTTGT
GAAGTACTTGCAATATCCCCACTAACACAAGTATCAGGTGAAATCACCTAGTGTTTTTGTGCCTGTTCTAAGATTTGAACTAAAGTCTCCCATGCTTCTC
TAAGATGCCTGCTAAAAGACCAAAATTTCCACCGCAATGAAGAACTTATCATCTTCATCGGGAGAATGCATCCAAATAAATAAGTGTCTTAGTTGACAAC
TCCCAGCACCAGCCACGTCATATTCCATGAACCTTATCAGCCCAAAGTGATTATTAACAGAAAAAGAACTTTTTTTTAAAAGATTAGTTCTTTTCCTGTT
AATTATCACTTTGGGCTGATAAGTTCATGGAATATGATGTGGCTGGTGCTGAGAGTTATCAACTAAGGCACTTTACCATTTATTTGGATCAATAAACAGA
TATGAATAGATACCCACCAAGGTGTAAGGTTTAGGCATATGGGAATAAAGCACTACTTGTGTGATTTAACCCAAATCTCTGTGATTTGCACCTACTTCAT
TGAAAGCTAAGCCACATCCTTGGTTGTGAATAACTTGAATCAAGGTACAAATCACGGACAAGAAGGAAGATCAAAAGGATTGAAATAAATTGAAAGAGAA
AATAAAATCGATCAACTCTTTAACCTTCACTAACAGGCACATAACTATGTTAAAAAGCTAACTGGAACAAATAATTTCTCCTCTTAGCAACAACAGCAGG
TATACAATAGAAAATATAATCACAATCAATGAGGTGCCATCAAAAGGACATTCAGGACTTGAACCCATCAACCTCCATACTTTTCACTTTAGTTCTAAAA
AATTTTGTTCCATAAAGGGAATACAGCATGCTACAACAACAACAACATACCCAGTGAACTCCCACTCAGTGGTGTCTTGGGTGGGTAGAGAGAGAGCAGG
CGTTACCCTTCCCTCGTGGAGGTAGATGGGTTCTTTTAGAAAGATGTTTGGCTCAAGTAACACATATCAAAGGAGTTTTAAAAAAGAAATAAAACTCCGA
AAGTAATGAAGACAGAGAGAGTGCTAATATAAGGTTCACCGATAAGCCCAAACTGGATCAAAGCGGATTAACAAGGCTGCTAAAGGGTCTAGATGCTTAC
GGAGCCATCCAGCGGTAAGTGCCAGTTTCTGGTGTCATTCCTTCGGTCAGCACCTCAATTCGAGCAACACCGAAATCTGCAATTTTGATTGACTTGTCAG
CAGCAATCAGTAGATTGTCCGATTTCAGATCCCGGTGAATCAGATTCAGGCCATGCACATACTCCATCCCCCTTGCCACATGTAAGGCCTGCTTAATTGC
TAACTTCAATGGCACAGCTCGGTTTTGCCGCCTTGTGAGGAACTGACGCACTGATCCCCCTCTTGCATATTCAGTCACAATACACCACACCATGGGTTTA
CGGCATGCACCAATAAATCGTACTATGTTTTGATGCTTCAAATTTGCCAACATCATGACCTCCTGCTGAAATTGTTGCTCCATAAGATTAGCCCTCTCAA
GATCATTTTCTGGCCTCTCCAGAAGCTTGATGGCAACATCTTCACCATTATAAGTTCCCTTATACAGTTTCCCAAAAGATCCTTGAGCAAAAGCTTGTCC
AATGGTAAGCCTCCTCAAGTCAATTGTCCACTCATCATAAATCTCAAGCCCAATGGTGGGGAACTGAGGATCAACCAAGGCTTGAGCGAGGGCATCATCG
CTCAATCTAGAAACTCTCCCCCTGACTACGCTAGCAGCAACAGAATAGTTATTGTGGATGTGGTTGTACTGGTGGTTTAAAATATGAGTGTGAGAATCAT
TTGATCCAACACTGCTGTTATCAACCGACATTGTAACAGAACCTCCAGCATTGCTCATCCCATAACTTTCCGTAGACATGTTTGACCCCTCGCCAAGCTT
ATAGTAAAAGTTCTGCGACAGGTTTTGATTCAAGTCTGTAAGTCCAACAGATTTTGGAGCCTCCATCATTTTTTCTGATGAGGCAGCTACAGCAGAAAAG
TTTCAATCCGACTTATTTCTTTTGCACGGGGATTTCTAGAATCAAACCACACCTCCACAGACCCTGCAAAATATGAAAAATGTAAAAGGTTAGGTACATC
AAAAATCAATTCTTCTACATAGACTGACAGGGTCAGCTACTTTCAACTCTTCTTTTTTATATCAACTTGGTGTCCGCAGCTTGCATGCACCTCGACTAAT
TCCACGAGATAATGTACCTTTCCACTCGCAACAAGTACCAAGCAACTCTATCTAACAAGGCTAGGACAGATAGAAAGAAATCGCCTAATGTTTTTTGTCT
TTGGGGTATTCAACCTGAGACCTCATGGATGTCACCCCTACATTTTTCTTCCAATTACAGGGGGTAAATTTCATGTAAACAAATATAGGGTTTTTCATTT
CCAAAAAAAACAAAACATCACCATAAGCCAAAAGAATCCAAACTATAAGCATAAACCAATATGATAAACTTCCCAAAACCATAGAAAATGAAAGAGATAA
ACAACTCCAAATTGAACTTTCACCCCCTACATCTACATATTTCTTCCAATAATGATAGAACAAAAGGTCATCATTCTAATCAGGGGCGAAGCCACCTTGG
TATCGAACCCCCTTCGGCTACTCCGTGTGTCTATTTTTACAATTTTGAACCCCTTATTGAAAATCCTGGCTCCGCCACTGATTATAATATCTTTCATTTT
TTATTAGTTTCAGACTTTACCAAAAATCAAACAACCAAGACGAATTTTTCTGTTTCAATTCCAAATTAAACAAAACATGTTTTCATCTCCAGCTCAAACT
ACTTCCCTAAGCAAAAAAGCTCCAAACCTAAAACATAAAACCCATAAATATACACATCAAACCAACTCCAAAATCACAAAAAACTCCAAATTCAACTTTC
CCACCTACATTTTTCTTCCAATTATAGGGTTGGGGGGGGGGGGGGGTCAATTCCTAGTAAAACAAAAGTTCACCATTTTCATCTCTAACTCAAACTACTT
CCTTAAGCAAAAAAAAAGCTTCAAACTTTAACTCCAACATCACACACAAAAAAAACTAAAAACTTTAATTAAATCACGGAAAATTCAGAAAAAATGAATG
ATCAACGGGCAAAATTAAGGAGCAAAAAGCAAATTTACCTCGATTGTGATTATAAGTTTATAATTCTACTTGTTTTCCGACGCCGATCAACTTTCCGACC
ACCGGAGCTCCGGAGAAAAATCAAAGTAAAAAACTAAAGAGAAGTGAACACAAGAAAAATAAACACACGGAGAGGAGTATTGTATGAAATGGAAGTTTAT
GTGGAGCCTACTTTTTTTTTTAAGTTCCATTTATCAAAGTCCGTTTTATTTCGATTGAGCATCTAAACACAACACGTAAAAATATTTTTATCGTACACTA
ATTTAAATTTTGAGATGAAAAAAGAAAAATGTGTAAACTCAAGTTCGATAATGTAAATAAGTTAATTATAAATTGAACTTTGATAGAAATTGTTGTAAAA
