BAC Sequence – LE_HBa0047H17

>C10HBa0047H17.3
TCTAGCTTGGACCGGATCTTCTTCTTCATGTCTTGATGCCTTGAAGTTCTGGCATAGAGTAGCTATTATTTATGTTTAGTTTCTTAGATACTCTTAGCTT
TAGTAATTTGAGGATAGATGTTCTTGTGATGATGACTTCCAGATTTTGGGGAATAATAGTTGTTGAGTTTTTTTTAGAAGTTTATTGAATTGATTTTCAT
TAATGAGTTTAAGTCTTCCGCATTGTATTTTTTCATTATGGTTAAAATGTTGGGGTTCAGAATGATTGGTTCGCTCACATAGTAAGATAAGTGTGGGTGC
CAGTCGCGGCCCGATTTGGGTCGTGACAATTTGTGATTCACATATATGAGTCCGGAAGGAGATTCTATAACATGGTACTATCATGAGATCGAAAGAAGAG
TAGTGTCATTGAAAATACCTACTATATCCATACTTGTTTAGCACAATTGAGCATCACTTATACCCCTATGTGATATCAATACCAATTCCCATACCTCTAG
ATTGTCTCTTACTTGTGAAATTCCTTTGATCTTGTTTAATTGCATATTTGATTACAGATATCTTTTTGTAAATTTAGTGGAATCATCCACCCAATCGTTC
TAAAGTGCTGCAACAAACAGGTTTGCATACTTGAATTTTCTAGTTAAATTCTTGCCCTTAAATCATTCCTTGTGGAATTCGATTCCGACTTTTACTTTTG
ATATTTTTATCGACAACGATTACTTACTCTTTTAATCATTTTTAAAATAATTTGAGCATTATCAGTGACCCTATTACAAATCAAACATATACGTCAAAAA
ATATGGTATTTGACGAAACGTCAACTTGATGGTCCAAAGAAATCTCCTTGCCAGACTCAATAGCTCTTGAGCAAAAGTTACAAGATAAGTTCAATGAAAT
AAAACAGGGGAACAAGATCGATCCAATCAGGATATATCTCCACAAAAGGAAAGAAAGAGCTATGGCAAATTGGAGCTAATGAAAAACTAAATGAGTTGCG
ACTAAGGATCGAGGTCTACACGATTGAAGGGTCCAAGCATCAAGTACATAGATATAAAACATTAACAGTGGTGATTAACATCAAAGAAGCTATTACCTTT
GAAGAAGCTTCAAAAAGTAGCAATCAAAATAATTTGACGAAGGTGGAGATCCTTAAAAGTAGTGGATGATGCTTGCAGAGTTTCAAAAGTTGCTCACAAT
TGACGCAAGAACAAGTTAAGAATGAGGAGTGTTAAGAATTCATCAACTGACATAATTATTTATTAGGATAAATCTATAAAAATCTAGAATATTTTAAAAT
TCAAAAGAATCGAAGAAAGATCTTTAGAATGGTATTTTAAATAGAAAAATCTAGAAATGTTATAGAAAAGAATAGCTAGGAATATTCTAGAAGAGAATAA
TATATATCTTCTAGATTCTTCCATGACCTCCCAAAATAGAGATGATGCATTTGATTTGCAATTAAGTGCAAAAAAAAAAACCAAGTAGGAAAGCAAAAAA
AGAACATAAGTAAGAGATCAAACAACAAGTGAGCGAGAAATAAGAAAGAGCTTGCTAGAGTGTGAGTACAATAAATATTTGTGTGTAAAAATTGTAAGAC
TAGAATGAATTCTTACTTTGCAATAATAAAATTCTAGTTGTGGGCAACCAATTATGTCCATCACCAACATAATATTCAAAAAAGTGAGAAATTTACTTTG
TCCATCTCCAAATTATATTCAAAAGTATATAGATTTACCTCGTATACATAAGATTAGAAATTAACTTTAATAGCTGAGGGAGGTCGATATTTATTTTAAA
ATCCCAATTCAAATCTCAAGCACTACACTAAAATTATGAAGAAACATATTGTCATACTTAAAGTTGTCAAATGAGCATATCAAATTAGACTGAATTAATA
AATTAGCAAATTATTAATCCATTCAGAAGCTGCTTTACGCTTAAATAATCAAGATTATAACTCAACTTAAAATATCAATTATAACTCAACTCGTCAAATC
GACTAATCGTTATTCAAGTCGTTCGTTCACTCTTATTAGAAGTTTATATAGGATGATATCCATTTTGGAAGGTCTCGAAATCCCCTTTCTTATCACTCCA
CAAATAATATTTTTTATTATTTCAGAATTCTCATAAAATTCTAGTAATTCATTTAACTAGTCAAATTTCTTAGTATTTCCAGAATAAAACAAATTAAAAT
TTTCAACCTATTTTAGTATTCGACACTAGTTCAATAATAATAATAATATATACTAGTCAAATTAGCATTTTAAACTTTGTGTCTGATAAAATATCAATAG
GGGCAAACATGTCAATTCAGTGGAGGAATCTCATAACTGACGTGACTAACTGAATTGGGTTTCCCGCCCTGTGAGTGACAAGTTACAGCTATATATAAAC
CTGCACAGACCTCTCCTTCCCCTATTCATCTTTTTCACACCCATTTTCTCGAGAGAGAGCAACAACAATGGAGATTTCTCACAATCTCCTTCCACTTCTC
ATTGCTCTCTTCATGATCTCCGCTTCCGCATCAATTTTTCCTGACTCACCTACACCGTCGCCGGTGATATCTCCTCACGACCACACATTTTCCCCTTCTA
TCTTCCCCAATGTTCTCTCTTCACTCGGTTTCCAGCAGCTCTCCTCCGCCGCTTCTGCCGCCAATCTCTCAACTACCGGCACTCCAGTCACCATCTTCGC
TACGGCTGACTCTTCTCTAATCACTTGTCCTACTTGCTCTCTTCCGTTGCTACTTCAGGAACACTCTGTTCCTGGAATTTATCCACTTCACTTTCTTCGC
TCTTTAGCTTTTGGTACTAAGCTGGAAACTCTAGCTCCGAATCGATGCCTCACCGTCACTTACACCGCTACTTCTCGTGATCCGAAAGTTTTCATCAACG
GCGTTGAAGTTGCTCAGCCGGATCTGTTTAATAATGGAATGATCCTTGTACATGGATTGCGAGGCTTTGTATCGCATCTCTCTCCACTCTCCTGCAATGT
GGAGAGAATGAGTTCTATGTCGTTTGACTCATTTCCTCTTCCTAATTCGGTTTCTACAGTTTCCTCTGCATCGCCTTTCTCTGTTACGCGCTTCATGTTA
AAGGATGCCATTATCAGGTTGAGGAACAGCGGTTACAGTATTGTAGCACTAGCGCTGAGAGTGAACTACGCAGAGCTTTCGGAGCTTAAGGCGATGACGG
TGTTTGCTTTAGATGATGTGTCGATTTTTGCCAGTGGAGGACATGCGTATCTCCCACATTTCAAGTTTCATGTTGTGCCAAATAGGAGGATTATGGCTGG
GGAATTGGTGAGTTTGCCTGCGGGGACAGTGTTGCCGACTATGGAGGGCGAACAGAAATTGGTGGTAACTACTGCCGGAGGAGGAGGTGTTTTAGCTCCT
ATGAAGATTAATTACGCGAGGGTTGTGCATTTTGATCTGCTGCATAACGCTAGGATTGTGATTCATGGAGTGTCTGTTTCATTTCCTCACATGCATCATC
ACGTCACAGCTGATCAGAAAGGCTTCGCTCAGATGGAACAGTCACACGCACACTGTGACGTCTCTGGAAGTGGTGGAGTCTGTGACGTTCATGATGATTT
TGCTCCATCTAACATGCGATCATCAGTGCTGGGGAATATTGAAGAGCATGAAGGTCTCTGAAACTTGACTACTGTTTGTTTGTGGAGTAATACGGTAGTA
TCAGACTATAGCGTAAATAATTGACTTTCACTTGATCATTCTTCAAATCCCTGTTTCTTAGCTTCTCCTTGTGTTAGTTACTTTAGTGTTACTATCTTTT
TGTAAAATGAGGTTTTCATTGCTGATATATGAAGAGTATTTGTAGTTTGTTTGGGTTATTGATTTGTTGATCCCTATATTTTTCTTGCCAGTTTTTCCTG
TTTTGGGTTCAAATCAGCCAGTAAAGGAATAAGAAGAAGAAACATAGATATTCATTGATTAATCAAACCAGAAAGTTGAGTCTGGAACTACCCCAATTTG
ATCATTAATTAGTGAAGCTCTTTCCTACAGTTAGATCAATTGATCAATATCCAATGGAACTCCACTGTTCCATTTTACACACAATGAGATACTTGATAAG
ATTGATTGAACTTGAAAGTCTTTTAAACTCTTATTAGAACAGTGAAGTCTTACATGAGTATGGTCATATTTAACAGTACTAGTGCTTGCTCATTTGGTTC
ATGATATATCAAATTGCTTCAAGGTTCATAGTCTTTAAGCTAAGGAAATATCCCAATGGGAGTTGGGGAATACAGTGATTAATCGAAAAATATTCAAGTG
TTGTAGGCTGCTCTGATTGATATATGCACTCTTGGTATTATGAGAATTTGATTGTTATGCAAGTTGGAAGTTTCTTCAAGTTCTTTTTTTGAAATTTTGA
AAAAAATAAGTCATTCTATAAATCAATTCATCAAAACAGTATGTTTGATAAAGAAGAGTATTTTTTTGTGATTCAGGTAATTTTGTCATACATTAATTTA
GTTTATCTTATAGTTGATGAATTTGTTATTTTCCTTTGGTGAATTGATTTATAGAATGACTTATTTTGATCAAAAATTCAGATTTTAATGTGTTGATGTA
GGTTAACCCCTGCCACTCTTACCATTAAAACTAATGTTAAAAAGCATTAAAGTTGAATGACAACAGTTGTAGTAAAAAATTAAAACTCATCTTTAATTTT
ATAGTGATCCAAAAGCTAATTATACTCATCAAGAAGCAACCTAATGGTTGATCAATTTAATGTCATACCAAAATATTTGGATTTTGCTGCTGTAAACAAC
CTAGCTAGTGCAACATGCTACATATAGTAGATTGAGGAAAGCTTCTAAGTTACGTTGTATTCTTACTTCTGTATAGGTATTTATTTTATGGCTGCTAATA
ATGCATACCAATTGGATCCCGATCCACTTGATCCGTCTGTATTAACTGGACAACTCACTCATAGGTCACGAGATATATGGATAGCGAATGATAATATGAT
TTTGAACACAAGGAAATGTGATGGGAAGTTTTGGGACCTAGTAAATGAACATCTCATTCATCCACGAGTCCTAGATGTGATTAAACTATCTGGATTATAT
GGTGTTTATAGGTCTCATAGGCCTGTTATTGATCGTACCTTAATCACCGCACTAGTTGAGAGATGGTGGCCTGAGACTCAAACATTCCACTTTAGGACGG
GTGAGAGTACGGTCACTTTACAGGACATGGAGATATTGTATGGCTTACCCGTGAAAGGTAATGCAGTAGTTGGGTATGAGCCATAGAGGTCTGTAGTGGA
TTGGCAAAATATTTGTCAAAGATTATTAGGTTTTAGTCCACAACCTCAAGACTTTAAACATAGTAGTCTCAAGGTTTCTACGCTTAATGCACACTTGCGA
CTTCAACCACGATTACCCAACTTGGCAACACAGGATATGGTCAATGAGAAATTAGGTGTTATATGTTTTGGATGACTGGCTTACTATTGGCAGACACATC
TGGTGGTCTTTTAAAGCTTATGTACTTGCCTATGCTGGAGGATATTACTACAGTAGGGTCTTACAGTTGGGGTAGTGCAACCCTAGCATATTTGTATCGT
TTTCTTTGTAAAGCCTCCCAAAGTAGCCAATATGAGATTGCTGGATTCCTACCACTACTTCAGGTATACTCAATAATAACACTTAGTATTTATTGAAATT
TTATCTAGTTTATAATTATCTATTATGTTCAGATTTGGGCATGGGAGAGAGTTACCGTCCTTAGGCCTCAGATTGTAGCAAAAAGAGATACAAGGAATAT
TTTCCCTATTGGTTTACCAAGGGGTCCACATGCTTCTAGATGGTATGCACATTTTAGTTGGACCGACACTACCAAACACGTGTTAAGAGTTTTTAGGGAT
GCGCTGGATTCCATGACAGAAGATCAGGTAAGATTTTGTACTAATTTTCTCTTAACTTTCGTATATATTGTAATTGTGAGTACTTTTTTTATAGTTTATT
TGGGAACCATATTCTTCTGACATAATTGAGAGTCTTCCCAAATATTGCCGCGTTGGAAGAGACATATGGCATGCTAGAGTTCCAATTTTTTGTTGGGATG
TTGTTGAGGTTCATTTACCCGATCGAGTTATGAGGCAATTTGGACTGGTACAAGCGATACCATCTTCATTTGCATTTGACGCTACACATTTTAACCATGA
TCGTCGAGGAAGATCAAACACAAATTGGGAATTAGAGCATGCACAATGGTTGCATTTTTGGAACCATATTGATCAATATGTACGGAATGCACCAATCCTT
CATGGATCACTTCGGTATGATGATCCCTACCTTATTTGGTTTAGACGTATTACTCATTTTATCATTGGTAATCCTATTTCGAGCCCTCAACAACAACAAG
GTTACGTGCCTAATGCGACGATATATGAAACAATGGTAAGTTTGATATTAGCTTATTAATTGTTGGAGCATAAATGATTTCTTTCGAACCATAGCTAGAA
TCTATATTGTTGAGTACTCTTCTTGCATATTGAAAAAGTTTTGCTCATTTTTGTTCTTCTTATGTAAAAATTAAGTCTAGTTTTTGAAACTCCGGCAAGA
AACTCCATTTTGGTGGTTAATATTTTTTTCATTTAACTTTATATGGTGTCAAGTATTTTAGTATGTATAATTTTGTGTATTTTGTACTGCTAACCATGTT
TGAGGTTGACATATTAACTAATAGTTTGGCTAGATCGGTGGAAACGAGCTCTGCTAAGGTTCTCGAACAGGTATGATTCTGTGAACCACCCTAGACTGTG
GGGGATTACATTCGGTATGTTGTTGTATTGAATTTGTGGACTACAACTAGCTTGGTCGCATAGTTGGATACTGATGAGCTGACTCTATATTCATACTGAT
TTGAAATTCTGGCAGAAAAAGCACAACATGAAATTAAGGTACAAAATTGCAGGCTTGGATAGATATGAGAGGTATGATTGTGGAGGTTCTGAAGATATTT
GTTACTTCTGAGATCCTCTTTGTCTTGTGTGGTTTACCATATAAATAGGGACATGTATTTCCTTTAATAAGCTAGTGGCATAAGCATTTTAGTCCACTTT
CTTCTATCTTGAACTTCTTATTTCTTTACTGATTCCATGTTTGCATTTTCTGCTAAACTTTAGACTAGTAACATCGGATGACTTGTGGAAGTTTAGATAT
TTTTCTAGTCAAATACATTCTTTCACCAAATTTGTATTTTTATCATATTTGCTTTCATTTGTATTGATGGATTCAACTCTGAACCTGAACCATCTTGCAG
TAATTATCAGTTGCCAATAAAAATTCTGGTGCGTGCTTTTAGTAAATTAATAATAGAATTTTGGTAGTCCATATTTGTTATATTAGTTCCTTTTATCCAT
GAAATATGCCTAGAAAGTCATACTGAATTAAATAAGAGTTCGCCATGGAAATCTCGTATGTGCTATAGCAAGTTCATGATTATCAATATATATTACCAGA
GCATGTTGGGCTCACAATCTGTCACTGGGTCTTTCTACACAGGATTTATTGCTTGGATAGTTCTGTTGTTCCTGTTTGAACTTTGAGTAAAGCAAGGCCT
AACTTTTTTTTTGTCGACATAACTCTAGTTTCTTATGCCACTGATCGTTGAAGCTTAATTTTGTGATAGACTTAAGTCCAAGTAGTTTGAATTAATAATT
CAAATTTTGAGAGCAACTATGAGACATTCTAACTCTTGAAGTTCAGGTGTATTTCCCTTTTGGGTTTTTGTTGTAAAGTGTAAACTAGACAGTTGACAGG
ATGCTAGATTTTCTTACTTCCCTACAGTAATTGTTGAGGACTGAATTTGATGTAATCTTTCGCACAATCTTGGGGTTTCATTTATACAACCTTACCATTC
TAAAAGAATTAATCACTCAAATTTTATTTAATAGTTGCTTACATATCTTTATTATTATTTGTTGTTTGGTTCTACAGAGCTTGTATAGTGAGCAGATTTG
TATCATAAGGCCTCCAATATTTGACTAGTGAATGTGAAGCCAATCACTTTGGCGTTTTGTTAGTTGGTGCAGATTTGTGATGGTTGGATCATTTAAAACT
TCCATGTTTTAATTTATATTGTGTTTGACTCAATGCAAGAGTTCAAGAAAGCAAGACTTTTGGAACTTGTGGTCTTAAACATGCCTTGGCATTTGAATGC
TATAACAACATGCCTTTAATTAAGGGGTAAATAGAATATTTAAATTGTTTCCAAATTTAGGGTGGTGTTATTCTTATTGGAGCAGACTAATATGAAGGGA
GTATCACATATAATTGAATGGAGGAGTATTTTCTACAAGCTGTGTAAATGTTTTTATGCCTTAAATGTTGCTCCTTTGCTGGCTTTTTAAGTTTTGAAAT
GTTTTTCTGATAATTGAAACATGTATATATGTTTCATCCTTGTAATTGTAAAATTTAGTGCAGTGTTTTATTCTGTAATCCCAAGATCCTGTAAGTTTCT
TGTGATCATTAGGGATCACTTAAGTCACCATCTATTCTGGTTGTGTGGATCTTCCTATGCACATACCTAACATATAAAGGTTTATACTACAATAGTCTTT
GTTTGGAAGATTTTATAGTCTCTTATTAAAAAGAAATGCAAAAGCTTACCTTGGATGTGAATGTGAAAATATACCAACTTGAAATGTGTAAATAATGAGA
TTGAATCCAAACTCAATAATTCCTACACCAATGTTCCAGTTTTTGAGGATTATGAAACAAGGACAAGAGTTAATAAGAAAGATTTGTCTATTTTGAATTC
TGATTTTTATATCTCAAAATTTTTAGATAATATTTTTTAAGCAATAAAAAGTGGCACATACTTGTAGACATTTTTTTAAGCGCAAATCTCGTTGGCATTT
TCTTATAATCGATAGAAGTATCTCATTTTGCAGATATTGAATTATGGTCGCCTATTTCTCAATTCTTGTGTTTATGTCTATTCTTATGTTTCTGTCTACC
TAAGCAACACTTTGATGAAATTACAACTGCATAAGCTCCAGACTAAACAACAAAAGACAAAAATTAATTATTATTTAAATTACATTACAGTAGCTAACTG
AAAGAAAATTATCAAAACTAGACATTGACCCACATTTGGAATTAACACAATTAAACTAATCAACAATTGTCTACTTAATTTTAATTACGATATGGACATC
GACTCCTATAATGTCCGATTTGTCTACATAATCGACAAGCTCGCTCATATACAACAGCACAACGATCCATCTCATTGGGTATTCTACTGTTCCTTGATCG
ATTGAGACGACGATAGAATTCATTACTTTCCATTCTAAAATTAGGAGATGGTCAATACGCCTTATGGCCAACCGGTGAGAAGGACCCAGAATATATTGCA
ACATAATTCTCTACAGTGAAATGTTCACTAACAAAGTTTCTATCTAACTCTCCCATTCTATCAGTAACCTTCATGACATGTGAACATGGGAAATGCAAAT
TAACCCATTTTCCACAATCACATTTTCTTTCATTCAGTGAAACACAATGAGGATTACCACCAGTACCATCAACTTGAATAGATCTAACCTCATATACCCC
TGTGGGTATATTCCAATAAAAAAATAAAGTGCCTTTTTGAACTTTCATAGTTCTTCTCCCACTTCATTTTGAACCTTTCGGTCCACAATTCATCTTGTTC
TAGGAGATGCTGCACTTTTTTAGACCTACGAGTGTATCGTTCAACAGTTTGCTCTAATGAAAGTCTGACCATAGAATTGACCGGCAAGCCACGTGCTTTT
TTCAACACTCCATTGAACGACTCTGAAATATTTGTTGTCAACACTCCCCATCTTTTACCGACATCATGGCTAACCGTCCATTTCTCCAAGGGGATTTCCA
TGAGATATTCATGTGCATCTTCATTTTCTTCTCTAATTTTCCAAATCAAGGACTCAAATTTTCTTACTTGATGGGTTGAAGCAGCCCTCTACATCAGCCT
ACTAAGATCCTTGTTTGGAAATCAAGATTGAAAATTACTCTTAAGATGTCTTATACAATATCGATGGAAGACTCGAGGCTCCTGAAATCGCCGCAACTCC
TGTAAACTTGTCAATATTCCTTTTGCCCTATCAGATATAACACAAATATCTTCTCTATCTTTTATGACATGTGCACTCAAATTCTTAAAAAACCATTTTC
ATGCTACTTTCGATTCTTTATCTACAATAGCAAACGCTAGAGGAAGAATATTATCATTTCCATCAATTCCAACAGCAATCAATAATTTAATCTCATATTT
TCCATACATATGAGTTCCATCTACTGAAATAACAAGGCGACATGTTTGAAATCCATCAATGCATGACTTGAAAGCCCAAAATACATATTTGAAAGTTTTT
ACCTCTAACGAACTCATAGACTCTGCGTGTTTCCATTCCACAATTGTTCCATGGTTAAAGTGTTGAAAAGCTGTAAAAAATTTGGGTAGGTCACTAAATG
ATTTCTTAAAGTCACCATACACCAATTCAAATGTGCGTTGACGTCCAAGCCACGCTTTTCTTTATGTTATTTGATGACCAAATTTTTCGTGAACCTTGGA
AATGACATCTACCACCAAAACCTTGGAATTTTTTTCAATTTGATTAAGAATCAAAGATGCAATTAAATTGGTATTTAGATTTGCATGACCTCTAGAAAGC
CCCTCAGTCTCACATCTATGATTTTCAATATATTTTCCTATTTTCCAAAGGTTATCTCCAACCTTTCGTCCTCGGAGAAACCACAAGCAACCCAATAGAG
TATGAAACTTGCATCTTGCAACCCATAAACTCTTGTTTGATGTCACCACCTTGAATTCATTATTTTTTTTCAAACTTCAAATTGTCACAACTCGTTTTAA
TTTTTCTTTACTATTAAAAAAATACCTTTTTTTCAAATCTTTTGTGCCATCTTCAGACCAGACGGAACAATACTCCATCTCAGATTCACATGTCGACATG
AAAATGTCTTCCTCGTTATCTAATGTTCTAAAATATGGTACATCATTTTGCACTTCAGACACATCCTTTTCAAATTGATTAGGAAAATTTATACCAATGT
CATTTTGAGAAAAATCTCTAGCATTATTGATATCTTCATCTGATTCACTCTCACCATCATCTTTTGAAGGTTCATCTTCCTCTGAACTGTCTTCACTAAT
TTCAGCATTTAAATCACTATATGGATCAACATTGTTCTCATTTTCTTTGTGGAAAAAGAAATTCAATTAAATTTTAGAAAATTATGATACATAGAAGCTT
GTTTTAAAATCAGTAATTTATTCTCCATAAGGTTATTCCTTAACAAAGTTAAGGTAATTAATCACAAAAAATATCACTATCTATCTATATATGTATATTT
ATAATGAGTAAAATTGTGTTATCAACTAATTATATTAAAATTCATTAAAACACAAATTTGTTGTTTTACCTGCCTCGTATTTTCTCGAACTATTGTCAAC
ATGTCTTTGGCTACTTGAACCTTCGCCAAATAATCGTTGGTCATGCATTAACAATTGTTGAAATGGTGGTTGAGCAATCGGCTCTGCATAATGTGGTTGA
CTAACCATGGCAAATCCATAATTTTGAGACAACAAATTCATGTGATAACCATGTTGACCACTAATTTGAAATATATCATTTTGATTTGTTGATTTGATCT
TTACATACATTTCCAAAACATTTATGTCAATCTTATCCGCAAAGTGTTGAGGTATAACAAAAAATTGTAACAAAGATTGATCATCATCAATTTTAAACTC
AATGAATCTTGTATGGTTACCTTGAATTGATCAAGGATATTTTTCCAAAATATCCATTTGAATATTTTCACTAGTTGTACCCATTTCTCATGCAATAATT
CAACCAATTCAACATACTTCATTGAAGTATACAGGTTAATAATCATATCTAGCAGATTCAGTATACCTGCATCTGTTCAGTAATTATTTCGCCACACCAG
TACAAAGCAACCATCACATTATGTTCAAAATTTGTCATTTTTATTCCTACACATAAAAATAAGTCATCTTTCTAAGTAATAAATTAGAAAAATATTTGAA
AGCTATGGTAAAAATAATAACACAATATGATACATTGACTCGACTTATTTAATTCATACCTTTGTAAATATTGTTTCAAAATTGGGCTACACAAACAAAA
TTTTGAATGAATGTTGTTGGAGTGTTTAGAACATTTGTTTCAACAAGGTTCATTTTATAACTATTTGTCGTCAGTAAAAAAATGAAAAAATTGACTTTAA
CATAATGTCGTAATTGATAATCACGATTTAATGTAGAAATGTGATCAGCGATAACGTTTTATGATCTGTAAGATTCCAATGTAGCGGGATTTTATTCTTA
ATCCGATGCCCCGTGATTAAATATACATAAAACGTGATTGACAGTTACGTTCTATATAATAAATGTGATTATCAGTTACGTTTTATAATCTGTAAAATAC
AGGATTCGATTCTTTAATTGCAGAGCCCGTGACTGGATAAAATGTGTCTACAGTACTAAAATATAAAAACGTTACTTTGAGTAACGTTTTATACTCTAAA
ACGTGATTCTAGATAACGAAGTATAAAACGTTATTGTCAATAACGTTTTATTTCCATTTGCTTCGTGAACTTTTGCTCTTTTTTTTCATTAAATTTTTTA
AAATAAAATAAAGCATAAAACGTTACTGTGAACCACGTTTATACTAATTTTGTAAAATAAATTAAAAACATACTATTTTGGTACATTGATTTATAGAATG
ACTTATTTTGGTCAAAGTATCTCTTTTTTGATGTTTGGAAACGTTTCCAGTAATTAAGTATGACATCACATTTACCTGATCCTTAGCTGCTGGTTATCTT
TTCAAAGAGTAGGAATGAGGAGAAAAATTGTTTGAAAAAAAGAGAAAATAATCAAATCACCCCCTAATCTATTACCGGATTTTTAACTATCCATTTTTAT
TTTATAGAAATGTTATTACCCTCTTGAACTTATTTAAAATAAAATAACTTTACCCTTAAATGCTGAGTTGGCACAGAGAAAGCATTCACTTTGTCAAATA
GAATAAACTGACTATTTTTTTCCTTTTTATTTTCTTTTTCATCGTTCTTCTCTTTCTTCTATTGTTTTCTCTCTCTTTCTTACTTTCTAACTATTTTCTA
TTCTAAATTCTACCATGATCTTGAAGATTTCAGGCAACCCTTTTTGGAGTTCTGTCTACTAATTAATTCTTAATCTTTGTAAATAAATTAGTCTATAATT
TATATTGATTCATCAATTTTTTTCTTTTTGAATATGATTTTGTATCTTCACATAACATTGTTCTTAAATTTCTGAAGATGCTTCTTTTTCAAATTAAAGA
AGGTTCTCATTAAATTTTTGTTATTGAAAACTAAAGTTTGTATTCAAAGTATCGATAAGACAACAAATATTTTTTGGGTTATATTTTGTTGATCAATTTT
TTGGTGGGTGTTGTTGCGAAGTCAAATATAATTATTTTTTTTGGCGAAATGGTCTGGTAGATACATATACTTGTATGCGTTTGTATTGTAAACCATTTTA
CTTAACTATTTACCAAGTAAACCCTTAAACTCAATCAAACAAGTATTCTCAAACTCCTCTCGTCATGTGTGTAATTCACTCACCTTGAATAGATGACATG
TCATATCCATATCACGTAAATTAATTACATGTCATAATTATCTTTATTATTTATTTTTAAAAATTATCAAACAAAATTTTATTAAATAAAACATAAAATA
ATAAATTTTAAATTTATTAAATTTTGGGACTCCACACCTCTTCAACAGTGTACATCTAAATTCACCGGCGAAGTCGTCGCGGCCACTTTCTTGCCGGCAA
GACTTGCAGGTCTCCACCTCCATTGCAAGCCTCTCTATTTTTCTTTCCTCTTTCTCCAACCTCCACAAAATTATTAACTGGCGACCCCTATGAGCCACCA
TGGGCCGTCTCTCTTCTTGTCCTCTCCGGAGTACCAATAAACCCACTCGCCGCCTCCCAATCTAGTGAAAAAGGATCAGTGTCGCCTCTCTCTTACTCCA
CTTTGAATTAGTAGACCCCGACGAAGCGAAGAGCATCACCATAAAATCGTTGCTTTCTCTCTTCAGTAATAACAACTTGTATGTGACGACAATGAGGTGT
CAATATCCTGCTAAAGTTGTTAAGAAGTGTATAGAAGAAAGAAAAATGGACGGGGTCAAGAACGGGGATGACGGCTGGAGTTGAAGGAAGAGGATGACCT
TTTCTAAAGTTCATTTTTTAAAAAAATTTATTATGTTAGTTTTAAATTTTTTTTAATTGAAAATTTTACTTTAAAATATTTTTTAAATTTAAAATGCAGG
TCCATCCGCCTTCTCACGCGTGTACCCACTTTCTTATGCCAATTCAATCATTTTAATGTCAAATAAGTATGGTCAAGGGTCAGAGGGGTTTGATATATGG
TATTTTATTGAGTTTAAGGATTTAGTTGATAAATTGTTAAGTAGAAAGATTCACAATACAAATTCATATAAGTACAAGTGTCCACCATGCCTTTTTTTTT
ATACATGCAACTTTGATAAGTAAAGGAAGTGAAAGAGTTAATGGTAAAGACATGGAAGGGGGTTTGTTTTTGAAAGAGAAAGTTCCTAGATAAGAGATAA
TGTGGAAGTTAACCTAAAACGATTTGATGGTAGTTTATTTCTAGTTAAATATTTTAGGATCGTGAAGGTAAATGGGGGAGATTTTTTATATATAAAAATA
ATTACAGTTCTATGAACTGAAAATCTGTAGCACGTTTATTACAATTATTTATTGGAAATAAATTAGTCAAAAAACTCTCTTTTTTCTCTTTTCCATTCTC
AAAAAAAAATTACAATTTGTATTTCTGCTCAATCGATTCTCTTTTCTTCTCAAATTCAACAATAACCTTTGCTTCTACATCTTTCTCTACCCGTAAAATT
GAAGCATAGTAATCGGAATGAGCTTCCATACATTTCTGCAAAGCAGAAGTAACTTCGAAATACTTTTATAACCCAAGTTATATTCAAATCCCTCAATATT
TTTTAAAATCAAAACTTTCACAAAGAGTTAAGATGGTAATTTGGGAAGAAAGTATAAAGAAGAAGGAGAAAAAATAATTAAAAAATAATAATTGGTGAAA
AATACGTGTCAGGTGCGTGTGTTTCATCACAAGACTCGTGAATGATTATTGTGTTTTAAAGGGTTATTTATAACATTTTTAAATAGTTCAGAGGGGTGAT
AGGACACCCGTAAAGTTAGAATGTGTAATTGAGATTTCGCGTATAGATTGGGAAAGGAGGGGAGGGGTTAGCCCATTTTATCTAAAAAAAAAAAGAAGAA
GAATTAGGATTTGTAAGGACAATATCTGTAACATAGACATAAAATCTGAACTTGGGAAATAGCAGTCAAAGCTTGCAAGTTGCTATTTTTTGGTTACCAT
CTCCAAATATTTATCCAAGCAAAATTACTGGATGAGTCAAGAAAAGTAGTTAGCATATTTATCAGTGTATATTATTGGATGAGTCAAGAAAAGTAGTTAG
CAATAACAAAGAAATAAATAATTTTTGCAAGGCCAGAGACAGAGCTGGAGTAGCTCAGTTGGTTGGAGCGTGTGGCTGTTAACCACAAGGTCGAAGGTTC
AACCCTTCCTTTTAAATATTCCTTTGGTAGTTATATTCAACCAATCATAACTATCTGTGCCAAAACCATCCTACAACATCGATAAAAATTAACTATTGCC
CCCAAAAAGTAATTATCCACATCTTTTGTACAGAATCGGAAAGTCCTCTACTTTTCACAGATGAACAAGGAAAATGTGGCCTCATTTTATACAATAACAT
GTGAATGCTAATAGAGTTAACAGTTGACACTTGACAGTGTGTGGTTGGCATCAACAAGTCAAATACAAGTGAAAAAACGAAAAAAAAAAATTGCTCCAAC
TGTAATGCTTGAGTTGATGCATTACGCAATAGGATTGCCGAGATACAACTAGTGAAGCAAAACAGAACTAGATTTTCACATTTTATTGAAAGATGGCGTT
GGAGAGCTTGGAGGCTTGAAGTCCTCATACCTGTTCAATGCAACGAAAGACAGGAAGTTCAGTTTTATAGCACAACTTAAAGAAGTGACAAAACATCACA
TGGATTATGTCATTCCATTCCTTTATTCCTCAGCAGGACCTAAGATATCTAAAACACAAAACCTTATCAACTACACCCTCTGTTCCTATTTATATGTCAT
TGTTTTAGATTCAAACTCCCTTAAGAAAATAGGTAAGTTTACCATTGTACCCTTATTTAGTATTTTCTAGAAGTCAAGTTTTTAATAAATGAACATGAAT
TAATTTATTTTGAATAATTGAATTGACCAATTAACATGAATATTTTGTATTTCCTATGCTGGTCAAATTCATACTTTCAAAGTCTAATAACTCTTAAGGG
TAAAATAGTGTTATATGCATTGACTTAGTAAATTGACAAATATTAAGGACAACCTACTTTTAGTAAGGTCGATATATAAATAGGAACGGAGGGAGTACTA
CATTGGCTACTATCACTAAAGGCTACTATCTGCAATTGCTGGACTCTTCAAAATTGTCAGGGTGCGTGTCGGATTCTCCAAAAGTAGTGTATTTTTTGGA
GAATCAGACACGGGTGCGGCATTGAAACTGAAGAATCCGCAACTTAGAATTTTCTGGTGATTCTAGTCAGGGTTGCTGCATTTGATGATGGTGATATGGG
AGGGGGTTGAGGTTGACATATCTGATTATGGTGTAACCTTTGAGATAAGTCAAAACTTGGTCAAACCACATAGTAACATCAAGACAAGAAATGAGATAGG
TGCTGTTATGACTCAACTTCGAGAATTTTACTTTACTCATTTTTATCTTGTTTTTTATTCTTTCCAGGACAAAGATCTTGTCAAGAAACTGGACCCAAAG
TCTGAAGATGTGGTAAAGTTATTGAAAAGATACTTCCACTTATTCTCAAATTGGAAAAAAAGGAGGAGATATAGCTGATATCCAGTTCCTATCAAAATTG
ATGCAGTGCAATCTGCCAAGTAAAAAGCTAACTCTACTTACGCAGGGTAAGGAGAATGACAGAAAGCTGAACTTTTTGATGAATCCTCCTTGGAGAAATT
GTTAGCACTATCGATTGCCACATCGTTGCCTCCAGTAACTGCTGATGTTACTTCCGCAGTTGCTGAGGATTTCAAACCACTCGGTCTTGGACTTGGAGAT
CTAGGTGGCTTTAAATCTTCATAACTGCAAAGATTAATCAGTCAGCAAATAAGATACAGTATACTTGCATGTAAGTAGTTGGACTAACTCAGGAATGACT
TAACGCAGTGTATGGAGACAAAGGCCTTGTAGTCACCAACTCTGCTTTGTCAAAAGTAAATAAATAAACAGAAGAGGCTTCCTTAGTGGGTTTGGTATTC
TCTGCTCCACTTGCACCTTCTTGACGACCTCCAGGAGGATTTGTACTAGGGGATGTAGGTGGTTTTAGATCTTCATAACTGCCAAGATTGAATCAGTCAG