ATCTCAAATTTTGTGCAAGACTAATTTCTCATGCATTGTTTAATGACGTATTCTAAAGATATATAGGTGCCTAAGTGGACATCATAAATATTACATCATT
ATAATAAGGGAAAAGGCTCAAATATATCATTGAACTTTCAGAAAAAGGTTAATTTATTATTCGTTTAAAGTTTGGCTCATCTATGCGTTCAAGAAAAAGT
CTCATTCATGACATTATTTTTTACAGTGGTTTTGTAAAATCATTTTTGACACGTGGCCAATTGTAATTTGGTCACGTCATCAATTTTTTAAATAAATTCA
AAACAAATAAATTAATGGCATGAATGAGCTTTTTCTTTAACGGCAATGACATAAATGAGCTAAACTTTTAATGAATAACAAATGAGCCTTTTTCGAAAAT
TTAATGGCATATTTGAGCCTTTTCCCTTATAATAATAACTTGTCCAACTTAACAGTTATATATCTTTAAAATGCATTATTAAATAGGAATTAATAAATTT
TACCCAAAGTAATTTGATCAAAGTTTAAATATATTTCGTGCTTTTTTTTTCTTTTGAAATAGGTTGTGCTTATATTTAGTTATACATATAAAGAATAGAG
AAAATTTCATATATGGCAAACTTATTTGATTAAATAACATTATATGGGTATAGTTTACCTAATTACATTCTATGGGTATGGTTTAGTTATTTTAGGTATC
TTTAATTTTGTATATAAGGTTTCTTTTGTTTTTTATTTATATAATTTTATTTTAAAAAGTGGTTTGTAACTGAAGCGTTAAATATGTTAACAATAAATAT
AGATAATGCCATAATTTAAGGTAAACGTCCCTTTTTTTAAGGTAAACATTCAAATTCATATTTTTTTTCAAAAAAAATAAGAATTATATAGCAATTGAAA
CAAAAGATAAACTTTTTTTTTGCTGTTTATGAAACAACATTCATCAAATTTTTTTTGTAATCGAATTCAGGTAAGTGTTCATTGGATGAAAATTCATGTT
TATTATTGCAATAATTATACAACGTTCTATTGGATTTACAAATTTTGATTTATGTGCGTTCGTTATTGTGGTGTCGTATTTTATTTTTTTTGAAAACTGG
TTTCAAAATATGATTATTTTAAGCAGAAGTTTCGTACTATATAATTATTTACTTTTTGTTGATGTAGTATTTGTATATTATAAAGAAGATCAGTGTAAGC
GAACACAAGTAATCGTTGGTGATAATTGTATATAGCCATAAAGTAAGTGTTTTGCTTTTGATACAATTATATACTTTTTTGATGTAGTTTTTGTATATTT
AAAAGAATATCAGTGTAAAATCAATTCAGTAATTTGATTATATAATAGTGTTGTATTAATTGTATATATGATCTCTTTGAATGATTTGAAATATATTTTT
TTTATAATTGTACAGATAATGGCTTCATTGGCTATTTTTGTTATGCATTCTAGTTAATATGTGTACATGAATATAGTAGTTAAACATAGCAATATATACA
ACTGTCTAAATGACTTTGTATATACTCCAATAATATATAAACTTAATATATACTAACTTCAATAATTTATATATAACTACTAAAATATATAAATTACAAT
CATATATGAAATTTTTCCATCTGTATAACTAAATCCAATTACTTTGTGTATATATGTATACAAAAACAAAAATAATAATGAGCCTTGAATATACAATCCG
CTACAACCACTATTAAAACTTAGTATATATGTATACAAAAACAGTCAATTTTGAAAACAGTCATGGACATATCAATTTTTGTATATGTATATAAACTTAA
TATATACTAACTTCAATAATTTGTATATAACTAATAAAATATATAAATTATAATCATATATGAAATTTTTCCATATGTATAACTAAGTTCAATTACTTTT
TGTATATATATACAAAAAATAAAAATAATAATAAGCCTTTAATATACAATCTGCTACTACCACTATTAAGACTTAGTATATTATTCATTATACATAACTT
AAAGTATGTATAAAGTAATCAAATCCACAGACACATATACAAATATATAACTAAAACATGTCTGTACTAAACATGCAATATACTATATACAATTACGTGA
TTACAAAATTTACTTAAGCAATAATTTTTTGTATATTGACATCTAAGTAACAAAAAAATTGTATCTAAATTTGTGTTTTAAGCCACTACCTCATAATTAT
GATGTTTTTCAGATCCGTCAACTTCACATGCATTTTCATCTGAATCAATGTTTACTGCTTTCCTCTTTCTTCCTCCTTGTACAATTTTAATGCCTCTAGC
TTTAGCATTGTTAATAACTTCTTGAACTGCCCTAGGGTCATATTTTTTCTTTGATCTCAATTCTTCCATTGTTTGTTCATGTTGAACTTGTTTTGATTTT
ACCATAGACCCTACATCAACCCCAAAATCTTGAGTTAAACCCATTGAAAACGATGGTAAATTGTCAACAAAATTGACATGCAATGGAATACCTCTGATAA
TCCTCATAGATGAAGATGATTCATTCATTATGTGACTAATTTGAGATCTAATAAGAACAAACAATCGATTATTTCATCAAATAAATATAAAAAAAACGTA
AGAAACACAATACATATAGAATTGTTGAATAAGAAAAAAAAAGAAAGGAAAACGACTAAAATTTAGGAGTACCTACGAAAATTGAATTCAACTTCGGGAG
GGAGTAATTGAATTTTGGGCAACTTGAAATTCAAATCGGATAGAAGTATTAATTGTAGGAGAAAAAGGTGGAATATGAATAAGAGAGATAATATTATAGT
GTAAAATTATATACAAAATTTTTTAAAAAAAAGATTTTTATACTATTGGTTATATAATAGGTGGTGGACCCCATTAATTATAGCAAAAAAAATAAACTAT
AATTATAGAAAGTAAATAAATTAAACTATACCCCTATTATATAATTATTTAGGAATGTTTGCCGTTCCATATAATTTTCCCTAAAGAATATACTCATAAT
TATCATGATAAAAATAGAATTAATAAATTTTTCCACTTTGAATTTAAGAAATTAGTAATAAATTAGAATAGACAAATTTGGTGATTGGACAAATCAAATA
TTACTAGCTAGATATAATGAACTTTTTCATTTGAAATTAAGGAAAATACTAGTAAATAAGAAGGAAAACAAGGCAAATGTGGTGATTGGATAATTAAATA
TCATAAGCTTAATTTAATAAGTTTTTCCATTTTGAATTTTGAAAAAAATATCAATAAATAGGGGAAAAAATGAGACAAAATTAGTGGTTAGATGAATCAA
ATCTCGTTTATTACTAATAATGATAATAAACACATGTTACTTTCCTTTTAAGTTTTGTTATATATATATATATATATATATAAAGAGGGGAAAAAGGTCT
GATATACCCCTCAACTTTGTCATTTAGAGCTGATATACTCCTTGTTATGAAAGTGGCACAGATATATCCCTACTTGTAAACAAATGGCTCACATATACCC
TTTTTCTCTAACGGAAATGAAAAAAAAATAATCTAAATTTTAATTATTTTTTTCTAAAAAATATAATCCTATATGAGTAAATTTAATCCTCGTCAAACAT
ATTTTTTTTGAATATTTTTTGTTTCAATGAGTAATTTATAATTATTATTTTGAATCAAATTTACTTATGTTTCACTAATATTCTTGTAAAACTCATTGTA
GATGATCAAATTTTTTCTTCGAATACAAAATTAAATTACAATACACACAAAAAAAATAGTTTAATTTTTTCTCTCTTTAAACTAAGGAATGTAAGAAAAA
AACAAAATAAGAATAAGAAACTCAAATAATTATAATAAAAGAAGTAAAAAAATAATTTATGTATGAAAAAAATTAAAATATACCTTGAACTTTGATAGAA
GAATCATATATACTCCTAAATATTTTTTTTTAAAAAAATAGAACTAATAAATATAAATTTAAAATTAATTTTTTAACTTCCCTTAAATGAAGGGTATATG
TGAGCCATTTTGTAACGTCAGGGGTATATGTGAGCCGTTTGTATAACGGTAAGGGCATATATGAGTCACTTTTATAACGAGGGGTATATCAGCTCCAAAT
GACAAAGTTGAGGGGTATATCAGACCCTTTTCCTTATAAAGAGAGATAATTTATTGTAAGAAAAATGACACTAAAAATGTGACATTTAAAATGTGAATGT
TTATTTGTAGTTAAGCTGAATTGAATATAATTTTTTCCACTTTGAATTTTTAAAAAGTATTTCTAAACCTAGAAAAAGGGTCAAGACAATGTTGGTGATA
AGACAAATTAAACATGTTTAATTCATGAGTAAACACATTTTACTTGTTTTTTTAATTTTGTTATTTGTAATCAAATAGGTTTTTTCAATATTTCTTCCCT
ATCATGATTTAAATAAGGAAATACTAATAAAAATAATAAATAGAAGAAAGAACCATATAAAATGATGATTGGACCAATTTATATATTCACCAATACACAT
AATTTACTTATTCCTTGATTTTATAACATATCATAATTTTAAAAAATATTACAAGGATGGCATCATTAAATTAGTGGAATAAAAAATACGATATTAATGA
AAATGAAACGAATACTAGTCATCGAAGCTATGAATTTTGTTGTGGCTAAGTTTAGGATCTAATAGAATCGTTAATGAATTTTTGAAAAATAAAATAAAAT
AGTGAATTAGCATGATAAAAAATATTTAAAACTTTAAATTTTTATTTTATGACACCGTAATATCAAAAAAAGAAATAGCGTAAAGTCCTAGATTATGGGG
GCCCAACCTAGCCAATTTTGGGGCCAATTGATTTGTTCATATAATTTTCAAAAAAAACCTGATGAATACTTAAAATCCTAAATTCCTATTTCGTAACATT
GAAATATCGACTTAAAATATTATATTTTTATTTCGTAATATCAAATCACACACACAAAAAAAAAGTTATTAATAAAAATATAGAATTATTATTAATTTTC
TTATCAAGGAAACATAAAAAGTAGTATTCACATGTTAAATGTCATGTGAGCATTAGTTTCTATATAGGCTCTATCTAAATTATAAATATTTGATCTTTGA
CTAATGTTACCTATGTACTTATATATATTTTTATGTTCATTAATTAATAAGTCAAAATTTCATGTCTAATAATGAAGTGATTTACGAGCAACAAGGACAT
TTTAAAAAGTATTTTCGAGGACAACTATATAAGTGATATCTTTTTAATAATTTAGAATACTATAATTCTGAAGTTAAAAAGAATTGTGAACTATGAATAA
TAAACGACAAAGTTTATAGCTACTTATAGCTTTATAGTGTTGTGATATTCTTTGACGACATGAAAACGTAATAATGTAACATTTTTTATTAATAAGTGTT
TATTTAATTATTATAAAACTTTTCGATATGAATTCAAATAATTTAATCGAATTGTAATAAAATATTATATTAAACTTGACTCGAAAGCAATAATTTGAAA
GTTTATATATATGATCCATCCATGTAACATAGTTGTGTCAATTTAATTTATAATTGTTCAATTAATTTGATATGGAACAACATGACGATACCTACTTTTT
ATGGAATATAAGTCGAAAGCAATATTTTTCAAACTTAGCATCTATTTACAATATTCGAATATACCCAAACATATTATAAATTTCACTTAAAAGATAAATA
TGGGAATATATATATATATATATATATTCACGATTGAAGTATTAAATATTAATTTAATCATCTACAATTCTTTCGAAATATTCAGAGATTGGTTAGATTA
GAAAGAGTCAAAAACGAAATTTTCACCTAAAGAAGTAGATTGATGTAGCAGTAAATTCAAATACAAAGAATTCATTTGAATTTTCATTGAAAAATCACGT
TATATATGTATGAGGCAAAGATCTCTTAAATTAAAGAATATTATTAAATATTTTAACAGAATTTATTAATAATAAATTTCGTTGTAGCACGCAATTTTCA
TCTTTATTATTTTAATTCAGGTTCGTACCCGACAACGGAAAATCCTTTTTGAAAATTATATTCTTGCAACTTTGCTTCGGAAATATTTTTTGTGAGATAA
TCGAAAATAATATCTCGTGAAAATACATATCGTTTAAATATGGACTAATGAAAAATAAATGCTTAAAATATTTGTCTTCCATTAAATATTTTACATTTAA
TCAATGAATTCATAACAGACATGTAGACGTTAAACATTCACAATAATCATTTACTATGTGAACACTTAATGTAATAGGTTATCCTTTGGCACGAACATGC
AAAACATCTTAGTAAAAAATTGCATAAATTAATATCAGTTATGTAACGATTTTAGCTCGCATAAATTAGTACATAGATTCCACGTAACATGATGTTAGTA
TTTATTTATCTCGGAAAACAAAAAAAAAGGTGGTCCTGGCTACTTTGCATAAATTAATATCAGTTATGTAACGATTTTAGCTCGCATAAATTAAAACATA
GATTGCACGTAATATAATATTAGTATTTATTTGTCTCGGAAAACAAAAAAAAAGGTGGTCCTGGCTACTTTGCATAAATTGATATTTACATAACGATTTT
AGCTCGCATAAATTATACATAGATTCCACGTAACATAATGTTAGTATTCATTTGTCTCGGAAAACAAAATAAAGGTGGTCCTGGCGGGGCTCGAACCCGC
GACCTTCGGCTCATAAGACCAACGCTCTAACCAACTGAGCTACAGGACCAACGACATTAATATTGATTACACTTCCTATACATTAACTTAATTATAATAA
TTATTAATAATGCTTTTAACTTTAATTTAAATCCAAGAATTAGGTGAAAGGAATATAATTAGTTATCTAATTGGGTAGAAAAAATTCACTTATAACATGT