CAAATAAGATACACTATGCTTGCGTGTAAGTAGTTGGACTAACTCAGGAATGACATAACGCTATGGAGACAAATACCTTGTAGTCAGCAATTCTGCTTTG
TCAAAAGTAGAATCAACAACAGAAGAGGCTGCCTTAGTGTGTTCGCTATCCTCTGCTCCAGTTGCACCTTCTTGACGACCACCGGGAGGAATTGGACTAG
GAGATGTAGGTGGCTTTAAATCTTCATAACTGCCAAGATTAAATCAGTCAGCAAATAAGATACACTATGCTTGCGTGTAAGTAGTTGAACTAACTCAGGA
ATGACTTAACGCAGTGTATGGAGACAAAGGCCTTGTAGTCAGCAATTCTACTTTGTCAAAAGTAGAATCAACAACAGAAGAAACTGCTTTAGTAGGTTCA
CCATCTTCTGCTCCACTTGAACCTTCTTGACGACCTCCGGGAGGATTTGGACTAGGAGATGTAGGTGGCTTTAAATCTTCATAACTGCCAACATTGAATC
AGTCAGCAAATAAAATACACTATACTTGCGTGTAAGTAGTTGGACTAACTCAGGAATGACTTAACGCAGCATATGGAGACGAAGGTCTTGTAGTCAGCAA
TTCTGCTTTGTCAAAAGCATAATCAACAACAGAAGAGGCTTTTTTAGTGGGTTTGCTATCTTCTGCTCCACTTGCACCTGCTTGATGACCACCAGGAGGA
ATCGGACTAGGAGATGTAGGCGGTTTAAGCTCTGCATAACTGTGGTAATAACAGTAATTATATGCAATATTCCAGTGAAGTCTGTATGTAAAGTTTCAAA
TATGATACTTTGAATGAAAAACAAGAGTTCGTATTTCTCTTATTTTGCTTAGATTATTCCCTAATAAACATCATTAGATCAGGTTCCATGAGACAAGCAC
ACACTGAAAATATATTCTTTGCATTAACAAAGATTAAAATTTTTTATATACACTTGATGTGTTTACTGAGTGCATATCAGATTCTGTCACTGTGGATTGG
AAATTCTAGAATATTGTGGACCATGATGATTCTACTTGAAATATTCTGGGATGTCTAATCTTCACACTTTGTATACAGTCAACAACAGTGAAAATTAAAG
TGGAGAGGACGCAGATGAGGTTACAAAGGATAAGGTGAGGAAGGAGTTTTTTATTTTTGTCTGTCTGTTGAGTATTTCTATCAGTTTCAGGGATTGAGTT
TTCTGAAGAACTAATTTCGGAAGAAGGTGTGGAGTGCCTGCTTTGCCTTCTTTGGTTGAACTTGTGCCTATGCTAGGGGTTGGAGTAGGAGATATTGGTG
GCTTTAGTTCTTCATACATTCCGGAAAAAGTAAAAAAGAAAAGAAGCATAAGTTCATTTGAAGAAGAAACATGCACCTATCAGAAAATAAATAATCAAGC
TTACGCAGTATATGGAGAGAGAGGTGCTGCTGCTTTCAACTTTGTTTCAGAAGGTTTTTTCTCGAGCAAGGCATCAGGGATCTCAGACGTAATACTGGTT
GGAGTTGCAGATTTCTGTAAATCACCAGTTTCCTAGAAACAACTGGGTTAATAAGACTTAAAATGAAGTGATTCTAAGGTCCTCTGCATGAATTTATTAG
GAGTATCAGAGTAGACAAGTCCCTTATAAAGACAGGATTGGAAGGTTCTCTGTTTTAAAGACAGTTGCATGAATGCCTCATTTATCCTAATTCTGTATAA
AAGCCATTTTGGGCAAAGTAATCTCTGTTTTCCATGAAGTAAATGAAATTACCTTGGGTGGGGAAACCTCAACACGTTGGGGGGGAATTTTTGCAAGAAG
GTCCTCCATGGGGGTCAACGGTGCTGTTGTTTCTGCAACAACTTCAACCACTTTACAGTATGAAAGGCTCCGGTTTTTGGCCATAACCGCCATTAGTTCT
GCCACCTGATCAATCAGAGTTGTCTTAGCTGCTGACTGTAAATTGCTACTCTTGATATAAACAAAATTTATGAGACTTAGCAAATACTTCAACCATTTTT
CTTTATGCCAATAGGTCTCACGTGACTTTGTAAAATGTCCAAGAAGAGTAACCCCTGACAGCCCAGATAAAATGCTATCGGTTGACATCAGATATAACAA
TATGCATGAATTGCAACTCATGATTGTTCATCGCCCATTTAGAGATTTTGAGTCCTGTATGTAACAAGTATTTCTGTGCACCAGTGGGAGTATTCATTAT
GTGAGGTCGGACTATTGCTCTCATGAAATTTAAGCCACAAATAACCTTTTAACTTTAAGAAATCAATGCAAACTTTTAGTTGAGACAGAGAACTAGAAAA
ATAAAAAAGAACCTTCCACTTTGATTTTCAGAATGAAAACTACTCAAGGAAAGTATTATTTATCTCTGAACAGTTATCCACATCACAAGCCCATTGAGTT
ACATGCTGGAATGTATTTTCATATCATGTTAAAAAAAAATTATTAGTGTAGATAATGTATCATTACCCTAAAGAGGTCAAGAAATTTTAATTGCAAATGG
AACTTTGTTAGGAACCTGAAGGTTTGACACGAGACCACCAAATAAAGTATCTTCCTCCGAAAGAGTAATATTGTGAGTTTCTTTAAAAGAATCAGTGGGA
CGTTCCATTCCTCCAGGTCTCACAATCTGAAATAGCAGAGTGAAATATGAGCACCATATTGCAGTTAAGACACATATCACCTCACTTTTGTATTTCCAAC
GCATAATACAGAGAAGAACTCACAGTATAAGGAAGCCCACTGGCAAGCAGTGCCTCTTCTGCTTTCCTTTTCCAAAGGAGGACTCCCCAAAACAAACTTA
CAGACCATAACAAAATGGAAAGTCAATGAACTAAAGAAAATGTTTTCATGTTTAAAGCCAAATATATCTTCCAAGGACTCTAATGTGAATCAGAATACTC
CTAGACTTACTTGAGAATTGCTGCAGGAAAACCGACCTTGTTTGTTCCCAAAGATGTGAGCAAGATAAAGTGGTCAACTTTTGCGACGGTTGCTGCGCAG
AGGAAACAATCAACTTTCTATCACTCATTTTATGTGAGTGTGAGTATTTTAATGGCACTGCATCTGATTTTAATCAATACCAATTGCTTCTGAAGGAACG
AATTGTAGAGGACAATATGACGAAAAAAGATTTGAGTAACATCTACAATTTAAATCAGAATTCCTTTTACCTGCATCAATAAGGTTCTTAGTAGCCAGGT
AATCAATTCGATATGGTCCAGTAACATCAAAGATCTCCTTTTCACTGGCACCAATGCAACATATAACAATTGATGCATCGCCCAGTGCAGGCCTAATCTG
ATAACTTTTCTCCAAATCGCATTCCACAATTTCAAGCTTCTCTATAGCTGGGCTAAAGACCAAATGTAACATGTGATGTTCCAAAGAAGCACATTTACTC
TAAACTGCTAATACCATAATCATATATGAGAAGTCCTTTCTGCATCAATCTTACCTTTTGCTCCTCCATCCGTAGCATTCTCAAGTTTTATCTGCTCAAC
ACTCTGTAACAAGGAACAATTTATGAGTCATAAAGAATCTAGATGCACGTTATCCAGTAAAATCACATGTTTCCACTAGTCAGAATTTTTACTTTGACAA
GAGGTTGAGCTCTTTGAGCACTTCGAACTCCAGCTCGAACTTTAAAGCCTAATTTCAGAAGCTCCCTGAAAACATTCTGGTCTTTCAGCAATATATACTT
AGTAGCAGGTTTAATGGATTTATATAGTTAAGTCTAAAGTCAAGGTCGAAAACAAAATACAACCTTACAGTCCGAGAACCAACCCTACCGGTTGCACCAG
CAACAAAAACAAGATTTGCATCTTTTGATTTGACATCTTTTGCAGTTCCTTGAGGTTCCAATGAGCTAATTTTTGCTGCACATTCATATATGATATATCC
ATATAATTATAACACTTCTTAGAAGATTGCTTATTTATCAAGCACCTTTAGACCACAAGAAAGAAATTAAAATTTGTTTCCTTGTAGAGATGGTTCCACA
GGCCCAGTCATAGAAGATCATCCTACAAATGCTCTCCAAATAATGCTTGTAAAAGCTAATAGAAGCAACAACAACATATAGTTCCACAAAGTGTGTCGGA
GGGTAGAGTATGCACAGACCTTGCTAGTGCTACCTCAGAGGTAAAGTGACTGTTTTGATAAACCCTTGGCTCAAGGAAAAACAGTCCAGAAAAAATGTAA
CAGAAGTAAAAAAAACAAAAGATAGTAACAGAACAGTACTACAACAAACAGTGACAAAAATTGAAGGAGAAAACATTAGTAGAAAAACTACAACAATTAA
TATGGATGTACAACATGTTAGGATCGAATTCACATACACACTTGATAAATTAAGAACACAAGAACTTTCAAGAGAAAGAGATGAGAGATCTAGTGAGAGA
AAGAGAGAAATCAATATTTCATGGTAACACCCCATGAGTAAACTTCCACGGCGGTGGGATATATATATTAATAAATCAAAGTATTTTTGGTTACAGAGAA
TAAATCAGACTCCACAACTTGACAAAACAAAATGCATAAAAGCTAATAGAAGATGATCCAAAAAGGCATAATAATACATCTGAATAATTCATCAATATGA
AGGTTTTACATTGAAGGACTCTTCTTCATAACCATGAGAGACCAACAACGACAACAAAAACATACCCAGTGAAATCCCACAAGTGGGCCAGTGAAATCCC
ACAAGTGGACTCTAGGGCGGGTAGAATGTATGCAGACGTTACCATTACTCTGTTGAGGCAGAGACTGATAGACCCTCGGTCCATGATAGGCAAACAGAGA
GTTATAATACAGCAAACTATATATGATCCTCCAGTCACTCTTCAAAATGGAACATGTAAAGAATGAAAAAGAATAAACTCCAAATGTTTTTATGCATTCA
ACTAGTACTTCACTAGAGAACATGTGATAAACCTTGTACAAACCCCATCCCTCAAAACTGGAAAAAAAAATAACTTCACTTTACAAAAAAAAAACCCCTT
TTTTTTCTTCTTTTATGATAAGCAAGGTTCAAAGTCACTGAAAACCTCCAAAAAATAATTTCAATATTAAACCTGATAGTGGGTTCGTCCCCGTACCCTT
CTCCACTTAAATAACAGGTATAAACCCATTAATCCTTCTTTATCATTTTCATTTCTTTCTTTAAAATGTGAAAAGGACTCCAAAAGGGTGTGACCAATTT
CAGAGTATGAACCCATGAATGAAAATTGCATTTACCTGAAATTTGAGTTCTGAAACGAAGGGTCTTAAGGTTTTTGGAATTTGGGCCCCTTTTAGTGCTA
GTTTGAATCAATGTAATTGGGTGTCCACACAAAAATGGCTTCTCTGCTAAAGCAGTTGCAGGGATATTGAGTGTCTGCAAGCAACGCAGCTCCATTATTG
ATTTCGTTGGAACTCTGTTGGAGGTGTGCGTTTAAGGAGTTGCCCCTGTAATCCATGTGGATGTTGTTAAGCTCTCTCAGTCACCACATTCTGACCACAT
AGTCTAGATCATATATACCAACTTTTTCAAAACAAAATTTTAACTATTATCTATAGAAAAATAAATAAAATATTATTGACTTCTAGATTCAATATTAAAT
TTTTTTTAAAAAAATATATATATATATATATATATTGACTTCTAGATTCAGCATTGCACTGACTACGTTATTTGTTTACGAATCTGCTACTAATTATCAA
AGTAAGGAATAACAAATCTCGCTACTAATTATTATTTGCACTGACTAGAATTATTATTTCATTAAAGTAAGGGATAACAAATCTCGCTACTAATTATCAA
CCTTGAGAGACATTTATTGTAAATTTTTGTAATCATATAAGAAATTACAAAAAACAAAAATTTATCTCAAAATTATATTCATTTATCTATCATACCAAAT
GTCATTTCGTATCCAGTATATAAGGTTTGGTATGTTGGTAAAATATTACTAAATCATATCTTACATAACTTTTCTGTTACTTCCTTCTTTCACCTTTTTC
TCCCTTTGACTAATTGCATCACATTCTAACAATTGTCTTGAAAAAAGAAATTAGGAAATTAGATTTTTTATTGGACTTATTATTAAGAGTATTGTAAATT
ATAATGATTAGTAACTTAAAAGTATTTAAAAGATTTAAAAAGTTGATACATTTTCGAAATTAGATCCCAAATGTAGATCATAGTAACAAACATTTTAAAA
ATTTAAAAGACACAAGTTTTTTAAATGATTCTCGAATTTTTATAGGGGCAACATACATTTGAATAAGGGAGTAACATACATTATTTTAAAATTATGTAAA
AGGTATCAAAAAAATTAATAATTTAAAATATTTAAAAATTATGATTGTGTTATAAAATCAAGCTCATGGCAATATAAATATAAAGAGATAAAGACAAGAG
GAGTAAGATGGAAGATAAGACTTTCTTCTTATTCAAGTGTATGCAAATCTCATATGTATCTGTTACAATAGTGAATGAACAACCCTATTTATAGAGTGAG
AAATCACTCCAAAGGTCACCATATTAAGTATCATAATAAATAGATACATTCTTATCCAAAAAGGTTCATGTAACCTAGTGAATATGAATGGTTGTTCATG
TACCAACCTTATGGACTATCCACTCATTCAATGAATTTATAACACTCTCCCTTGGATGTCCATAGATAATGTGCCTCGTTAAAAACCTTACTAGGAAAAA
CCCTGTGGGAAAAAATTCTAGTGAAGGAAAAAGAGTACACATATCTTTTGATACGCACCATTTGTTGCCTCATTAAAAACCTTGTCAGGAAAATCCAGTG
GGAAAAAACCTCGATCAAGGGAAAAAGAGTGCAACGCGTATTGTACTCCCCCTGATTTAAACATCACTTAATTTCTTGTGATGATGTCTCCAATCTTCGT
ACATTGTGGTTGGTATATTCTTTTTATAGAGTGAGAAATCACTCCAAAGGTCACCATATTAAGTATCATAATAAATAGATACATTCTTATCCAAAAAGGT
TCATGTAACCTAGTGAATATGAATGGTTGTTCATGTACCAACCTTATGGACTATCCACTCATTCAATGAATTTATAACACTCTCCCTTGGATGTCCATAG
ATAATGTGCCTCGTTAAAAACCTTACTAGGAAAAACCCTGTGGGAAAAAATTCTAGTGAAGGAAAAAGAGTACACATATCTTTTGATACGCACCATTTGT
TGCCTCATTAAAAACCTTGTCAGGAAAATCCAGTGGGAAAAAACCTCGATCAAGGGAAAAAGAGTGCAACGCGTATTGTACTCCCCCTGATTTAAACATC
ACTTAATTTCTTGTGATGATGTCTCCAATCTTCGTACATTGTGGTTGGTATATTCTTTTTTAAAGAAAAACCACACATTTCTTGAATATGGTGCGTCATT
TATCTCAACCAAACACACTTTCAACTTGCTTCATGGAGGACTTTCATTTCTGCATAGCAACATTTGTTTGCTTCATTGATCACCGGGATATTATTGTGCC
TCCACATGAATACACATAGCGTGGTTGAGATAGAGCTTTATGCGGATCAGATAAATATTCTGCATCTGCGTAACCAATCAATTTTGTTTTGGATTCCTCG
GAATAGAATAAGCCCATAACTATGGTCCTTTGAGAATATTCAATCATGTGTTCAACACCATTTCAATGTCCTTTATCGGGGAGAAACTGAATCTTGCCAG
TAAATTTACTGCAAAACAAACATCTAGTCAAATATTGTTAGTAAGATGCACTAGTGCCCTGATTGCACCAAGATAAAGTTTCATCACCAAGAAACTCTTC
ATCCTTCTTTAGAGATCAAACTGAATCATCATTTTTTTTCAAGTGATCTCATAATCATTGGGGTACTCAATGAATGCGATTTATCCATATAAATTTGCAT
CGAAACTTTTCAGTGTATGTGCACTGTTAGACAAATATTTCATTTGTCAAATTATCAATCTGTAGGTCAAGACAAAATTTTGTCTTACCAAGACCTTTTC
ATAAAAATACAAGGACAATTAGGGTCATTCTTTTGTACCTTTTTTCTTCCTTGACTATTTCAATCCATATAAGGATTCTTGAAGCTTTATTGGAAAAGTT
TCTTTCAAACTCTTATATGCTTCAGACACCTCGATTGTTTCAAGGATTTTCATATAACCTTCATTGTCTAGCTAGACATTAAAATTATTCATTTACATGC
ATTCAAGTTTTCATATGTTGCCAGATCAAAACAAACCTCATTTCATCCACCAAAGGAGAAAACATCTCCACTAATGTCAGGATTTTTGCGATAAACCTTT
ATGCCCCAAGGCACAAATCGTATTTAATATCTTACAGTTATACTATCGTATAATAATTTATTTGTACCCCACTGACATTATACCTTGATTTATGGACTAC
CAGTCCAAAATGTCACTTTTCTAAGTGAAACAAAATATACTTGAATTGTGCATTTTACTTGGCCAACCATTTATCTGTTCACACTATATGACAGATTTGA
ATTCAAGATCCTCATCACAATTTATATCATTGAGCGTTACCTCATATCAAAGATAATTGCATTATAAGCACATTGTCATGGCTTTAAAATTCATCATATT
TCCATGACACACCTCAACATCACTTTGAAAGATCAAGTGTACCATCACTTTATCTTCTTGTCTTTTGATGGAGGATTTATAAATTATTGGGTCGATAACA
TTCACAAGTCCAATGTCCTTTCATACCATTTTGATAATGAAAACTGCCTTCACATTTTGAAGGACTATTTGGAGAACCCATAGTGTTCTTCCTTTTATCA
TTACCACAATGATAACTATTATAATTATGTCCCTCCACGCCCTTATTCATATCATTAATCATTTGTCATCTTTCAGACTAACATTCACTGCTACCACATT
CGTATGATTGAATGGAGCAAGTTAACAGGCGGATTTCAGAGTTATTACATGTTGCTACCACATTCTTTTCAAGGAATGAAGCAAATTCAATAGAACGAAT
TTCAAGACTTTTCATCAAAGCCTAGTCATCATTATATCATCATTATGGTGCATTGACTCAAACTCAATGTCTTATCCATATAAGGCGTTTTACGCCATAA
TTCTATGGGACTTGAACCCAATCACGGTGCATCAAATCTCAAATTGATGTCTTACCCTTTTGGTGCGATAGAACTTGAATCTATCGTCTTATCCTCAAAT
ATTTTTATTATGATGCATCCGGACTTTTACCTGATGTCTTACCCTTAACCAACGGTATAATAAATCGAAGTACAACATGACTCATCCTTTGAGTCTTTCA
AAACAATCAAAATAACATTCAAATTCATGCTATTAAAATTTTATACCTTCTTCTATTTAAGAAATTGTGTATAGCATGTCATATTCAACCAATAGTAGTA
TATGTCTTCGGTTCCTGATAATTGTTAGTGACTGAATACTATTTTATTCTAAATCATAAAAATATTCTAGAAAATACATACCTGATTTTATGCATATAAT
ACTTTGATCTTCATAACGAGATCAACCAAAACATGAGTTAAAGTAAAACTAAAACTCAATCTCAATTGGCTAGAGACTCGTGCTGATAACGTGTTATAAA
ATCAAGCTCATGGCAATATAAATATAAAGAGATGAAGACAAGAGGAGTAAGATGGAAGATAAGACTTTCTTCTTATTCAAGTGTATGCAAATCTCATATG
TATCTGTTACAATAGTGAATGAACAACCCTATTTATAGAGTGAGAAATCACTCCAAAGGTCACCATATTAAGTATCATAATAAATAGATACATTCTTATC
CAAAAAGGTTCATGTAACCTAGTGAATATGAATGGTTGTTCATGTACCAACCTTATGGACTATCCACTCATTCAATGAATTTATAACAGATTGTCTTTTA
AAATTTTATTATTGCTACATAAATTAAGATAATATATATTATTTGAAAATGACATTAAATATATTATAAATGATAGTAATTACAACTTAAAATTTTTAAA
GACATAAAAACTAAGTTGACTCTTGAATTCTATCAGTGCCAGATAGAAAAAGAAAATTATTAATTTACGTAAAGTATCATAAACCATAATAATTAATAAC
TTAAAATATTTGAAAATCATATTAGAATTTTGATTATCTCTTCAAATTTTAATGTTACATCAATTATTACAAAAATAATACTTAAATCCGTGCTATTTAG
TAACTAATCAGAAGCCGCTGCCTTTTCCTTTGGTTGGAGGTTCCTAAAAATGATAAAAAAAATAAATTAAATTATTATTATGTTTTCATGATTATCAAGA
TAATATTCTCTTGTTCTTAACTATTTGTCCACTTTTAAAATAATATATTTATTAAGAAAATAATTATTGACATATTGAGTTTATAATTTGATCTTTAATC
TTTATTAATTATCAAATTTGATAATTTAAAACCTTTAAGATTTTCAAAAAAAATTACCTTTCTCAAAGCAATTAATTGAGAATATAATAGATAAAATAAA
ATATCCTTTCATGATTTACCAAAAAAATTAATTAAAAAAGCTTTTTTAAAAAAAAAAATGAACGAGCAATCAAAAATATAAAAATGTGAAAGTGAGTAAT
GAAACCTATAGCGAAGCCAACGGGAAATTTGGTAGAGTTGTACAGATTCATTAGCAGCATGGCAAGCTAGCAGCATATAATTTCGAGGCCTCACCATCCA
TGCAAATCTCATACACAACATCGAATATATACACAACACTGCAACCAAACACACAATAATATTTATTTATATACGGCGTAATCCATTGATAAAATTGACA
TCAATTTTTACTTACACTTTTCAAGTAGACTTTGTTCATTTTAAATACCTCAAGTAAGATTTTACTGTGTCATTTTAATATTTTTTTCGTTAATCAGCTG
AAATTACAAAGTGTATAGTACACTTGCAGATGAAATGCCATAATGACTAATTGAAAAAAAAAGTTAATGTATGACATTTGAATGTAAAAATAATAATTTT
AAAATAAAATATTAAAAAATAATTAATATTTCAATAAAAATAAATAAATAAAATTACCTATTTTCTACCGTCCCATCCCATCCCACCCCGACCGATCCAC
CTTACTTCTGTCCCTTATACCTCCCCAACCTCCCGCCTAATTTTGGTTCTTCATCCATTTTTTCTTTAAAAAAATTCATTAGATTTTTTCGTTTTTTTTC
TTCTTTTTTTTTTGTTGTGAATTTGATTTTGAGAACCATATACCACATTTCTTCTTCTATTTATTTTTTTGGAAAAAATGTGTGTTTTGTTCTAATTTTT
TTTAAAGAAAAGTTAGTCTGATGATTTTTGATAATTTTGTTCTTATAATTGTTTTTGAAATTAGTGCGATAGTTTTTTATTTTACTTTTTCATATTTTAT
AAGGTTTTTATCATGATTTTGCATGGTGAAAAGGTAAAATAAGTGGTAGGAATAAAGAGTGAAGAAGAAGAAGGAAAATAAAAAAATTCTCATGCGCTCA
AGATGCGTGCAACACACACAACATATCAAGTCAGCAAAAAGTATCAAATCAACACAATAAAATATAATATGAAATATTTAGAATAAACAAAATCTAATTA
AAATGTCTAAATAAAAATTTATGTCAACTTTAAATGGCTATCAATGAATTAGCCCTTTATATATATATATATCAACAATATTCTATAGATATTTTAATAC
TGTATATCCGTTTCATTCACACTTACATGTGACATGTCACAATTGAATTTACAATAGTTAAAAACATAGGCCTAAAGTTTGAATTCTGACATTTTCTATT
TAGGGGTGAAACCTGAATTTGCCATAAATAAGTAAATATATAAAGAAGAAACATATTTTTATTTATATGTAAATAAGAGTATAATTTTCTATCGAAGAAA
TTTACCTAATTTCTTCGGCCCTACCTAGCTTTAACGTGATCAATGTAATTTTGCATTGTGTGATCCTTCGTCTCATAAATTACAAGATATCCTTTATTTT
AAAAAAAAATTATTCCAAAAAGAATGTCATTTTATTTATGATAAGAAATATTTTAATTCTAAAATTTCTTCTTTTTCTTAATAAAATGATACAATTATTG
TTTTAATTCATAAATTTCAAAAATCTTATCTTAACTATTATATCAAGTTAAATAAAATCATATAAAATAAAATGGAGAGAGTATATGTTATAGCTAACTC
ACCTGCAGTCATGTTGCCAGATATTGCGTCTGGGGTCTTTTTTGTATCCATCATTCCCTAACACAATCATTTGTCAAAATTAATTTCAGGAATTTTTGTC
CAACTTTTATAGTAAGATCGATGATCATCGATAGATATATATGATATAAAATGATGATATATATATATATATATATATATATAGGAAAGGGTACATACAG
AGATTACAAATCCCCAATTGGCCATAGGACCCCAAAAGTGAGTTGTTTTAGGACCCATTGGACTATTCAAGTACGCTCGGACGGATTTCATCATCTGCAT
ATACATAAATTATTCACAAAAACACATATACCGCACGTCGTTGTGAGTGTCCAAAATTCAATAAGAGATCCAAAATTATAGGGTTTTTTTCTTTAATCTG
TCTAAACTTTGGTAGAATTTAATATCCGTGGTGATAGCAAATATCATATACCTGGTGAATTAATCGAGATGCACCAAATCTAATAGTTGTTCGTTCCTCG
ATATAAAGAAAACTAAATTCACTAGAAAATCTTGCAAGGAATGGTAGGAAGAAATTACTAATTAAGAAAATTGAATTGCCTCAAGTACTAATATATCTTT
TTTTTTTTTTTTTTTTTTTTTTTAAAAGACATGTTCTACTTTGTTGAAACTTGATTTGATAAAACCAAAATCATATGAAAGGGCTTACCAAATTGTGTCA
ATTTTTGCATGAGAGACGTACAAGGAAGAGCACTTGAAACGATGGTTGATTAATTAGTATTAGTGAATATATATAGTAGGAGATGGAGAAGCATGAGGCT
ATTAATTTATATATGTTTGAGATTTGAGAAGGTAGGCTGTAAGAATTATTTAATCCTATATTCCACATTAACTGAATTTTGGAGGTTTTAAATTGGTCAT
AATAATTGAATTGTTCAATGTATGTTTAAATTTTTTTTCATTTATTTAATGTTTCATATTTCTAAGAGAAAAATTACCTACTTACAAAGTTATATTTATG
ATTTCATAAAAGATAATAGTGAAAAATATGATTTTAATTATTTTCTTGAATATTTTTCTTAATATGTGTATTACCTTACAAATTCAATTGATATGGAGTC
GAGGAGTATTAATTAGCAGATTCTGAATTTAAACATTTTGAGTTCTAAATTAAACGTAATTTTTGTAAAAAAAAACATTTATAAATATATACTCATATGA
TTTTACTTTTTACGTAATTTCTTATTTGATATTGTACATAAATACGTCTTTCAACTTGGCTTCAACCGACATCTATGACCTCCAAATGACCTCCAATTCT
GGATGTGCTCAAGTAGACACTTAGACTTGTATATAATTGAACAAAATATACTTATTATGCGTCTTACATGACATGACACAAATTTTCATATAGAACGTTC
TATTTATTCAATTTTACACAAATACAAATACTTGTATACATTTAAAATTTACAAACATAAATATTAACTGAGACTAAGTTAAAATAAACGTTTATATATT
ATGCTTTTAATTGGAAAGAGTAAAGTTAGATTTGCTACCCATGCTATATTCTATAGTAGAGGAAGAGGCATGAATGAATCATTCATTACGTTACGGCTGC
CTTGGCCTAAAAAGTCATCCTCATGACTCCGACGTTTTATGTTGTTTTGTAATTGGAAATATCTTTGGTCGTCTTTCAAGTTATTTATAACCATATATAT
ATACATACACACACACAAGGAATTAATTTTTATTGTTTCTCTGGTAAGCTGGGACGCCAATTTCTAGCCTAACCCTTATTTCATGTTTTTCCAAATATAT
TACATTGCCAAACTTTTGGCCAAATCTCAACACCTTTTTTGTTTAACTGACAAATTATTACCCAATTTTCGATAAGTGGATTTTCAAAATATAAAAAATA
ATCAACACACGAATAAATTAAAAAATTTAACATATACTATACGCAACACATATAAGATAATTTAACCTTTTTATGATGTAATTTTTGTCAATTATTTTCA
CAACAACACAAAAAAAATTTAGCTAAGACTCGAATCCTTCTTCATTGTGAAAGAAATTTTGTCGAGTGATTTTAAATTTTCTTAGGTGTTAAGGTCACTA
TATGTAATACCTCTAGTTCCAAAAAAAAATTAAAGAGAAAATCATTCAAGTCACCCATCATTTTCTTAAGTTTTGGTCAACTTCAAACGATCATATCTTT
TAGCACATAAAGAGTTAGGTAGCCCATGATCTATCAAATTAAAGGTATTTGAGTCCTCTATTCAAAGCCACCAGTTTTGCTAAAACTCAAGCTCTGAGTA
AAACGTTATGATAACAACGCTCATACCTGGCAGCAGCTTTGGGATGACTCCACGTTACGGAGCCAATACGAATCTCACTACCTGCTGGAAAATTATTCCG
ACTCATAGCTCGTTTTATTTATTTCTTCAAGGGTGTTTTAGTCCTAAAAAACCCTTAGGAGGTCATCTAAATTATCCTAAACGTGTAGAAAACCCAATTT
TATAAATCAAACCCTCTCATTCACTCATAAAATTCTACGCTCAAGAAATTCAAGAAACGTTAAGGTTAGGGTTCATCTTTCAAGATTTTGTTTCAAATTT
CTTCAAGAAGGTTGTCTTCCATGTATGTAAGACTATCATACTGTTGGACTTGTTCATCCTCACGCCCTACATCTATTTTCAAATCAACAAAAGAGAAATC
TAGGATTCCACCCCTAGATTTGAGTATTCTTGAGATGAGTTGATTTTGAGTTCTCGAGTTTCTGTTCCTTTTTGATATTCTATTCCGAATTATTGAATTG
TTATATGTTATGCATTAAGATTCTTGAGTTGATTCTTTCACATCTATATTTCATCATGAACCCTATGTTTGAGTATTTTTTAAATGAGTAGTATCATTGA
ATTCTGAGTACTGAGTTTCCATATTGCTATTAAGATCCTGATTTGAGTCATTCATGTTCATAATTACGCATGAACCCTATGAATTGAGTTATAAATCTTA
TGAAGCTTTATAAAGCCAACACTTCAGTTTTAAACTGAGTTTTTTTGAGTTAGTAAAGATGAGTTTTGAGAAAGAGTTTCTAATAGTTTTGTGTCCCACA
TGTGTTAGTTTTTATGACTCACATTAATATTATTTTGGTTTAATATTTAATAAATAACTAAATTCTAATTGAATAAATATGAAAAGTTTATTACGGTTAT
AACTCCCCACTATCTTCTTTGATGGAAAGTGGTAACTAACCGCTTGGTCCTCTCTCTACCTATTAAAAGGGAATAACCTATCCCATATAAGAGAAAAGAA
AGCTAGTTCCTTGTCAAGACTCAAGAAAAAACTTCCGCTTAATTCATGTCAAGAATTATAATGATTGATTCGGGTATATATTCTTAATTGAATTATTATA
GTAATAGGTTTATGAAAATCATATAGTCCTGTGATCCTGAATAATTGATAGGATTTATGAATGTTTAAATTGTTTTATGTTATCACAATCCATTAAATCC
TTACATGTTGTATCAAAGTTTGGTTTAAGAACTAGTAATTTTTCATAGGATTAATGTTTTCTGTATTTGAAGCGGTAATGGGTAGTATTAAGTAAAATAA
TTATTCACTATTATGAAAAATTTTATTTTGAAATTATTTATATGGGATTAGTTAATCACCAAAGTGGTCTAATCTTTGAAGAATTAGTTCAAAATAATAG
TGATTAAAAGTATATTAAATTCTCCATTATTTTAATGCTTATAACCGATATAACACTTATGAATATATTAAAATTTTTGGTTATAAGATATTTATGAATC
ATCCAAAGGTTGATTATTTTATTTTTATAACCATTGATCATTGAGGAGATAATCATTGGTTTTATTTATTTATCCAAAGATAATAAATATCATCGATTGA
CACATTAAAAATTATTGAATTACATTAAATACACATGTATGTCTGAACTTTTATTTTGATGTTTCATCCCAAGGAGGATATCTATATATATTTAAGAATT
TATAAATCACTTCTGAATTTGATAGTATGTTTAAAATTTATCAAAGTATTAACAAATGAGCATATTATATTTGCAACATTTGCTCTTCATTCACACTCTA
TCTCTGTTACGACCTATAACGGTCTTAACTTCTTAGATTGGTGCGAATAAATCAAATTTCATCTCAGAATTTTAGATTATAATGTTGCACTTTACACTGA
GATGCCAACTGCTATTACTGAAACCAACACTATTGAAGAAGTGTCATATTATAAACACTAGGTCGATCTACCATATTAGGCATAATGTTTATGAGAATGA
ATATTGCAGGCAACATTAAGACTATTTTCCCAAAACTGAAAATGCAAAATATTTTCTGAAACTTGTGAAAGAATTCTCACAAACTGCTGATAAGTCTCTT
GTTGGGACACCAATGAGTACTTTGACCACCATAAAGTTTGATGGTTTCTGTACCATGCATGAGCATGTCAACGAAATGACAAACTTAGCAGCAAGACTTA
AGTTTTTGGAATGGAAGTGAAACAAAAATTCCTTGTACAATTCATTATCAACTCATTACCGTCTGAGTATGGCCCTTTTCAAATGAACTATAACACCATG
AAAGACAAATGGAGCGTGCATGAATTGCACGTAATATTGGTTCAGGAGGAAGTAAGGCTCAAGTATCAAGGAACCCATTCCATTAACTTTGCAAGTCATC
AAGGAGTTGGAAAGAAAGGAAAGAAACATGCTAAAGAAAAACAGAGGCACCATAATGTTAATGAGTCCTCCTCTCAAGTACATAAGAAGGAACACAAGAA
TGATAAGTATCGTTTCTGTGGAAAATTTGGACATTTTCAGAACGATTGCCTGAAATTTAATACATGGATCGAGAAGAAAGGTAAGCCTAGTGCTTTTACA
TGTCTCGAATCAAATTTAACTGAAATTCCTTATAATACTTGGTGGATTGACTCTGGTTGTACTGTTCATGTTTCTAATACGATGCAACAATTCTTTACAA
CACTAATCATAAATCAAAATGAAAGATATGTGTATATGGGAAATAGAATGAAGGCTCCCGTTAAAGCTATAAGGACTTACTGGTTGGTCCTTAATATTGG
ACATCACTTAGATTTACTTAAAACTTGTTATGTACCTTCTCTTTCGAGAAATTTAGTTTCTTTATCTAACTTAGATAAGACTGGATACTCTTTTAATTTC
AGTAATGGATGTTGTAGTTTGTTTAAACATAATTATCTCATTGGTAGTGGTACTCTTTGTGATAACTTATACAAACTGAATCTTGATAATCTATTTGTCG
AAACACTATTAACTCTGCATCATAATATTGGAATTAAATGAAATATGGTGAATGAACAATCTGCTTTTTTGTGGCACAAATGTTAAGGTCACATATCAAA