TTCAACTTTTTGAAAATCTAAAGCGTACACTTATTTTAGAGATCGAAGGTGTTTGACTAGGCTTTGGAGTTTTAAATTAAATATTTATGTATATCTAATA
AATTTTTAACATATATATAAGGTTTGAATTAAAACTATTGATTTTTATCAAATTCATAATCAAAGCTTATGATTTATCTCTATAATACATATTCAAATCA
ATTAGATTAATAAACTTTGTACATCAAGTGACTATCTCGAAGTAATAATAATTTTTGAAATATAATATCAAAGATTTTATGAATCAAACGTGAAGGTTCT
CTTTGATTCATAAACTTTTAAGCAATAAAATATCTTTATTTGAATGATTTTGAAAAATCTAATTTCAGTTATAATGTTTAGAAAGTCTCACCGAAGTCAA
ATGCGACTTCACACCTTACAATCATGTTAAATTTTTGTTGTTGACGACTCTTACATAACGTTTTAAAAAAATATAAAAGATTAACCGAACAATACTGATT
GAAATGATTTTGAAAAATGTAATTTTAGTTATAGTGTCTTAAGAGTCTCGCTTAAATCCAATACGAATACTCATCTTATAATATTCTAACTTCCGCTAAT
AACAACTCTTACATAACATTTTCTAAAGATTATAGAAAAGTAATCAATCTGCATTTAAGTTTAGTTATACAAAATAGAATAATCAAAATATTAGTATGAT
CAAATTTCATTAAAAAAAATCAGGTGAAGTGAACCATGCATGCCCCTAGGTTCTACAATTAAAAAACTTAAATTCGAATATTTTAATTAAAAAAAATTGA
CTTCAAATAGTTACTTGAACTATTTTGTCTAAAAATTCAATCAAATCCTATAAAAAGAATATTGCTATTTGAGATAAATTTAATAGCCATTTGATATTTT
AAAGAAAAATGAAAGAATTAGATAATTTTTGAAGAGTTTCTCTTCCCAATATTTTTTTTAAAAATAAGGAGGAAAATCTAAAACCCGAGCAACTTACAAA
AATAATTATATTTATAGAATTATTAAAGTTCAATAGCTATAAATATAATATTTACTAAAAATGACTACACTTTATATCAATTTCTAGCTACATGTTTGTA
TTAATTTTTTATTATTATTATTATATTTATACAGTGATCTTACAATGCACTAAATAAGGTATGATATGTTTTCTGTCAGTGTCAACCTTTTATTATGTTC
CTAAATCACTCAAATTTCAATTATTAAATTACCAATTAATAATTACATATTGTATGTGTATCTGATTCATTCACATAATACAATAAGTTGTATTTATATT
CCTAAGTACAATATATTCACTAAATACTAATTATAAAATATTTTAAAAAAATTTGAATATAAAAGAGTGTTTATTTCTTTTTCTCGTCGTATTTTTGCAT
ATATTTTTTTATTTATTTTTATTTAAACACTAATACAGTTGTAATTACAATAACTAAATAAGAAAAATGTATTACTTGTACAATTAACATATATATACTC
TGAATTCAAATTGATGTTTCTATTTTTAAAACTTAAAGTATTGATATGTCAAGGATGCAAATTATTTATGAAAACTTAATGCATTAATACATCAAACAAG
TTAAAGTAGTACAATTTTAGCATATGAATACAACAATTTGAAAAATAGATACACTATTTTTAAACCAAAAAAATGAAACACCAATATACTATACATATGA
ATACACTGTTTTTAAATAAGAAAATGAAAAAACAATAGAATGTGTATGAATCAAAGTGTGTAAGTATATTTAACTGTATATAAATTTAAAAAAGCCAACA
AAACGTCGATTTTTTTTCAAGTTTTTCCTATAAGACTTGAGGCTTGATGTTAATTTAGGTATTTATTTATAACAATATAATATTGATGTATCCAACTATA
CTTGTATTGTCTAATGAAATTGGATAAGTTACTTATGTAACCAGATATATTTGTATTCACAAATCATCATTGCATTAATATTACAATACAATTATCTATG
CATATAAGTATTATTAAATATAAAAATTTGAACAACGATAACCTAACGGCTCTACTGAAATGCGGATATTCCCCACGCTCCATCTCATAGACCGTCGGGG
ATCTTTCATCGATGCGTCGGGATAAGAAAATGGCTCCAGCAGTAAAGGTGACACTCTTCACAAGAGATAAGCAATTTCGCCATGGAAAGAAAAGTATAAA
AAAACAATATAATTTTCATGAAAAAGCAATTACAATCAAAAACCTATAAAAATAGATGTATATAAATAAAGTTTTCATAAAAAACGCAGAGAAAATCAGT
TTAAAATACCTTATAATGAATTGAAACCACAAAAATCGCTCCTAGAATCATATAAAAAGATCTTGAATTAGAAGGAATTGGAAAAAAATACAAAAAGTCT
GTAACATAGAGATACTGATGAAAGAGAAGGTATTGATATATCATTAACTTTGTTATTCATTGTATAGTTATAACCATATAACATAAAAAAAAATTAAACT
ATAGCTATTTTATTTAAATGTATATTGATGTTTGCTAAATTTTGTAGTTTTTTCTAACCCTAATCTACTTACATAATGTCCTAACTTCTACTACTAATTC
TTATCAAAACATATTAAAAAATCATAAATTAATTGAACTATATCGATATCGATATCGAAGAAATAACTATATGATATGTGGTTTTGAAAGTCTAGTTTTT
CGTTATACAAAATATAATGAATCTATGCTTATTTTCAACTCCGCGAAGCAATAAAAAACAATGGTCCAACCAACGAATACCTTGACATCTTATAGCGGCG
TGACTTGGGACGGGAACTGGTCTTCGATGGCCGGAGGGCCGCTCCGGCCATCAGTTGGGAGCGCTGCTCTGTTAAGCCAGCCATAATGAGGGTCGAACCC
GCGCCCGCGCGGGTTTTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAAATTAATTGGACTAGTGTGTGAGTTGAGCTTTTATTGCATGTGAAAAATTTGTAGTGTAGTAATTAAGGGTGCGTTCGT
CATTTGGTACAAAAGGAAATATTTTTTTGGAAATTGCTTTTTTCAATTTTTTCATGTTCCATTGGTTATAATGGTTGGAAAACAATTTTAAGCAAAACAC
CCATTTAGCCCTATCGTGATTCATGACCTCCCAAAGTTTAGAGACTCTGGACAAAAGTCTAGTACAAGTATTCATCTTATCATGTTCTAATTTTTACTAT
TGACGGCTCTTACAAAACATATTAAGCAAAATATAGAAAATTAACTAAACAATATATACATATATAATTCAAATGATTTTGGAAAGTATTAATGTCTAGA
TTCTGGAGTCTTGCCATACTCAATGTGAGTACTCATCTTGTCGTGTTATAGCCTTTACTAGTGACGAATCTTACAATAACCTTTTTTTTAATAAAAAAGT
TAACAAATAATCAAAATGTACCGATATGATTGGAATGATTTTGAAAAATCTAATTTCAGTTATAATGTGAGAAAGTTTCACCAAAGTCCAATGCAATTTC
TAACCTTATCATGTCCTAACTTCTGTTGTCGATGACTCTTGCATAACGTTATAAACAAATATAAAAGATTAACCGAACAGTACTGATATGATTGGAATAA
TTTTGAAAAATCTAATCTTAGTTATAATGTCTTAAAAGTCTCACCTAAATCCAGTACAATTACTCATCTAATAACGTTCTAACTTCTACTAATAACAATT
CTTACATAACATTTTTCAAAGATTCTCAAAAAGTAAATAACCTGCATCGATATTACAATAATGATTTTGAAAATTTCAATTTTAACTACACAAAATAGAG
TAATCAAAATATTGATGTGATAAAAATTGTCCTAACTTCTGATACTTATAAAAACATTCTTTAAAAAAATAATCCTAAATTACCTGAACTATATAGATAT
CAAAGGAAAACCTATATGATAGGTGGTTTCGAAAGTCTAATCTTTCATTATACAGAATATACTGAATCCAGTCTAAATTCTTAAAGGCAATGACTTTGAG
TACACTACTATTAATCGCATTACTCACACTACACCACAATCCGCCTTTTATGAACCAAAGGGCTAAAGAATGGTTGTCCTGATCATTTTATTGCTCCCAC
TTAGGCCACAAGCTTAAGCTACTAAGCTCTACAACATGTATTTTCTGGTTGATGTCTTATAAAATGGATGTAATGGTCTTCTACTACCGATGTGGGACAG
GAGATTGACGATTACTGAGGAATTAATTAGATTATATTGTTTGAGTTGAGCTTATTTTTGCATGTAAAAAATTTGTAGTATAGTAATTAAGGGTATGTTC
ATCATCCGGTACGAAGAAAAATATTTTTCTGGATTTTTTTTCAATATTTTCATATTCGATTGGTTATAATTGTTGGAAAGTTATTTTAGCAACTCTCGCC
AAAACACCCCCGTAGCCCTATTATGATTTGCGACCTCCCCAATGTTTAGAGACTCTGGACAAAAGTCCAATAGGAGTTTTTATCTAATCACGTTCTAATT
TTTACTATTGACAACTTTTACAAAACGTGTTAAGCAAAATATAGAAAGTTAACTAAACAATATATACATATATGATTTGAATGATCATAGAAAGTATTAA
TGTCTAGACTCTAGAGAGTCTTGCCAAGTTCAATGTGAGTACTTATCTTGTAGTGTTATAGCGTTTACTAGAAATAATCAAAATGTACCGATATGATTGG
AATGATTTTGAAAATATAATTTTAGTTAGAGAAAATGGTCAAAAGCCTCCCTAATTTATCACTGATTTCTCAACTACACACTTATAAAAGTATGATATAT
ACCCGCTTAAAAACTCACGTGCATATTTGTATTAAAAATTAAGTGGCACGCACTTGTCACGTAATTTACCTTTTAAAAAATTTAAAAAATATTATTTTTC
CCTTTATTTTACTTCCTTTTGTATTACCCTTCTTCTATTTCCTTTTCTGCTCATTTTTTTCTTTACTTTGATGAAATGATTTTTCAAACTACCAAAGCAA
ACTCAAATTAAGAACAATTTGACTTTTCAAATAGTTACTTGAACTATTTTGTCCAAAAATTCAATCAAATCCTATATAAAAAAATATTGCTATTTGAGAT
AAATTTAATAGCCATTTGATATTTTAAAGAAAAATGAAAGAATTAGATAATTTTTGAAGAGTTTCTCTTCCTAATATTTTTTTAAAACAAGGAGGAAAAT
CTAAAACCCGAGCAACTTAAAAAATGACTATATTTATAATATTATTAAAGTTCAATAGTTATAAATATAATATTTACTAAAAATGACTATACTTTATGTC
GATTTCTAGCTACATGTTTATATTAATTTTTTATAATTATTATTTGTAGAGTGATCTTACATTGCATTAAATACGGTATGATATGTTTCCTGTCTAGTGC
CAACCTTTTATTATGTTCCTAAATCACTCAAATTTCAATTATTAAATTACCAACTAATAATTACATATTGTATGCGTATCTGATTCATTCACATATAATA
CAATAAGTTGTATTTATATTCCTAAATACAATATATTCACTAAATACTAATTATTAAAGTATTTATAAAATTTTGAATAGTATTTATGTCTTTTTCTTGT
TGTATTATTTCATATGTTTTTTATTTATTTTTATTTATACACTAATACAGTTGTAATTACAATAATTAAATAAGGAAAATGTATTACTTGTACGATTAAC
ATATATATACTCTGAATTCAAATTGATGTTTCTATTTATAAAACTTAAAGTATTAACATATCAAGGATACAAATTATTTATAAAAACTTAATGCATTAAT
ACATCAAACAAGTTAAAGTAGTACAATTTTAGCATATTGTAACGACCTGTTTAGTCGTTTTGAGCAGCAGATTTTATTTCTGGAAAAACAGGCTGAGACG
ACGGAACCCACGACGGAACGTCATGGGCACGACGGACCGTCGATGGTGTCTCGTCCCAAAACACTTAGAAATTCTGAAATTTGGGTGCTGAAATCGACTC
TCTGAACTTTGTAACGAAATGCCAGGACGGACCGTCACAGGTGTGACGGACCGTCACAGACCCTTCAGAGAAATTGAGTCTCTGAACTCTGTGACGGGCA
GCAGGACGGACCGTCGCAGGCGCGACGGGCAGCAGGACGGACCGTCGCAGGCGCGACGGGCCGTCACAGACTGAGCAATCCCAGTCTGGGTCGGAATTCT
TGATACGTTTTAAGGGACGTTTTTGACTATTCTTGCCTTAATTATAAAGTTAGTGGGTGAATGTTAATAAGTCTAATTACTTGGGGGTTAAAAGAGGTAA
CCTTAAGTTAATTAGTGGGGCATTATTGCCATCTTTTATCCTTAATTATATACTAATTAGGGTAAAAGAAAGAGGGTTTGAATAAAGAAAATAGAAAGAA
CAAGAGAAAGAGAGAGAAAGTTGAACGAGAAAGAGGAGAGACGAAGATTTAGGGGATCGGGTGTCACGAACCGACACGTAGAATTAGGGGATCGAGTGTC
ACGAACCGACACGTAGAATTAAGGGATCGGGTGTCACGAACCGACACGTAGATTTAGGGAATCGGAGTGTCACGTACCGACACAAGAGGATTAATGAATA
TGAGGGATCGGAGTGTCACGTACCAACACAAGAGGATTAATGAATATGAGGGAGCGGAGTGTCACGTATCGACACAAGAGAAATAAAGATAATGAATCTT
GAAAGATGTTAATATACTCAATCTAATGAACATGATTCCCAAATGAGTATGGTATCGAGGCTTGAGTCCTCATGTGTGAACTTGACGGTAACTGTTAATA