AGAAAGATTGAAAAGATTAATTAAGAATGAAATTCTTTCAAATTTGAATTCTACAGACCTTAGCATTTATGTCGATTGTATTAAAAGGAAAACAAACAAG
ACACACAAAGAAAGGAGCCACAAGAAGCACACAACTTCTTGAAATTATACACAGATATATATAGTCCTTTTGATATTGCATCTTTTAATAAAGAAAAATA
TTTATAATTTTTATTGACGATTTTTCACATTATGGGTATGCATATTTGTTGCATGAAAAATCTCAAGTGATAAATACCTTAGAGGTCTTTATTACAAAGG
TTGAAGGACAACTAGATAGAAAGGTGAAAATAATCAGGTCAAATAGAGGTGGTGAATATCATGGAAGATATGATGAAAATGAACAACACACAGGTGCATT
TGCTAAATTCCTCAAAAAACATGACATATGTTCTCAATACAAGTTAACATCCCTTAAAATACAAGTGAAGATCTACTTCATCCTAGTGCGTTTTTAGGGT
TTTTAAAGTCTCCCCTTCTTGGGAACATTCATCCAATGACACTTCACACTTAAAAGGATAACAACCAAAGCCACCAGCCCACATTCATGCATACACTATA
TAAATCATACACATAGTTAGTAGGAACATCACTCCACATAGAAGGCTCAAACAACTTCATACAATTCAAGCAAGTAGAGCTACATCCACCAACTCCTTAT
GCATCATTTTGTACCATTTCTCATGATGTTAGAGGAACTTCCTTCTCTAAGTTACATCATGCTCATTTAAGCATCACTTATAACATCATGCAATTTCTCA
TCAAAACACAATCATGCAATATTTTTAATAAGGCATATTTAAAACGATTCTACCCATAAAAGCTCAACATGCAACTTCTTAATAAAACATTAGGCATGCT
CAACAAGTCAACTCATGTAACATTTAGGCATGCTCACAATTTCCCCTGATGAAGCAAATAGACAATTTATTCTAAATGCACATGAACATGAAGGAATACA
AAACATGAAAACTCAATTTCTCATTTAACAAGAATTCAACCAAAATATGCATATAATAAGGAGAATATTTGCAAACTCATTTTTCACAAAAGACTCGAAC
ATGAACCAAGATACTAAGAACTCTTAGTTTTAGGCTTGAATATACACATAAGGAAAAGATAAGGATATCTCACTTATAGAAAAGATAAGGAAGAAAGTAT
TGCGATACTTGCAAGGAACTAAAGATCATATGCTCACTTATAGAAAATTTTATCATTTTGATGTGATTGGATATTTAGATTCAAATTATGCTGGTTGTGT
GGATAAAAGAAAATCCATATTTGGATATTTGTTCCTATTAGCTAAAGGAGCAACGTCATTGATAGATGAGTTTATGGCATCCTTTGAGGTCATAGTTCAG
ACTAAATGGCTGTGAAATTTTATTTCAGGACTTGGACTGGTCCGCAGTATTTCTAAGCAGCTGAAAATTTGTTGTGATAATATTGCAACAGTCTTCTTCT
CTAAAATTGATAAATATTCAAAGGGTTCCAAACATTTGGAATTGAAATACTTTTCAGTTAAACAAGAAGTCCAGAAATATAAAGTGACAAATGAACATAT
TAGCACAAAACTTATGATTGTTGATCCTTTAATGAAAGGATTACCATCCAAAACATTTGTTGAATATGTTGAAAGAATGGATCTTATTGATATCAATGAA
TGAATTTGTGTAAAGATTTTATTATATTATGCAATTGACACTTTGAGCTCAACTATATATGTTTCTTCTATTTCCTTTTTTTCTCTTGTATACGTTATGT
GGAAAATGACGATGACAAATTTTATTTTAGATAAAGATATTCTAAGAATTATTGTCATGCCCCGAGCTACCCCCGAGACGCGGACATGGAACATAGGACC
ACAAGTGATCCCAAACTAACCCTGCTGGCATGATTATGAACATACTAAAGATAATAAACTAAATGCGGAAGCTAAGTCATAGTTTAAACTGAAAAGATGG
GGAATACCCATATTTTATAACTAATATAAAGAAGTTATTAACTCAATGCTAAGCTTCTATGTCTTAAATAAGCCTATAACTGACTAGAAATACTAGGACA
AGCCCCAGCTAAATCTAACAAAAACTGAAACTAAATGACTGAAAGACTGAAAAGAAACTCATGACTATTGTCCTCGGAGAATGAGGACTCACTACTGGAT
CTGCTGAATAGGAGATCAGAAATCGATCTAAGCGGGGTCTGGATACTGAGAACCTGAACCTACATCACGATAAGATGTAGCGCAGTATGCGTCAATACTT
GAGGGTACTGAGCATGTAGGATAGAGTAAAGCTGAAATAATACATAACTGAACAAGCACAAAATCAAGTATATAATCTGAACATGATATAGATTTTGAAT
GCTGAGATAACTAAATGCAATGACCAATTTATAACATGCTAAAACTGAATACTGGATATACTGATAAATGGTCAATGCAGTGAAATTTGACTGGAGCTAC
TAATAACCGATACTAAAATCACAAGAGCTAAATGTGGAGTCCGATGTATACGCCCCACCGGAGAGGACCCAATATACCATGCCAGAGGTATAAAGACATG
CTGGCGTGATCATTAAAATGATGGTCACGAAGAGGACTTACAACTTATTTGGCTAGTAGTTCTGGAACTATAGGATACTCTGAACCCTAGTCTAACTCAG
TATTAATGCTACTCCCAATGAATTACGTAATTGACTGATTATGAGTTTATGTAAATACTGGCTAAATCAAAATTGAACATGAAAACTGAGAATGCAACAA
TTAATCTAATAATTATGCATTTATAATTGAGGCATGTATATTTGATGTAACTAAAATATCTGACCTAACATGTGTAGTTCAAGAACTAAAGAAATAGATA
GCTAGAGTTCTTAAATTCATGAGATAAACTGAATAATAACATGAAAATCTGACTTGGAACATATAATTAATTAATTAATGAAGTTCTGTTGAAGTTCTAG
AAACCCTAGGTATAATCATGATATGAGAATCAAGAATCTAACTGAAAACTAGGGACCCAATGGGTGAAAGGAACCCACTAGTGAAATCCCACATACCTAG
TAATGAAATTCATGGAGAAATATTTAGATTTCAGGGTTGAAACTACTGGAACCTTGCTGCATTCTTGACCTTTTTCTCCTCTCTTTCTTTTAGTTTTCTA
AGTTTTGATTAATAATTTGACTTAGGTAAGTTTTAGTTATGTTTCTAGGCTTAAACTGACTAATATATGATGATTTAGGGTTAAAACGACGTATCTTTAA
GGTTTAAACAAAGTGGGAAGAGACCAAAAGAATTTTGAGTTAATTGATGTCGGACCAAACAACGACTTGGAGTGATGGCCCATCGTTCAATCGACGGTCC
GTCGTTTCGATCCTTAGGTTAGATTTGTTCGACATACCTTTACTAAAATGGGCATAACTTTTTACTCAGAGGTCTGATTTTTGCAAGGTTGGTGGCTATG
GAAAGATAATTCAATTACCTATCTTTTGGTAGGTCATGGGACACCTATTTTGTGCTAAGAGTTATGATCATTTGAAGTTGAACCAACTACATTTTCCCCT
AACTGTCTGCTAATTTTCACCTATGGTCATACCTACGATCCGTAGGTCCATCTACGGACCGTACTGGTCAATCGTGGTTCTAGTCAGAGAGTGGGTAATT
TGGTCTTTATCGACAAACACAGACTACTGACTGTAGTCTGACCTACGGACCGAAGATCTGTCCGTCGTTCAACACTTAGTCAAATTTTTTGGGCTGCATT
TCGGGAGAGTTTCAGTCACAAATGACGGATGTGCAGTACGAGCTGTGGGTCAGGCTACGGTCGGTCGATGGTAACCGTTGATTTCATATGTAGATTTTTT
ATAATGCTTTCTGGTCTGTTCTAGATACGGGACCATTATGTATTTAAAGTTCGTATTGGGAAATATATTAATATTGTAGTACATGGAAGGAATTATATCA
AGAAGTGATGTATGACTGTCATGACTCCTATTAGTTAATTAGGTCAAACAACAAATAATGTTGGATTTAGTATATGTGTACATTGTAATTGATTTTTTTT
AAATTATTAAGTAAAGGCATGATGTTACGTGTGCCAAGTGGGAGAATGTTAATTTTATGGCCAATGTGTGTTAGTTTTTATGGCTTACATTAATGTTATT
TTGGTTTAATATTTAATTACTAACTAAAATCTAATTGGATAAATATGAAAAGTTTATTATGGTTATAACTCTCCACTACCTACTTTGATGGAAAGTGGTA
ATTAACCGCTTGGTCCTCTCTCTGCTTATTAAAAGAGAACAACATATCCCACCTACGGTATCCTAATATGCACAAGGTAAAGAGAGAGAAAAGAAAACTA
GTTTCTTGTCAAGACTCAAGAAAAGACTTCCGCTCAATTCAAGTCAAGAATTAGAATGGTTGATTCTGGTATGTATTCTTGATTGAATTATTATAGTAAT
AGATTTATGTGAAAATCATATAGTTCTACGATCCTGAATAATTGATAGGATTTACGAATGTTTAGATTGTTTTATGTTTTGAGAATCCAATAAATCCTTA
CATCTTAAACATGATTAGTATGATAATTCAGTATGCCATCAATGTTTAAGCATTATGATATCTAGTTATGACATCAATATTTATGCAGTATGACTTCCCG
GGTCATCAATGATCATATCACAATATAATTTTGATATATTTTTGAGAAAGAGTTTTCAAGTATAAATTGAGACTTTTTCCTTCTACAAGAAATCCGTGAT
ATACATTGTCGTATTAAAATATTTAACCATATTTCTTATTTTGTATTCTCATTTCAGATTGAACGAAAGAGACATGCTCAAATTGCTCTAAGTGAGAGTA
ATATTAAAAGGGAACAAAAAGAAATTATAGAATAGTGTGTCGTAAACGGACCAAAATAAAAAAATAATAATTTAGATTCTGAGCCTAAAGTTATAAGAAA
TGACTCGAGGACGCAACAAAATCTGAATAGAGATTAAAAAAAACTTGTGAAATGGGAGGAATAGATTATTAAAGGAGTTCAAAAATATCAAATGAACTCA
TATGACCTTGTATAATATTTTCTTAGTCTATTTTGGATAAAAATAAATTAGAAATATGATTGTTACATCTTTGTTAAAAATTGGAAGGATTTGACATTTT
GTATAATTTCTTTATTGGAAGAATGAGCTAATCTGATATTTATCATGATTTTTCCCTTATGAACCATTTTCTAGGTTCATAGTAACTCTAGATAACCAGT
ACAATCCCATAGATAAATATTGTAGTATTTTAAATCTTGTTTTGTTTTTGTAATGACCTTAAAGGTCTATTTTTTATTTTTTCTTAGAATATTATCATGT
TATGCCTTTCGATAGTTGCTCCGAGTTCAAGGCGTTAACTTTTGATAATATCATTTTATTTGACTAATGTCTCAATGACGTTTATGAATTTGATGAATAT
GGTCTTTAATAAATCTTTGTATGTTCGTGATTGTGCTTATTGATGTTTTGATTTATTCACGGAGTGAGAATGAACATGTTGAGCATTTGAGGATTGTGTT
GCAAGTTCTCAAGGATCGTGAATTGTATGCTAAGTTCAGCAAATATGAGTTTTGATTGAGGTCCGTTGCTTTCTTGGTCATATTGTTTCCGGTGAAGATA
TTCAAGTTGATCCTAAAAAAATTAAGTAAGTTAAGAATTGATCTAGGCCTTTATCCGCATCAGATTTACGAGATTTCTTGAATTTGATTGGTTACTATAG
AAGATTTATGAAAGTATTTTCTTCTGTTATTTCACCTTGGCAACATTGGCTCAAAAGAAGGTGAAAGGTTTAAAGGAGCTTTAATTGTTCCTAAAAGAAT
TGAAGCAATGGAGGAGTTACGTATGTTTCAGGAAAATAAAATGAATCAGTTTAAATTCTAGATGCAAATAAAGCAGAAAGACATGCCAAAAAGATTTAGT
ACTCAAGAATTGCATTCATAACGAGAAATAAATTTAGTTTAGTACAAGCCCAAAGATGAATCTCCTGATTTATTCGCAAGTTCGCTTTTGAATATCAAGT
TTGGAGATCCCAAGATAGAAGAGAAAAATGTTTTAATTCCTAAAGCAAGGAGGAGTGTTGAATATTTGCTTTAAAATTGTAAAATTCTTATTGCAATAGT
TTTATTAAAATAGATCTAGTCAACTAGTTAGGTCTTTTAATTGTGATTTGAATCCTATTTGAATTTTGAATAAATAGTATATTATTGACGTAGGAGTTTA
ATATTTTCAACAAATCTGTTTGCTTAATTTTAGGTTTAGAAGTTATTAATTATTACAAATTGTATTCAGATTGCACTGAAATTATATCAATTATTAAACG
TTGATTCATAAACTTTCTTTATTTTTATTCTTTTATGCAATTTATTCTCTTTTAAAACCAACAATTAATATCAGTTTCACTTTTCTTGAGGACCTGTGAA
TGAAGAGTTGAATTATTAAAATGGTTTTTTACGAATGACTTCATCTATTTTGATAGTGAAAATTATCAGTTATGAGTTGTGAGAATGAAAGCTTAGTTGG
ATGCTCTTGATCTTCAAGAAGTTATGGAAGAGAATTATGAAATTACTTCGGTGTCGAATAATCCCACCATAGCTCAAATTAAGAGTCACAAGGAAAAGAA
AACCACAAAGTCTAAAGTGAAGACAACTCTATTTTCTGTTGTTTCAACAACTATTTTCACAAGAATTATGTCTCTCACATCACCTGAAGAAATTTGGAAT
TATCTGAAGAAAGAGTATGTCGGAGATGAAAGAATACTAGGAATGCAGATATTAAATTTAATATATAAGCAAGTTTGAGTTGCATAGAATGGAAGACTCT
AAGACGGCCAAAGGAATACTCGTACGGATTGATTGACATTGTGAACAAGATAAGATTACTACGTGCTGAATTTAAAGATGCAAGAATTGTTGAAAAAATT
CTTATTACTGTGCTCGAAATTCGTGATATCCCATAGTACCCAAATCGAAATCTGTGATGGAATTAACATTGTTGTTTCCATTAGCGGAGAGTCTACCTAG
CTAATAAAATGATTACAAGCATTAACTATTCGGGTGGATCAAATTCTAGGGCTTTTGGGGTGATGTTTAGTGATCTTGTCAGGGATGATTTTTTAGGTAA
TCTTGCGATGTATATAGGTGTTTTTGGGTATGTCAGGGCCCTATCTTGACACTTCAATTACTGATTATAGGATCTCTTAAAGAATTCCTACTTGTGTCAA
TGTCTCATGTATGTATGTATATTTTGGCTCACTTATAATACATATACATGACCCTTAACTTGGTGTCAATTGACAATTTTGACCTTTAACTTTGGTTGTG
CACAAGTAGGCACTTAAACTTGTATAAAATTGAACAAATAGACACATTCATCCTACATGACACAAAAAATTGCAATTTTGTGTCTTACGTCGCGTCTTAC
ACGTATTATGCCATGTAGAACACATGTGTTTACTTGTTTAATTTTATACAAATTTAAGTGTCTACTTGTGCAGACTCAAACTTAGAGGGCATAGTTGTCC
GATGAAGCCAAGTCATATTTATGTACTAGATTTTGAAAACGTGCGTTGCATGTTTGTCCCTTGTAATTACTACAAAATGTATGCATACTTAAAAAATTGA
ATTTCAGAATAGAAAATATATTTGTATTGCACGCTACTAAGTATACATATTCGTAAATTATTTAAATACAGTTACAATATGTATAAATAGTTATTCATAA
AATTAAGTAATCAAAAGAGAAAGAGTGTAACACCAAATTAGCTAATGAATTCAAAATAAAATGAAATAAAGTAGACTAAAAATAATAAAATAGCTAATGA
ATTCTAAAACTTTTAAATAACAAAAATTAAAGAGAGAAATAGTTCTAGTTTATAAGAATAGAGGAACTTCCTCAATAACTAACAAAAAATAAACAGATCT
ATCTCTTTTTTATTGCATATGTGATGAACAATTACATTCATCAACAATTATACATTAGAATAACAAAGCATATGCATCAACAAAAAGTAATTGTGTTGAA
CAATGTGTCAGCGTAATTACATCCACCAATAGTCATTCATCAATAATTATACATCAAAATAACTAAGTGTATGCATTAATATAAAGTGATTTTGAAGATA
ATTTTTGGTATTTATGGTTACAAGTTTGGAATTGTAAAAGTCATTTAAAATTTGATGATATACATAACGTCTATGAGAATTAGATTGTTTAAAGTTGGGA
ATGTGTAAAGTTTCTTATTAAAATCTAAATATGTGCCATATTAAGATGTATGGTAATTCAACAGACATTTTTGTTCTTTAATTATAAAGGATATTTTGAA
TATAATTTACTGTCTTTTGTTGTTACGAAACACTTTATCTACCGAACTCTATTTTAGAATAAAAGACAAAGTAAGCATTTTTTTAATTAATCCTACCTAG
AAACATAATGGATTAATACCATATAAGTATTACTTAAGTAATATTTTATTAATTATTTCTTTAATAATATTTAAATTAGTAAAAAAGGTAGAATCATAAT
CCTATTTTAAAGTTAAGATCTTCTCACTTATAATAAAAATAATAATAATTGTTGGACTCGCCCTCCGCTCGTTTACCTATATTAGTCAATACACTTTTTT
TTAAAAAAAAGTATAAAGGTTATTAATAATATTGTTATATGTTAAAAAAGTAAAAGGAGTATATACTTCTTAAAATGAGTAAAAAGAATCTATGAGATTT
TTTATCCAAATACTTTTTCTAGATAGAATAAATGAAATAATAAGTTCTAAATTTAATCAATAAAAACATAAAGTTTCAGAATATAAAAATATTTAGCAAT
ATTTTTTGTCTTCTTCAACGCTTCCTCGGGGTATTTATTTACAAACATGAAATCACACCATGATTTTATTTTCATACAAGTAGTAAATCATTTATAAATT
CTAAAAAAGCACATTAAACATAATGCATGCTAATTTTTGTAGATTTAATTATGAGAAAAAAACTAATTACATCAATTATTCAATTCTCTTATCCAATAAC
CTAGAGTGTTTACTACATGATAATCAACTTGCTATAACATACATAATCTTTAAAAGAAGATTTGTACATCAAACATGTAAATGAAAAAAAATTATTTTCT
TTTTCATTGCCATTATTCAAGAAAAAGTAGTCAATTTACCTTCATTCAACCGAAAATTGAATGTAACAAATAATGAACTAAGTAAAAATACGCAACATTG
AAATGAAAAATAATACTTATCAAACAACAAATAAATGTCCATGACGCCTTTCACCTTCTTGAAGAATGCATCGAATGCACTGAAATGATTAAATTCTAAT
TCAGGTACTATATTCTCCAAGAATTTACCGTCAATAAATTAACGAAACAACATACATATTTTTTCTCACACAAGTAGGTTTGTTTTACCTCATGAATGTT
GAGTAGCCTTTTTGTCCAAATGAAAAACTCTCTAGATTATTTATCACATGTTGCGTTAAAAACATAAATTTTCGATGAAAAGAATGAAACAAACATGTAA
TATTAGTTTTATCTATATATATATATATGTCTAAAATTTTGATCAAAAGAAACATGAAAAATTTGAAGAAGGTGAGATAAATCAATTAACATGCTACTGT
CATGAGAAGACATCAAAATAAAGTATTTTGTTGGAAAAATCATGTATATAATTTTATCAATGGAACTCTTCAAATTCTTTAACTTAAAATTAAATAAGAG
ATGTTTTGAAATGTTTGAACTTCATTTGTTTGAATGACTATTTATCTTTCATTATATCTTTATTACTTTAAAGTTTGTTATCTAATTATTTATTAAAAAT
ACTTTTATATTTTAAAAAATAGAAAAAATATTTAAGTGAAGGGTAAAATGGTAATTCAACTTTGAGGTTAGGAGCTTCCCACTTATAATAATAACTAGTT
CCAGACACGTGCATTGCACGTGTTCCCCAAGCTAAATTGCATGAAGTTGTTGTAACGATGTGTTTGTATGACCTTTTTGATATTAAAGATGAAGAAACCA
CAAATATTGTGAAAGAAAAATAATTATATGTTAAATGTGCGTACATTTTGATTTAGTAATTTGCTGATAAAATAAAAATAGATCAACAAAAAAATAGTTA
CAAATTACAATAATTAATTAAGAAAAATATATAGAAAACTTTCACATATATAAGAAAATATTAGGCAAAATAGAAGGCATACCACTATATAAGAAAACTC
ACATTTATAAGAAAACTTTCAAATTTTCTTTTCAAGAAAATCAAAAAAGTCTTTCTTGTGTAATGGAAGATATATGTACGTTTTTCTTGTAAAGACGGTC
TTAACTTAACTAAGAGAAATAATTAATTAAATTGGACATTTGAACTTAAACTTCATATTAGAATTAAAATGAATTAAATGAAAGAAAATGAAGGATAGGA
ATCAAAGTCTCAAACATTTTTACATATTTCACCAGTAGCTAGAGACTTTTAGTAGATGAATATGGTCAATATATTAAATTAAGTGTATTTAATTATTAAG
TAACCCTTCAATTTCTTCTAATTTTATAATTTCAAAGAGTGTTATACTCTATACAAATTTATAGGATAATTCTAGTAATCCAACTTTAACTTTGTTGCTT
CACACTGTAACGACCTGTTTAGTCGTTTTGAGCAGCAAATTTTATTTTTGGAAAAAAACAGGCTAAGGCGACGGACCCCACGACGGGCCGTCATGGGCAC
GACGGACCGTCGCAGGGTCTCGTTTCAAAACACTTAGAAAAAACTGAAAATTGGGTACTGAAATCGACTCTCTGAACTTCGTAACGGAATGGCAGGACGG
ACCGTCACAGGTGTGACGGACCGTCACAGGTGTGACGGACCGTCACAGATTCTTCAGAGAAATTGAGTCTCTGAACTCTGTGACGGGCAGCAGGACGAAC
CGTCGCAGGCTCGACGGGCCGTCACACACTGCGAAATCCCAGTCTGAGTAAGATTTCTTGATACGTTTTAAGGGACGTTTTTGACTATTCTTGCCTTAAT
TATAAAGTTAATGGGTTAATGTTAATAAGTCTAATTACTTGGGGGTTAAAAGAGGTAACCTAAGTTAATTAGTGGGGCATTATTGCAATCTTTTATTCTT
AATTATATGTTAATTAGGGTAAAAGGAAGAGGGTTTTGAATAAAGAAAATAGAAAGAACAAGAGAAAGAGAGAGAGAGTCCAACGAGAAAGAGGAGAAAC
GAAGAGAAACAAAGCTTGGAGAAAAATTTGCTTGCTTGATCACTAATCTTCGGTGGAGGTAGGTTATGGTTTTCATGCTTTCATAGTAAACTCTTAATAC
AGAATGATATGTATTGGTAGTATTGTAAACCCTGCTATGTGCTTAATTGTATGCATGCATAAACGTGATTATATAATTGTGATTATATTAAGCATGATGA
AGTTATTGAATCCCAAATCTTGATAAAAACCTAATCTCTTTTTAATGATGATGCCTTGGTAAGGGAGAAGTCTTGATGAATTGATGGAAGGAGATTAGGG
GATCAGGTGTCACGAACCGACACATAGAATTAGGGGATCGGGTGTCACGAATCGACACGTAGTATTAGGGGATCGGGTGTCACGAACCGACACGTAGAAT
TAGGGGATCGGGTGTCACGAACTGACACGTAGAATTAGGGGATCGGGTGTCACGAACCGACACGTAGAATTAGGGAATCGGGTGTCACGAACCGACACGT
AGTATTAGGGGATCTGGTGTCACAAACCGACACGTAGTATTAGGGGATCGGGTGTCACGAACCGACACGTAGTATTAGGGGATCGGGTGTCACGAACCGA
CACGTAGATTTAGGGGATCGGGTGTCACGAACTGACACATAGATTTAGGGGATCGGGTGTCACGAACCGACACATAGATTTAGGAGATCGGAGTGTCACG
TACCGACACAAGAGGATTAATGAATATTGAGGGAGCAGAGTGTCACGTACCGACACAAGAAAAATAAAGATAATGAATCTTGAAAGATGTTAATATGCTC
AATCTAATGAACATGATTCCCAAATGAGTATGGTATCGAGGCTTGAGTCCTCATGTGTGAACTTGACGGTAATTGTTAATGATATAGTATTTGTTGTTGC
TACATGATGAGTATCATAGTTGATTTTATGATATTACTCGGTATATATTGATTTCTATTTTGAGTTGGCCGATGATATCTACTCAGTACCCGTGTTTTGT
ACTGACCCCTACTTTTATGTTCTCTTCTTGTTTATTTGTGGAGTGCAGCAAACGTGCCATCGTCTTCAACTCAACAGTAATTCAAGCCAGTCTTACTACA
TCGGAAATTCAGGGTGAGCTAATGCTTCTAGCTTGGACTGGATCTTCTTCTTCAAGTCTTGATGCCTTGAACTTCCGGCATGGACTAGCTTCTTATGTAT
TTTTAGCTTTTAGAACACTCTTAGTTTAGTCATTTGATCGTAGATGTTCTTGTGATGATGACTTCCAAATTTTGGGGAATAATAGATGTTGAATTTTAGA
AGTTAATGAATTGGTCTTTACTTATGAGTTTAAGTCTTCCGCATTACTTTCTGTTGATATATGTTGAAATGATAAGGTTTAGATTTGGTTGGTTCGCTCA
CATAGGAGGGTAAATGTGGGTGCCAGTCGCGGCCCGGAATTGGGTCGTGACAAACTTGGTATCAGAGCATTAGGTTCGTTGGTCTCATCACACGAGAACA
GGTCTAGTAGAGTCTTAAGAAACGGTAGGGGGACGCCTTTACTTTTCCTTGAGAGGCTATAAGACTTTAGGAAAATTTCACTCTTTCATTCTTTCTTTCG
TGCTACTACTTAAGTCCAATTGGTATCTAGGCGATACGAATTGGTATCTGTCCATCTTCACTCTCTTTCGCAGATGGTTAGAACTAGAGCAACGACTACG
CCAACACCAACACCAGCACCGGCGGGACAGGGTACGTCTGAGCCAGCCACTGGGGCTGTAGCTCGAGGAAGAGCAGCGGCAAGAGGTTGTGGTAGAGGTC
GTGGGAGGACGTCCTCTAGGGGAATAGGACGAGCACCTAGCCCATCTGATACTAGGGCAGTGACTCCTCCACCGACTAAGGAAGTAATAAGAGAAGGGGA
GGATGGGGAAACTGAACAAGTGCAGAATGAGGGATTGCCACCCCAACCTACCCCAGAGATGATCAATCAGGTTCTCGCCTATCTCAGTGGGTTGTCTGAT
CAAGGTCAGGCACCTTCAGTGTTTTCTGCGTCAACACCTCCGGTTTCAGAAGTACAACATGCAGCCACTATGGCTCCTCGTATGGAGGCCTCATTGGACA
TAGGCACATTTCCACGTCTGACTACTGGGCCTATAATGACAAATGATCAACATGAACTTTTCAGTAAGTTCTTGAAATTGAAACCTCCGGTCTTCAAGGG
TGCTGAATCGGAGGATGCTTATGATTTTCTGGTTGACTGTCACGAGCTACTATACAATATGGGTATAGTAGAACGGTTTGGTGTGGAGTTTGTGACTTAT
CAGTTTCAAGGGAACGCCAAAATGTGGTGGCGATCACATATTGAGTGTCAACCAATAGAGGCACCACCTATGACTTGGGCCTCATTCTCTAGCTTGTTTA
TGGAGAAGTATATCCCCCCGAACTTTGAGGGATAGGAAAAGGGATGAGTTCTTGAGCCTAGAGCAAGGTAGGATGTCGGTCAATGCATATGAGGCTAAGT
TTCGTGCATTATCCTGGTATGCCACCCAACTGTGTTTCAGTCCACAAGAGCGAATTCGCCGGTTTGTGAAGGGGTTGAGGTCAGAATTGCGGATTTCGGC
CTTACAGATAGCGGCAACGGCAAAATCCTTCCAAGAAGTGGTAGACTTTGTGATAGAAGTGGAAGGAGTGAAGCCAGACGACTTCACCACAACATCGACA
TCAAAAGAGTTTCGAAAGGGAGGTGAGTTTAATGGTGCTTACACTAGAGGACAGGGTTCAGGAAGTTACTCAGTCCGACCAATTCAGTCTTCACTACAGA
CTGTAGTTGGGGGACCACCTCAGACCGGTCAACACTTCTCCGAGAGACCTATGCTTGACTCCAGAGAGTGTTACGGATGTGGAGAGACTGGACATATTAG
GAGAAATTGTCCAAAACAGAGTTACAGACCCCCAATAGCTAGAGGTAGAGGTGGTCATGGTAGAGGCCGTTTTTCTGGAGGGCGTGGTGGTCGAGGAAAT
GGTGGTCACCAAAACGGCCGAGGTGATGGGCAAACTGGAGCCACTACATCACAACATGGTAGGGGCAACGGACAGACGAACGATAGGGCCCATTGTTACG
CTTTCCCTGGGCGGTCTGAAGCGGAGGCATCTGATTCTGTCATCACAGGTAATCTTTTGGTTTGTGATTGCATGGCTTCTGTATTATTTGATCCCGGATC
CACATTTTCTTATGTATCTTCCGCATTTGCTAATGGTCTTAATTTACATTGTGAATTGCTTGACATACCTATTCGTGTTTCTACTCCGGTAGGCGAGTCT
GTGGTAGTTGAAAAGGTTTATAGGTCTTGTTTGGTGAACTTTGTGGGGAGCAACACTTATGTAGATTTGGTTATCTTAGAAATGGATGATTTTGATGTAA
TTCTGGGTATGACTTGGCTTTCTCCGCAATTTGCGATCTTGGATTGTAATGCTAAAACGGTGACGTTAGCCAAGCCTGGGACAGATCCGTTAGTGTGGGA
GGGTGACTACACTTCCAATCCGGTGCGTATAATCTCCTTTCTTCGTGCTAAGAAAATGGTTAGTAAGGGGTGTTTAGCTTTCTTGGCACATATCAAGGAT
GACACTACCCAAGTACCTTCGATTGAGTCGGTTTCGGTGGTCCGTGAGTTTCTGGATGTGTTCCCTGCAGATCTTCCTGGTATGCCACCAGATAGGGATA
TTGATTTCTGTATTGACCTTGAACCGGGTACTCGCCCCATTTCGATACCCCCTTATAGAATGGCTCCCGCAGAGTTAAAGAGAGTTAAAAGCCCAACTTC
AAGAGTTGTTAAACAAAGGCTTTATTAGACCAAGGGCATCTCCTTGGGGTGCTCCGGTTTTGTTTGTGAAGAAGAAGGATGGGAGTTTTCGGATGTGCAT
AGACTACCGGCAGTTGAACAAGGTAACCATAAAGAACAAGTACCCTCTTCCCCGCATTGATGACTTGTTCGATCAGTTACAAGGTGCTTGTGTCTTCTCT
AAGATTGACTTGAGATCCGGTTATCATCAATTGAAAATACGGGCAACGAATGTGCCAAAGACTGCTTTTGGAACGAGGTATGGGCATTACGAATTTGTAG
TGATGTCTTTTGGTCTTACGAATGCGCCTGCTGCCTTCATGAGCTTGATGAACAGGATTTTTAAGCCATATTTGGACCTCTTCGTGATCGTATTTATTGA
TGATATATTGGTATACTCAAAGAGCAAGAAGGAACATGAAGAGCATTTGAGAATGGTATTGGAAATGTTGAGGGAGAAAAAGCTTTATGCCAAGTTCTCT
AATTGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTAAGGATGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTGAAGAATT
GGGTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGTCGATTTGTCAAGGGATTCTCTTCTATTGCTTCCCAATT
GACGAACTTGACTAAGAAGAATGTTCCATTTGTATGGTCGGACGAATGTGAGGAAAGCTTTCAGAAGCTTAAGACCTTGTTGAATACCGCACCTATCCTT
ACCTTGCCAGTAGAGGGTAAGAACTTCATTGTTTATTGAGATGCATCCTATTCGGGTTTGGGTGCAGTGCTAATGCAAGAGAAGAATGTGATTCTTATGC
TTTAAGACAATTAAAAGTGCATGAACGTAACTATCCAACTCATGATTTGGAATTGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAGATACTATTTATAT
GGGGTTAAGTGTGAGGTCTACACGGATCATCGTAGCCTTCAGTATGTCTTTACTCAGAAGGATTTGAACTTGAGGCAACGGAGATGGATGGAGCTACTAA
AGGACTACGATATCACTATTTTGTATCATCCGAGGAAGGCGAATGTTGTAGCGGATGCTTTAAGTAGAAAGGCGGGAAGCATGGGAAGTCTAGCTCACTT
GCAAGCTTCTAGACGCCCATTGGCTAGAGAGGTTCAGACTCTAGCTAATGACTTGATGAGATTAGAAGTAAATGAGAAGGGAGGATTGTTGGCTTCTGTG
GAGGCAAGATCTTCCTTTCTTGACAAGATTAAGGAAAGACAATCTGATGATGAGAAACTGCGCAGAATTCAAGATAAGGTATTGCGAGGAGAGGCTAAGG
AAGCACAAATCGATGAGGAAGGTGTTTTGAGGATCAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATTCTGACAGAGGCTCATAG
TTCAAGGTATTCTATACATCCGGGTGCAACCAAGATGTATCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGACTTTATT
GCCAAGTGTCCAAACTGTCAACAAGTAAAGTACGAACACCAAAGGCCCGGAGGAACACTTCAGAGAATGCCCATTCCGGAATGGAAGTGGGAAAGAATTG
CAATGGACTTTGTGGTTGGTCTTCCAAGGACAATGGGTAAGTATGACTCTATTTGGGTGATTGTTGATAGGTTAACTAAGTCTGCTCATTTTATTCCGGT
TAAGGTGACTTACAATGCCGAGAAGTTAGCCAAGATCTATATCTCAGAAATCCTTCGGTTGCATGGGGTTCCACTATCCATCATATCAGATAGAGGTACG
CAATTTACTTCTAAATTTTGGAAAACATTGCATGCGGAATTGGGTACTAGCTTGGACCTTAGTACTGCGTTCCATCCTCAGACCGATGGTCAGTCTGAGC
GAACGATTCAAGTGTTGGAGGATATGCTTCGTGCATGTGTGATAGAATTTGGTGGTCAGTGGGATAGCTTCTTACCCTTAGCGGAATTTTCATACAATAA
TAGCTATCACTCGAGCATTGATATGGCTCCATTTGAAGCATTGTATGGTAGGAGATATAGATCCCCCATTGGTTGGTTTGATGCGTTCGAGGTTAGACCT
TGGGGTACTGATCTTCTGAGAGATTCGATGGAGAAGGTGAAATCTATTCAAGAAAAGCTTCTAGCGGCTCAAAGTAGACAGAAGGAGTATGCAGATCGGA
AGGTTAGAGACTTGGAGTTTATGGAGGGTGAACAAGTCTTGCTGAAGGTTTCGCCCATGAAAGGGGTGATGCGGTTTGGTAAAAGGGGTAAGCTAAGTCC
AAGGTACATTGGTCCCTTTGAAGTACTTAAATGAGTAGGGGAGGTGGCTTATGAGTTAGCCTTGCCTCCAGGGCTGTCCGGAGTGCATCCGGTATTCCAT