ATATAGTATTTGTTGTTGCTACATGTTGAGTATCATAGTTGACTTTATGATATTACTTGGTATATATTGATTTCTATTTTGAGTTGGCCGATGATATCTA
CTCAGTACCCGTGTTTTGTACTGACCCCTACTTTTATGTTCTCTTCTTGTTTATTTGTGGAGTGCAGCAAACGTGCCATCGTCTTCAACTCAACAGTAAT
TCAAGCCAGTCTTACTACATCGGAAATTCAGGGTGAGCTAATGCTTCTAGCTTGGACTGGATCTTCTTCTTCAAGTTTTGATGCCTTGAACTTCCGGCAT
GGACTAGCTTCTTATGTATTTTTAGCTTTTAGAATACTCTTAGTCTAGTCGTTTGATCGTAGATGTTCTTGTGATGATGACTTCCAGATTTTGGGGAATA
ATAGATGTTGAAATTTAGAAGTTAATGAATTGGTCTTTATTTAATGAGTTTAAGTCTTCCGCATTACTTTCTGTTGATATTATATTGAAATGTTAAGGTT
AGATTGGTTGGTTCGCTCACATAGGAGGGTAAGTGTGGGTGCCAGTCGCGGCCCGATTTGGGTCATGACACATATGAATACAACAATTTGAAAAATGGAT
ACACTATTTTCAAACCAAAAAAATGAAACACCAATATACTAAACATATGAATACACTGTTTATAAATAAGAAAATGAAAAAACAATAGAATGTGTATGAA
TCAAAGTGTGTAAGTATATTTAATTGTATAAAAAATTGAAAAAGCCAACAAAACGTCGATTTTTTTTCAACTTTTTCCTATAAGACTTGAGGCTTGATGT
TAACTTAGGTATTTATTTATAAAAATATAATATTGATGTATCCAACTATACTTGTATTGCCTAATCAAATTGGATAAGTTACTTATGTAACCAGATATAC
TTGTATTCACAAATCATCATTGCATTAATATTACAATACAATTATCTATGCATATAAGTATTATTAAATATAAGCATTTGAGCAACTGTTGACACCCAAT
TTTTGACCCACGTTGATATAACTTAATTATCGAGCTTCGTGAGTTTTTCAAATTATTTAAGTTGATTAGTTTTATAAATCTTGCTAAATTTAAAAAAAAT
AAATAAAATATATATATATATATATATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATGTATATGTATATGTATATGTATATATGTATCTCTTAAGTTTAGAAAGTATTCTATCAAACTAGTTTA
CTTTAAATAAGCTCGTTAATAAATTTATACCAAATTCATTTTACTTTAAATCGATGGACCTCTATTCCTTTTAATTCTTCTCTTTTAAGAAACCAATCTT
GGGCCTTTCTCATTTTTGTCCTCAACCCAATTAATTCCCTTACCAACCCAATTTCTTAAGTCCAATTCGTAGGCTTCACCCAAAACCCAACATGAAGTCG
ACCCCACGCTCTTTTCCCCTCGCGTCTCTATCCCTCTCTCACCCCTCTTCCCTCGTATCCCCCACGCGAGTTGCAACGGCTCTTTGGAGCCGTTCCTCTC
TCTGCAAATCGTACAACCTATCAGTGAAGCAGTAGCCAGACTCGTCTCACCAGCCTGGAATCCGTCCTTGTGGCGCGGATTTCCGCCACGAAGTTCGCAA
GGACATCAAACCCATCTCGACCCTCCACGTCGACTCGGAACGGTTCAAACGATTTGGAATCGTGGAATATTCTTCTCTTTCGGGTAGGGTTTGAACTTTT
GAATACGTAAATGGGCCTGAAATTTCCCGCCCTCCAAAGGGGAAACCCTGATTTTCCCCTCTCTATTTAAACCCCTCAGATTCTACAGCAAAGGGGGTTG
GACATTTTTCGGTTTGAGAAATTTTTAAGGGGTTAGCGATTCTTTGGTTAGAAATTTTGGTTGAATTCTTCCTTGTTTCATACAGACATCATAGCGCAGG
TCCTTTCCCTTCTTTGTAAATTTTGGTTGTTTCTAAGTTCACATTATAACAAAACAAGGGTCCCGTCTCTCTTTTTTTTTTCGAATTTCGCTATCGAGGC
TTCGAATCTCGAGATATTTGGATCTACACAGTCTCCCTGCTTTCCGTCGCCTCTGTGCTGCTCGTTGGAGCTCTTAAACTCGCGTCGTGGTGGAAGTTGC
TGTCGTCTTGCTCGCACCGTCCCAGTCGCTGCTCCTCAACAGGTAATATCTCTTCCGTTTTGGATATGTTTTGTTGCGAATGTATTTAGCCATTTGGCCT
CTCCCGAATCCGATGCATAGGGTGATTTCTCGTGTGGTTTTGCTGTTCGTCAACTGTGCTTTCATCTCTATTTCTCCTCATGTCAAGCTTGTTTAATTGT
TGTTTGCTTAATCTGTTGGCCATGCTTTTTTTTGTTTGTTTATAAATTCGATTCCGTTGACGAGTATTGCTTGTTATTTAGGGTCATCATAGGTGTTGTT
TCGTTCTTTTAAATTAAATGTTCGCTGTATCCTCACGTTATCCATGCCCGTTGGTTATTCTGTAGCTCTCTCTAGATTTGGTTTCTTTAAGAGATTCAGT
TATTGATGGTATTGTTGAGTTATGTTATAGTTTCTTTACTCCAAGTATTTTGTTCCTTCCAAGCTGTTAAGTGTGTTGCTTTCGAGGTGAAATTGTATCT
TAGAATTGCATCAGTTTTTTTTCTTTCGTGAGATTTGATTAAGTGTGATAGCTTTGTTGGGGTCCGTTTGTTCAATAAAACTGTTGCTCATTTTTGTTAA
ATAGTGGTGGTATAATCTCTGTATATGACAAGTGCATCAGTATGTGTGTGTGCACGACATGTCACCATTTTGTTTCATGTCTCGGTTCTTTGGAAATTAT
GTTTTAAGTTTTCTGTTTCTCTTAATTTTGACTTCGTAATAGTCTGTTTTTTTTATCTCCGTTTATTCAAGATGCGTGTTATTAGTCCATCTTTCGCATA
CTAATTTGTTTCTACTTTGTTGCATGGGAAACTTCTTCTCGAGTCCATTTTGGGACTCCCCTTTATCCGTCCTTCTCCGTGCATCTCGGAAGGGCCATAA
AGGCTAAAATTCCCTTCATTCGAGTCATATACAATCAAGCGTAGCGGAGATTGAAGAAATCAAAGAAAGCGAAATTGGATTTTTATTTACTTTCTTTTGT
ATTCTGTTTGTAATGGGCATAAGCCCTTGTCGCTTTATTTTCTCGTATTTTTGTATGTTTAGATTAGGACAGGTACGAAAGAAAAATGGATCAAACACCC
AAAAGCAGGTGGGTCAAGTTTCGGTCAAGTCGAACAGAACCCGAGACTTGGACCTGAATCTCTCTCTCTCTTTATTATTTGCTTACGTTTTTTTTTTTAC
TTGAATGTTGTTAACTTAGGGTTAGAATAACTCCAACCCCATCGAACGCCCTTCATTTTATCAAAACTTAAAATTAAATTTGAAAGGTTAAAACGATAAG
TATTTCAAACTTGTAAAATCGCCTAAGTAGATTTCTAAAAGTTTAATAATTCAAAATTCGCAAGTCTTTAAAACAAAATAGTCAAATAAGTTAATCGTCG