GTGTCGATGTTGAAAAGACACCATGGGGATGGAAATTACATTATCCGTTGGGATTCAGTTTTGCTTGATGAGAATTTGTCTTATGAGGAGGAACCTGTTG
CCATCCTAGATAGAGAAATTCGCAAGTTGAGATCAATGGAGATTGCATCCATCAAAGTTCAATGGAAGAATCGACCCGTTGAAGAAGCCACTTGGGAGAA
GGAGACGGATATGCGAGAAAAATACCCATATCTGTTTACAGATTCAGGTACTCCTTTTCGCCCTTGTTTTCCTTCTTGTGATTGTTCGGGGACGAACGAT
GGGTAAATTGGTATCTATTGTAACGACCTGTTTAGTCGTTTTGAGCAGCAGATTTTATTTCTAGAAAAAACAGGCTAAGGCGACGGACCCCACGACGGGC
CGTCATGGCACGACGGACCGTCGCAGGGTCTCGTTTCAAAACACTTAGAAAAAACTGAAAATTGGGTACTGAAATCGACTCTCTGAACTTCGTAACGGAA
TGGCAGGACGGACCGTCACAGGTGTGACGGACCGTCACAGATTCTTCAGAGAAATTGAGTCTCTGAACTCTGTGACGGGCAGCAGGACGGACCGTCGCAG
GCTCGACGGGCCGTCACAGACTGCGAAATCCCAGTCTGGGTCGGATTTCTTGATACGTTTTAAGGGACGTTTTTGACTATTCTTGCCTTAATTATAAAGT
TAGTGGGTTAATGTTAATAAGTCTAATTACTTGGGGGTTAAAAGAGGTAACCTAAGTTAATTAGTGGGGCATTATTGCCATCTTTTATTCTTAATTATAT
GTTAATTAGGGTAAAAGGAAGAGGGTTTTGAATAAAGAAAATAGAAAGAACAAGAGAAAGAGAGAGAGAGAGAGTCCAACGAGAAAGAGGAGAAACGAAG
AGAAACAAAGCTTGGAGAAAAATTTGCTTGCTTGATCACTAATCTTCGGTGGAGGTAGGTTATGGTTTTCATGCTTTCATAGTAAACTCTTAATAGAGAA
TGATATGTATTGGTAGTATTGTAAACCCTGCTATGTGCTTAATTGTATGCATGCATGAACGTGATTATATAATTGTGATTATATTAAGCATGATGAAGTT
ATTAAATCTCAAATCTTGATAAAAACCTAATCTCTTTTTAATGATGATGCCTTGGTAAGGGAGAAGTCTTGATGAATTGATGGAAGGAGATTAGGGGATC
AGGTGTCACGAACCGACACATAGAATTAGGGGATCGGGTGTCACGAATCGACACGTAGTATTAGGGGATCGGGTGTCACGAACCGACACGTAGAATTAGG
GGATCGGGTGTCACGAACTGACACGTAGAATTAGGGGATCGGGTGTCACGAACCGACACGTAGAATTAGGGAATCGGGTGTCACGAACCGACACGTAGTA
TTAGGGGATCTGGTGTCACAAACCGACACGTAGTATTAGGGGATCGGGTGTCACGAACCGACACGTAGTATTAGGGGATCGGGTGTCACGAACCGACACG
TAGATTTAGGGGATCGGGTGTCACGAACTGACACATAGATTTAGGGGATCGGGTGTCACGAACCGACACATAGATTTAGGAGATCGGAGTGTCACGTACC
GACACAAGAGGATTAATGAATATTGAGGGAGCAGAGTGTCACGTACCGACACAAGAAAAATAAAGATAATGAATCTTGAAAGATGTTAATATGCTCAATC
TAATGAACATGATTCCCAAATGAGTATGGTATCGAGGCTTGAGTCCTCATGTGTGAACTTGACGGTAATTGTTAATGATATAGTATTTGTTGTTGCTACA
TGATGAGTATCATAGTTGATTTTATGATATTACTCGGTATATATTGATTTCTATTTTGAGTTGGCCGATGATATCTACTCAGTACCCGTGTTTTGTACTG
ACCCCTACTTTTATGTTCTCTTCTTGTTTATTTGTGGAGTGCAGCAAACGTGCCATCGTCTTCAACTCAACAGTAATTCAAGCCAGTCTTACTACATCGG
AAATTCAGGGTGAGCTAATGCTTCTAGCTTGGACTGGATCTTCTTCTTCAAGTCTTGATGCCTTGAACTTCCGGCATGGACTAGCTTCTTATGTATTTTT
AGCTTTTAGAACACTCTTAGTTTAGTCATTTGATCGTAGATGTTCTTGTGATGATGACTTCCAAATTTTGGGGAATAATAGATGTTGAATTTTAGAAGTT
AATGAATTGGTCTTTACTTATGAGTTTAAGTCTTCCGCATTACTTTCTGTTGATATATGTTGAAATGATAAGGTTTAGATTTGGTTGGTTCGCTCACATA
GGAGGGTAAATGTGGGTGCAAGTCGCGGCCCGGAATTGGGTCGTGACATACACTTTTAATAGAACTAATAATTCTATTTTTACTATAATGTTTGTAAAAT
AAAATATTAAATCAGGAAAAAGTACTTTAAAAGCTATACAACTTACGTGGTTACCAAAGCAAGAATAATTATCAACCATGCAAAGACTTAAATCATAAAA
CTCAAAGTCTTATTGTGTACAATAATATTTTATTTGTAGTTATTTATTTATCAAATAGGAAAGAAAATAGAAATTTTTTAATGGTAAATAAAAGAGCACC
TCTAAAGAATCAACAAAAATATTATAAAATGAAGCTAAAATTAACAATTTGAAAGAAAAAAGTAGTAACAATGTGAAAGAAAAAGAGATGACAACTTTCT
TTATTCTCTTCCAATTATTCAAAATCTCTTCGATAGGATATAATTGAGGGACTCAAAGGATTGTCATGAATATGCCATTAACCCATTTCATGGATGAAAG
GTGAAAGTAACAAGTATATTATTATGAACATCAACAAATGTATAATATCTTCGTTTCTAATATAATAATACAAAATAAAAATTCCACCTGAACACATAGA
AGAGAAATCTTAACAGATCTTAGTTAATCTACAATAAAATTATCAAACAAATATTAAGATACAATGAATGAAGAGAAGTAGATATCATCAAAACTAAGAC
AATATATATCATGACATAATTTACAGATCAGAAAATTAGTGAAGCACACAATGGTATTTATAGCCAAGATATATAAAAACTCAAAAGTCAAGTTAGAAAA
AGATCATTAAAATATCATTAAATCTCTTTATTAAAAAGTGAAAGGACAATTTATATTTTATTCTTTAAAAATGGTTAGATTTCCAAAACTATTAAAATCC
AAATTCGTAGTTATTCTTTAAAGTTAAAATGTATGACTATAAGTATTCAACATATGTACTAATACACATAAAAGAATATGAAGAACCAATTTTGAAATTG
TCAAGAACCAATTTTGAAATTGTCAAAACATTTATTGTATGGTAGTCAATATGATACTTAGCATTTATTTAAACATATATTTACATTTTTTTTACACAAA
TTATTTAAAGAAGTATTTTCTTTATTTAAAGATAAAAATGTTTAATTAATTATATTAGATGAATTTAATTAAATATTTTATAGCCTTTTCATTTAGTGTA
GGGATAAAATAGTAATTCAACTTTTCACTTTGGAGCTTGCCACTTATAATAATATATGATATATATATATATATAAAATAGTAATTCAACTTTGACGTTA
GGAGCTTCCCACTTATAATATGATTATGTCCTTGTAACTATAACTACTTATGCTTAATCCTAGGAAACATAGTTCCTTTATGAATCTGTCTTAGATCTCA
AGATTTCTATTATTTTCATGATTATGTCATGGTTTTTTTCATGTAGAGTCGTCCACTTGATCAAGTTAAGGCATCAAATTTTCCGTTTTGAACTACCAAC
CTCTTGGGCGTGACAGAAGGTGTTTTAACTCTGTAAATCTTTGTATTGGTTGAAACAGACTCCACATTGCTGATTTGCTAAATTGTCAACTGCTCTGAAG
ATGTATGAATTTGAATAATCATACTCAAATTATTATCTTTTTACCTTGCAAGGGACAAATGTCCAAATTAATGTTCTTATTGTGTATGTGGATGACTTGA
TTTTTCTGGAATTGAGCACAGTACTATTATACGAAGGTTTAGTTGTTTTGAAGTATTTCTGGAGGTTGATGTTACAAGGGTCCACTGAATTTTTCTATGT
CAACAAAGATATGCCTTGGACTAATCGATGGAAATGAATGTCTTTGTATTGAAATGGTTTAAAGGTATGTTGCACAGTTTGAGCATGAAAGGTGAGTTTT
CGATCAGTGTAACAGTCAAGAGACATTGTATCTTGCTCAAAATCCGGTCTTTCATGAACAGACCAAACATATTGTCACTATATATATTCGGGGTGAGCTA
CTTGATGGTAGTATATTAGGAGCTACAAATGACTGGAGTGAGCTTGCCCGAAGACATCATGTCTTCTTCAATAGTGTATGTACACTGAGCCTTGTTTCAA
AAATAGGATGAACTTTTGCTTGTTTGATTTCCTCATTGAATTGAATTAAGAATGGATTGAATTGGAGTTTCTTATATTAGGAGGTTGATTGGTTCTCCAC
TTCACCACCCCAAGTTCTCACTCTCTGTTCTGCTTGAAGAGCCTGCAATAGTTCGAGAAACTAATAACAACACGCGAATGTCTAATGATATGTGTAGTTC
GTGTATAATATGTGTAAAACATGCATATAATTTATGCTTCTCCATTAGGAAAAGTAAACAGTGAATCCAGCCGGTTATTTGTGTAAAGATTTCCGTGAAG
TCTTACTTTATTGGAATCTGATACATCAATATCATAATCTTTGTGGTTTCGGGAAGTGAGGTTAAATTTAACAATATCTAGTGAATTTATGCCTATTTCT
TCAATCTCTTGACCTTTGTTGTTTTTGCCTTATCATTTGACAAGCGTTATAGCTAACATGATGTGATTTATACCTAGTGAATTGTCGGAGGTGCTCACAA
ATTGACTGGTTAGAATTACCTGTTTTTGCCAACTGGTTCGCATAATGATAAGAAACTGGAAGAGTGTCTGAAGCAAGCTGCCAGCAAGCATAGCTGAAAG
TATGCCTTCAACCCCAAATTTGAATTTGTAACCAAGCAATGCACCCAATGGAAGCCCAAAACCATAATAACATCCAATGCTAATTAAGGCCACTTGAAGC
TGCCATCCTGCACCAACTGCCACTCCTGCATTTTTGCAATTTGATAAAAAATAGTTATATCGCGCTAATCATAAGCTTATGCAAACTTGCAAGAGTTCAT
TTGATCATAGGTTTATGATATGTTTCAATAAGTTGTGTCCATAGGTTTTGCGTACTAGTCAAATGTTAGGGTGTCTGGTAACAAGACAACGTCACTATAA
CTTGTTTGAATGACCTTTTTGGCATCTATATTGTCCTGAACTTCACTTTATTTCTGAATTGCAGCTATGTTCAGCCTGGATTCGTGAGAAACGGATTTAT
GTACCTCGAGAATATGTTAATGAGTAGAAATTAGAGAGAAATACCAAGTAGAACAGGTTGGATGCCATTAAGGAAGATGATAGCTGCAAGAATATATCCC
AGCTTTGATGTCTCCTTTATGACATGCTGTTCATTTGTGAATAGTCTTGGAAACTCTTTTCTGGTAGCTAATATTGTAGCTGAGATTATAAGGCCAATCA
CTGCTGATGTCAAAACATTGACTGTAATGGAGAATTTTGCTGCTTTTGGATTTCCAGCTCCTAATTCATTTGAAACTCTCACACTGCAACGCCACAAAAA
TCTTAGTAAGGGCAGATTTACAACCAAATAGGTGACATAGAAACATAAAATTGTTATCATCTAAGTTTGCTAACTATAACTCCTACTAGTTGTCATTCAA
TGTAATCTTGCACGGAAACAGCTAACCTGGTTGATGAAGTGAAACCAAAGGCAACCGTCAGTGTCCACAGTTGCAATCCGAGGCTGTCATATCCAGACCA
GTTGATTAACATGTAAGGATTTGTAGTGAAAGAATTCAATAGAAAGTTCATTGTGAAAGAACTCAAAAAGGAGAAGAGCAAAAATCAGGTCTGTGAGACA
ACAAAAGGGTGGTCATATCAAATTTTCATTACACGGACCATGTATATGAGTTAAATCCAAGAAAGTAGTTGCGATAGAGCAACATGATACTAACCAGATA
GATATGGCATCAACAGAAACTGTAGCATTTTTCAAGCCTCCTACCATTAGAATCACTGCAGTGAAGTACCAAAGCTCTAAACTGCCACCATTCAATTAGT
ATCATCACGAAAATGGTACAAGTTGAAACATTTCAAGAGACGGTAAATAATAATTACCAAGCTTCCAGTCTCTACTTACCATACCATTACCGCAGAGGCC
AGTGATAGCTTAACAAAGTTTGTCAATGATTTGACAGCCAGACATGAAAAACCAGTCCACGCCTCTGGAAAATAGCCCGAAATTATGTAAATAAGCTGAG
CAATGTCCAAAAGCCACCAAGATATATTTCCAGCAATTGCAGCACCAAAAAGTCCATGCCCTCCCTTTACCACAAGAATCCAATTTAGCAATACATGAAT
AGCCAATCCCCCCACTGATATGATGGCCATAACCCAAACTTTGCTCTGAGATTGAAGAAACTTCTGCATAGGAAAGTTGAGAGCATATGCAAACATTTGA
GGAATTATCCAAATCGCGTATTTCCCTGCTAGATGAGAGATGTCTTTATCTTGACGTAGGAGCCTTAGTATCGGTGATGTGAAGACAAAAACTGGTGTGA
GCAACAAAGATGTGACTCCAGTAATGATCCATGATCTTTGCAAGTAAACTCCAAGCATATTGAACTGTCCAGCTCCCACTGCTTGACCACAAAGTGTTGC
CAAAGCACTTGCCATCCCTAACTAAAAATTTAACAAGGTAAACAAAAAATAAATAAATCTTTAAGATCCCAATCATGTTATATTTAGATCATCTAAAATG
TGTACGTATAATAAAATCATACTCATTCTAAAGTGTCAGTAACTTTGATTTAAACTATGTTATTAATCTTATTCTATACTCGATAAGTACCAATACAAAA
CTCATAAGCTTCAAATCGTGTGGTTACTTATAAAGGTATAAAAGCAGTGAATATACAATCGAATACCATGACTCCATAGACAAATCCTGCTATAACATTA
TGAACTTCAGAGACAGCAGCAAGTTCTAAATCTCCCAATCTTCCAGCAAAGGCAGCTGTAACAAACTCAAGAGAAAACAAAGAAACTGCATTCAAGATAG
CTGGTCCTGCTATATGCCACACCTTTTTTGATTCAACACACCATTTATTCCCTATTTGTTCATTTTCAGTCTCTTCACTCTCTATTTCTAAGCCCTTTTG
TTCCATATTTTTAAGAACCCGATGCTTCAAAACTCTGCTTTAGCTTAAACAAACAAATGAATCATTGAGATGTTACTTTTACTTTAATATTGACATGTGC
CCCCTTGTCTAGTTTATTATTATAATTTGAATCATTTGCAAATTGAGTTAGTAAATTACTTTAAAAAGTATCTAAAACAAGATTGTATGAGTTGGGTTTG
GTAAATGTTTTATTAGTATATAAAAAATATTGTGAGATAATCATCATTCAAAAAGATGTAAAAGGTATAAAAAATTTGAGCTATCTGTCCACTTTTGTTG
ACTATGGACAAAAAGACTAAATGATGAAATAGACACTGGCAGTTGATGATTTTTATTTTATAAATATTTTGAAAATTATTAAAAAATTTAAATATAAATA
AAAATGTGAAAATAAACAGTCAAATGTATTTGGCTAAAGACCCCAACTAGTTGCTGATATATTATACCATAGAATACTGTAAAAGTTAAAATTTTATTAG
ATTAATATTAATGTTTATTTAAAAAATTAAATAATTATCTAACTTGATTTACTGGTAAATGGTAATCATAAACAACAAAAGAAGTTTGACATGATTTAGG
CATCCTTGAGGAAAAGACTATGACTAGATTCAATTCAAACAAACTCTATTGAATTCATGTCACATCTTCATTTCCAGCTTTATGGAATTTGTTACATAAC
GAATTAAGAACAAGGGGCGGGTTGACGTTGAAATACTTGCAGGGGCGGCTTTAAAAAAAAGGAAAACAGAATTGATATATCTATAACTTTTTTTTTTATA
GCAGTTTTAGATTTTTTGTCATTAAGGAGCGTCAATGATTGTAAATGGTTGTCATACAACGGATTCAGATTTGTTATTAAAGAATGATAATGGTTAAAAT
AAAAAATATAATTTTGAGGTTAATAAGACTCGAGTGTCCATGACTGTAATTAAAAAAATTTAAAAACACATGACCTCAAAAAATTTTCACAATCTTAATC
TTAATCACTAGACTAAAGTTTTTTCTTTGTTTGAATTATATACTATATCATATTTGTGAAAATCAAAGTAAGAAACTAACCTGCATAGCCTTTTTAGGTT
TGTGACTCTTTATCTTTATCTTTTTATATATATTTTTCTTTATGAAAGTGAAATGTTTTGCCAAGATTCTGGTGAAAAATAAGTTAAATGTTTAAAGTAG
AATATCAAGTTACTTTTCAAAAGCTAAAAGTACTTTTGAGAAAATATTATTAGAAAGACTTTTGTTGTTTAAAAGTAAGTTTCAGATTAATTAGTTCAAC
ACAAACGACTTTTCATCGAAAGCACAAATTTTGAGGAACACTTTTGAAATCACAATACCCTTATAAAGTAAACAGATTTAAAAGTTTGATCAAATATGTG
ATAAATAAACTCCTTAATGTTTGATTTATTTTATAAATCAGTACTTTTTTAGGTAGATTGTATTGAAATTTGAAATATTAAAATGAGTTAAAATAGAATT
TGAATTGAATCTTGACCCGTCAAAAATTTACTTTGGATTCAAAATTGGATTAGGTCATGACCCGCTTGATTTCAATATTTTTAACATATTATTTAACTTT
TTTAACCACAATTGAAATTTCAATTCAACAATTTTAAAAAAATACAAATAAATAGATAAACCCTAATATTTTATTGATAATTTTAATATTTGAAAGAAAC
TTCAGGGAAAAATTAGTACTTCTTCCTAATCAAACTGTGTGAAACACTACTTTTATTCAGTCCTAAAAATGACACCTTCATACGACAAAAAATAACTGAA
CTCTCTTATTTAGGCTCAACCATCCACTACCTCATAAGAATTAAACCGTGCAGGTAACCTTCATTCTGCAACAACATATATTCAATGGTCTCAGTTTTGG
GAAGTCTGCAGAGCAAGTAAGATAACCAAATCTACTTGTAATATTATCTGTGGATATTCTCCTATATAGTAACCTTGTCATTGAAAATGACAATTTCAAG
CTACAGTAGCAAAAGTTAAAACATGCTTGAGGATATTAGCACGCAGCATGGGTTGTAAATACAAAAGTGAAGACGAAGGCCTAGCATTGAGAAGAGAGAC
TCGATCTTTCAGTGAAGTGGGGAATTCGTTGGAGTTGACAGATCCATGTCAATGCACATATCCTCAGCTGGTGACGTTTCATTTTCATCCTTACCTTCGT
AGCACATATCCTGTTCAGGAACTCCAAAATGTTGATTTTGATTACATTCAGCATCAATAGAAATCTCAGGAATATCATCCAGCAAGCTACTAATGTCACC
ACAGCTGGTGAGGATGTCGGAAAAGTCACCATAGCAATCATGTGTTTCTTGCATCAAGTAATTTGTGATCCCTGTATGTACTATATTTCCTTCTGCTTCG
GACTTTCTAATATGCCCCTGCTGCATAGCTACTGCTTTGTGCTTGGCAGTCCAATCTGGGCGACTCCACAGATACAATGGAGGGGACACAATGTTCCATT
GGTCCATCTGCTGGTTATAAACATTAATTGATCCTGGCAGGTAAAAGGACTGGCATAACAAAAAGAACTGCGTCATATCATTTGTAAGAGAAAAATCAGG
CAATAAAAATCTTTCAATCTTTTGCACCTTGCCAGCCAAGATAACGTCATCTTCCCAAATCAAATCATAAGGATTCTTTCTTTTATCAAGTCTGCAGTGG
CAGAAGATTGATAAATCAAGTGGTAAGCAGAAAATAACTGAACATGCTACTTTCATAATATAAATCTTCACCTTTTTGTTTCTTTTGGAACAGTAATAAT
TAGAAGCTTCGGTCTGAATGTGAGAGCTTTGCTTATAAATTCATTTGCCGTGGAGAAAGGGGGATTAAACCCCATGATCTACTCAAGGCACAAGATAAAA
TGGGTTATTCAAAACAATGTCAAGTTATTCAAAGTCGAGCGTTTCCAACATACCAATTTGGATCCTTCTGGCAAGTCTCTTAAACCAACAGTCATCCAAT
CCCTCTTCTCAAAGTTGAAATCATTCTGGAAAGTTGTGAAATTTCAAGAGGTTATTCATTAACTTATAAGACAAAATTAGACAAGACACTAAGTTAATGA
ATACAAAGCAAACAATCTTACAAGGGCAATGTGGACTTAAAGGAAACAGAGCAAAAGTGGGATGAAAGTTTCATATTCGTAGTTTGCGTGAGAAGTACAC
AAGAGGAGACTTAACATAGGTGTACATATGCATTAACTCTATCCCCTCCCTTCCCTCTACCATTCAATCTATCAAAAAATGTCCAAGACAACCTGTTTTT
TCTTTAATTTATACAATAATGGTTCATAATGCCCTAATAGTTCAAGCAATAGTTGCAAAATCAGCATAAGATAATATAAAATAAAAAAGAGTAATATCTA
TATCAATCTCCAGAAACCAATACATGCATGCTATTGTGAAGCATCAATGCATACAGATTATTTAGTTAAACAACAGTCTATAGACATAAACCTAAACAAT
GGACTGTATTACTCAGGGAGTTCAGAAAAATTGAAGATCTGATAAGTTAAAAATTAAAACCTTGCTCATAATGCTTTCATAAAAAGGAATATGTATGGCA
ATACTTTCATAACTATATGAAACTATTGACTCTCCAGCACCTCAGATGTCGTGAATAACTTGTATTAGATAGTAATGTGCTTTTGAGTTGGCTTGACAAA
CTAAATACTCCCTAGATTCTGGTGAGAAGATTGAGCTTTAATCATGACTAATCATAGTCTTTTTCATGAGTCAAATTATTTTAAAAACTCGAGTTGACTA
GGTTAGATGTGGTAATTTCAGTCAGATTTTAAAGCAATATTCTTAACAAGCAAATCTTCTCACTTGATGGAGCATTACAAGTGGCGATAAACCTAATTGT
CAAGGATGGTCGGTGGTCCAGAAGTAGAAATAGTTTACCGTATTGGTGACTTCTCGTATCTACGAGGCATTTTCCAAGTGAAATTGGAGGATCTCTCTGC
TCAACCTATTTTGTGTCTGACAACACAAACTGAAGCTAAATAGTATTGACACACGTAGAAACTTCACCATGCCCTAAAAGAATAACTCATCCCTCAATTA
CCAATGATTAAGAAAAGACCACACCACATATTTTCATTCTCTTTCATCATTCTAGTTACAACCCATCACGTTTTATTTGCGTAATAATATACCACATGCT
GGTTATGGAGTGCTACGTTGTAACATTTGGTTAATGAACAAATCTTAAGGTATTGTACGACTGGAGCAAAAAAGAGTAAAAGACTAGCAGTTGTAACATG
AAGGGCCCCTATTCTGACTGATCCAACAACAATCACACAAGAAGAGTTGATGAAAGAGGAAATATTAGGAAAAACTCTAATTTACTGTGTTTTACCCAAA
AACAAAACAGAATTCCCAGCAGGAATCTGGTTCACCTGTAATTCAGATAATCAAAATGAAGGTAGCTGATATGATTGTCATGAAACAATTTACCTTTGTT
TGTACAAGATCAAAATTTCTGAAATGGCATGTTTTCCCCATTCTGTCTAGTTCTTCTTTCATCAAGCAGCTAAAATCATTGGATCCACAGCAAAAATCGA
CTATCTGAACAGGAAACACCTCAGCATTCAAGGAAGTATGTAAAGCTGCAATCCTTTGAACAAGATAAGAGAAGGAACAACAACAACATACCAGTATAGT
CCCACAAGTGGGGTGAGGAGAGGGTGTGGTATTAACAAACCTTACCCCTACCTTTGTGGGGGTAGAGAGGTGGTTTTTTTCTGATAGACCCTTGAAAGAG
AAGGAAGAAGAAGAAACCAAAAAAAAACAAAAAAACAAACAAAGCAAACAAGTGCATGAGAAGAGATGTTCGACTGAAAATATCAAAGGTTCGAGAACAA
ATTTATCGATGACAAAATTGAAGAAGTAAAAGAATCTGTTTAACTGAATTTGTAATCTGAATTTTACAAAAATTGGCCAGACTGAAAATTTTTGGAAATT
CAGAAATCACCTTTTAAGTCAACAAATACAATTTACATCCTCCACATCAAAAGTAAAAAAGAAAAGATAGGCAGGTTTTGATGTTAATACAAGAAGAGAG
ACAAGAACAAGGAAATAAATAAGTAAAAGTAAAAAAGAAAAGATAGGCAGGTTATGATGTTAATACAAGAAGAGAGACAACTACAAGGAAATAAAGAAGC
AAAAGAAAAAAAGAAAAGATAGGCAGGTTATGATGTTAATATAAGAAGAGAGACAACTACAAGGAAATAAAGAAGCAAACTCATCAGGATTTTTTACCGT
GTCACCATCTTGCACATACCATCTTAGTCTGTCAACCACCTGCACAAGGATTCAGCCTCTAATTTGCATAAAAACACATAATAAGTCTGATACCATTTAT
AACTATGGGCAACAAAAAAATAGTGGGATAGAATATAATGTCATGTGCTGCAAGTGCAAAATACAAGTAGGTTATACATTAAAATATAACGTAGGCATTT
GGGAAATTTTGGTTTAAGTTGAAAAGGAGTATCTGGAAGTTGAAGTTGTGTTTGGATTTTGGAAATGAACTTTATCTCACAAAGTATGTGAAAGTCGAAT
ATTTGTAGATGGAAACCATTATATCACTTTAACTACTCCTTAAACTAGTATTTAAATACCATACCGTAATTTGAGGAGCAAAATTCAAAATATTCAAATA
CTGATGGTCAAACAAGTATTTGCATTATGACATGTTTCATCAACTTAAATGATCAGTTTGTGGCGTATATTCTTACAAAACCGATTTGCAGCCGTAGTAT
TAAGAAAATGTGAATCAAGTTAGGAGCATACATTGTATACATCCCTACTAGAGAGGGAGTACTAAAAATGTTAATGTACATTTTATACCAATGTTATCAG
AAGTACATAAAAGCTCTAAGGCCTGTTAGGGCTTTAAGTGCAAAGAGCAAATAAATGTGGGCTTTAATGAGAAAAGGCGAAAATAGAAAGAAAAATACAC
GCAAATTTATGGAGTATATAATTAGTCCAAGACTAATAAGTATAAGCAATGAATAACAAATATATAGACAAAGAAATTTAGAAAAAAAATCCAATAAAGT
GAAATAACAATTGCTTAGTGTAGCCTCTTCAGGAGACGCTCGTTTGCAAGGTAAATTTGTCTTAAAACCTTAAAGACGACACTGAACAACATCCTTAGTG
AGGTGAGGCAAAGCGCTCAACATGTTTTGAGTAAATTGAGCCTCACTTCTGTGCTTAAGCGTGCTTTTGACAACACCGTTTTATATTTCCAACTTGAGAG
GGAGTTAAGAAAGTTTATGTTTGGAACAAGTAAACAAGCTAAGTGATCATTCCTTGTATTGGAAATGATTTACAATCCTTGGAACAGTGTAAGTAGAAAT
AGGAATTATTCTCATATCCATTTCTGGATTACTTGTAACCATTGCAAATTCCCAACTTGCTTGAGGGAATAATTAAGCTATTCATTCCCCAATACTTCAT
TCTCTTTTCTTTATAGGTCATTTGGTAGAGTGCATTAGAAAAAATAATGCATGCAATAGCTTTGTGTATTACTTGTACCTTGTTTGGTACACTTTTTCAC
CTATGTATGCATTTGTACTACACTCTAATTGATATTAAGGTATGTATAACTAATATGGAAATCCATTAAATTAGTAATGCAAAGGGTTTTAATGCATGCC
ATGATTAAAAACACAAATGCCCCTCAAAACCTTTTCCCCATCCTTTCCCCATATTTGAGGAGGGTACTTTTGTAAATAAATATTTTAGAAATTATACAAT
GCATGTTATTTTTAATACACCAAACCAAACACTGCATGAGAAATAATCTAAGCATAACTAATACAAGCCCTTGCGCATACAAAAAGATTCCTAATTATCA
TGACATAATCATTACATATTCCAGACAACATTCGTAATGGCTTTTGCTTCTCCATCAAATAATTTTGTCAACAGTTTACTTGTAGAAAAATATTTGCAAA
TACTGATTGGCCATGAAATATTGGTTTCTAGTGAAAAATTATTTGAAATTCAAGTAAAATATTATTTGAACTACAAGTGAAAAATTGAAATAGCAGTCTG
AATGAGCATTTCAAACGAAACTTTTCAAATCTTCAACTTGCCATCCAAGTTCATGTCCAAACGTGACTTCCACGGACCATTTTCCAACTTCAAATCCTAC
ATTTCAACTTCAACTCAAAGATTATGCAAAGCCATACTTAGCATCCATTATTCCATAAAGAGTAGAAGTAGTTTTTGGAAATAAAACTTGGCAAAAAGAG
TTTGGTCATATAACATGTCATATTTTTGGCAAAAAATAAAATCCCAAAAACTATTTTTAAAAAACTACTGTTTGGGCCAAATTCTATTTTTTGGAACTTT
TAAAAAATTAAAATTTGCCTCAAACTTTTATATTTTATAATAACACCCCAACATTTATTAATCCCAACTTGACAAGCTTGAGAAACGCACCATGAAGGCA
CTCGCTCAACTTATGTATTGTATTAATGTTTATGATGTGTTTGTTGCTATCCGACTCTCAAGTATGTAATGGTATTATTCCATAGAACTTGTTAAAAGCA
ATGCAAAGATTGGAGCTTATAATTTATGAGTTTAATTTTTATCACAGAACATGTTCATCATAAAATGATAATACAAACTTAAAGAGTATTTTTAATAGTT
TTTAAAACTTATGGATATAAATCATATTTATTTAAGTCAAATATTTTCCCCACATGGTGAAACTTCACCCAAAAATGACTGGCCAAAAATATTTGGGAAT
ATATGACCAAACACTAGCTTAATAGCTCTCTTGACTTTCAACAAAGACATAATCATCAATAATTCTATTACAATATTCTGAATGATTATCTTGACTTTTA
TTTAGGCTTAGCCAAATGACAGAGAGTTTGAGATTTGTTATTCTTCTACATCATATTCGGAAACTATACATCTCTATTTACTTTTCAGGAAGCACTTTTG
GTAAACCTTGTTAGAAAACTGAAAACATGCATACAAAATTCCAGGGTATTAATCTGCTTCCTCATGAAATGTTTCAGGTAGCATTGCATCAAATACAAAA
GCTATGACGATGGAAGACAGGGTTGACTAGTATACCGGCTTTGTTGAGTTTGTTTTAAAGTTGCATCGGTTAGAAAAACTCTGAAGATGTAAGACAGTGT
TTACTAGTGAGATGCAGCGATATTATCACTCCCATTGAGATACAAGATACAACAACATATCCATCAAGATACAAGATCTAATAATAAAATGCAAAAACAG
GACATACCTCCTTCAGTTTGTCCACCTTCGTGAAGTGGCGACCAAAAGACGTATAGCGCATCCCATTAAGAAAAGGGGCAAGATAAGATCCAAGCTTCTT
CTGTAACATACAAGAGAGAAATGAATATTTGCAACTCATTCATCAGATAGTCAATAAAAAAAACCATTGAAGGCTCAAATACAGCTTAATAATAGAAATG
ATTGGCAAGTCATTTGATAGAGAATGAAATGTTGAGTAGAGAACGAAGATTCATAAACTACAGGAACTTCCAGTATCCATAATTGAGAAGGTATGTGTCT
AGATTTTCATAGCATGGTCATATTTGATAGGTAAAGCAATAGATGCAAAAGGAATCACCAATTACACTCTCCAGTAAAAAAAACTTTTTGCAATCAGTCA
ACACTGCCAACGAAGATTTTTTAGCTGTATTTACCAGCTATTCAAGGTAGAAATAACAGTCTCCAGTACAGAAAGGATAACCATATCTTTGTGTAGGAAT
AGGTTATTAACACTGAGATATATATCTAGTATATTGTATTATGTAAGATGACATGACATACTAATACAAATCTTATGGTGCCGATTCTCCAAATACTGAC
ATACAATAGATTCTTCTTCTCACACCAATAAGATTGAACTCTTGAAAATAATTAACAACATTTGGTGGAACTAAAAAACTTAATTGTTTGTGATATACAA
CTTGTTGTGATGCAATGCATGCAAGTATAGAGACTACCTTCAAGTGCATGAATTATTTGCCTAGACTTAGCAAGAAACGATCTAGACAAAATCAAAAAAG
TGCATCAGAAAGAAGAGCTAGTAATTCTATTCCACGAGCTAATGAAGGAATCGGGCTCCAAGCATGCATTAATGCAGGAACTTCCAGCAGCTGAGGCAGA
TTTTTGGTTTAATTTTTGGACTAGGTAACAGCTAGACCATCAAAGGGGGTTATTATATTTTTGCACAAAATAATTTATGTTATCATGGAGACTGTTAACC
CGTAGCTACGACAGCATCTTGCTAATCACATGTGGAAACTTGTAGAAGTGCATTAGAATTCTGTTGGTGCAATTAGTAAGTTCAATAATCTAATATACTC
CTACAACTAGATCACCACCATCTAAGCAAGATACAAATCTCAGCTGTTGGTTAAAAAGAAGTAACAGAGGTACTACATTTCTATTGATATAGTTCACTTA
GCTCCAACAAAAAGATGTCACTAATATGAACCGACTCTCTTTCTTGAAAATGGTGTTTTGTCAAGTATTTTTCATGGGCTTACATTTACAAAGAGAACTA
GGCCTCTTTAAGCTTTTCCAGGGCTGATTTAAATCCTAAAAGTTTTTCCTCTATCCTTTCTTTCTGATCCAAGTATATATGATATGTCATATCGACACTC
CTATTTTAGTACTATTCTTGTAGTTTCGTGTTCTTCCACTTATGTTACTATTTGTTGTTTCTTGTAGTTCGATTGTAGGATTATTGCTGTAGTATTGTTC
TACCACTATCTATTGTTTTTGTTATTTTCAATTCCTGTACATTCATTACGTCTTTTCTACATGGTTTTTGTCTTGAGTGAGGGCCATTAGAAACAGCCTC
TCTACCTCATCTCTGAGATAGAGGTAAAGCCTGTGTACACCCTACCCTCCCCAGACCCCACTCTGTGAGACTACATTAGGTATGTTGTTGTCATATTGAC
ACTCCTCTTTCTTTCAGAATTGTTGGACATGACATGCACTTCCTATGTTCTACACTCCTCTTTTTTCAGAATTGTTGGACATGACATGCACTCCCTATGT
ATCAACCCAACCAGGAAACTTACTGCACAACATAGCGTTAATTTGTGGAGCATGAAACTCGTCAAAAATTTGATCACAAAATAACACATCAAGTCAGGAG
CAAGAATATAGCTATATAAAGCCTGTGTTTATAGGTAAGAACATTTTAGGCCCTGTGGAGCAACCTTCCATCTGAAAATCTGACTAAGAATTTCTGGCTC
GCAGACAGCTTTGGCGTCTTCAATGCTGCATCCTTCGTCTAGTTTCCTCAACGCTACTTGAATAGCCTGGTCCATAAAATAAAGAGGAATGTTTTATATA
AAAGAAAACTGCAGAAGAAATATGAAGAAAAACTGATAAAATTCTCTTCAATACTGAACCAGTAGATATACCTTTACAGAACACTGAACTTTTCCCAAGG
TAATGGCCCTGTCTGTGAAATTCTTTTGAGAGTTACTATCTATACATTTCCGATACTGCTCATTCACAAATTCCTCCACATTAAACGAAGAGGTGGAGTT
TTTAATCAAAGTCATCACTCTGCAAACCAAGTATCAAATGCAAAGTAAATAGGTTAACCAAATGCATTAAACATCCATTAAAAGTATATCTTGGATGGAA
AACGGAAGGATGATTCAACTTTAAGAACATGATGAAGTCCATTGAGTACCTCTTTTTCATTTCATTATCAGCCAATTGCTGTGTAATGATGGTCTTCTTC
ATCACAGGCATAACTGGACGGACATTCACCGTCTTGCCACTAAAAGTACTTTGTGGGGCACAGACCAACTTTAGTGGCACCTTCGATTTGCCTCTTTCCT
GCGTTGGAGGCTTCAATTGTTTTCCTGACATAGATGTAAATTTTTAATATCTTTAATAGACTTAATAGCTTTGACCAATTACAGAACAAGAGCTTGTATA
AGCCATGTAGCACCTTTTCCATAAGAATCACCAACTTCAGTAGCACTGTGACTCGTCTCAAAAGGCCTTTTCATGTGCAGGAAGCTTGTTTCAGTGAGAG
CACCAAGAACCTTACTCCTTCGTGAGAGCATCCTCACAGGTCCTGATGGAAGGCCTGAGGATTGTGAGTTTGCTTTCCCATCAATATGTGGAAACACAAT
ATGGTCCCTTTTTGGAGTCCCAATTTTAGGAATGATCTTGTGGTCCCTGGGCAGAGGTAGGTTTTGGTAATTCTTTTAACACATAATAAGAACATGAATG
GTTCAGGATTCCTTGAAGTTGCAGATGAAACTTACATACAGTATATCAAGATACGTCTGGGCAAAAGATCATTCCAAGCCCTTTTCTGGATGTTTTTGTC
ATAATGGGAGGCCTCAAAAGAAATGCATCTTAGAAAAGTCAACAAGAAAACACAAAACATGAGATGCCAAATACTTCTGTCCTCAAGTATTAATGTATTA
TATAATCAAAGCACTCAAAATCAAGACAATAAGATCAAGGAAACCTTGGTAAGCATCTGCGGTGATATGCCCTTGGACAGCGTCTACAAATTGCAAATTG
CAACTCAAATTCCTTCTTATCCTCCCCTTGCTTGCAGACGGAACATTTATGAGCAGGGCAAGTAAATGATTCTCCAGCTACGATTTCCTTCTGCAGCTCT
AAGGATCGACATTTATCACCCGGATAAAGTAACTCTGAGACGCATTTAGGATGAAAGAAGTGTCCACAAGTTGCCGAAATGCAAGGGAAGACCTTTGGGA
AATTGTGCAAATTAAACGTAGGTGAGCAATTCGGATATCAAAATAGAATAACAGTGATATGAAGAATTGGGAAATATGTAGAAGAAACATATATCAGTAT
CTCCAGTATTATCCAATTCCCAATTCGTCCATATTCTGGAAATCAGAAATGGCTCTGGTTAAACTGCAGAAACTCCAACCATCTTCTAGTACTCTTCATT
TGAGCAAAACACAGATCAGATAGTAGAAGAATAACCATATTCTATTATATGAAAAAAAAAATTCATTCTTCCAGAAGGTAGCATGTAGTACCAGTTTCAT
GCTAGCACTATCCAGTGATGAGAAATAGAAGACAGACGTACTCTGAGGTGACTACCTGCTTTAATCCTAGCATACTCCCACCCACATTTCCCATCCGATT
TCTCTCTTGATTTTCTGCATTTTTAAAAGAAAGTGGTTTCCTGCATTTCTTTAACCCGTCAGATCTGGTTTCTATCTCTCCTCATTAGAGAACCATTTTT
CCTTAAACCTGATCAATTCTTCCGTTCAATCATCCCTCCAGCCTATTTGATATTCTCTCCTTCTACAGTTCTACTTAATAAGCTTCCCACAAGCTCCCTC
CACCTCACCAATACTCCAAAATCAGCCTCTGGACACAAGAATGAAGAAAAATGACATATGACACTGTTGCAAGTTAGATATAGAGTCAGCTCAAATTATA
CGAGATTTGAGTCATGTGTGGATTCAGAAAATAGTTATTCCACAGATACCACAAGAGAAACTCTTGTCTTAGCTTGTATTTGGACATATGATATGAAGTC
ATGATTTCAAAACAGCTGGACATGCGATTTGGGATCATGATTTCAACTCCCAATATCCCCTAAAAAAACCTGATTTGGATTCCACATCATGATTTCAATT
TTTTAAAAATGTAAAACTTGACGCATAAGTTAGTTGTTTTTTTTTAAAAAAAAAGAAGACTCATGTGCGCCGTGAAGAGACTGATTGTACCTTGTGAGAG
GACTTAATTGAGGATTATATTAAAGCGTAACTAGTTACTACTATTGTTGACTAGTGGATCTATATAAAATTATGTGTATTTGGAAGTTTGTAATCACCAA
ACATTTATTTATAAAGGGAATGTGGAGATATGTGATTTATTAATCCGACATATTAGGATATTCCAATATCTTGTTTATGAACTATGGTTTGCTCATTTGA
TAAGATGCGTAAGAGTTGGAGAGACTTTGATAGTTTTCACAACTTGTGGGTTTTTCATGTTTATGCAAAAATACAACTTAAAAAAACCAAGTTCATGTGT
AAACAACACTTCAACTTCAAAAAAATGATTTCATCTCACACGTCTAGTCATGCTGTTATTTACAATGAATAATCCAGTGCATTATGTTGACATTCTAACA
CAGAGAAAACTACAATATCCCCGCTAAGGACTACAAAGGAAAAAAATTTGAAAAGACCACTTTGGAAGTGCTTAACTAGAAATGTAGAAGCATAATGCAA
AACCAGATATTAAAACTTCTCAAACACTGTCTAGGGATGGTCCAGGGACACTTGGAAAAATGCAACAATGAGTACGGTAAAAAGAGTACAGAATAGGAGA
GAGAAGCTACCCCTTCTCTCCACTCTCCAATAACTTGCCTTTTGTCTAGATCTAGCATTTTCTTTAATGTTTAAAGATTTTTCAAACATGTGCATATGTA
AAAGCTCTGACAATGATTTGAATCATTTGATAGACTTAAGCATGTGAAAAACATGTTGTTTTACTATAATGAAATATTTATCTTCCTCGTAAATTGATAG
GGGATAGGGGATGAGTGATATAAAACAAGATTGAGTCATGAAATAAAACTTTCAAACCCAAAAGACATTAACCAAATGAAGTGAAATAAAATAAAAAAAC
AGAAACACAGTTTATTCGGTAAAATCAGTTTTCTCAACAATAAGGACAGAACTCAAGCAAGTAGGCATTGTCATTAAAAATTGAAGAATCAAAGGCCCTA
AAACTGAAGTGACTGGAAATGTGCTCAAGAATCACAATCTTTGTGGAGTGCTGTGATCAGAATGAAGCATGGGCAGATGGATGCTTGGGTTACCAAGGTG
GCAAACAATCCTTATGGTGTAACTGTCTGTAGATCCATAAGAAAGGTGGACTACTTTAAGAACCATACTGTCATAAAAGTGCATGATGGCAACAAATCTG
CCTTCTGAGAGGACATATGGTTACGCAACAGAATTTTTTTTGGAGATACTTCCAGGCATGTTTGATTTAGCTCAATAACATGACAGAACTGTGGCTGACA
TGTTGTCTCCTCGAGGTTGGGAGTTAATTTTCAGAAAAAGCTTGAATGACTGGGATATCCAAAGACTGCTTGAACTCTTAAAACACTTGAAACCTTATAA
GGGCTAAAGGATGGGATGGACGGACTATGGTGGAATGGACTCAGAAAAGGGGTTTACAAAGTGAGTTCAGGGTAGAAGACTCTTGACATGACCTTTCCAC
TAACCAAAAAGTGGCCATGGAAACAAGTTTGGAAAGCCAGAACACCTCTGAAGGTAGCATGCTTCTCATGGCTGCAAGCAAAGAAGATTGTACTGACCCA
TGAAAACTTGAGAAAGAGAAATATCGTCTGAGTCACAACTCACAACAGCTGTTTATGTGTAGAGACAGTTGACATTTGTTTTTGTACTGCAGAATTGCTG
ACCTACTATGGAAGATTCTCATCAATCTCAGAGGCATACATTGGACAATACCTAGCAAGCTTGTTGACACTCTCTCTAGTTGGGAGGAAGCTGGGATTGG
TGCAAAGAACATGAGCTACTGGAGAACCATTCCAGCTTGTATTTGGCAGACTATTAGGAAGAAGAGGAATGCCAGGTGTTTTGAAGACAGAAGTAGAGCA
TTACAGAAGATTAAAACCGACTGTATTCTGTTATTGTGTTTTTAGTGTACAAAGAGTAACCCCCCCCCCCCCCCCAGCTGCAAAAGCTATCCTAGAAGTT
ATTGAATCTAGCTAGAATTGTGGAATTTTCTGTTTTAACTGCTTACTTTTTGTAAAGGGGGTTTCAGTAGGGTTTATAGTACAACGTGTTACCTTCTCGA
AATAAGAGGGAAAAAAAGGGACTTACAACATAGATTTGCAGAATTTTGTCTTCCAAGTCAAAGAAGAAAATTAGAAAATTTGGCATTTTGTTGATTCTAC
ATTTAAGATTTTCATGTGTATAAAGGGCAAGAAATTCAAACCTCTGCACAAGTTAATTTGTCAGAAGACCCCAACAAGCCACAAGCAAAACATTGGTGTC
GTTGATATTGGCAATTTCTGCACAAGAAGGTCTGGATTGCCTGTGAAACAGCCATATGTTAAAACCTATATCTTATTGTTAAAATGGAAGTCACATGCTG
AAACTTTACAAACAACCAAGATTGAAGCACTTCCTACAGCAGTTGGATAAACCCCTCAAATGATGACAAAATATAAAGAGAAGCAGCAAAATTTTGACAA
ACCAGGTTAAGGAACAAAAATTTCAGACTCCTACTTGGTGATTTCTGTAAGAAAGAGATTCACAAGAAGATTCAGCTCCAGATTCCACGGTCGGATGGAA
AGATCGTATGCAGCGGCCTTCACAACTGACAAACAGCATTCAGACAGACAACATTAAAGCAATACAACACTCTGCAAACGTTGAAGGACATATACCATAG
TTTTTCCCAAACATCTTAGGATTAAAATCATACTAATGAATGAAGGTAAATCCATGGGATAATTCTATACAAAGAACGATTTATACAATCCAAAGGCAGC
AAGAAAAAAGATGATTCCTTTAAAAAGAGTTCAATGATGATCTTTTCCATTAGCCTCTTTTTTCTCTAACATCTTTAAGCTTTAGACAGGAGTCAAATGA
TTTAGTCCAATATAAGTTTTAGTTACTTGTGTTATGATCTCAGTTAATTAGATCAGCCCAGCTTACTTCTGAGAGACTATGTTGCTCGGACTTGGGTGCA
GGTGTCCGGCATGGGTGCAGATCTAGAGGTCGAGTCCTTCATGATCTAAATTTTGAAATTTGGGAGCACCCAGGGTATGGATATGGGTGTGGACATTTGG
TTAAAAGTATTTCAAATATTTTAAATGTTGAGTTATTTAAATATCCCTAAATTATGGTGGACTATTCAGAAGGAATGCACGAATTATTGACAGCAAGTTT
GAATATATAATTATTATTGAGTACAAAGGCATCTCCTTGCATAATTTTTAGTGTAACATGGCTACTGCAAATGATGTAGAGGTCATGATGGGCTTCTTAA
GTTCATTGCATATTCAATAATGATATTGACGTAAATATTTTTAGAGCACTTTTCTGATGCAGACCTTTAAATTGAAATATCTTTTAACAATAAAAAAACA
TATGTCTAAATTATGAATTCACCTAGCTTTTGTTTTGATTTCAGAAATAGTTGCATATTTCTCAATCGATTTTGTTCAAAGTACCCAAAATCAATTGATC
ACATCCGTTACGGATCCCACACCCATGTCTGGTCAACAGGATGCGGCACCAAAAGTGAAGGGTCCATGCTACTTAGCTCTGAGAATGAACTAACAGGAGT
AAAGGACAAATATCAATTTCTCTTCATATTTCTTGGGTGGAGGGGAAGGGAAGTATAGTGGAGGCTAGAGATCATAGACTTGAAGAATTATTATTTGGAG
TTATGTTCCATAGCATTCAATTGGGACTAATAACTTCCCCTTTAAATTCTTTTGGAGGGTGGATCTGTGAATATTGGGGAAAGGTTAAGTGTTTGTGTTG
GGTTTTATTTGCCCTAAATTTTTTACCATAAATAGGTTTTCCTTGTAGGAAAAGGTTTTGGATTGACTAATCCTTTTCTTGTAGGAAAAGGTTTAGGACT
CTATAAATAGAGGCATGTTCCTTCTAACTTAATCAGCATTCACAATGTAGTCTTAAAGGTTTTGAGAGTTTTGGTTAGAGGGAGAATTTGTGGGTCACAA
ACTTGATACGTTATCACTTGTGTGAACCTCCCATGTATTCTGAGTGAATTGGTTGAGGTTGTTTCTCTCTGTATTTTGTACTCTCATATTTATAGTGGAT
TGCTCATCTCCTTTGTGGACGTAGGTCAATTGACCGAACCACGTTAAATCTTCGTGTCTTTTGGTATATTTCTCGTTGTCTTTTTTACTCGTGGTCTTTC
GAGGTTTGCATTGCTAGCTTCCGCATTTACACCTGCTTATTTCCGGTCCTAACAAGTGGTATCAGAGCCAGATTCAATGACGGAGTCAGGTTCAGTGGTT
CGATAATCGATGATTGAACCAGGTTAGAAAGATGTGTTCATCTTGGCGGTGTAGTTCTAGCAGTAACCTTTTTTGACAGTAATGAAGATTTTGTTGGAGT
AATTGTTTCAGAGAGATTCTTTGTGTTGAGACATAAATTTTGCAAAGAAGATTATGGAAAGGAGAAGCAAGTTGTTGAAGATTAAGTCGAGAAGGTGGAC
AAATTTATTTTGTCAAAAATTTAGGCCAAGGGGGAGATTTGTTGGGTTTTATTTGCCCTAAATTTCTTACCATAAATAGGTTTTCCTTGTAGGAAAAGGT
TTTGGATTGACCAATCCTTTTCTTGTAGGAAAAGGTTTAGGACTCTATAAATAGAGACATGTTCCTTCTAACTTAATCAGCATTCACAATGTAGTCTTAA
AGGTTTTGAGAGTTTTGGTTAGAGGGAGAATTTGTGGGTCACAAACTTGATACGTTATCACTTGTGTGAACCTCCCATGTATTCTGAGTGAATTGGTTGA
GGTTGTTTCTCTCTGTATTTTGTACTCTCATATTTATAGTGGATTGCTCATCTCCTTTGTGGACGTAGGTCAATTGACCGAACCACGTTAAATCTTCGTG
TCTTTTGGTATATTTCTCGTTGTCTTTTTTACTCGTGGTCTTTCGAGGTTTGCATTGCTAGCTTCCGCATTTACACCTGCTTATTTCCGGTCCTAACAGT
TTGGTGGAATGAATCCAGTCCTATGTGATGTAGAGTGGACTTAACCACTAGGTAACAAATTCCAACATATCCAACCAACAACTTACTAACATTAAACAGA
TAAACTAGTATCAAGGAGGAAGGGGAAATTCCAAAGGACCTAAAATTTAGTAGAGATTTGTAAGATCAAATTTTGTGAAGCTCCAAATCTTGAGCAATTC
TATAAGCAACAAATATCAATCACGAGTCGAGATACATGGAATTGGAAGGATAGAGAAATAAGTCTAACCCAACGAAAATCATTATACAATATAGCCTGCT
AAGGAGGGTGTGGTTTACCCTCACTTCTTAGTCTGGAATCCTAAAGCACCACTGCTTTGAATGGTTTGCACTTAGAAGCATGAGAAACCATCTTCACAAC
AGAGAAATTACACGAGAAGTAGAAAGAAGGTTTAATGTTAATGTTAATACGTGTTGGGGTGGGGGGATCAAGAGATGTCAGCTATTAATTGCTAGCATAT
TGATTAAGGGGTGTCGCTTCGAACCAGTTCAAAACTCAATGGGTAACGAGGGTACAGTACAGTCTCCATAGCTGGAAATCAGAATGATAAGAAGGAAGAA
ATAAAGCATGGGATATGCCCCTTTGCCACCCCTATAAATTATCTCTAAAGAAAGAAATCAATGGGTATCGAAGTGATTTAAGTACATCCAAAAGTTGCCT
TTTTGTCTTCTAGCAAATTTTGGGCGCATTCATGAGATTACAATCAGTATAGATGGTTATGCTCCTATCAGAGAAATATACCTCTGTTTGAGATTTTTTT
AAATTTTGTATATATACCTAGTAGCTAGTACAAGGGATTTCCCCCTTTAATATCAATAAAACCATTAACTAATAAAGAGAAAGGAAAAAAAAAGCAAATG
ATCATATGATGTACGCAAGTTCTTCCTAGAGTCATGGGTAACACTTCTTGAGTTATGTATAATTTTAGCCCGTCTATGTTTAATGTTTACACCTAGATAA
GATATAGAGAGATTATATTGGAAATGTTGAGTTACCATAGAAGTTCTCCCCCATCATCACAAAGAGCACAAACATGATCAAATTGTTCATCTTCAATTGC
ATCATCATCGCCACCACTATCAGCATCATTATTGGTCTCAATAATAAACCGGGGTCTCTTTTTTGCTTGATTGCACTGCTAGACAAGTCACAAGTAAGAA
CTGATAATTCTTGATTAAACATAAAATGAGATAACATATAAATTGCATCTAACCTCATAACTGTGTATCCTCTTTCGTGATGTCTCCAAAATAAATGCAT
CAAAACTCTGTTTTAAAATATAAATTTCAGTACAGAATAATGCCGGAAATGATAATGTATATGCACTGAAAAAGCAGAAGCAGGTGATAGCACAACAAGG
TAGGGCATTAGCAACTACAAGAAGAACTAGTTCAAAAGCAAGTAAATGATACACCAGTAACCGACACTCAAATAAGGATCAGATAGTGATACTCATGCTT
ACTACACTGAAACATAACTTAAGCCTCATGACTCTAAAGCCATCAAGACTTCGACAAATGAGAAGAAATCATCATGTATTACATATTTGAACATCAGACC
TCATGATTTACAAGCCATTTCATTGACCCACTAGGATACACCCTTAGGTGCAAAACTCTCTCTGGTCTTACAGAAAAGAGGCATACTTTGAAACTACATT
CAGCTACCTACACACCAAAAGAATTAAATAGCTGTGCAGAAAGTCAACACGACAACAAACATGTTATACCAATAACTAAAGCATCACAACCTTGGAATTA
GATAAATCTTTATCCCTCCTTGCAGCTTCTTTGATTGTTGGCATGTGCTCTAGTAGATCATCTTTAGAAGGTAGTACCTCATATGCACTAAAAGAACTGA
CTTAGTAGATTCCATTATAACCAAATTTGGCAACAAAACATTTAAAGGATTTAGGTGTGACTTTCAGCACCTTAAACTTTTCTCAATGTAATTCCACACA
ATCCCTTCTGGGTTCTTCTTCACAAAGTGGAGGAAATGAACAGTGATGAGTACAGATCTGATGGTATCTACATAACCATTTCGGGGTTTAAGAAGTTTGA
TCCAGATTTTATCTTTGGAGAGCACATGAATTTCTGGCAGGGCATAAGAAAGTTCAAATCTCCATGCTAGAACCTTCTTATAGATGGGCTGAAGACCATC
ATCTGCAGTTCCACGCAAAAATATCTCTGAGTTCAGTGCCCCAAGTTTGTCATCCTCACCCCACTGAAGAGGCAAAATGGAAAATGAAGCAACTCCTCCA
TTGCTATCAACAAAATGGTAATTGGTTATGCAGTTGGGAACAATTTCACCCTCTTCGTCTGATGATGCCATGAACAATAATTTTGAAGTGTCTACCTATT
TGTCATAGTTAACAAAAACTTGCATCAACAATAACACATTATTAAACAGTCACATACGCTATTTATCAACAACAACGACATACCTAGTGTATTCCCACAG
ATGGAGTTCGGGAGGGTAGAGTGTCCCAAGACCTTACCCCTATCTCATGGAGATAGAGAGGCTCAAGTAACACATAACAAGTCAGTTCGAAAAAGACAAT
GCAGAGGTAGAACAAAAAATAACATTTTAGCGGCTAACAGTTCATCCCCATGTGTCAAAAGGATTTCTCTTACTCATATAACAATTTTTCATGATACATT
AAAGACAAAAAAAAAACGAAAAGAAGAAGAAGAAAATAACAAAATCAAATAATACCAGAATTAAAAACTTACACACAGACCTAATAACAGTAGGTGAACA
CAACAACAGATAAATGTGTAGTTCAGAAAATAGCAAAAGACAAGTTTTACTTTGTTCTCTCTACAGCTTCATTCTCCAGAATAACCCAAAATCCAACATT
TAATCCAGAAGTAGCACCAACATTTCAACAAAATGACTGCAATAAACTGAAATGTTATGTATCATTCAAAAAGAAAAAAAATCTCAAGTCATTACACCCC
AAAGCCCTAACTATCAGCATTTTTTTTCCTTCTTTCCAAAAAAATCCGTTCATATGTATCAACCACGCAACATAATATACTACAGAAACCCAGTTCACAA
ACCAAAAAAAAATGAAATATGCATGATAAAATCAGTGAAAAAATACAGCGATGACTTGAAGAAACGAGAAAAAACAAAAGAGAGAGATGATATTCAAGTT
CATTTCTTCCATAGAAGGTGCAAATTAAAGCATAATACCTGAAGTTGATAACCTCTTTTGTCCAACTTGTGAAGAGAAAAATGATGAACCAAATAGAGAG
AACAATTAACACAAACGGGGGGTGTGTTTGATCAACGGTGAAGAAGCAGACTGACAGAGACTTTCACAGAAAGGAGCAGTTGCTTTTGCAGAAATTTGTA
TGTACTCCTCATTATGGCAGATGCACGTATTACTGAAAAATGACCAAAAATGTCCTTCAATTAATTAAACAAATTTAGTATCATTCATTAAATTTAAAAT
ATTGTTATAAATTATCATAAGTAACTAACTCAAAAATTCCTAAATTATTTAAAAATTTAGAGTCATCCAACTTTCAACTATCATGTAAACTATTAGTAGT
ATTTTTATTTTATTATACTATATAGAAAAGTGTAGAAACAAACACGTCTTCATTAGTACGTTTGCTTCTAGCCGAGGACATAATAAATTATGAGTCTATT
TCACTATAATATTTATTATTATTAGCAATTTAGCATTTCAAGTAAAAGCTGAGGGAGGGATAGTTTATGAACACGTAAAAGTAACTAGAGTGAATAATTT
GATATGAATACTTTCTTTCATTTTTTTATTTGTTAAATTTTTACACGTCTATTAAGAAAATAATGGTTGATATAATGAATTTATCATTTTAATTCTATTA
ATTAATAGGATCTCAAATATATTTATGGAAAAAGGCTCAATTATGTTATTGAACTTTTAGAAAAAGGCTCATTTATGTCGGTTAAAAGTTTGGCTCATTT
ATGCCATTACCGTTAAAGAAAAGACTCATTTATGCCATTATTTTTTACGTTAGTTTTGCAAAACCATTTTTGATATGTGACCAATTATAATTCGTTCACG
TCATAAATTTATTTTGATAAAAAAATCATAATTCTAAAAAAAATTAAATTAATTTTTTAAATTTTTTAATTAAAAATACAAAAATTCTGAATAAAAATTG
AATTGTTTTTTTATTTATTTATCTAATTAAAAAATTGATGAAGTGACCGAATTATAATTGGCCACGTGACAAAAATGGTTTTGCAAAACTACCGTTAAAA
AAATAATGGCATGAATAAGTCTTTTCTTTAACGGTAATGACATAAATGAGACAAACTTTTAGCTGATGGTATAAATGAGCCTTTTCTGAAAGTTTGATGG
CATATTTGAGTCTTTTACCTATATCTATTCATTACACTCTTCAAAAACTTAACATAATGTTAATAAATCGAGGATATAACATGAAAAAGAAAATTGTTCT
TCCGTAATTTGTCAAAAATGGCAAGTATAAAGGGACGTTAAATTAGGAAACATTGGACAAGTAAAAAAGGACATGAGAGCATCGGTAAAGATAAACGGTT
ATGAATTTACTATTCTCTTCATTCATTTTTACTTGTCATTGTTTAACTTGGTATACACATTAAGAAAACAATTATATATTCATATAGGTATTTAACATAC
TCTCCCTATTAAAGGATGTTTAGTTAGGTCTTGAAATTTGATTTGAAAGATAAGTATTTAATATTGAAAACGTGGAAGAAAATACTAATTATTTTTTCTT
AAAATACCAACAGTGAAAAAAAAAATTATTTTAAAAATAAATGATGAATAAAAGGGAAACGGAGTGTGATAATAGCAAGTCTTTAATTTCGTAATACTAG
TAGTACAGTATACAATTTTGAATTGAAAAAGAGGCAGACAGACAATAGTATACTAACATTTAATCCAACTATACATGCATCATATTTAATCCAACTTTAC
CCTCCCATCAAATGTTAGTAAAATTATACTTCATATATAATCCAAATTTATCAAACAAAATTCAAATATGGAATATTAATACTTACTTTAACAAATTGAT
TAAATATTTTTTTTGGTTTTTCATTTGATTCGGTAATTATATTGGAGTCTGATTAAATTTAGATTTATCCCGAAAAGTGTCATATTAGGGATAAAGCGCT
TCCTAATAAAGGTGGTTTCCTATCCAAAGGAACTCAAATTCGTGACCTCTTGACTAAGGATAAAAGAATACTTACCACTCTATCTTAACTCTGATTGACA
AATTAATTCAATGCTCCTTCTGTCCCTATTTAGTTGTCCACTTTAGAAATGACACACATATTAAGATAACAATAATTAGCATAGTGAAGTTATAATTTTA
CCCTTATTAATTATGGTTTCAAAAATGATAGATTAAAACTTGAAAATTTCCAAATTTAAATGAGGGTATAATAGGAAATCTTTTTTTGTCCTTTCTTGAT
TTGTCAAAATGAACAAGTAAATAAAGACAACTAAAATAGAAAATATGGATAAATAAATAGGGATAGAGGGAGTATTTAATTACCTAATTTCTCGCCTGAT
TTTCATATATAATATACTGCATATGAATATTATTTGAAATTGTGTGTTCAAATTATGTATGTGACATTTGGTATCACCACACAAATCATAATCAGGATAT
GAGAATATTTTTTTCCTAGATATAATCAAGTACTCGGTCTAGATCAATCAATCCTCAACATAACAAATAAGGTGATCAAGTAGAAAAATAAGTTTTTTTA
ATAGTAAAACGAGTTGGGGCTTATTATAGATGTGACACTCAAAGAACTCAAGATGTTGATGTCAATATAAGTTTTAAGCATAAATGTTCATACTATCAAC
ATAAACTTAATGCATATCATGATTTCAAACATGGTAATTATACCAGAACACGTTGCAGAAAACATACCTAAAGCATACGCATTAGCATACAAAAATAGAA
GTTTTAATTGGAAATTGATTTACCTTCGTGCCCGGTTTAAGTACATGTGTTCACTCTATCACATAAATTTAATATATATCAGATATTAAATGAGAATCTT
ATTAGAAATTGTTGCAAAGAACATACCTAAAGCATAAGAATTATCATACATAGATAAGTGAAAGGTTTGACTGAAAAGCGATTTCTACCTCATTACCCTA
ACCTTACACTACTAGTGGATTGTTAGTGATGAAATTGTGCAAATAATTATATGTGATAACCCTAAACTTAGAGTTGTCAAAATAGGTTGACTCAACCCAA
CCTGATCCAATCCTAACAGGTTAGAAAGTTAAATGTGTTAGGACAGGCTGACCTTTTTAATTAAAAGTCTATAAAAACAGCAGTCCAACACAACCCTAAA
CAGGCCACAGGTTGAAACGGGCTGTCCGTTCAACCAAAAATTGAGCAACATTGGTGTCTTAGAAAGGATATCTAAGAGTTTCAAGCGTTGATATCTTATT
AACACGACGTCAATACATACAAAAATTCATTTATGAATTACGCGCTTAAGTGAATACTTACAAAAATACATAACACACAAGATACAACATCCTAAGATTC
ATTCGAGCAAAAAATATTACATAATCACTTTTTTCATAAACAAGACAACAAAGGAAAATTGAAAGTTAGGTATAAAAAAAAAAGTAAACTTGATTTTAGT
GGGCTAATGACCCTAAAATGTAAAAGATATGCAAAGGAGTTAGACTTCATTTTATATTTTAAAAATATTTGAGCCTACGAGGCTAGCAGGCCAAATGAAG
CCGGCTAGAAAACATCATTCCTAAATGAACCAAAGAAACTAGGTCCAACCCCACCTAATTTAATGGTTTGGTTGGACCGACTTAACGAGTTAAACCCACT
TTGACAGCTCTAACCATAATGATGGAGGGAGGATCAGCTCTAACCCTTGTTATGGGCTTTACATTAATTCAGTCAAACATAAAATAATAAAAAAGGGAAA
ATTAGCAATTTATTTAACATATCTAACATAATTAGTCAAAAACAACAACACTATAAAAATTTATTTAAAATATCAAAATTTCAATATTTTACAAAATAAT
TATATTCAAATATTATTATTTATTTTACACTTTTTTACACCAAAACAGTCCATCATTGAACCAAATTCTAAATCAATAACAAATAAAAAAGGAAAAAAAA
TATCAATTTATCTTATTTCCCCATCATTCATGTTGATCTTCCCCATCATTCAATTTTTATATTTTCTCTTTCTTGAAATTTCTTGGCAGGTCAAGAAATA
CAAATTATGAATGGTTCTTCTAATTTTATTGACAAATCTCTAATTCAACTCAAGAAATATCTCAATTGTTAAAGGTAATTTCAATTATTTAGTGATATTT
ATGTTGATTTTGTTTTTGAAAACACTGATTATATTGTATTTTGGATTTTATATGTTTTGAATTTTTCGTCAATTTTTTTTGTTCTTATGTGAATTTGGTT
AGATAATCATAAAATATTTATGTGTTTCAGATTTTTAGTTTTTTAAATAAATTCTTTTCAATTTTCTTGTCATTTTGTTTTAATATTTCAGATTTAGTAG
AATGTGAGTTTGGTTAGATAATCATCAAATATTTATTTATATCAGATTTTTAGTCTTTTAAACAATTTCTTGCGAAAAACATGATCAAGGCCAAGGTGAA
GAACAATTTTCTATTAGTTTGTTTTGTATTTATAATTTCTTTAAAATTTTGTATTATTTCTCCAATTGTATTCAAACCATTATGTATGCTTTTAATATTT
GTTATTTATTCAAAATCTCATGTTACATAGTCCATGAATCTTGTATTTGTTCTTAATGGTATTCATCATAAAGTTATGCTAACTAGTTATGTATTTTATT
TATAGGAAGAACAACTTTCTATTAGTTTGTTTTGTTTTTATAGTTTTTTTTCTTAGGAATTTTGTATCATTTCTCAATTCGTTTTCAAACCACTATGTAT
GTTATTAGTATTTATTATAAATCTCAACATAGGTTATGAATCTTATATTTATTCCTAATATATATTCATTCCAAAGGTATACCAATTAGTTATGTACTTT
ATTTAAGAATGATCACAAAAAATGTGCATTTATTGTTTTTCAGTTTTATTTTCATCATTATACAAAATATAATATAAAAACTAGAATGAATACAAATACA
AATAATATTCCTATTGAGAAAAATTTGATTTAAGAAAGGAAAAAATTTTTTGAAGAGAAAAATAAATAAACAACGAAAAAAATACATGAATAGAAATATA
TTTCTTAAATAACTAAAAATCCATTTGACATACCTATTGGAATGAATACACCTATTGGAATGCATACAAACTAATCAAGAAATACAAGTTTCATTATACA
AAATAAAACATGAAAACTAGAATGAATACAAATACAAATGACATACATATTGGAATGAAGGATTTAAGAAAGGATACAAAATTCTAGTAATAAAATAATA
CATTGTGAAAAAAGTATGTCAAATAACATATAAAACTGTAGGTGTTCAAATTTGTAAATTTCTAAAAATCAAATTTAATAGGTAAAACTCTAAGGTATTA
GGAAAATACATAAATCCCCCCCCCCCCTCCCACCTATGCCTGAAATTCCAAAACACACTTATACTATAATAAGGTCCTATTATCCCCTGAATTTATTTTA
TAAATAATTTTATACCCCTTTTAGGCCTACATGGCACTAGCATGAAAAAAATGTCAACACGCGTTGGGCCCACAAGATAGTGTCACGTAGGCCATAAAAG
GATACAAAATTATTTATAAAATAAGTTCAAGGGGATAATAAGACCTTAATATAGTATGAGTGTGTCTTTGAGATTTCGGACAAATGTTGGGGATACTTGT
GCATTTTCCCAAGGTATTATCATAAAGTTTCATAATAATAACTAGTTTTGAAAGACAAAGAAAAGTTTCATAATAATAACTAATTTCGAAAAGACAAGGA
CAAATAATGGCCTTTGGAAGAAGGAAAAAATCACCTATTTTAGGTCTCATAATCTTTTGTTAAGAAAGTAATGAAAATATTTAGCAATTTAATCTAATTT
GAAATATTTTTCCCTTGATTTCCCCTAGTTTGTTATTTCTTAATTATATTATGTTAAGTTAAATAAATAAAAAATAAATATAAATCAACCCATAGCAAAC
TAAAATATTTCCATTTTTAATAAATATTGAAAGTATTGCTAATGGATCCTATTAAATGTTAAAATATTGTTGTGTTGAAAAATTTCCCCCCCAAAAAATC
CATCTTTCTTCCACTTGGCTCAAAGACCATGTAACACTAATATTTACTGACATATTCATTAATTACGGATAAAACACAACCCTAATATTATATCCATCAT
AAATATCATGATATGACAAAATATTAATGTGAATTATGATGGTTATAGATAATTTTGGACTTTCCTTTCATACATTACATAACAACTTATTATACTAGGT
TCATAATCTATAAAATATCTAAAATTATGGTCCATAATCATGTCTAATTGAGGCTTATCTTATAATATTCCTAAACAATAATATGCACATTCTTACGAAA
AATAGAAATTCATCAATGTATATTAGGGACACATAATTGAGCTCAAGTGTCAGAACATTATAAGCACACCAATCTTGAAATCTTTGAAGTTGACACCTTT
TGTTTCTATATCTTCTATTTAATGACAAGTAACATTTGGATTCGTCAAATACTACAGAGTAACCATCATAAGATTCAATGACTTATGATGTCGTTGACAA
TTTCATGTTATGCGGTAACGTTTTACAGTACTAATTGAAATTCAAAAGGGGGTGAATTAAAATTTTTGTTGATCGATTTCCTGTATTGACCAGTCAACTC
ACTTGCACGTTAGTAAAACAGATATATAATAATAACTTATAGTAAGTAAATAGCACAAAATGCTTTTCCACTGGTTTGAATCACCGATGTGGTGCCTAGT
CTAGTCCCCTTGGATTTCAAGGGTTCCCTTTAGAGCTTTGAAGTGAAGTTGAGATGTACAGAGTTTCCTTGGTTTGATCATGTCTGATATGCAAATCAAA
AGTTCTATATTGACACTTCATCTACTTGTAAACCTACACTCAAAATCTTTCTTTGTCTTTTCTTTTCAATTATTTCACTCAAGTGATTACAAAGCTTTAT