GAAAATCGTATTTAGCGGAATATCTTAGGTGCCTTAAACACCTTCCTAAGATACTAATAGGAATCCCGAACCCTTAGAATAGTTTTCAAAATGATTATTT
TCTGTTTAGTTGTTTTGAAAAATAAGTTTTCTTGATTTTTCTTAAAAAATTAAGTGGCGACTCCTAAAAGTCGAAAATACCCTTTAATAAAACAAACTCT
TTTCAAAAATCAATTTTTTCGATAAAACAACAACGATAACCTAACGGCTCTACTGAAATGCGAGTATTCCCCACGCTCCATCTCATAGACTGTCGGGGAT
CTTTCATCGATGCGCCAGGACAAGAAAATGGCTCTAGCAGTAAAGGTGACACTCTTCACAAGGAGATAAGCACTTTCGCCATGGAAAGAAAAGTATAAAA
AACAATATAATTTTCGTGAAAAAGCAATTTTAATCAAAAACCTATAAAAATAGATGAAAAAAGATATATATAAATAAAGTTTTCATAAAAAGCGCAGAGA
AAATCAGTTAAAATACCTTATAATGAATTGAAACCACAAAAATCGCTCCTAGAATCATATAAAAAGATCTTGAAAATACAAAAACTCTGTAATATAGAGA
TACTGATGAAAGAGAAGGTATTGATATATCATTAACTTTGTTATTCATTGTATAGTTGTAACCATATAACATAAAAAAAATTAATCTATAGCTATTTTAT
TTAAATGTATATTGATGTTTGCTACATTCTGTAGTTTTTTATAACCCTAATCTACTTACATAATGTCCTAACTTCTACTACTAATTCTTATCAAAACATA
TTAAAAAATCATAAATTAATTGAACTATATCGATATCGAAGAAATAACTATATGATATGTGGTTTTGAAAGTCTAGTTTTTCGTTATACAAAATATAATG
AATCTATGCTTATTTTCAACTTACGAAGCAATAAAAAAACAATGGTCCAACCAACGAATACCTTGACATCTTATAGCGGCGTGACTTGGGACGGGAACTG
GTCTTCGATGGCTGGAGGGCCGCTCCGGCCATCAGTTGGGAGCGCTGCTCTGTTAAGCCAGCCATAATGAGGGGCGAAGGGTTTGCTTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTAATTGGA
CTAGTGTGTGAGTTGAGCTTTTATTGCATGTGAAAAATTTGTATTGTAGTAATTAAGGGTGTGTTCGTCATTTGGTACAAAAGGAAATGTTTTTCTGGAA
ATTATTTTTTTCAATTTTTTTTATGTTCGATTGGTTATAATGGTTGGAAAACAATTTTAAGCAAAACACCCATTTAGCCCTATCGTGATTCGTGACCTCC
CAAAGTATAGAGACTCTAAACAAAAGTCTAGTACAAGTATTCATCTTATCATGTTCTAATTTTTGCTATTAACGGCTCTTACAAAACATATTAAGCAAAA
TATAGAAAATTAACTGAACAATATATACATATATAATTCAAATGATTTTGGAAAGTATTAATCCCTAGATTCTAGAGTCTTCCCGTGCTCAATGTGAGTA
CTCATCTTGTCGTGTTATAGCGTTTACTAGTGACGAATCTTATAATAACGTTTCCTTTAATAAAAAAGTTAACAAATAATCAAAATGTACCGATATGATT
GGAATGATTTTGAAAAATCTAATTTCAGTTATAATGTGAGAAAGTTTCACCAAAGTCCAATGCAATTTCTAACCTTATCATGTCCTAACTTTTGTTGTCG
ACGACTCTTGCATAACGTTTTAAAAGAATATAAAAGATTAACCGAACAGTACTGATATGATTGGAATAATTTTGAAAAATCTAATCTTAGTTATAATGTC
TTAAAAGTCTCACCTAAATCCAGTACAAGTACTCATCTAATAACATTCTAACTTCTACTAATAACAATTCTTACATAACATTTTTCAAAGATTCTCAAAA
AGTAAATAATCTGCATCGATATTACAATAATGATTTTGAAAATTTTAATTTTAATTATACAAAATGGTATAATCAAAATGTTGATGTGATACAAATTGTC
CTAACTTGTGATACTTATCAAAACATTTTTTTAAAAAAATAATCCTAAATTACCCGAACTATATAGATATCGAAGGAAAACCTATATGATAGGTGGTTTC
GAAAGTCTAATTTTTCATTATACAGAATATACTATTAATCGCATTACTCACACTACACCACAATCCGCTTTTTATGAACCAAAGGGCTAAAGAATTGGTT
GTTCCGATCATTTTATTGCTCCCACTTAGGCCATAAGCTTACGTTACTAAGCTCAACAATATGTATTTTCTAGTTCATGTCTTATAAAATGGATGTAATG
GCCTTCTACTACCGATGTGGGACGGGAGATTGATGATTACTAAGGAATTAGTTAGACTATATTGTTTGAGTTGAGCTTTTTTTTGCATGTAAAAAATTTG
TAGTATAGTAGTTAAGGGTATGTTCATCATCCGATATGAAAAAAAAATTTGGATTTTTTTTCAATATTTTCATATTCGATTGGTTATAATTGTTAGAAAG
TTATTTTAGCAACTCTCGCCAAAACACCCCCGTAGCCCTATTATGATTCGCGACCTCCCCAATGTTTAGAGACTCTGGACAAAAGTCCAATAGGAGTTTT
TATCTAATCACGTTCTAATTTTTACTATTGACGACTTTTACAAAACGTGTTAAGCAAAATATAGAAAGTTAACTGAACAATATATACATATATGATTTGA
ATGATTTTGGAAAGCATTAATGTCTAGACTCTAGAGAGTCTTGCCAAGTTCAATGTGAGTACTCATCTTGTCGTGTTATAGCGTTTACTAGTGACAACTG
TTACAATAAAAAAAATTTAATAAAAGAGTTGAAAAATAATCAAAATGTACCGATATGATTGGAATGATTTTGAAAATATAATTTTAGTTAGAGAAAATAG
CCAAAAGCCCCCCTAATCTATCACCCTATTCTCAACTACACACTTATACTACACGGGAGTCTTATACCCCCCTGAACATTTTAAAAATATGATATATACC
TTCTTAAAAACTCACGTGCGATTTGTATTAAAAATTAAGTGGCACGCACTTGTCACGTAATTTACCTTTTAAAAAATTTTAAAAATATTATTTTCCCCTT
TATTTTACTTCCTTTTATGTTACCCTTCTTCTCTTTCCTTTTCTGCTCATTTTTTTTCGTTACTTTGATGAGATGATTTTTCAAACTACCAAAGCAAACT
CAAATTAAGAACCCCTTGAGTGAACTTTTTTTTTTATAAACCTTATGAAATTCTTCATGATTTTTGTTCAATAAAACAAAAAAATAAAAAATAAAAGGTC
GATTGATGGTAAAAAGATTCACTATTTGATGTTGTTTGGTAGGATATGCAATGATTTGACTGTATTGAAACTTAGTGATGAACACAAAAAAGTGATAGTT