GAAAGATAAAAGAAGATTGCTCTATAAGCTCAAGTGAAATTGTGTGCCTTTGTCGTTTGACCATTTCTTCATTTATATGCTGAGTGTTGAGGTGTCTCTA
GAAAAACCCAAGGGAGTTTTCTTCAATCAAGATTTTTTTATGATTCTTTAATTGAGACCTTGATTTGATATACCAATTTTAGTTCTGCCTTGAATCAGAA
ATTGGTTGGTGATTTGTGCAACGCTCCTTTGTATCCTAATTAACTTTAGTAATTAGTGAGTTGATCTTTTTTGATGTTTCTTGCCATCTTAAGTTGTTGT
CTATTTTCTTTTTCTCCTTTTTGGATTCTGGTGATTGGTATTGATTGACTTAAATTGATTTGTCTTTTCATTTTCTTTTTGGCATCTGATAAATGAATAT
TTGATTTATGTAGTATCCATTTATACTCCTTTGATGAAGGTGGTATGATCTCCAGATTTTCTGTTTGAATCACTTTGTTGGTTTATCTTATTGTCTTCTT
TTGTAGACATCCACAAATTTTGCTTTCTTTTATTTCCTGACATTATTCAAAATATATTAAGTTAGCAATCTCCCTTTTTTTCGATAATGACGACTTTATT
AGAAAGCTTTTAAATTTACTTTCCTGTTGTGACAACTGCCTCTTTGAGAAACAGAGTAGCTGAGTCGGATGAGATGCGAGTGACCTTATGTGCATCAACC
TATTGTTAAATGAACTCCTTCTTATAGCACTTATCATTTATCAAAACATATCACATGCTGGCAAACGTGCGTGTATCAGAAGTAGCATCAATAAAAGAAG
GTCAAAAATAGAATAGATTCACTAATGAGTCAACCATGATGCGGGATATCAACAACCCATAAGGTAGATGGGAGGATGAATCAGGATCCTCAAGGTTCTC
CACCATGTACTCACGAAATCATAACACCCAGTTGATACAATATTTTTTCAACAGAGAAAAAATAACATACACATCTCAGTTGGAAATGTTGCTAAGAGAT
CCCTTTCACGGAATTAGAGTATTAGCGACTGTATGAGCCAGAATACAGTTATCAACACCAAGAGATAAGGATCCAAAGTTAGTAATATCAGCACCAGTTT
CAAACACAAACAATTCCGCATTTTTCAAAGAGATTTCAAAGTTTTCCGAACCACATATTGCCATGCATGAAGGATATCGCCAGAAAAATCAGATCCAAAC
ACATTATTAAACAAAGAATCATTTAAAACAATGTGATTACCCAACACAATAGTCTCCCATTACCACTATCAGCAGATACCCGAAGGTTAGCATAACACAG
ACGAACATGTTTCTCAAAGAACTCAAGGCCACAAAGATAAAGTAACTTAGATATTTTCTGAGCACGAAAAAGCATACTTACAACATAATGAGATGCTCCA
ACTGCTCTAGATTGACCACCCTTCATGGTATAATAGGACGCCTGGAAAATGTCACAAAACAAATTTTATGCTCTAGCCCCTAAAATCGCAGAGAGTCCTC
ATCAGTGAAGGAGTCGGGGAGAGCAAGTCATGCTTTCTTGGAGACTTCTTCTTCGCAATAGATGGACGCTTTTTAGTCGAGGAAGAAAGACCGATAGAAT
CAAATTCTGAAGAATTAGAAGATAGTTAATCTCAAATGAACTGGAATGAGAGGCAGAAATATTTTTACGAGAGTTCATTGATCTGGTGCAAGTCATATTG
AGAAAAAAAATAATGAATAAAAAGGGGAAGAGATGAAAAGATATAGAGTGGGGAGAAGAAGGATGAAGATGAACAGGAGAAGGGAAGATGAGGAGACGTT
TGAATTGGAAAAGAAAGACTAGACAGAAGAGAGAGGGTTACAGAAAAAGAAAAGTCCAGGAATTTACAAAAGGAACTGATATCAAAGCTGGCCATAAATA
GATCAAACAATTAAGATTAGTAATAATTACAAATAAGATTTTTCTTTTATAAAACCATTTAAAAAGGCGCTTTTAATATCCATTTGAAAAAGTTTAAACC
GCTTGTAAGAGGCATATTTTAAAGAATTCAAATTGATTCTAACTTTGCTACGGGAGCAAAAGTCTCGTCTAGTCAATACCTTGTTGTTGTGAGTATCCTT
GAGCAACAAGCCTTGCTTTATTTCAGAAAACTTTTCCATCTTTATTCATCTTGTTTTGAAATATCCATTTTGTTCTGATAACTGAGCAAACTTTTGGTCT
TTCAATAAGAGTCCATATTTGATTTCTTTCAAGTTGATAAAGCTCTTCTTTCATTGCTTTTATCCATGATTCATCTTCCATAACTTCATTTATTCGTTTT
GGTTCTATTTGAGATACAATAGCCAGGGAGGCTTTCTTTCAAAGGGAAGATTTTGTTTGGGTTTTATCATCTGGTTTTCCAAGAATGAAGTTTTTAGGAT
AGCTTGTATGATGTCTCCATTCGATGGGGATATTAGTTTTGTCGACTGGAGTAGTCGACTCCACCTTTGTAGTAGCTAGATCTTCAGTATTAGTTTCAGC
AATGACCTTTAAGATAATTTTAGATTGATTGAATGAGGTAGTTTCATCATTACCAATTTCTATTTCCTTCATTCGTGGATTAATGTCATCAAATACCACA
TGTACAAATTTTTTAGAACTTAACATTTTTTTATTAAAAACTCGAGAAGTCTTGCTAGATAGTGCGCCTAGGAAAATACTGTTATCACTCCTTGGATCAA
ATTTACCAAGATTACTCTTACCGTTATTGTGGATGAAACACATACAACCAAAAGGATGAAAGTAACTGATATTTGCTTTTTTCCCTCTCCATAGTTCATA
AGGTGTCTTCTTTAGTATAGGTTTGATGAGACACCTGGTAAGAATGTGACAGACAGTACTTACAGCTTCTGCCCAGAAATGGTCTGGGAGATTTTGACGA
GTAGCATGGTTTTTGATGTATCACGTAAAGAACGATTCGTTCTTTCCAATACTCTGTTTTGCTGAGGTGATCTAGGTGAAGAGGAGTTTTGAGTGAACCC
GTTTTAAGCATAGAATTCTTCAAATGCCTTATTCTCTAATTCACTACCATGATGACCGTGGATAGTACTGATGAAATAACCTTCTTCTCTTTGAATTGTT
CTACAAAATGCTTCAAAATTTGTTAAAGTGTCATATTTGTAAGAGAGAAATATAACCATGTAAACCTTGAAAAGTCATTGACAATTATAAAGCATACCTT
TTACCTCTAATACGAGCAGATTGGATAGGACCAAATAAATCATATGAAGGAAGGATTTGAAGAGGTGATACACTCAAATTATACTTCCCTAATGAAGTAT
AAGCGGTCGTATCAAGGGTTAGGTTGGGGTCGATCCCACGAGGAAAATGATTTAGACTTAACTTCAATCTACTATTACGTCTATTTAGTCAAGTCCTTTC
CAAAAATAATTAATTAAAGGGGGGGTTTTGTGTAACAAAAATGTTTAATTATTTCTAAGGAAGACAAATAGCAAGTTTATAACTTTGGTGTTTATCAAGT
GATGAGAGAACTAGGGTATAAGTGTTCCCATAGGTTCATAACGTGTTAATCCTAGCTATAACAATTCTTTCTTAGTGTCTTGCATGCAAAGTGGTAAGTT
ATGTATCCCTAATTCCTTTGTCCGACAACTAGAGAATTTCACTCCGTACCTTGGTCTGGCTACGTGTGTCTACTTTACTAAACCTTACCTTTACCTCATA
TTAAGCATCATGTTCAATGTATGGCTAAGTTACTACTTTGCACCAATTGAAAATAGCATATTAGATTGTGTATACTAAATCTATGTTGATAATTCTTTTC
CTATCAACTACCTCCTTGGTCCGAAAAGTAGAAATAGGGCAAAATCTAACGCGTGCACCCGTTAAAAAGACTTCTAAATGAAATAATTATCAATACATGC
AAGAACCTATTCTAGAATTGTTATTTTGCTAGTTTTACCTTGTTAATTACCAATGGTTCCCACACCCTAGTTGTGGATTTAGTTACCTATGCTTAGAAAT
ACACAATTCATAGTTATTAAACAAGACTTCATGTACTTACTTTGACAAGTTTTAAGACAATCCAAAAATCACACTTGAATTAAAGAAAATATCTTGAGAA
TTGATTCCGGAAATTTGAAGTAATTCCCAAAATCCGAAGTTGAACTTCCAATAACAAGAGTATGAAAAAAAATAACAAAAAGTGTAACCCCAAAAATGAG
GTTTTAACACTATTTATAATAATATAGTCCTAACAAGAGTATGAAAAAAATAACAAAAAGTCTAACCCCAAAAATGAGGTTTTAACACTATTTATAATAA
TAAAGTCCTAACTAAAAAGGGGTTCTAAATAAGGAAAATTTGTCCCAAAACGCGTCTTCAGTCAATGACCCAACTGATGGTCCGTCGATGGAACGACGGA
CCATCGACTGCCTCTGTCGGTCCACACTTAACTTTTTCTTCAGCCTTCACTTTTGCGTCCTCTCTGTTACATTCGACGGACCAACAACACGGTCCGTCGT
CTCACTTATGGTCCGTCTATGCCTCCGTCCTTCCATACTTAGTAATTTCTTCAAGTCGGCTACTGGGAATACTCTTTGTTAGAAATGACGATTTGCCAAG
ATGATCCGTCGATCAGTTGACAGTCCGTTGATCCTTCCGTAGACCCACACTTGGTTAGATTTCCCCGAGTTGCTTCCAAATGCTTGAACCTCCAGTCGAC
GATCACCTACAGACCGTCGATGACTTCGTAGGTCATCACTTCTTCACTGATTTCAGCACAGTCTTCTGCATTTCCGTTTTGGAGAGCTTTCCTACAAACA
CAGATAAAAATATATAAAAATTACTACAAAAAGTCTTATACACACACTAAACTTAAGGAAAAGGCATTGAAAGTACCGTCGAAACAACAGTACATCAACA
CCCTCAACTTAAATTCATTCTTTGTCCTCAAGCGACGCACTATGACTCACCACACATAGCGTTGATGATCAACAAGCGGTTGGGTCTGGTTGCCCAGAAC
CCGCTCTATCAGTAGGAGGGACACCGTCAGTACTGTCCGCAGCAATGTCTGCACCCTCAGTGGTGCTCCTCTCAACATCCTCATGTCTTGATCTAGACGT
CCCAACAACCAACTCACGAATCCTTATCTGTCGGGCTTCCTCATCAACCAAAGAAGCTCTCCTTGCGGCCTCAAATTCAGTGCGCTCCCTCTTCCTAGCT
TGAGCCTCATCACTCTCTCTGGGTCGTTGTCTCTTGGCACACTCACGTGGCGGGGAGGTTGGCACCTCTGTGGTTTGGAATAGTTCACTAAGAGCCATAT
CCTCAACAAGCTTCGCAAGTGTGGCCTCAGGCTCAGGTACTCGCACATCCAGTATAGCATCCACATCAGCCCTCGGATTCGCCACAACAACTTGGGTAGT
CGTCAAATCAATAGTAGGGGTTGGTCGGTGAGAACTCTCAACTCAAACGTATTAAGGGGCTGGTGACTGCCAAAATCTGCCGCTCAGTCTGCTGGGCAAT
CTTTTTCTCGATTCGATCCTCCGCCTCAGTAATGGACTTTTACTCCAATGCTGGATATGATGCAACAATGTGGCTATTTGGGTCTCTAATTTCTGGACCC
TAGCAAGTGGGACCAGTGCTGCTGATGATGTAGAACGGGAGGAACTCGAAGGTCTGCTAGAGCCCGAGAAAGACTCGACCGTGGTGATGTCGGTAGGCTC
TGATGTCGCCTGATCATCCCCTTGGGCTTGCTCTACCGTGCTCTACTCTGGGCCCTCTGTTGGGTGCTGCCTCATTGGCCTCATCCCAGATGAGATCGAT
GTCAGCTGTCCCAGTAAGAGTCTTGAGAACATCAATGTGCCAAATAGGTACTCCAGCAGACCTGTAGAACTCAAAAATCATACAGGGAAAGTGGTCGAGG
CCTTAAAGTCCCTCTCATGTATGACTGCCAGCAACAACCTCAGAAAATCCTCCTCTAACCCCGCAACCATAGCAGCTACCAATACTGCTCTATCCCATGT
CAGAATGTTTTCAGTATCAGTCGGGGATAGGTAGTGACAAACCAATAGCCAGATAAACTTGGCAGCAAATGTGAGGTTGACCTTCTTGATAAGGCCTCTG
GGCTCAAGAACCCTATCAGCACCCTTACGATCCACAGAAATGTGCTGGACTATCCATCTATCTGTGGTCTCTCTCACCACCTTATCTCGCTGGAAGTGGT
CCTCCTTAATCATCTTTCACCGGTAGTCAAACTCGGGGTTTAGGGGCTCCCTGGTAGTATCTGTATCAGCACCGTATAAGAAACTAGGAGGCAGTGACTA
CGCCGGACGCCACCTTGGGCGTGTCGGTGTTCGGGTGCCTAGTGGCACATACTCAAGATCAGTCTCATCGTCTGATGAATTAATCACCAGCCGGCTTGGA
ACGTCCTCGGGAGTAGACAATGTTAGGCTTGGGGGCCATTTATACATGCAAAAGAAGGTTACTAGTACCAGCGTAATCGTGCAACACACTCAAAGGAAGC
AAACAACAAAGGTGGTACAGAAAACACAATCAAGTTCAGAACTGCAGAACTGAACGATGGGTACTACCGACGGTCCGTTGATGGAATGACGTTCTGTTGG
TAGGGTCTGTCGCTGGACACCTAGAAAAGTTTAGAAGTTATAGTTCTACAGTAGTTGCAGTTAGAAACGACGGACATGCAGAACGGTTCGTTGATAAAAC
GAAAAATCGTAGCAGTCCACTTGGACAAAATTTTGGGAGCTTCAGAAAAAAGGTTTTGTTACAAATGATAGATGTGCAGGACAGTTCGTTGAAGAATAGA
CGGACCGTAGACCCCATCCGTCGGTGGACACTTAGAAATTTTTTTGAAACCTCCAGCAAACAGGGTTCTGTTAGAAGTGACGGATGTGCAGGACGGTCCG
TCGATTTCATCGATGGATGTAGATCACATTCGTTGTTCCAGAGTTTAAAAAATTAGGTTGTGGCTATCGACGGACCCCATCGATGGTCCGTCAATTGACC
GACGGTCCTTAGACGGGGTCTTGTACTATCGGATAGAGTCAGATTTGTTGCCATCCCCCTTTGCACTCCACCCATACACAAATTCAAGCATAATACTTAA
ACACATGTTCTATAACAATATACACATCATTTCATCATTTGTAGGGCTTTGATTATTTCAATTTTAATCCTAGCTTCTAAGATGCTAACAAGCCCTAAGC
CGGAAAACAACAAAACACTTACGCAAGATCATTTAGACACTAACACCGCAACCTATTCACTTTCCATCATTCTAAGGGACTAGGGACCAAATTTTAAGAA
GTTAATCATGCAATTTCATCCCCAAGTCAAGACCCACATACATGTTTCATCATTTTCGCATGCTGTTGAAAGAGTATTCAGTGAGCAAATGAGAGCAGCA
TACTTGTAGATTGTGGTGGAGTGAACGGGAGGATGAAATTTGTAAGACAACACCAATCCCATTCGAACACCGACCCGAAAATTGAAAGAAAAGGATGGGA
AAGTTTGGGGAGAAGGGTTTGGGGACTGAGGGGATTTAGAGAAGATGGGGAATCAGAAATTTTAGAGTGTATGAATGGTGGAGTTATTGGGGGAGTTTAA
GGGGAAAATGGGGAGGAAAATTGTTTGGGAGGGAATTTGAAAAGGTGTGGAGTAACTGAAAGGTTTGAATTTATTATATAGCCGGCCGGGTCAGGTCGGT
TCATTGGATATGAGGAACGTACGATTCCCCGCCGAGGGACCATAAGTCAGTGGACGATCCTTCGACTGTGCCCTATCTTAGAAAAAATTAAAAATCATAC
CTGGGATCCACGGATTCATTGTCGATCCATCGATGAGACGACGTCCCATCGATTGGTTCGTAGATCAGTGCACAAGACCAATTTTTGCAGATTTCCTTAG
GTTTGGTCCCTGCACATTGAGCACCTAATAAGCCATTCTTTTTGTATTTTCTAAACACTTTTTAGATACGGATCCTAGACTACTCTCTAGCCAACACTCT
AAAAGAAATAAAACAAAAAATACACACATGATATTAAGTAAAAATCGAAATAATGCAACTATTCCTATAAAGACAAGAAAAACCTAATGTTGGATAGAGG
ATACATATTGGGTTTCCTCCAAATCAGCGCTTGATTTAACGTCGCAGCATGACGCAAGACTCTTGATTACTCCGACTTCATCAAGATGGTATGCCTTAAC
CACTTCATTCACATTTTCCACATGCCCTAGGTAGATTTTAATTCTTTGCCTGTTTACATGCACCTTTCGTTCTCCTTGTTCTCCAACTCAACCACACCAT
GAGGGAACACTTGAGTGATCAAGAATTGACCAATCCATTTAAACTTGAGTTTGCCCGGAGACAAGCACAACCTAGAGTTGAACAAAAGCACCAAATCCCT
AGCCGCAAATTCGCACTTTTCAATCTTTTGGTCATGGTACTTCTTCATTTTTTATTTGTAGAGGGCTGAACTTTCATAAGCCTTCAAGCGAAACTCATCA
AGCTCATCCAACCCATTTAATCTCTGTTCCACAGCTTCATTCCAATCCATCTTCAGTTTCTTCATTGCCCACATGGCCTTATGCTCTAACTCAACCGGCA
AGTGGCAAGCCTTCTCATATACAACTCGGTATGGAGAGATACCTATGGGAATCTTGTATGCTGTCCGGTAGGCCCAAAGAGAATCATCAAGCCTCCTTGA
CCAATTCGTTCTGCTAGCTAGCATTCACCGGTTTTGCCAAAATTTGCTTGATTCTCTGTTTGACACCTCAACTTGCCCACTAGTTTGAGGATGGTAAGAA
GGGACTATATTGTGACGAAGCCCATATTTCTCCAACAACCCTTTGAAAAACTTGTTGCAAAAGTGGGATCCCCCATCACTAATTATAGCTCTAGGGGTGC
CAAATCTGGAAAATATGTTCTTTTTCAAGAACGCGGTGACACGCCTCCCTTCATTGTTTGCAAGTGCTATGGATTCCACCCATTTTGACACATAATCAAC
CTCGACAAGAATGTACTTCATCCCATGAGAACTCACAATAGGGCACATAAAGTCAATGCCACACATCAAACAACTTAATTACAAGAATGGGATTTAAAGG
GAGCTATTGCTTTCTAGAAATACCTCCATCTCTTTGGCACCTATCACATGCCTTGGCGAACTTATGAGCATCTTTGTGTATAGTTGGACAATAGTAGACA
CATTGCAAGATTTTATGGGTAGTCCGGGTAGCACTATGATGCCTTCCCACAGATGAGGAGTGGCATGCCTCCAAAACACTAATTTCTCAACTTCCGGCAC
ACAACGGCGAACAAGACCATAAGCACAACTCCTGTATAAATATGGCTCATCCCAAAAAAACTTTTTCACATCATGCATGAACTTTTTCCTTTGATGAAAG
GACAAGTCCGATGGTACTATATCACTAGCTAAATAATTTGCAAAATCAGCGAACCATGAAATCAAGTCTTGAGAAGTGGCCAAAACATGCTCATCAGGGA
AAGTATCATCAATTTCAGCCTTTTCACCCAACTCTCGCATAGCTTCATCTTTTAATCGGGACAAGTGATTGGCAACTTGATTTTCGGTCCCTTTTTTATC
TTTCACTTCAATGTCAACTTCTTGCAACAGTAATACCCATCTAATAAACCTTGGCTTCGTATCTTTCTTTGCTATCAAATATCTCAAAGCAGAATGATCA
ATATGTACTATGGATATCGTGCCAAGCAAATAGAAATGAAATTTCTTGAAAGTAAAAACCGCCGCAAGGAGCTCTTGCTCAGTCACAATATAGTTCTTTT
GAGCTTCATTAAGGGCCTTACTAGCGTAATAAATGGGGTGAAGGATTTTATCCCTTCTTTGACCCAAAACTACACCAAGAGCAACCCCACTAGCATCACA
CATCACCTCAAATGGCTTGCTCCAATCTGGGGAAATAATAATGGGCGCAGATACCAACTTCTCCTTCAACTCACAAAACGCTTTCAGACAAGATTCATCA
AAATAAAATTTACACTCTTTCTCAAGTAACTTGCACAGAAGAAGTGCGATTTTTGATAAATCTTTGATAAACCTCCGGTAGAAGCCCGCATGCCCAAGAA
AAATCCTCACACCTTTTATAGAGATGGGTGGAGGAAGTCTCTCTATCACCTCAACTTTGGCTCGATCAACCTCTATCCCCTTCTTGGAGATGCGATGACC
CAATATAATACCCTCTTTCACCATGAAGTGACATTTCTCCCAATTTAGCACAATGTTGCAATCTTCACACCTCTTGATAACCTCGCCAAGTGACTTAAAC
AATGCTCAAAGGAATTGCCAACAACAGAAAAATCATCCATAAATACCTCAATGGTGTTCTCCACCATATCGGAGAATATAGACATCATATATCTCTGAAA
AGTACCCAGTGCATTACACAACCCGAAGGGCATTTTTTTGAACACGAAAGTTCCATAAGGAAAAGTAAATGTGGTTTTCTCTTGATGTTCCGGTGCAATA
GAGATTTGGTTGTAGCCCGAATAACCATTAAGAAAACAATACCACCCCTTTCATGCAAGCCTATCCAACATTTGATCCATGAAGGTAATATGAAAATGGT
TTTTCTCAGTCCATGTATTCAATTTCCGGTAATCCATACACACTCTTTATCCGATCATCGGCCTCATTGGAACAAGCTCATTTTTATCATTAGGGACCAC
AATCTTTCCCCATTTATTAGACACACACTGAACAGGGCATACCTAACTTCTATCAACGATCGGATATATGACTCCGACATCCAACCACTTAATAATATCC
TTCTTCACTACCTCTTGCATAAGTGGATTTAACCGTTTTTGATAGTCTATACTTGGCTTATGATCGGGCATGAGTTGGATTTTGTGTGAATAAATACCGG
GTGAAATCCAATAATGTCCGCAATAGTCCATCTAATAGCTCTCTTGAACCTCTTCAACACATCTACAAGACACTCCACTTGCTCCATATTCAAATTCGAT
GCAATGATTACCAATAAATTGTCACCTTTTCCCAAGAAAACATACCTCCGATGAGGTGGTAGAGCCTTAAGCTCCAATTTGGGGCATCCTCAATAGATGG
TCTCGCAGGTGGAGACTCGCGATGCTTCATATCTAACTCAACTTCTTTAGTTTGAACCGAACATCACCTCGATCAAGTGCTGCAACCAATGACCTATAGT
CTGCAATACCATCACTCTCAAAATTCATAATCACTGCTACGAGTGCCTCAACACCAAGACACTCTTCTATATGTACCTCTGACGAATGCTCAACTATGTA
GGATATCGCAGATATTAACTGGAGCTCACCACTCTGCCTTATGGACTTGCAAATGTTGAAAGTCGCTTCTTCATTGTTCAACCTAAAATTCATCTGCCCT
TTCTCCATATCAACCAAGTTACAACCGGTAGCAAGGAAAGACCTCCCAAGAATAATAGGCACCTCAAAGTCCACCTCACAATCAAGAATCACAGAATCGG
CCGAAAATATGAATGACTCCACCTTTACTAACACAGCATGGAGTATCCCAATAGGCCTCTTCACCGTTCAATCGACCATCAGTAACCACATCGCAGTGGG
ATTTGGGCCACCCAAACCCACCTTCTTGTAAATAGAGAAAGGCATGAGATTGATGCTAGCCCCAAGATCACATAATGCTTTCGCAAAGTTTAACAACCCG
ATTGTACATGGAAAGCACCCGGATCTTCTTTCTTTCGCACAAGATACCTTGTAGCAATAACACTACAATGTTGCATCCAATCATCATCCTCAAAACTAAT
CGATCTCTTCTTAGTGACCATATCTTTCATGAACTTGGCGTAACCAGGCATTTGTTCGGGAGCTTTTATCAAAGGGACATTGATGGAAAACTGTTTGAAC
ATAGTAATAAAATGTCGATATTTGTCATCTTTGGTCTTTTCACCAATCTTTGCGAAAATGGAGGTGGTGGTCTAGGAAAGGGAGTCACTTTTTGGGGTGT
CTCAACTTCTTTCGCCAATTTATATACCAACTCACCACTAACTTTCTCTACCTCATTATCTCCTCTCTTCTCATCTTCGACGCCAGACGACATAGGTGGA
TCCATGGTCTGCTTACCCCCTCGAGTAGAGACTGCTATACAATATCTATTTTTTTTGGATTTTGGACAATATTGCTAGGAAGAGTACCCGGTTGGCATGG
GTTCACAGTAGAAGACAATTGGACCATTTGCAACTCAAGATGCTTGATTGAGATTGTATGTGCATCCACCTTTTGCCCAATATTTGCTAAATCACCTCTC
AACTCTTTGGCATGCTCATCACAAGCATCAAAACTCCTCCTCATCTTCTACAACATATCCTCAACTCGCGCCATACTACCTCCACCATCCCTAGGAGCAA
CTTCTCGATTTTGAGGTGGAACATAGGGCCCACTCTGATCATTTCTATTACCATAGTTACCCCGGTTGAAGTTGTTGTCGTGGTTGTAGTTGTCATCTCG
TGCATAGTTACCATCTTGGTTGTAATTCCCATAGTTTTAACCTTGATTTCCATGACCTTGGCGCAAATTCTGCTGATTGGAGCCTTGGGCATTCGGTCTC
CAAAACCTCCCGTCTACTCATTCACTGCATAAAAATCTTCTTCATAGTAGTAGTCATCAACCGGTGATGGTGGTTTAGCCAAATAGTTCACCGCATTTAC
CTTTTATGCACCCCCGATGACATATTTTAACACCAACCCAAGCTCAGTTCTCATTTGAGCCATCTCTTCACGAATCTCATCTACGGCTGGGTTGTGTGAA
GCTTGCAATTGAAAAGTGTTTCTCGCAGTATCTAACTTCCTAGTGCTCCAAGCTTTATTATTTTGGGAAATTTTCTCTAATTTATTGGTTATGAGCATCA
ACCGGTGGAGGAGGTTGATGGTTGATATCATCACCAACATCAGTAAGATTGTGTGGATTGTTCATTCTGCGAAGCGTACGGTTCAGTTCTGGATCAAATG
GAAGCACTATTTATCCTCAACACCGTGTATTTGGCATCCACTAGAGTTAGACCTGAAAGAGACAAAAACAAAGAGAAAAGTAAAATTAGGAATTTTTTTA
CTAAACTTCTGTAATTGTGCTTAAAGTTAATCTAAAAGTCACTATCCCCGGCAGCGGCGCCAAAATTTGATATGCTGAAATTATACTTTACTAATGAAGT
ATAAGCAGTCATATCAAGTAAAGAACCCAATTGTTAGATTGGGGTCGATCCAACGAGAAAAATGGTTTAGACTTAACTTCAATCTACGATTACGTCTATT
TAGTCAAGTCTTTTTTAAAAATAATTAACTAAGGGGGGGGGGTTGTGTAACAAAAATGTTTAATTATTTCTAAGTAAGACAAATAGCAAGTTTATAACTT
TGGTGTTTATCAAGTGATGAGAGAAACTAGGGTGTAAGTGTTCCCCATAATTTCATAACGTGGTAATCCTAGCTATAACAATTCTTTCTTAGTGTTTTGC
ATGCAAAGTGGTAAGTTATGTATCCCTAATTCCTTGGTCAGATTTCCCCGAGTTTCTTCCAAATGCTTGAACCTCTAGTCGATGATCACCACCTATGGAC
CTTCGATGGGTCGATAGACCATCGATGGCTTCGTAGACCATCACTTCTGCATTGATTTCAACGTAGTCTTCTGCATCTCCATTTTGGACAGCTTTCCTGC
AAACACAGATAAAAATATATAAAATTACTACAAAAAGGCCCTAGACAAACACTAAACTTAAGTAAAAAGCATTGAAAGTACCGTGAAACCACAGTACATC
AATAGGTTTAAAATTACTTACAATGTTTTTTACCTTAAAAGATGAACGACTTTGCTTACCCAATTGACATTCATCGCAAATTTGATCTTTCTCAAAATTT
AGTTTTTGTAAGCATATGACTAGTTAAATTCTAGATAGTTTCTCAAGATCATGCATATTTGCTTGTCCAAGTTTTCAATGTCAGATCGAAGGATCACTTG
TGACTGCAGTTAGACAGGTAAGAGAAAGAAAAATTAACATTATTTAAAACATATGTATTATTTACTCGACTCCAATGAGAGTAATCTTTTTCTCAAGATG
ATTGACAATGCAGCTTGCTATCAGATTGCATGATGATTTTTGAGTAATGGTTCTTACTCCTGTTACTTCTCCTTTAACATTGTCCCCAAATCTCACAAAT
CCTCCATCAATCTTTTTTTAACATTTAAAGTTTTGTTTCTTTCAGCACATATTTATGGAGCATCCACTAGCAAGTACCCACATTCCTTTTTTTTATAGGT
TTTCTTAGACCGCTCCTACAAAATAATAAATTAGTTTCTTTTAGGTATCCAAGTATTTTTGGATCCTTGATGGTTAGAAGTCTCTGGTCTCCAAATCCAT
TTTCCAGAAGTGTATTTTCTACAATTAAAAGATTTGTGACCAAGATCACCACAAGTGTAGCAGTTAATTTTAACGGAGGTTTCAGGTGAATAAGAATTAG
AACTAGATTTATTTGATTTGTAGAAACTGTGATTAGGAGAGTTTCTCCTATATAAAGTAGTTTGGTTAGATTGACCAGGACTGTGACTGGGCGATTTTTT
GATGTTATTCAGTTGCATTTTTATTTCCTCTAAATCTTCTGTAAGTAAGCCGACCTCAATTTGAATTGCTTCAAGAAGAATCTGCCAGTCTTTCTTTTCT
TGAGCAAGCTTATTGTATTCGTTAATAACCTTCTTTAATTCATCAATAACCATGTCCAATGATTTTTTTAAGTCATTACAATTAACACAATTGAATGGTC
TTACCTCATTTGTTTCACCTAGTTCCATGAAACATAGGTTGGTCATTTCATTATGATCATCATCAATTGTTTCTCCTTGATTTCATGCTACAGAGTTTTA
GGATCCTCGTTTCTTTGATTATTTCTTCTTCTTTGTTGATAACAATTTTGTTTTAAGTGTGCTGGTTTTTCACAATAGTAGTATCGATCATCATTTATTT
TGAAGTCGTTATTCTCTTGAGGTCTTTGTCATTTTTGTCGTAGTATTTGTCTCACTCCTCGATTTGTGAAAGTTATTCCCTCATCATGATTTTCATCGAC
CTCTTTTCTAACGTCAGGTGTCTTGGTTTTGAATGCCACCGTCCTATAATCCTTGTTGTACCTGTTAATTTAATTTTATTCATAGGCCATTAAGTTGCAA
CGAAGCTCATTATATGTCATTTTTTATATAAATATCTATCTTCAAGAATGACAACTTTGGTTTCCCAAGCCTTGGGAAGACTTCTAACAAGTTTCTTTAC
TTGTAATGCATTTGAATACACTATTCAAAGAGTTTTAAGTTCACAGACAATTTTGCTGAATCTTGAAAAGATAGATTTAACGTTTTCATCTTTGGCTATT
TTGAACAACTCATACACATTAACAAGTGAACTGATTCGAGCTTCCTTTATTTTGGTGGTTCCTTCATACGTCACTTCTAATTTGTGTCACATTACTTTTG
CGGTTTCACAATTTGATATTTTGTCGTACTTTGCTCCACTCACTGCACAATATAATAAACTTATAGCTCTAGCATTAGTTAGGATTACCTATTATTGTTT
TCTAGTGATTCCAAATGATTCAAGATTGAATGACTTTTCAGTGCCATCTTTGTCAGTTAGTCCAGGAATGGGCTTTAGACCTTTCTTGATCACTATCCAT
GCTTGATGATCAGTTGAGGAGACAAAGATTTTGAATCTATTTTTCCAATGAGAGTAATGTTGTCCATTGAAGTATGGTGATCGTGTGAAAAATTTCCATC
TTAAAGTAAGGCTCCAAGTGTCACGCCCCAAGCCTACCCCCTGGACGTGGACGGCACCCAATGTACATTGCTGACCTTGGGCAAACCCTTGGCCTGACTT
ACTCAACTCAACAGAATACTCAACTTAACTAAGTTATAGAATTGAAAAAAAATTCTCATAAATAACTTTAAATACTGTCTTGGACAAAATGACACTAGAG
TCTCAAAAATAGAATCTGAAACAACTTTGATGAATGTTGAGATAGACCCCACAACATTCTAAAATAGAAAGACTGGAAAGCAATAAAAAAGGATCCTTCG
AAATGTAAGGAGTCTCACCACTGACACTGGAGCTCAAACTGGATCAACGAAACTTTGCTGAATCTGGTTACCTGCATCTGCATCATAATACGAAGCAAGC
CAACTTGCATCAATACATTGAATGTACGAGTATGCGAGTTGGAATGCTGAACAACATCTTAAGCTTGATTAGAATAAAATGAACTTACCTGGAATCGACT
CAATATATACTCAACTCAAAGTATCAATATAAAGTAATTTAAAACACATACGACACATATATATGAAAGTGATATAGTTCATGTGGGAGTTTCTCTAACT
GACAACCAACACTATGAGCCTAAGTGGTGATACAACGTCTCGTCCACGCTACCATAACTGTCATATACTTTGTCGTCGCATAGAACATCCTCAACCTAGT
GGATCTACTGGCTAAACTTACGTTATTATCTAAAAAGTATGACCCATTAATACCCATGACGGTTACATGGTTTACATGGAGACTTGAGTTAATATGAACT
CTCATCCCCACATCGGTGCTCAATACTACTCCCAAAATATAATTTAGCTCATGCTTTTAAAATAACCTTTTTCCTCTGGGTTGAATAATTTTTTCAACTA
TTTTCAGCTTTAAAAAAGCCTCTTGGAATCAATGTTCCCTTTTTTTGTTCAAACTCTGTTGAGAAATTCTTACTTTCCTCTTAACTTAAACGTGAAAACA
TTTATAAGATTTCTAGGGAATACTTAGTTCCCTTATATCTTTTGAGAAATGAACTAAACTCTTTACTTGACTTGGAACCTTTGATCTTAATCAATTCTTT
TGGGAATACTTAGTTCCTTTAATATTTGAAGAAAAAACTATATTTTACTCTTTCTTTAAATCTAATATCAAGCCTTCAAACGAAGTTAAAACGTTTACAT
AAGACTCTTGGAAACATTACTTTAACTTCATATCTTTAGACTTGACTTCTTAACTTACTTGACCTTGATACTAATTTCCTTGAATTGAATTATTAATTCA
AGGATCATGATCTCATGTTTATGGATGATTTCATCATGTTTAGATGTACGTTAGAGTGTTGGAATCGACTCAGAAATATAGGTTCATCAATTAAGAACTA
GTGCGAAAAGATAGGGAAAGAACATGATGTCTATGTGGCCTTGGCGCTCTAAGAGGCGCAGGGCACCAAAGCTTGATGGACAGAGACTGTACTGAGAGGC
TTTGGCAGGTGCGGCGCCCCAGGGCTTGTCATACGGGATTTTTGACTTTTCTTCTTCGTTTTTCATCTCTAAACCTTCTAAACTTCCATGAATATCACCC
CAATCACTTGGAATCACTAATAACCTCAATCCCAATAGATTATATCTGAAAAGCAACACAGAAATATTAATCCAATCAACTAGAATATGCTACAACTCAA
TCAATCAAGAATCCGATAATGTTCATTAAAGTATAAATGTTCATCATTCAATCTAATCTAACTTGCTGAATGGAATCAAATTGGTGTGCGGGTGAAAGTA
CCCATCATAGAAAGATCTCACATACCTTAAAGGGATTACCCCCGACGAAATCCACGGAACGATTCTTATTCTTTGCATTCTTGAAGAATTCTTGATCTTA
CCCTTCTCTTCTCTTTTTCTCCCAAGCCCTAAGCATTCTCAACTTTGCTAAAACTGAATTGGGACGTGGTTTTACCCCTAATATACCCTTAAAATGAATT
AAGAAATAATCGGGTAAAAAGACTACTTTACCCTTACTAAATTTCGGATTGGACTTTTCTCAGTCCAACAACTCAACTTCCGAAAGGCATATCTCCCTCA
TACGACATAAAAAATGAGCATACTCAATGTTGTTGGAAAGGTCTGACCAAGGGATTCCCATCCATATAAAGAATTGCTCCTAACTACTCTCGAGCTAGAA
GTTATGGCCATTTGAAATTGTCAAAAAATCACCTCCTAAACCTAGCAAATTTTCCAGATTTTTCCTGTTCTTTCCAAAAGTAACTATTCTTAGTTTCTTT
GTTTAATCCTAGCTATTTATGATTACGAGATGTTACACCAAGGATTTGATAGTGTGTCTCTTTAGATCTTTGCTTACGTGTCGTTAAACATTGAAATGGT
GAAACCTGACTTTGATACCAATTGAAATTCAAGAGTGGGATGATTTAAAATCTCTCTTAGTCGACTTCATGTATTGACTAGTCAACTCACCTGCACGTTA
GTAAAATAGATATATAATAATAAATTGCGGTAAAATAACACAAAGTATTTTTATATTGGTTTGGATCAGCGATGTGGTGCCAAGTACAGTCCCCTTGGAT
TTCAAGGGTTTCCTTTAGAGTTTTGAAGTGAACTTGATATGTACCTTGGTTTGATTATGTCTTATATGCAAATCAGAAGTTCTATATTGACACTTCATCT
ACTTGTAAGACTACACTCAGAATCCTTCTTTTTCTTTTATTTTCAATTGTTTCACTCACGTTATTACATAACTTATGAAAGATAAAGGAAGATTGCTCTA
TAAGCTCAAGTGAAGTTGTGTGCCTTTGTCATTTGACCAGTTCTTCATCTACATGTCGAATGTTAAGATGTCTTTTGCTCTAATAGGAAAATCTAAGGGA
GTTTTCTTCAATCAAGGATTTGTAATGATTTTTTGATTGGTACCTTGATTTGATATACAAATTTTAAAAAATAAACTTAATTTCTTAGGGGTAGGGGGCT
GGTAGGGGGTGGGTTGGAGGCTGGTAGGTTAGAGGGGGAGGGAGGTTGGAAGAGAGTTTTGGAAAATGTTTTCCTTAAGTTTTGAAGGGAAATCATTTTC
CTTAAATTTGAGGAAAATGAGTTGATTTGTAAAACATCTTTCAAAACACTTAACCCAATCAAAAATGAGAAAATTGAAAAACATTTTCCGGGAAATATTT
TCATTCGTACCAAACACATTCTACGTTAACACTAATGTGTGAGTAGTGATTGCAAACATAGTATCACAAATTTTTTCTTTTAGAGTAGATAAGATTACAA
TTTATTTAACCTTTATTTCCACGTAACTACTCGTTTAATGAATGAAGATATTAAAATTAAAGAGTTACTGAATTTAAAAATATTGAGGTATTATTTTTAA
AATAAACTAAAAAGAAACTAACACATAAATCAAAACAAATAAAATAAATTATAAATAAAACAAACTGATTTTATGTATAAATAATTACATATGTTCTAAA
ATAAACAAAACAACTAATAGAAGACAACACTGGTAGCTTGGGATAAAGGCTTTGTTCCTAAAGAAATTTGGAGGTCTTAACATCAAAGAATGTTGCAAAT
GGAATATTGCTTCAGTGGGGAAACTTTTGTGGCAAGTGACAATGAAGAAGGACGTGTTATGGGTAAAGTGGGTGAATTGTGTTTATATGAAAAACACGGT
GAATATATGGGAATATGATGCTCCACTAGATTGCAACTGGTACTGGAGGAAATTAAACCCCTTAAAAACACAAATGGTGAAGTGGTATCAGGATAATAGG
TATACTCTCACTCATAATGGTGCCTACTTAGTATCTTGCAGCTATCAAGCTCTATTAGGTACACTCACGAAATTAAAAGAAGCAGATTTAATTTGGAACT
CTGTCATGCTACCACGACAAATATTTATCACTTGGCTGGCATGTCAAAAGAGGCCACCCACGCGTGAAAGATTGTTAACAATGAGCATTCAAGTAGAGGA
TGAAAATTGTTGTTTGTGTGATGAGAGGGTGCTGGAGACACAAAATCACTTATTTACTAAATGCAGGTGGACCACAAATGTGAAAATCATGATGTGTACA
TGGTTAGGGGTGCAATTACCATCCAGAGGAGTTTATGAAACAATTAAATGGTTCAAAAGGACAAGGTGGAAGCAATTTCAAAAGGAAGTTATTGCAGCAG
CCTGGGGTGCATTTTGTCTACCACACTTGGATAGTTAGGAACAAGAGAATTTTCAGTCATCACCTGGGGTTCTACGCATTGAGTTTGAGGGAAATTGCCG
AATGCCCACCCTACTTTTGGCTCAGGTAAATACTTTTAGTTTGTAAATTCTATTGGCTTTAACGGGAAGTTCTAAGTTTGCGGGGAATCCATGCAGATAT
TGAATAAATTTATTCTAGCCTAAGTACTACTGAGATTGGTTTCGTAATCTGATTGAGAAGTTGTGGTTTTTGAAAGTTTTAGAATTCTGGAGGCTTTAAG
TTTTTAAAAGTGATTTTTGTCAACACCCGAAGCTATGAGCTTTGGAATGAAATTTGGACAATTCCATTAGCTTCTAAATGCAGAATTTGGTCTAGGAGTG
TAGTCGTTTCATGTTTTGAAGTCTTTATATGGATTTGAGTTCTTGAGTTGGAAGTTAAAAATGAATATAGATCAAGATTTGAATTCGGTCAACGTTCGGA
GTTAGGACACTCAAATTGGATTTATGACGACTCCGTTGGATTCATATAATGATTTTAGGCTAAGGTTCGGTCTTGATTGAGTTTCCAGAGGTCCCGAGGG
CAGTCTGGTCTTTATGGGAAAAATTAAATTGCAACTTTAATGGGTACTGGGTCAAGGAGACTCCGAATTCATATTTCGATGGTTCCATTGCATTTAGAAC
ATCAAGTTTAGTTGTGTAGCATATCTGGTTTGTGTGCATCAATTAAGAGGGGTTGACAACACAGATAAATATAGAGACCTTTCTTTGAAATAAAATCAGG
ATGGGAGTCACTAGTCAATGATGTGGAAATGATGGAATGATAATCAAAGGATAAAAATCTTCTCCAAACTGAATCGTACTCAGCAGCGGATTGAAATGAT
TAAAGACTGCAGAAATACGGTAATCATTGAGAGGGTTTGTTAAAGCCAGTATCTTCGCAATACTTACATTAATCATTAAATTCAAATTCTCCATTAAATT
TTACTATTTTAGTGGATATTGCTTTTGATATGTAACAATAGTAAAATAGAGAATAGAGAACCTTACTGACCAAGGATAGTTTAATGTGTTACTAATTATG
CATATTAGAATTTGATATGCATATCTATGTTATCTTTAAAATCTTTGGCTGAAGTTTAAAGTTTACTTTATGTGTATTATATTCTAGGTGTTTTGATGAG
CCTCACAAATATAGGAACCCGGTCCCTGACAGAGTGATCTTGTCCATATTCATCTGGGGTAGAGCTGTAAAATTGTCAAGTCAGGTGGTAGGTGAAAAGT
GCAATGTAATGTACCAATAAGAAGAGTAGACGAGATTGTCTATTTCAGTGGCACACTAATGCAGTGATCATGTCCCTAGCAGAGATCTTTTCATCTCATG
CACAATGGGGTACAACTGTAAAGCTGTCCTGTCAGTAGTTGGTGGGACGCCAGTGTACTGAACAAATCAGAATGAAAGAGGTTGTTTGTCCATCAGTTAA
TAACTTTGTATTGTTGGTACTTTCAACATGACAAACAACATTCAAATAACTGATGGATAGCTCTATCAGTTAATAACTTTGTTTGTCCATCATTCAATGT
CCTTGTCCCAAGGGTTTGTGTTCATTTCAATATAGTCTCTTCACCAACAACACAAACATTAAGTTTTGGCAAACAAAGCATTGGATTTCAGAAAATCCAA
AAGCTCAAAAATCAAAGCCGTCTTCAAGAATTATCATCCTAAGAGCAATAGGAACCTGATAGAGCTACAAGCTATCTATTTTTCTTAGGATTATACCTTC
CATGCTTACATAGCACATCTGTTCCTAATCTATAAAGGATTCAGATATTTGTTTCGGGTTTTTAAAAGTCTAAATCAGTTAAGGTTAACTGATTTAGTGG
GCAAAATTATTTTGTTGCTTAGTCAAATTCTAAGTCATCTAGAGTTAGGTGGTTTAGTGGGCGGTGTGGTATCTGCTTATTAAAGTCTAAGTCATCTAAA
GTGTGGTGGTTTAGTGGTCAGTGTTGTATCTGCTTGGAGAAATTCTAAATCATCTAGAGTTAGGAGGTTTAGTGGGCGACATTGTATCCGCTTAGAAAAA
TTTAAGTTATATAGGGGTGGTAGCTTAGTGGATAGTGTTGTATCTGCTTAAGGTCTTCAAGTAATAGGTAGATTACTTGGTCGCGAGATTAATAAATTTT
TTTCTATTGGTTTTAATTGAGTTCACTTTTGCTTAAGAAGAATTAGTGAATGAGTTTAAAATACTGTGCAACAGGTCATGGTTTTACTCTCTTGAGCAAA
AAGGTTCCACATAAATTGCTTGTGTTGTGTTTTGCTTATTGTTTACTGTTCTGCATTGTTCTTGTTGTGTCAAGGGACCTGGTTCGTTGACTGATAGTGA
ATGCACACATTCTATCAATTGGTATCAGAGCGAATGCTCTCTAACTGATTAAAACCAAGAGAGATTCATGTGGAAAGATGGTTCTTGCACTGAACAGAAA
TCAAGAAGCGTAAAAGAAGGAGTTTAGGAAAGATAGGTCTCTAGAAATCAAGATGATGTTGTTAACTTATGACATTCTGATTAATCACAACTCACAAGAA
TTAACAAGGAATAACATGAGCAGCCTGGAATTCATGGCAAAACAGGATTGGCAGGAGGCTAAAGACTAAGGAAAAGAAATATATGTAAATCAATCTGTCA
AGATTCAAGAGATCAAAAGATCAGCCAAAGATTCAAGAAATATATTGTTGTAAATCAATCAGCTAAAATTAAGGAAAAGAAATATATGTAAATCAATTAA
CCAAGATTCAAAGAAGAGATTGAAGACCAGAAGATTAAAGATCAACCAAACATTCAAGAGAGATATTGAAGATCAACCATGATTCAAGGAGTTCATCTCA
CAAAGGAAGGAATTAATTTAATCATGAACATATCTAATATGAACATGATACAGTAAATCAATTCAAATAAATCAAAGAATAATCTAAGGATTCTTGACTT
ACAACTCTCTTGGGTTTCCAAAACAGGGCATTATCTTTCACAGCTATTTAAACATGTCTCAGTCTTAGATGTGAAGCACGCACTTCACTTGAACTTATAT
TATAGTCTTGTTTTATCTTTCATAAAACATTGTATACTCTTGAGTGAACAATTGAAAAGAAAAGAGAAATAAAGATTTGAGTGTAGGTTATACAAGTCGA
GGTTGTGTCAAAGAAAAAGGTCTAATTTGAATATCAGACGGGCTCTTAATCGTAACATTTTCTAACACCAAAGTTCTCAACAAGATCTTAAAGAAACCCT
TGTAACCCAAGGGGACTGGACTAGGCACCACATTGGTAATCCGAACCAGTATAAAACACTCTGTGTTATTTACTTACTGCAAGTTATTATTACTATCTAT
CTATTTTACTAACGTGCAGGTGACTCGACTGACAAGAGTAGGAAGTCGATTGAAGGGAGTTTCATTCCCTCTCTCCCTCTTGACTTTCAATTGGTATCAG
AGCAGGTCTCACAGATTTAGTGTTTAACCACACGTGAGCAAAGACTACTCTCACCGGAAAGACAAATTTAGATTCTTTGTCTCTTCAAATGATCATCAAG
CATGGATAGTAATCAAGAAGGGCATGAAGCCTATTCTAGGATTGACTAAAAAAGATGGCAGTAAAAAACCGTTTGATCCTGCATCATTCGATATTACTAA
GGAACAACAAAAGGTAATCAAACTAATGCTAGAGCTATAAGTTTGTTGTATTGTGCAGTAAACAGAGCAGAATATGACAAAATATCAATTGGAGAAACTA
CAAAGGAGATGTGGGACAAACTAGAGTTAGCCTATGAAGGAACCACTAAAGTAAAGGAAGCTTGAATCAGCTCACTCGTAAATGAATACGAGTTGCTCAA
AATGTCCGATGATGAAAATATTGAATCCATATTTTCAAGATTCAGTAAAATTGTTTGTGAACTAAAATCTCTTGGAATGGTATAATTAAACTCGTTACAA
GTCAGTAAGCTTGTTCGGAGCCTTCCCGAAGCTTGGGAAACTAAAGTGGCCATTCTTGAAGATGGAGATCTGCAGAACATGACATATGATGAGCTTCGAG
GTAATTTAATGTATTATGAGTAGAATCACATTAACAGGTACAATAAGGATGAAAAGAAGAAGGTTGTTGCATTTAAGATCGAGATATCTAACATTGAAGA
GGAAGTCAATGAATATCAAAGAGAAGGAATGACTCTCATAAATAGAGGAGTCAAACAAATGTTTAGACGAAGAAGACAATGACCTCAATAGGATTTAAAC
AATAATGAATTCAAAATAAATGATGATTGATGCTACTTTTATGGAAAACAAGGACATATCAAACAAAAATGCCCAGAATGAAGAAGGAGAAATAATCGAA
TAAATGACGAAGCCTAGATTCAAGGAGAAATATCTGAAGATGATCATGATGAAACCGGCAACATATGTTTCATGGCACCAGGTGAAATAAGTGTGGTAAG
ATATTTTAACTTCTCTAAATGTAATGACTAACAAGACTCTCTGGACATGGTTACTGATGAATTACAAAAAGTAATCGATGCATAAAATAAGATTTTTCAA
GAAAAGAAAGACTGACAGATTCTTCTTGAAGCAAGTCAAATTGAAGTCGACTTGCTAGAACAAGAATTGGAGAAAGTAAAAGTGCAGCTGAACAATATCC
GAAAACCTCTTAGTCATAACTCTGTCAGATATAACAGAACTATTTTCAATGGGAGAAGATCTTCTAATGAAAGTTCCAAAATATCCAACAGATCTTTATC
TAATTCCTCTTATCATACTGTTGAATCTGCTATTAATTTCTCTTGTTATACTTGTGGTGACATTGGTCATAAATCTTTTAACTGTAGGAAATTTTCTTCT
GGAAAATGGATTTGGAGACCAAAAGTTGTTAATCCTAACTCTCAAGGGCCCAAAAATACTATGGTAGCAGAAAGAATTGAATCTACTTGTTTTGCAGTAG
CATACTAGAAAAACCTACAAGAAAAAAAATGTGGTTAATTGACACATGTGTGGAAAGAGAGAAAATTTGAAACTATTAAAAACATTGCTTGAGGATTTGT
AATATTTTCAAATAATGCAAAATGAGAAGTAATTGGAGTTTAAACTATCACCATCATGTAATCTAGTAGAATCTCAAGCTATCCTTGTATATGACTTGGA
CATAGAAAGAAGCAGATCAAATCAGCAAAATGGAGTGGCAGAAAAGAAAAATTATTCATTACATCAATAATAAGGCTACTCAATCAAATTCTTCCAGATC
CTTTTTGGGCAGGAGTATTATGGTAAGAAAAATCTGGGAAAGTTTGATACAAGAAGTTAAAAAGGACAGTGAAGCAGGTGAGGATGAAATTGATACATCC
AAACTAGCAGACGAGGTTCCAAAAGTGTCCACGAAAATTTTCACTGAAGATTCAGCTACTGCAGAAGTAGATTCGACTAATCCAGTTGATAAAGTAAACA
TAACTCATACCTAGGGAATGGAGAAACAACGCCGGTTATCCTGAAAACTTCATTCTAGAAAAACTAGATTACGAAATTCAGATGAGATTCTCTTTCAAGA
ATCCAGTTTCATTGGCTCTCATATCTTATTGGAACCTTTGAAATTGGGTTATGGTATCCTTTTTTTTTCTGAAAATTTCGGTTGGATTTTCAGATGTTGA
CTTTGCAGGTGATAAAAATGACATAAAAAGCACCGGTGGAACATGCTAGTTTTTGAGAAAATCTCTTATTTCATGAGTATTTGGCGGCTTGAAGTTGTGG
AACTTCACTACTATGGATGATGCATCAACACTTCGACTATGATTTATCCTTTAAGGGAGTATCTATTTGCAATAATACAAGTATTATTAGTCTATCTAAA
TATACTGTGATCTTGTTGAAAATGGTGATTTTCTGCTTGAATCTGTCAATTCAGAAATGCAGTTAGCTGATTTTTTACAAAATCTTTGTTTGAGAAAAGA
TTTTTTTTCCCTCGAGAATGTCTTGATATTACTGTTCTTATTTATTACGCTTACTGGTTTTCTTGTTTCTTATGACACTCATACTTTCACAAGCATGAGA
AATGTGTTGACCTCTCTGAAATACTTTCTTCGTGATTTTGGAGTTGACCTATCGCGTTCGTTGTTTTTCTCTGTTTTACATTTTGATGATGTCAAAGGGG
GAGAAAATGTAGACACGACATATAGAAAGGGGGAGCATATAAAAGGGGGAGTACAAGGATGTCTGTCAGTCCGCGAGACATCAAACAGAGAACTTAAACT
TAAAACTTGTATTAGTTCTAGTTGTCATAACAAAAAGGGGAAGATTGTTAACTTATGATATTCTAATTAATGACAACTCGCAGGAATTAATAAAAAATAG
AACGAGCAGCCTGGAAGTCGTGGAAACATTACGAAAAACAACATAGAGCCAAAATTGAATCCTAGTCTGGATTAACGAAGCAAAACAGGAAAGGCAGGAG
GCTAAAGACTAAGGAAAAGAAAATCTATAAATCAATCTGCCAAGATTCAAGAGATTAAAATATCAACCAAAGATTCAAAAAAGATATTGCTATAAATCAA
TCAACAAAAAATTAAGGAAAAGAAATATATGTAAATCAATAAGCCAAGATTCAAGGAAGAGATTGAAAATCAAAAGATTAAAGATCGGCCAAACATTCAA
TAGAGATATTGAAGTTCAGCCAAGATTCAATGAGTTTATCTAACAAAGGAAGGAATTGATTTAATCATGTACATATCTGATATGAACATGATTCAGCAAA
TCAATTCAAATAAATCAAAGAATCCTCTAAGGATTCTTGACTTACAACTCCCTTGGGTTTCCGAAACAGGGCATCAACTTTCACAACTATTTAAACCTTT
CTCAGTCTTAGATGTGAAGCATGCACTTCACTTGAACTTATTTTTTTGTCTTCTTTTATCTTTCATAAAACTTTGTACACTCTTAAGTGAACAATTGAAA
AGAAAAGAGAAAGAAAGATTTGAGTGTAGGTTATACAGGTCGAGGTTGTGTCAAAGAAAAAGGTCTGATTTGAATATCAGATGGGGCTCTTAATCGTAAC
ATTTTCTAACACCCAAGTTCTCAACAAGATCTTAATGAAACCCTTGTAAACCAAGGGGTCTGGACGAGGAACTACATTGGTGATCCAAACCAGTATAAAA
CACTCTGTGTTTTTTAGTTACTAAAAGTTATTAGTACTGTCTATCTGTTTTACTAACATGCAGGTGAGACGACTGACCAAAGTAGGAAGTTGACTGAAGG
GAGTTTTAATCCCCCCCTGACTTTTAGATGTTTGGTGAAACCTCTGATGAAAATGAATATGAGGACATGACCTACCTAATGAGAAGGTTTCAAAAAATAA
TGAGAAAACATAAAGGTTTACAAAAGGCAGGAAACTCAAACAGAGCTGCAATTGCAAACCATTTATTCCATAAGTTAGGAAAGCCATGGTATTTCACCAT
AGATTTCCCCATGCATAAGGTCGAACACAAAGACTACCTAAGGTTTGGAGGATATAAATACAAGAGAAGGAACCAGTCCCTGATAATAACGGGTGAAAAG
CTGCAGCTGACTATGTCGTGAAGCAAGAATTTGCTGTCTTGGGTGATTCTTTAAGTGAATTAGAGGAGTCAGAACATCATGAATATGCATCAGTGCTCAC
TATTAAAGACGATGAAGATAGGTTTGATGCCATTTTTACCTTCATAGAAAAATTGATGATGAAGAAGCTGATGAAGAGGTAACCCTTTCTGACCTTAAAG
AAAACTTGAATGTTTACTCTATTAGAAAGTTAAGAAATTTGGTTGTTGTGTTGATTGAATTTATTACTGAGTCACAAACTGAAAAGGACTCGATGAACAA
CAACCTAACAATCCTTTATAAAGAAAAGGTAGTCTTGGTTGACCAAATGTCATTGTGGAAGAACAATTCATAGTTCTAGAAGCTGAAAATCTAGAATTAA
AGGAAAACTAAAGATGTTGAGTGAGAAATGTCGCTGAAACAAAACTTGCTATGACTCTTTAAAGAATTCTAGTGCTAGAGAGGGACCTGGTCCGTGTAAA
AGAGGAATTGAACAAATCCCTCAAATGGATTGCTTCTTCTAAAATGCTTACAAATGTAGCCAGTCAAGGTAACAACAGTAGAAGAGCGCTGAGCTGTGAG
AAGATAGATTTCTTATACAATCCCCACACCAAAAATGTTGTGATTGTTAACAATATGTGATGTTTGCATTGCGGAAAATATGGTCATCTGAAGAAGGAGT
GTGTAGCTTGGAAGAGATCTTAATAAAGTTCCTCAAACTATTTCAAAAATATGAACTAGAAGAAGGGACCTGGTCAAACTTAGGAACAAACAAAAGAAGG
GGCCTGGTCAACAAAGGAACATGCAAAAGAAGGGACCTGGTTGTGGTTCTGGTCCTAAGTTAAAGAAAATTAGTCTGCCTTACTGGACACAGAACTCGCT
TATCACTTTGTTATCTGCTTATTGGGAACTCCATCTCACTAACAAGTGATTTTATATGCAAGTGAGAGAAATTAGTATCAGTCAGTGTTGGTTTATGGAT
AATAAGTAACACATTATTAGTAACACATTCAACAATATTGGTCGCTAAGGTTGCTATAAAATGGAAGTTACCTTTCTTACTGTCAACACATAAAAAATTA
CAGTAAAGTAATAAAAAAATTCAAAATGAAGAATTTGAATTGGAATGTTAAATATAAGAGAAGTGTACCTTGTCTGTCGATGCTACCGAAATATTGGACT
ATGAAAATTTTGGCTTTAGCAAGCCCTCGTAATGTTTGTGGAATATCTCCAGTCTCTAAATCACTGCAATCAGGTGGTGAGTCCGATTTTGTTTGCGAGT
GATTTGTGCCCTCTAATTATTAGTCCATCATTTCCGCATCACTGACTCGTTTCCTGATTTTTTTCAACGAAAGATCTATATGTTTATTTGTGTCATCATT
CCCTCTTAATAGATGACAGTTGTGTTTTTCCATATCGTAAATATCACGTTTCTAGAGGTGGATAAGCTCAAATGTATATGGTCGGTAGATATCGACGACA
CAATAAGATTTGGGGTTCTCTCACCACGGACATCCTACGCCGCTTAACTTGTTTATAAGTTTGAAGATGATTTGGATTTAATTATCGACCCTCAGAGGTT
TCAGCTAGAGTTTTTGGTGTTAAATCGAACAAATGATTTGCAACTCTGGTTCCAGAGGGCAAGGAGTCAATTTATAGCTGCCCTGTGATCTACAGGACAA
GCTCAAGAAAGTGTATGAAGAGGCAGTGCAAACTAATCTGTGTTGTTCATCTTTTATTTCTAAGATATTTAAAACAAAGTTTTGAAGAATTTGGTAAGAA
ATAACAAAATTTAAAGAGTATTTTTAAACTAGAAAATTAAAACTAGTAGAGAAAATAGAATCATAAACAAATTAGAAACAATATAAAAAAATTTCTCAAA
CAAAGAAAATTGAGTCCACTAAAAGCACAATTTTCTCTTAAGAAAATTATTCTCCTCAAGTACCCAAGGTTAATAAATATGTTCTCCCATGATAGATTGA
TCTTACTCACCAGTGTATCGATACCTAAAACCATGGGGTCAACGAACCACTCAACAACAGTAAACTACACTTAAAATCAGTGGCGGAGCTAGGTTTCCGC
TAAGAGTGTTCAAACTTTAAAAGAATTGATAATTTTTTTTAGTGGAGTGGGTGCAAAAAATATTTGTATTTACAGATGAGCGGGTGCACCCAAATTTAAA
AATTAAATTAAATATCACTCAATTACTAAATCGTATGAAAACTTTTTTTTATATCGAAACTTTAAATTATAAAAGTATCTATAGTATAATTCAAAACTAA
TAGAGAGAGAGGTCAACAAAAACAATTTTAGCTACTAATTGAATATAACTCCCCCTAGTTCATATTAAGTGAATGTTGTGACTTTTTTATGATCCAAAAT
AACTGAATATTTCAAAGTTCAAGAAAATTGTTTGAAATTTTTTTGCCCATCTTTACCTCTTATTTTAATAACAATCTTAACTCTTTTACATTTCTAAAAG
ATAGTTTATAAATAATAAAAAAATAATAGTGGATAGTGATCTTTAATTTATCTTTAAAAATAATTTCTTGAGAATGAGTTATGCCTAATAATTCACTTAA
TATAGATAGAAAATATAAAAATAAATATAAAATCTTACTTATCAAGTTAATTATTAAGGTTAATTAATATGTCAAAATTTAATGCTAGAAACATAAAGAA
TATACGGGGGCGGCTTTTTCTTTTTTAGAAAATATTGCGTTAAAAACGCAGCTAAGGAGGAGAGAATCACTAACCACAAAGACCTAAATTAACCCAGAAA
AATATTGTGTTGACAAAACATAGTTTGGAAGATTAAATTTGGGACCTCAAAGACCTAAACTAGCATGATTACGTTCAAACCAATAACTTATGTTATGTAT
AAGTGTGTTCAATTAATAAAATATGCATATATTAGACAGTATTACCCACATATCGAGTATAATTTTTTGACAAAGGGTGTTCGCCTGACCAACCTTAATA
GGTTGTAGCTCCGCCCCTGCTTAGAATACTAGGTTTAGTATTGTAGAAGACGTCCACAAAAATTCATTCAACTAAAATAAGAGGAAATTCTTCAATTGTA
GATAACAAAGAGTAGTGTGAAAAAGTCCTAATTGTGCCTAACTGGAAAGGTCATAAACCTTTGAAAAAGTTACAATTTTTCTGAAATGTCACAACTTTTC
ATAAGTCACATCTTTTCATAAAAGATACAACTTCATAAAAGTCGCAACTTTTCATAAAAGTCACCACCCTAGCCTATACCCAAAATCCCTACGACACACC
TTATCTTTGATGAGGTCCTATTACCCCCTCCAACTATTTTTTAAGTAATATATTACCCCTTGCGTGCCTACGTGGCAAAAATAATCTGCAAGGTCGATTT
GTTTGTTGAAGACGCGCCATGACCCACTTTTTCAGTTTTCGTTAAAGTGACTTTAATGAAATATACTCCTCTTCTCTCACGTCCCACCCCACTCCCTATG
CCCCATAATTAATAAATCTATATGAATAAAGATAATGAGTTTTGTTTCAAATTGTTAATATTGATCTTTTATTATTTTATCATTTGGTTTAATATAATTA
TCAAGTTCAGAATTAATAATCGACATAAAATAAGAATTAATAATCGACATAAAAAGATGTAAAGAATATATTAAATTTTACTTTACCTTTTCAAATCAAG
GAGCTTGAATGATAATGGATGGAGCTTCTTCAAAAATGAAGAACCATAAACATGGGGTTATTTTTTGAAAAGAGGAAGAAGATGCTTTGAGAGAAACAAT
AAAATTTATTTTTGAATTTTTTTTCAAATTGCTTTGACACGTGGCTCATTTTTATTGGCCATTGTTAGCCAAAAGCTGCACTCACTCCGCACTCACGCGC
CCTAGATGGGTGAAATCACGATTTTTGCCACGTAGGCACGCAAGGGGTAATATATTACTTAAAAAAAGTTGGAGGGGGTAATAGGACCTCATCAAAGATA
AGGTGTGTCGTAGAAATTTTGGATATAGGCTAGGGGGTAATTGAGTATTATCCCTTTATTTTATTTCAATTATTTATTCCTAGAGAAAAATTATTATTAT
AACTTAACAAGAATAGCAAAACAAAATTCACATAATCAATTATTTTGAAATATATATATATATATATAAACTTTTAAAAACTATTTTTTCCTTAGATAAA
TAGTTAGGAGGTTACCTAATGTAATCTTTAATTGGAAAACCACCAATTGTTCTAGTACATTCTCAATATGATCTTGCTAAATAAGGCACCAAATTCTGAA
AAAGTAGTACATTAATCTACTACTTCCATGATATGTTTTCCTCAATCAGCAGAATACAAGAAATACCAATATTATACTAATTTCCTTAACCCGTTGTTCA
TTTTGTATTTGTAAGATACTTAAACAAAACTTTAGAGATTTTTTTAAGAAACAACAAAGTTTAAAGAGTATTTTAAAATTAGAATTTTAAAGCTAGTTGA
GAAAATAGAAATAGAAACATATTAGAAACAATATTGAAGTATTTTTCTCAAGAAAGAAAATGAGCTCACTGAATGCACAATGTCCACTTAAGGAAATTAT
TCCCCTTAATTACCCAGGTTAATGGAATAAATTATCTCAGGATAGAATGATCTTACTCATCGGTGTATCGGTACCTAAACCACGGTGTCAGCAAATTACT
TAATAGAAGTAAAGTACACTATGAATACTAGATTTCATAGTAGTAGAAGGAGTCTAGAAAAGTTCATTCAACTAAAATCAGAGAAAATTCCTCAAGTTAT
AGAAAACAAAGGGTATTGTGAAAAAGTTCTTAATTTGCTTTACCGAAAAGGTCACAAACCTTAGGAAAAGTTTCAATCTTTCATAAAAGTCACAACCTTT
CATAAAAGTCACATCTTTTCATAAAAATCACAACTCTTCATAAAAATCAAAACTATTCATGAAAGTCGCAACTCATCATTTTCCATTCAAACCTTTTAAA
ACCCAACAATCTACCCTCTGATGTAGAGGATGATGATCCAAGGCTACCTGATAATATTTATTTGGTATTGCAACATATGTTGTTACAGTGTTTGCCAGAG
AACGTTTCTAATCGCCTGCAACTTGTTATGTGACATCCTAAACTTAAAGATGATGGCTGGTTTGAGATGTTGTAAATTTTACGGAAAATACCTTCTTGAC
GAACACTTGTACCAGATTCACCAAAGCTTGTACTTCATCGATAACTGTTAGTGAAAAACTTACAAGATAATAAGATTACAAGATTACAATTGAATATAAA
ATGAAGAAAGTTATCTCTTCAGGCTTAGGCGTGGATATCTCGCTCTCTTTAAGGAGATTCAAGCCCACTGCAGCAAATGTTTTCACCGGTCCAGCAGTAG
TCCTCTTTGACTTGTCCCTTCCAGGATACAACAGCCTTCACAAAGTATAACTCAACAACTCTAGACAAGAGTTGAGTCTAAAGCTCCACAAAAAAGAACA
CCTCCCTTCAACTAATAAGAACTCTCTTTTAGACTAACTCTTTCACTCTTTGTTTTCTCTTATGAATTGTGTTTGTAAAATCAAATGAAGACTAACACTA
TTTATACTACAAGAAGTCTTCCTAGGAATGAATAGGAAGATAATCGAGGTAGTAAATAGTGAAGATAATGGCCTTAGGAGTTTCATAGGTTACAATAGGA
GTTACATAGGTTACATAGGTTACAATGGGAGTTACATAGGTTACGTAAGTTACAATGGGAGTTACATAGGTTACAAAGAGTAATGGAGGAATTAAGAATG
AAATACATTGATGGATAACCAATGCTAATGGATGATGTAGAAGTCATCCATTCCAATGTTCATTCTTATAACTCCAAAATAAAGCAATTTAATATGTTAA
ATATTAATATTAAAATGCTAATAACCTAACGATCCCCCACTCATTTTAGTATTTAGATAAGAGAGTATATCAGCTGAAGGAAGACTACTATGCATAATGA
AGGTGTGCTCTGCATTGAACTTCCACTTAGTGAAACAGTAACTTTTACTCCAGAGTCGTACTGGTCTCAGACTTGAACTATGACTGCGTAAAGGAAATAA
AATATCACTGCTCACATATAATAATCAAGGTGTTGACATGAGCTTTAACAGCCAGCACGTTGTGGCCATGTGCTATCCCGGTTTCATGAGTGCATTTGAG
AATAAGCCCCATTCTCATAGGAAGCGACCTACTTCCACACATCACATAGGTAAAATTTGTCGAGAGTGCTCCTGTAAGATTAACACTCCACCCATACGGG
CTACAGATATTCATTAAGAGTTTTATCAACTAAACCTTCACAAACTACAGGAAATAATGCACTCACATTATAGGGAGGGAAAAAAATAGTGCATTTTTCA
CAACAAGTCATCATATGATTAGTTTTTCCCTTTGAACCGGGTTATAGGATCTCTAGTCTCCAGGTTGGGTTTCCTCATATATGACTCAAGGAGTTGTAGG
CTTCAATACCATCCCCCTCGATGTGCTCCAGACCTTTTCTCTTGTTAAGTCCTTCGTAAGAGGATCTGCAGGATTATCACAAGATTTTACATAATCAACA
TTAATGGTACCATTTGTCAAATACGATCTTACATTACTGTGTTTCCTCCTTATAGGTCTGGATTTACCGTGTTAATAACGGTTTTGAACTCTACCAATTG
CAGCGGTGCTATCACAATGAATTAAAATAGGAGGAACTGGTTTTTCAAAATAAGGAATTTGAAACAATAAATCTCTTAACCAATTCGCTTCCTCACTAGC
TGAAGCTAAAGCAAGTAGTTCAGCCTCCATGGTAGAGTTAGCAGTTATAGTTTACTTTTTTGATCTCCAACAAACAACACCACCACCTAAAGTAAAGACA
TAACCAGTAGTAGAACAAGAATCACCTGACAAAGTGTTCCAATCCGCATCACAAAAGCCTTCAAGTACAGCAATATATTTTTTATAGAATAAACCACAAT
TTTTCGTTCCAATTAAATATCTCATAACACTTGTTATAGCATGCCAATGTTCATTACCTGGCTTGCTTGTAAACCTGCCAAGTACTCCTACTGCATATGT
AATATCAGGCCTAGTGCAATCAGTCACATATCTCAAACTTCCGATTTTACTAGCATATTCCTTTTGATTTATTACATCATTTTCACTTTCAACAGGAAAT
AAGTGAACACTTGAATCAAAAGGAGTAGCAACATGCTTGCAATCATGAAAGTTATATTTTTTCAAAATTTTCTCAACATAATGTGACTGTTCAAGGAAAA
TCCTCTCACATGTTCTTGTTATTTTTATTCCAAGAATAAAATTTGCCTCACCAAGATATTTCATATCAAAATGGCTTCTAAGAACATTTTTAGCTTCATC
AATAACATTCATGTTAGAGCCAAAGATCAACAAATCATCAACATATAGGCAAATGATCACATGTGAATTATTCCAAGACTTATAATATATGCACTTATCA
CACTCATTTGTTTTAAAACCATTTTCAATCATGCAGGAATCAAACTTTTCATGCCATTGCTTTGGTGCCTGTTTCAAGCCATATAGGGATTTAGTAAGTT
TACATACTTTGCATTCTTGGCCTGCTTCAACAAAACACTCGGGTTGGTCCATATAAATTTCTTCATTTAGGTCTCCATTTAGAAAAGCAGTTTTTACATC