TTCATAATTTGGAGACTTCAGATTTGATTTTTCAAAGTGAGTTTTGAATTTTGGTTGAAATTATTGAGAGTTTAGACACTTTAAAGATGAAGTGGTTGGG
TCATGATAATATAACTAAGGGAATATATAAATTTTACTCAAGGGTTCCTAAATTTCTCCATGACACTAAAATTTGATCCTCTTGACTTTTCAACTTAATT
TTAATTTTAAGCTATTGTCAATTTTTCAATTGAATCTACCATGAAAAAATTGTGATTCGAGGATAAAAATCCACTAAATCATGGGAGTCTGACGAAGGAC
TTGGTGGTGGAACTGAGTTTCCGTGAATGTTGCTGCTATAATAACGAAGAGAGAAAAAAAAGAAGGTAAAAAAAATTTAAAATGAAAGGAAACTATCTTT
TTTATAAATTAAAAAAAAACAATCTAAAAATTAAAGTTTTAATTATTATTTTTACTTCTCACTTTGAGAGAGTGAACTGCACTTTCTTTGTCATCTCAGC
ATTGAGGGAGCAAATAATTTCATTTTCAAATAGTTTAAGGAGGTAGTAGGACTCCTGTAAAGTATAAATGTGTAGTTGAGAATTAGGTAATAGATTAGGG
GGTCTTTTGACTATTTTCTCTTTGAGTTATAATGTCTATTAGTCTTATAACAACGATGTGGGACAGGAGATTGATAATTAGTGAAACAATTAATTGGACT
AATGGTTGAGTTATGAGTTTCTCATAACACCTTTTTTTTTCCAGTACGAAAGAAACTATTTTTCTCGAAATTGCTTTTAAATTTTTTCATGATCGATTGA
TTATACTATTGAAAAACAACAACCCGTATCACTATCCTGACCACCCCAATGTTTAGAGACTGGCCAAAAATCCAATACAACTATTCATCTTATCACGTTC
TAACTTTTACTATGGACGATTCTTACATAACGTTTTAAACAAAATATAGAAAATTAATTGAACAGTTTTACTATTAATGTCTCGAAAGTCTTTGCCAAAG
TCTAAAACATGAGTAGTACTCATGTTATCACTTTCTAACTTCTCCTGGTGATGGTTTTTACATAATACTTTCTAAGAAGTGTCGAAAACTAGCTATCGAT
ATATTGAACGAATTTGGAAAAGTGTAATTTCGTTAATATTCAGAGAGTCTCGATAGTGTATCGATATTGAAAAAACCTATATGAATGTTATTGATACGAA
TCAAACCAAACCATTACAATCCTACTAAAAAAGATAATGGTTCAAACCAATTGACAGACAACTCTATGTAGAGTGGTTTGACTTTGGTAAAGCTCGTCGA
ACAAGCCTCAAACTTCAGCCATCGGGCGGAAGCGCTTAGCCCCCCTACAACAAGGAGGGGCGAGTACCCGATTCAGTCTCGGGAACTCAACTCTCACTGT
TATGTCAGCTCCCGGGGAGGGCTGCTCTGTTAAGTCAGTGGCTAGGCAGATCAACCTAGCCCCCAACTCCCCGGGGGAGAACACAACGTCCAATTCCGAA
GAACTGGTTGTCCGAATCATCTTATTGCTCCTACTTAGGTTACAAGCTCAAGTTACTAAGCTCAGCAATATGTGTTGTCTAGCTGAGGTCTTATAAAATG
GGCGTATTAGTCTTATAACACCAATGTGGGACAGGAGATTGATAATTCGTCGTCCAGTATGGAGGAAACTATTTTTCTCGAAATTGCTTTTCAATCTTTT
TTATGTTCGATTTGTTATAATTGTTGAAAAACTCTCGCCAAAACACCTTGTATCCCTATCCTTACCACCCCAATGTTTAGAGACTCTGGCCAGAAGCTCA
ATACGAGTATTCATCTTATTACGTTCTAAAATTTTTTGCTATTGACGATTCTTACATAACGTTTTAAATAATATACAAAAAATTAACCGAACAATATCAT
GATATGATTTGAATGATTTTAGAGAGTCTAATACTATTACAGTAGTACTCACGTTATCACTTTTTTAAGAAGTGTAGATTGAACTGATTTGGGAAAATGT
AATTTCACTAATATTTGGAGAGTCTAGCTAAAATTCAAGACGAGTATTCATAGTGTATCGATATTGAAGAAAAATCTATATGAATGTTATTGATACGAAT
CTATAAAATAACTATAAAAAGATATGGTCCAACCAACGAAAACCTGACAAATCTGGTTTCTGCTCTTGACAACACTTCTGCGCCATCAACCAGGTAACAC
TGGTCTGTTAAGTCAGCCCAGGAGGTGCACCTTAGACTCCCGCCAAAACTTCAACACGAGTACTCATTCTATCACGCTCAAACTAGTACAAGTAACTATA
TAACTAACGGAAAACCTCAACACTAGTACTCATTCTATCACGTTCAAACTAGTACTAGTAACTATATAACTAACGGAACTATAAAGATGATAGTCCAACC
AACGAAAGCCTAACAAATCTAGTACTAGTAACTATATAACTAACGGAACTATAAAACCTCAACAGGAGTACTCATTCTATCACGTTCAAACTAGCACTAG
TAACTATATAACTACACAGAACTATAAAAAGATGATGGTCCAACCAACGAAAGCCTAAAAAACCTAGTACTAGTAACCATATAACTAAACGGAACTATAA
AAAGACGATATTCCAACCAACGAAAGCCTTACAAATCTTGTACCAGTAACCATATAACTAACGGAAAAACCTCAACTCGAGTACTACTTGTTCTATCACG
TTCAAACTAGTACTAGTAACTACATAAGTATATGATGGTTAACCAACGAAAGCGTAACAAATCTAGTACTAGTAACTATATGTAACTAACGAAATTATAA
AACCTCAACACGAGTAGTCATTCTACACGTTTATATATATGTAACGGAACTATAAAAGCATATGATGGTTAACCAACGAAAGCGTAACAAATCTAGTACT
AGTAACTATATGTAACTAACGAAACTATAAAACCTCAACATGAGTACTCATTCTACACGTTTATATATATGTAACGGAACTATAAAAAGATGATGGTCCA
ACCAACGGAAAGCCTGACAAATCTAGTAGCACGCGGACCTAGCCAGGCACTGGTTTCTGGTCTTTGACAGCACTTCTGGGCTATCAAACGGGGAGCGCTG
TGCTCTGGTAAGTCAGCCCAGGAGGTGCACCTTCAATGGCACCCCATCTACTCCCACTCTACGCCAACTCCATTAAGGATTGACACACAATCAGTATAAT
TACTGACTCAATACTGGTCTTTGACAGCACTTCTGGGCTATCAAAGCCCAGGAGGTGCACCTTCAATGGCACCCCATCTACTCCCACTCTACGCCAACTC
CATTTAAGGATTGACACACAGTCAGTATAATTAATTACTGACTCAATACCAAGAAACCAACTAAACCAACACACACTGAATTTGTCAAATTGATCGTCCC
AATCACCTTATTGCTCCCACTTGGGTTACAAGCTT