CATTTGATGAATTTGCAAATCAAAAATTGTAGCCATAGCAACTAAAAGTCTAATGGATGAAATTATTGTTACCGGAGAAAAAGTATCAAAAAATTTTAGG
TCTTCTAGTTTTTTATAACCTTTTGCAACTAGCCTAGCCTTGTATTTATCAATAGAACCATCCGGTTTCAACTTTTTCTTTAAGACCCATTTGCAACCAA
TTGTTTTACAACCCGGTGGTAAATCAACTAACTTCCAAGTTTTATTAGAAATTAGAGATTCCATTTCATCATTTACAGCCTTTTTCCAAAAAATAGAATC
ATGTGAATATAATGCTTCTTTCAAAGTTAGAGGGTCAATTTCAACATTAAACACATAAAAATCAGGACCAAAATCTTTTTCTACTCTAGATCTTTTACTT
CTTCTTAACTCAAAATCAACAACTTCTTTATTTTTTAAAGTTGAAGTAGAAGAACTAGGTAGTGACAAAATATTTTGTTCAATCCTTTGACCCCCACTAT
TTTTAGTATCAAAAGGAAATTTATTTTCATGAAAAATAGCATCACCAGATTCTATTACAATATTATCTTCAAGATTAAAAAATCTATAGGCTGTACTATT
TGAAGCATAACCAAGAAAAGCACAAGTATTAACTTTCTTACCCAACTTTGTAATCTTGGGATCCATTAGCCTCACAAAGGCTAGACAAATCCAAACTCTT
AGATAACCCAAACTTGGCTTGTAACCTTTCCAACTTTCAAAAGGTGTCACTTTAGACTTTTTATGAGGCACAGGATTCAACACATAACAAGCAGTTAAGA
TAGCTTCACCCCAAAAATTTAAAGGTGCATGTGACTCAATTAGCATGGCATTAGTCAATTCAACCAAAGATCTGTTTTTCCTTTCTGCTACTCCATTAGA
CGAAGGAGAGTAAGGAGGAGTAGTTTCATGAATTATTTCCAATGATCTAACAAAAGAATTAAACTCATTTGATTCATATTCACGGCCTCTGTCACTTCTA
ATTCTTTTTATTTTTCTTCCAAACTAATTTTCAACCTCATTGAGATAAGTTTTGAAATTTTCAAAAGCATCACTTTTATTTTTCATCAAGTAAACATATG
TAAACTTAGAAAAATCATCAATGAAAGTGATAAAATATCTATTACCTCCATGATTTAGAATTCCACCAAGTTCACAAATATTAGTATGAATTAATTCTAA
CAAATCAGTTTTTCTTTCAACTTGAAAATGAGACCTTGTAGTGATCTTGGCTTTACTACAAGTCTCACACTTTCCAAAATTCTTTTTAAATATTGGGATT
AATCCTAAACTACTCATGATTCCAACATAACGATCACTAATATGACACAAATGACCATGCCAAAAATTAGTAGAAGAAAGCATATAAACAGAAGTAGAAG
TTTTATTCATTTCAACATTCAACTTAAACATCCCATCACATGCATACCCCTTCCCCACAAAAATACCTTTCTTCACTATTACATATTGATCAGATTCAAT
AATCTGTTTAAAGCCTGCTTTATTAAGAAGAAAACTAGACATCAAATTTTTTTCTAATAGAAGGAGTATAAAGTACATCTTTCAATGTTAATATCCTTCC
AGATTTAAAACACAATTCAACATCTCCCTTTCCAAGCAATTGATTAGTGTGAGCATCACCAAGCATGATGGTTTTGGGCTCCTCAAAATGAGTATATTTT
TTAAACCAGTCTTTGTCATAACAGACATGACGGTTTGCACCAGAATCAGCCCACCATCCATCAACATTCTCAACCATGTTTATGTCGGTAATCACCGCCA
CAAAAGGTTCTTCGGTAACGTTTGCCTGAGGGTTAGGACTACGTTTCCGGAATTTGCAAAATCGAGCAATATGCCCACTCTTGCCACAAACAAAGCATGG
TCCATTTTCTTGAACTTGTTGATTTTGTGCTTGGTGATTTTCACCATTATTTTTCTTGGGAGGTCTACCATTATTTTTCTTGAATTTTTCTTCTTAGGAT
TTAAAGAAGTATTTTTGTGAGTTTCAGGATTAGCATTATTCGAAGTAATTAAATTTACCTTCGATGTGATGTTGTTCTCTTCTGTTTGTAAAAGTGCATC
TTGGCCCCTTGCTTCTTCTTCCATGCGGACTTTCATTATCAAGGTTTCAAGAGAGGTTTCCTTTTGTTTGTGGCGCATAGTTTTTTGAAATTCCTTCCAA
GAAGGTGGAAGTTTATCCACTATGCCACAAACAATAAGGTTATCTCCAATTTTAACCTCTTCGGACCTAAGCTCTCCAACAATCATGATGAAGTCTTGAG
CTTGATCTACCACTGATTTGTTGTCCACCATTTGGAAACGAAAAAATCTACTAGCTGCATATTTTTTCGCTCCAGCCTCTTCAGTATCATACTTACTCTG
CAATGCCTTCAAAATTTTCTTTGCACTAGAGTAAGTTCTATCATAATAATCATAAAAATTATCAGATAGACAATTAAGAAGATAATACCGACACTTATAG
GAATCACCATCGTACTTTTCCACTTTCTCTAGATGAGAAATAGTTTCATCATCATTCATAGTGGTGATGTCTTCTTTATTTGGATTCTTCTCGGTTAAAA
AGTAAGAAACATTGAGGAGACTTAAGTAGAAAAGTACTTTACCCTTCCATCTCTTGAAATGGTTACCATTGAACCGAAATGGCTTGTTAAGATCTCCCAT
CTTGACATCCGCGGTTTTTTCAATTGTAGACATCTTTGAATCTCTTTAAAATTGTTAGTGGAAAAACTTACAAGATAATAAAATTACAAGATTACAATTG
AAAATAAAATGAAGAAAGTTATCTCTTCAGGCTTAGGCGCGGATATCTCGCTCTCTTTAAGGAGATTCAAGCCCACTGCAGCAAATGTTTTCACCGGTCC
AGCAGTAGTCCTCTTTGACTTGTCCCCTCCAGGATACAACAGCCTTCACAAAGTATAACTGAACAACTCTGGACAAGAGTTGAGTCCAAAACTCCACAAA
AAAGAACACCTCCCTTCAACTAATAAGAACTCTCTTTTAGACTAACTCTTTCACTCTTTGTTTTCTCTTATGAATTGTGTTTGTAAAACCAAATGAAGAC
TACCACTATTTATACTACAAGAAGTCTTCCTAGGAATGAATAGGAAGATAATGGAGGTAGTAAATAGTGAAGATAATGGCCTTAGGAGTTTCATAGGGTA
CAATGGGAGTTACATAGGTTACATAGATTACAATGGGAGTTACATAGGTTACATAAGTTACAATGAGAGTTACATAGGTTACATAGGTTACAAAGAATAA
TGGAGGAATTAAGAATGAAATACATTGATGGATAACCAATGCTAATGGATGATGTAGAAGTCATCCAATCCAATGTTCATGCTTATAACTCCAAAATAAA
GCAATTTAATATGTTAAATATTAATAAAATGCTAATAACCTAAAAATAACTCCTATAGGAAATTCTCATGGCTTGAGGGGTGTCGAAAGACACTATCCTT
AGGGACACCCTGTATGGGTGTGTATGCGTCTAAAGTTTAATCCTGAAATACAATAAACAGGAAAGGAAAAATAGCAAGAAAACAATAGTAATTGTATTTG
AATCAATGTGAAGGTTACAATCTTTAAAAAATATTTCAAAAAGATATATAATCCCCTGATTATTCTCTTCACATATGTTCTGGATTTGGCGGAATACTTG
TGACTCAACACATGGAGCAAAAACTTCTTTGTATGCGGAAGACTTGCTTACCACCACTGAAGAGCAATTATGTATTCCTGTGTGGGTTTTTTTCAGAAGA
AGACCTTTTTATGTAGGCTTGAGTTAGGGCTTTAGGGGTATTTTGGTCCGAGCAATGTCGACCCCTGGGTTTGAAAAACATGAGTTGGGCTCATCTTGTA
AACTTAATGGACTGACACAAGTGATTTGGACTTGATTTAAGTCATACAATTTTGATTTAGATATTAATCCGACTTTATCAACCAGTAATTTTACTTGGTA
AACATTGATGATTTAAGATTTAATACAAATTTAATATGGATTTATCAATAAAACTTCAAAGTCAACAAATGCCCCCTACTTCGAGGCTTGTTGGGGTGCT
CGATTTGTCGAACTTGTAAAGACAAGCCTTGAAGTATTTGTGAAGCAAATGTTTTTTCGTCGTAGTTAATCTTTCACGAGGCATTTGAAGCTTCATGAGA
AATGACCATGCCTATATGTTGAGATCAACATTTACTAGAGTCTCTATGACAATATTCTCTAATTTGTAAGAGGTCATTTGACTTTCGGTTGTTTATCAAC
TCATTTTCGACTTGAAGTATTTCAAGCTCATGAAGAATTACCGCATGACATTTCTTTATAGCGTGGTAATTTCATTTGGGTCATCAACTACGAAATGACT
GTCAATTCAATGAGCAAGGATTGCTTATACAATCTTGACTTGGTGATAGAGACCTTGTGATTTCGACGCAATTTTTAGGCTTTCACTTGAATAGAACACA
AGGATTCAAATTCTCATGACGCGAGTCTATTATCATTCGGGCATATTTTTCATGTCATTTTCGAAAAAACTTTACGATAATTTGATTTCTATGAGATCTC
CATAACTCGACTTCATCGGAAATTTTTCATAATTTGATTCTTATGAAAACTTGTAATAATTTGGTTTCTATGGAATTTCCATAATTATTCCCATGAAAAA
TTTCCATAATTTAATTCCCATGAAAACCTACCATAATTTGGTTTCTATAGAATTTTTATAATTTGATTCCCACGGAAAATTTCCATAATTTAATTCTTAT
GAAAATTTACTATAATTTTCATAATTTGTAGAAAATAAAATTTCCATCATCATATTTTTTCATAATTTATCGGAACACAATTCATGTACTTTGAGTTCTA
TAAATACACACGCTCTTACAAGAATAGATTGTCAATTTGAGGCATACAAAACTCAGTTTTTGTCACTTTTTTTCAGCACAGCACGCCAGCGGTAGAAAGT
TCATAACTTGTTGTAGAAATATTGAAATCATGATCTGTTTGATGTTAAAGAAAGGTGAAATATAGAGCTACGACATATTCGTAATTCAAAATAAAAACCT
TTCTGAATTAGCATAAATAGATTTTTGAAGTTTGCTATCAAATCTGTCTTCCTTTTTTGTAGCTCTATGTAGTCCCACTAAAACGTCTATATCTTGGTGT
AGAAGATTCCGAACGACAAGAGACTTCTTTCTATAGAAACTAGATATCAATGTCTACAAATATCTAAAAATAAAGGTAAAACTCTTTATGGATTGACGAG
AATTAATTTTCAACGTTGTTCTTTAATGCTGTCGTTACTGTTTTGCAGATTTGTGAAATCTCACCAAAATGTTTGTATCTTGATTCTATAGAAAATATAC
TCTTAAGTGTTCATGAGTTTACTTCACTGCATCTTTATCGAAGAATTGCATATTGATTTTCGTATTGATTGAGATTCTTTTTATCACCTACATGGAGAGA
ACATAAAACTCTTAAGCCAATAGGATCATATTCATAATGACAAGCGATTGAATATATGTCATAATTTTCATCATGCCGATTTAAATTTTTGTGCAGTTGG
CACCGTGAAATACATCATTCATCATGACGAGTGTGAGAGCATATGCCATAATTTTTACCATGTCGATATGAAACTTTGTGCTATTGGCATCGTGAGATAC
ATCACTTTTCCCCATTTTTTTGTAGGTTTACGATGGACTGCAAAGAGTCTCAATATCATACCAAAAAAAAGTGAAGTGTAATTCATAATTGTCTAGGAAC
CACTCCATGCATCTTCTTTTGTAGTTTCAACTTTGATGACAAACCACACTTTGTGCCTCTTCTTTAACAATTGCGGCTTTAGTGATGAACTAGTTTTCGT
ACATTTTCTTCTACAGTTGCTGCTTTGATGATGAATCATATGTGTATCATCTCCTTTTAGAGTTGTGGCTTTGATGACAAATCAAACATGAAACATCTTT
TTTTTTTTGCAATTGTGGCTTTGACGACTAACCATACTTGATATTTCTTATTTCGTAGCTTCAACATTGATGACAAACCACGTTTGGTGTCTTCTTTTTC
AATTACAGCTCTAGCAATGAAGCACACTTAGTACATCTTCTTCTACAATTGCGGCGTTACTCATCTTCTTTTAGAGTCCTGGCTTTGATGAAGAACCACA
CATGAAAAATCTTCTACTTTTCTCTTTTTTATGTAGTTGCATCTTCGACGAAGAACCACATTTGACATCTCTTCTTTTGTAGTTTCAACTTTGGTAACGA
ACCATACTTGGTGCCTCTTTTTTTTTTGTAGTTTCACCTTTAATGAATAATCACCCTAGGTGCCTCTTCTTTTGTAGGATCATGTTGAGAATTTCTTCAA
GTTGTACGCGGAGTATGATATTTTAAGATCATCAAAATGACTAAATAATCACATGAAAAGGCCCTCTCTGATGCGCAAAGCCGTCTCGATTGTGCAAAGC
TGACACATAAAAGTTGGATGGATCCATGGAAAAACTTCAAGCAACTCTAGAAGATGTGTGGAGAAAGACATAAAAGTCTTGACTTCCAAGAAAAAGAATA
TCATTGGCGCTTATTAACCAATATCAGAGAAGTTGTCCAAAAGTCAAGAGAACATCACCATTACGAATGGAGAGACTTACACCATTGAGACAAATAATGT
GATGTCTAACAATGAAGTTGAGAGATTAGCCAATCTAGAAGAGACGATCGAGAAAATCTGCCAAGAAATCATAAGCTTCAAACCTTTTCCGTATTTTCTT
AGATTTTTCTGATCCAGTCATTATGGTGTAGTGGTTCTTCTTTTTTAAGCAATAAAACAGTGACTTATATTTCAATAAGAATTTTATCCTCTTGAATTTC
AAAGTTTTGATTATTTATTTTCACGAGCCCCCTTTATTTATTGAAAAAAAGATTACATATGCTAGCGTATATGAGGATTGCAACAAAACTGAAGATTTTC
AGCTTTCTTTAACTTTGCGCACATGTGGAAGAAAATTCATAGCATGAAGTAGGAGTATCGGAATAATGAGCTTCTTTTTTTGGTGGAAAGATAACTTAGA
GATATTCAATATGTATAAAAATCATGTCCATGAGATTTACAGTTTAATACATATCTGTATTTGAAGGTGGATCAAAATATACGTGCTTGAATCTTCAGAT
TTCTTCAGCTTTGCGCACATGTGGAAGAAAAATTCATAATGCGGAGTATAAGTATTGGAATATGAGATTATTTTTTTGAAAGATAACTTCTATATATTAA
ATATTTATAAAAATCTTCTATATATTCAATATTTATAAAAATCAAATCCATGAGATTTACTTATTAGTACAGATTTGTGTTCGCAGTTGACTCAAAATAT
GCGTGCTTAAATCTTCAGCTTTGCACACATGTGAAAGAAAATTCATAACGTGGAGTAGGATTATCGAAATAATGAGATTCTTTTTTTGTTGAAAATATAA
CTTTGATATCTTCAATCTGTAAGTAAATCAAATCTATAAGATTTACAGATCAGTATAGATTTGTATTTAAAGTTGGCTCAAAATATGTGTGCTTGAATCT
TCAGCTTTCTTCAGCATTGTGCACATATTGAAGAAAATTCATAACATGGAGTAGGAGTATCGGAATAATAAAAATCTTTCTTTGTTGGAAATATAACTAT
AATATATTCAATTTTGTGTAAAAATCAAATCCATGAGATTTAGGAATTAGTACAGATTTGTGTTCGAAGTTGGCTCAAAATATGTGTGCTTGAATCATCA
GATTTCTTCAGCTTTGTACACGTGTGGAAGAAAATTTATAACGTGGAGTAGAAGTGCCAAAATAATGAGCTTTTTTTGTTGGAAAGATAACTTCACGATT
TTTAGTCTGTACAAAAATCACGTCCATAAGATTTACGAATTAATGCAGATTTGTCTTCAAAGTCAACTCAAAATCTAGGTGCTTAACTCTTCATTTGATA
GAATCATATGATGTTCACATGACAACGTTATATTTTTCTTCTTCTTATGACTTAACGTAGAGTAAAAATAATCTAAGCTGCCTATGTAGCTTAGTGAAAA
GGATAAAGTCATAATGTAGTTCCGAAAGTGAGCTTTAATTTTTTATTTTTTTTGTGTCCTAATTTTTGCATAGGTCTCCCCTTTCGAGATTTTCAACCTA
TCGGACATTTTTTTTGGAACCATACACAGTTTATACTCTTGCGCTCCAAAAGTACGCTGCCGTTTCAAGGATAGTACTTCTTCAAGAATTTTTCATTGAT
GGGAGAAATCCGCAAGCCGTCTGTATCCACAAGTTTGTAAGATCCGCTTGAATAGACTTCTTGGATGACATATGGTCCATCCATTTTGAGGTGAACTTAC
TTTCAATTTATGAGATAGATAATTGGTCTTCTAACTGGAAGGACTTGATCACCAATTTGGAAGGACCTTAGGTGAACCTTTTTATTGAAAGCACGAGAAA
GATGAGCTTGATAACATTCAAGACTTTGTTGAGTTTTCAACCTTTTCTCATCGAGAGCTTCTAACTCTTCAAGACACATACGAGCATTATCTTATAAAGT
AAGTCCCTTTTGGATGACAAGCCTCAATGATGGTATTTGCCGCTCAAGTGGAAGGAATGCTTCAGTTTCAAAAACAAAAGAATAAGGAGTTGCTTGAGTC
GGCTTGCGATGAGTCGTCCGGTATTCCCAAATAGCTTCTTTCATTCTATCATGCCAATCTCTTTTAGATTTAGAGACAACCTTCTTTAAAAATTTGCACA
ACGTCTTTTTAAATGCTTGAAATAGACCATTTGCAGCTGCATAATACATAGAAGAATTGTGTTGTTTGAAGCCAAAAAGGTCGCAAATCTTATCCATCAA
TTTATTGGCAAATGACTTTCTATTATTAGTTAGTGTATAACTAGGAATTTAAATGTAACGACCTGTTTAGTCATTTTGAGCAGCAGACTTCAATTCTGGA
AAAACTGGCAGAAGCGACGGACCCCACGACGGACCGTCATGGGCACGACGGACCGTCGCAGGGTCTCGTTTCAAAATACTTAGAAAATCTGAAAATTGGG
TACTGAAATCGACTCTCTGAACTTCGTAACGGAATGGCAAAATGGACCATCACAGGTGTGACGGACCGTCATAGGTGTGACGGACCGTCACAGACCCTTT
AGAGAAATCGAGTCTCTGAAGTCTGTGACGGAGCAGCAGGACGGACCGTCGCAGGCGCGACGGGCCGTCACAGACTGCGTAATCCCAGTCTGGGTCGGAT
TTCTTTATACATTTTAAGGGACGTTTTTGACTATTCCTGCTTTAATTATAAAGTTAGTGGGTTAATGTTAATAAGTCTAATTACTTGGGGGTTAAAAGAG
GTAACCTTAAGTTAATTAGTGGGTTATTATTGCCATCTTTTATTCTCAATTATATACTAATTAGGGTAAAAGAAAGAGGGTTTGAATAAAGAAAAAAAAA
GAAAAGAACAGAAAGAGAGAGAAGGAGAATCGATAGGGAGAGACGAACGAAGAGGAAAAACACAAGGCTTTGGGAAATTCTTGCTTGATCACTAGTCTTC
GGTGGAGGTAGGTTATGGTTTTCATGCTATTCGTAGTAAACTCTTAATAGCGAATGATATGTGTTAGTAGTATTGTAAACCTTCTATAAGCTTAATTGTA
TGCTTGCATGAATGATGTGATTATGTAATTATGAATAAATAAGCATGATGAAGCTATTGAATCCCAAATCTTGAAAAGAAACCCTAATCTACTTTGTTAA
TGATGATGCCTTGGTATAAAAGAAGGCTTGATGAACGAAAGTAGTGAGATTAGGGGATCGGGTGCCACATTCTGGTACCAGGATAGTATATGAGGATCAG
AGTGTCACGTTCCGACAATAGGATAGTATATGGATTGGGTGCCACGTTCCGGTACCAGGATAGAATATATGGATCAGGTGCCACGTTCCGGTACCAAGAT
AGAATATGGATCGGGTGCCACATTTCGGTACCAGGATAGAATGAGGATCGGAGTGTCACGTTCTGACACCAGGATAGTATATTGAGGAGCAGAGTGTCAC
ATACCGACACAAGGGGAATAAAGATAATGAATCTTGAAAGATGTTAATATATTCAATCTAATGAACCGAATTCCCAAATGAGTATGATGAGGAGGCGTGA
GTCCTCATTGATGTGTTTGGTGTTGTAACCAAGGGTTATGGTAACTGTAAATGCTGCATGCTAAGGATATTAGTTGATTTTATGATATTGCTTAATATAT
ACTGTTTTCTATTTTGAGTTGGCCGATGATATCTACTCAGTACCCGTGTTTGTACTGACCCCCTACTTTTATGTTTTCTTCTTTGTTATTTGTGGAGTGA
AGCAAACGTGCCGTCGTCTTCGACTCAACAGTAATTCAAGCCAGTCTTTACTACACCGAAAATTCAGGGTGAGCTAATGCTTCTAGCTTGGACTGGATCT
TCTTCTTCAAGTCTTGATGCCTTGAACTTCCAGCATGGACTAGCTTCTTATGTATTTTTTTTGCTTCTTAGACATTTTTAGTTAGAAATTTGATCATAGA
TGTTCTTGTGATGATGACTTCCAGATTTTGGGGATAATAATAGTTATTGATTTTATTAATGAGTTAAGTCTTCCGCATTACTTTATGTTGATATTACATT
GAAATGTTAAGGTTTAGATTAGTTGGTTCGCTCACATAGGAGGGTAAGTGTGGGTGCCAGTCGCGGCCCGGATTTGGGTCGTGACATTAAAAATGATAGA
TTGTATTCACCTTCATGAAGTTTGCAACATTTTCCTTCTTTACTTCTTTGAGGGCTACCGCCTCAACCCATTTTGAGAAGTAATCTATCACAACAAGGAT
GTACAAGTGCCCGCCAGAAGATTTTGGTAGTGTTCCAACTACGTCTAGCCCCCAAGCATCAAATGACCAAGATGAAACAGTCCAATGTAATACATCAGGT
AGTTGGTGCATAAAGTTTGCATGAATGAGCATGCTTGACATCTTCAAGCATAATCCAAGCAATCTTTTACCATTGTTGGCCAAGAACACCCTATTTTTTA
ATATGAAAATGCAACTTTGGCCCAGATTTATTCGATCCACAAACTCCAGAATGTGCTTCTTGCATCGCTTGATTTGCTTCTTTTTCTCCCAAAAAACGCA
AGAGACCCCCCTCGAATGATCTTCGATATAAAGTATCTTTATAGTAAAGAAACCGAGGAGTATGACGACGAATTTCAGTCTTTCTTTTTGGATCTTGTGG
AGGTATATTGTAGCACAAGTAATCAATCAAGGCATGTCTTCAGTCGACTATCTCAATTGTGAAACATCTACAAGATGTTAAAGCTTGCTTTCTTCATCCG
CATCTAATGGTACTATCCATTTTTGGCAGATAGCGATTTGAGCTTAGTCGGGCAGAGTCAATGTTGAAGCCAAAGCAGCTAAGGTATCAACTTTCTTGGA
ACATATTGAAGAGTTACATCTCTAAGACATCTAATCAATTTTTGTGCATAGTTATGATAGAAACGCAATTTTGGCTTTTTGACTTCATAGCTACCCAACA
ATTGATTGATCACTAATTCAGAGTCTCTAAAAACTTGTAATTGCAGTTGCTTCATATTGATCACCATTTCAAGCCCAAGTATTAAGGCTTGATATTATGC
AACATTATTGGAGCAACATTGTGTTAAGGTGAAGAAATATGGCAAGATCTCCTCTTGAGAAGTGACGAATATCACTCAGCGCTGGCTCATTCACGATGTG
ACGCCTCATCAAAATACATATACCAAGATGGTTAAACATCAACAACCATTGCATTTTCATTAGATAATTCATCAGTGAGTTCCCAATCATTTCGTATCGA
GTGGTCTGCGAAGAAGTCTGTCAATGTTTGCCCTTTCACAGCCTCTTAAGGAATATACACAATTTCAAATTGTTGAAACTGGATATACCATCTTGCTAGT
TGATCATTGAGGACGGGTTTTGACATCACAAATTCGATGAGATTTGCTTTAAAAATAAGATGGACAGCATGAGCTTGAAAGTAGTGTTTCATCTTCTGAA
TTGAGAAGAGCAAGGCCAAACATAGTTTTTCGATTGGCGAGTACTTCAACTCATTTGGTGTCATCATCCTACTCAGGTAGTAAAGGATATTTTCTTTCCC
TTCGCCATTCTCTTGGGCTAAGAGTGCTCCATCTAATCTCTCTTGAGATGATATGTAATGTATCAATGGCTTTCCAGGAAAAAGAGCTGCTAAAATTGGT
GGTTTGGTCAATTAAGACTTGATGCTCTCAAAGAAATTACTACAAGATTAGTCCCATTCAAAAAGAGTGCCCTTTTTATAAGACAACTGAATGGTTGACA
CTTTCTTGCTAGATTCGAGATGAATCTCTTAAGATCTGCTAGTTTCTCTTGTAGACTCTTCAATTCATGAATGTTTCTTAGATCAACCATCTTCAGAATT
GCGTCTATTTTTGCTTGATCAATTTTGATACATCGATGTCGTACAAAGAAGCCAAGAAATTTTCCAGAGGTAACTCCAAATGCACATTTCAAAGGATTCA
TTCTAAGTTGATACCTTCGTAGTAGATCAAGCACCATCTTTAAGTCTTGCAAGTGGTTACACTTTTTCCTTTATTTCACTACTAAATCATCAACATAACA
TTCAATATTTTTGTGAAGAATGCTATCAAAGATGTTCTGCATAGCTCTTTGGTATGTTGCTTTTGCATTCTTCAAACCAAAAGGCATAACTTTGTAGCAA
TAAATGACTTTAGGAGTGCGGAATGCGGTCAACTCTTCATCCTTTGGTGACATGCGGATCTGGTTGTATCTGGATGAACCATCCATAAAAGATATCACCT
CATATCCAGTAATGGTATCAATCATAAGTTAAGGGATAGGAAGTAGAAATTCATCTTTTGTACATGCATTATTGAGATCGCTAAAGTAAATGCAAACTTG
AATTTGCCAATTCTTTTTTCTCACACGGGCAATACTTGAAACCCATGTAGGGTACTTAACTTCACGGATAAATCCAGCCTCAATAAGCTTGTTAACTTCA
TTTTCTATCACGGGAACCAATTCAGGCCTAAAACATCGTTGAGCTTGCTTGATGGGACGTGCACCGCTTTTCACAGCAAGATGATGGAGTGCTAACTTTG
GGTCTAATCCACGCATTTCTTAGTAATTCCAAGAGAATACATCTTTATACTCTTTGAATAAGTTGATGTAGGCCTTTTCCATATCACTTGCTAGTGAAGC
ATTCACATAAGTGGGTTTTGGATCTTCATCAGTTTCAAGGTTGATTTCTTTCAATGCATCAACAATCACCTTTATTCCTTCTTCAAGTTCAGGTGGCGCA
TCTTTAGCATCTTTATCTTCTTGAGGTTCTCCATCATGGAAAGATATATGTTAACACCATGAGACATTCTCCGACTTTCTAGCAATTTTAATTGGAGAAA
AAATATGCCTTTCATCTTATGTAGTGACATGATATGAAGAGCCAACACTTTCTTCATCTTCCCCACGTTGCTAAGTGTAGACCACAAAATTCGACTTTGC
CTTTAGTACTTCTCCATAAGAGACTACAATGTTTGTCTGTCACCTCATTCTAGAAGAAATTAGAGTTTAAAAGTCTTTAACAGCATTTTGAGAGTTGGGT
AAAGCAGATGCTTGCATACCCTTGCTATTTCTCCAAACCTTGTTTTTCTTCCTCAATGGACCTAACCTCTCGAATAAAGAAATCCACTGCGTTGAGATTC
TAAGTTGATCGAAGACAGAAGGCCTTTTGTTAGAATTAATAGACTCATCTTCCGCAGTTATACAGTTGCTGCTCACCATTTTTATGGAGATGCAGATAGG
TGGGGGCTTTTTGTATCCCACCCATTCATGTTGTTGCCTCATAACAGGTTCTGATGGAAGCTTCCCCAATTTCAATGGTTCGTTAGGATCAAATCCAACT
TTTGCTAGTATCCTATAAGCATTATGATCAAAATATTCTTCTGTAAGCTTCATTAGAGTGCTTCATATTGGGGTGACATAGGGGCCTCAAATTTTCCGTG
AAGTATGACTTAGGAGCCATAGACTTTCCATGTAATTTTGTGGAGGACTTCATCATATCAATTTTCCTTACAAGAAGGGCCAAACCTTCCAGCGCATTTT
CTCGCAACTCGAGAGAGTGTACCTTGTCCTCATTTGCCTTAAGGACATAACAAAGAATGTATGTGACCTTTTTACTTGAAAAGGCACCAATCATGTTAGT
CATCTTGTCTGGATTGCCAAGTTTTAGATCTAACTTTTTCCTTATCGACCGCTACCTTAGGCATCTTGTTAAGGAATCCGACATCTACGAATACAATGTC
ATCAAATTTTATGGAATATTTCTTTAAGTAAAACTTTGCATCAGCAAAGTGAGCTTCAACTTCAGTGAATGGATTATCATATGTAATAATCCTTTTTGTA
ACTCCATTCTCATAATATTTCAAACATTGGTGGTAGGTAGATGGGATTACTTTGTTCTTTTGTACCCATGGCCTACCAAGCAAAATGTTATATGAAGTCT
TTGCATCAATTACATGTAACCACATGCTTGATTGCAACTCTTCGATGGTGAGGTCGATTTTAACGTTCCCTATGGACCTTTGTCCTCCTTGATTGAATCC
TTGGATCATCAAGCGAATATCAGTAAGATTTGTTGTTGATATCCCAAGTTTTTCATTATGCGAATCAGAAAGATGTTGATTCCAGATCCTCCATAAACTA
GTATTATTTCACCTTTTTCTCACACTTAAAACTGACCATGAATAAAGGGCGATTATGAAATGTGTTAGCAAACAAAAGATCATCGTCAGAGAATGTGATT
TTGGCCATTTATGCATTTTCGACTCGAGGAGATAGATGTGGAGCATATTTTGGTGATAGGCATGATGGATTTTCAACTTTAAGAGATGACTTTGGAGCAT
CTATTAGTGATTGATATGATGGAATTGCATCTTTCGCTTATTTTTCATCGATATTACAACATAGAGATTTTGTTCCATCGCATGTGAACTTGGTGTAAAA
TCAATTTGGCAAATATTCTCCAAATGTAATTGGTTGATAGGGCTCTAAGTAGTGGTGCATGTTTATTTCCTTCTTCTTTGAATAAAGACTCAAAGTTTTG
GTTTTGGGTCTCCTTACCATATTAATCAATCTTGTCTGATTGATGTTTTGGATGTCTTGCTCCATATTTCCTTCAACAAAATTGCAGGTCATGACCATAT
TGGGTATGTCAAAAGCGATACTGACTTAGTTTGAATTCAATTTCTCATCTTTGATTTCAATCTTCCTTTTGCGAGCTAAGTCCGTGATTTTGTCCTTGAA
TATGAAGCATTTCTGATAGGGTGGCCAACCAACCGGTGATGTTTGCGTATTTTGGATCATCACTCCTTTCTGCTTCATCTGGTCATTTCATCTCTGGTAA
CTCAAAAATTTTCATCTCAAGGAGTTCATCAAAGATTGCGGAAACATCCGAGTCAAGAAATAGGTAGTCCTTCCACTGCATTTCCTTCAAGGTGAGCTTT
TGGTTTGTCCTTCCTTCAAAAGAAGTCGTTTTTGTGCTCTGTGTATTCCCAACCTTGTGGTGAATTTCACATGAGAGGTATTAACGTTCAAGGTTTCCTT
GTTTTCAGTATTAGGAAAATATTTTCCCATTTTCTTGAATTCTTGCCTTTCTTTGACTTTGTGGAGTTTGTGGACAGGTGGCGCTTTAGACCAACTGACG
ACATGCTCAACTCCATATCATGTGCGCGAGAGTTCGATTCTTCAAAAGTTTCAGGCTTAATGCCTTTCAAAATATAGCGAAGACCCCAATGGATACCTTG
AATGCACATCTCTATGCCCGAAGCTTCACTAAGTCTATCTTTGCAGTTAGACTTCCATGCCTCCATCGGTTGATGAAGTCAAAGACCAACTTTTCATTTA
ATTGACGTGTGTTTGTAAATTTCACCATGCTTACAGTATGTCTTGTGCTATAAAAGCGGTTGAGAAATTCTTGCTCGATTTGTTCCCAACTATCAATAGA
ACCAAACTCAAGGTCTGTGTACCAATCAAAAGCATTGACCTTAAAGAAGCGGACAAATTGTTTGACGAGGTAATCATCGTATGTCCCAACATTTGTGCAC
GTTTCAATGAAGTGTGACACACATTGCTTTGGGATTCCTTTACCATCAAACTGCTGAAATTTTGGAGGTTGATAATTGGTAGGTATTTTCAAGCTATCAA
TCCTTGCAATGTATGGCCTTGCATATGTCAAGGAGGATTTCGTAGCAACCTCGTACTTCTCTTTAATGGTCCCCATGATGAACACCTTGATTTGGTTGAT
CGGGATCATTCCATCACAGGAAAGTTGGATCTCTTTAGCATGTTTCACTTGCTTTGAAGGGCGATCGACCATCTCTTGGACTTGTGGATGTTTTCCGGGC
GCATGCCTTGATTCTTCATCCATCATGCCTTTCCCCTATCAGTTAGCTTAAAAATTTGAGCATCTTGATATTGAACATACTTGTTCAAGTCTTCAATAAC
TCTTGTCAAGATCACAAGTTATTCTTCTACGGATGAAGTGCTAGTCGCCATCGCGTGCATTACCATAGTAGGTGATGGAGAATGGTGTTGATTTTTTCAA
ACATGTGATGCAAACATGTTATGTGGGTTGATCTAGTGCTCAAGAGATCATCTTCAACTAAAGCAGAGGGGCTTTTTGTATGTAAATAGGCCCAATTAGG
CAAGAACCCTCTCGAACATTTCAGCGACGTCTTCTTTTGAGGCTTTCACAGGAGACTTCACACATTTTGTGGACAAACCAAAAGCAGTATCATATTCGAA
TGGCATTCGTGAGGCTTGTTGTCCCAACAAGTTTGGCTTGGTTCCTTGTGATAGGTCCCATGTTTTTCGCAGTAACATCAAGGATTTTCCACATCGTATG
TAAAATTTGGATCCATTAGATTTTGTGGAAGCAAATGCGAATCCAGACGCACATGCATATTTTGATACATATGCAGATTCCGATGCAGATGCGAATATGG
ATGCATATTTCAATGCAGATCTAAAATTGGATGCAGACGCAGATTTGGATGCAAATGCAGATAAGGATGTAGATCCAAATTTGGATGCAGATGCATATTT
CGAGTTGATATTCTTGGAAGTCGTCTCAATGTTCTTGAACTTGTATTTTGGAGATGAGAGGTTAAAGTTGTCCTACTGGGCGTACCAATTTGTATGCGTC
TAAAGGTTCAATGCTGAAATACAAGAAACAGGAAAGGAAAAATAGCAAGCAAATAATAATATTTGTATTTGAATTAATGTGAAGGTTAAAATCTCTATAA
GATATCTCAAAAAGATATGTAATCCCCTGATTATTCTCTTCACATATGTTCTTGATTTGACGGAATACTTGCGGCTCAACACTTGGAGCGAAGACTTCTT
TGTATGCGGGAGAATTGTAGATCACCACTGAAGAGCAATGATCTATTCCTGTGCTTATGTATTTGTGTGGGTTTTGGTCAGAAGAAGACCTCTTTATATA