BAC Sequence – LE_HBa0029I24

>C10HBa0029I24.7
TGTGGTTGTTGCCCAGGCCGTCCGTCACGACGACGGTGCCTTCCTCCTGAGTCAGCAGCGCGATCATCTGATTCTCGCGCCGGTTCCAGCGGTCTACCAG
CGTCGAGAGGCGCGAGGCCAGCTCGGCGTTGGAGACGTAGCCGGGGGTAGTGCTCATGCGGTGCTTGGGTTCTCTCTGAGGGTTATCGGATGCCGAAGGC
GAAGCCGCCAATCGACGTGATGAGGTAGTTCGGGTAGGCCGGGGCGTCGTAGCCGTGGACCTGCGGAGGCGGGCTGGATGCGCGGCACCGCACGCGGAAT
GCGCGGGCACCGCCTGTCCATGCGCCGGACGCCGAGAGCGTCACCGACTGCTCGTAGGTGTAGAAGTTGGACGCAGTGAAGGTGTTGCCGTCGCCGCCCA
TCTGCTGAATCAACGCGCGGTACATCGGCGGCTCGTGCGAGGCGATGACGACCCACACAGAGTCGCGCAGCTCCTCCAAGATGACGTGCAGCCCGTAGAC
GCGCGTGTTCGCGGTGACGGTCACCGACACGGAGGGCGTATGACCCTCGCCAGCCAGCACCGGAGCGCCGAGCCAGAACTCGTGGATCGCCACCCAATCG
CCGAGCGGGATGAAGTTGTTGCCCGCCTGGTAGCAGAGGCTCGTTGCCCCGGTCCACCACACGCCGGTCGCCGACTGGAACTGCCCAACGATGTTGGGAG
CATTGACGCGGCCTCGGAAGAACGCGCCGCCGCTGCGGTCCACGTAGAACACCGCGTTGTTGGCGTTCTTCGCGCCGGAGCCGACCCACAGGGGCCAGTC
GCCGAGGTTGGAGATTTCCACGCGGAACTCGGCAGCGTTGACGATGTTGCCGTTGCCGTCGAGGGTGTGGGTCTTGAACGTGCCGCCGTTGATCGTGCCT
GCGTTTGCCGTGAGCGCGGCCAGGGAGTTCACCCTGATCTTGTCCGCAGTGATCGTCCCGTCCACCACCAGCGCACCCTGGATGCCCACGGTGGACTGGC
CGCCGACAGTGCCGATCACGAACGGATACTTGATGCTCGCCAAGGTGCCGCCCGAGGTGTACTGCGGGTGGACGAAGGCGAAGCGATCCGCGGTGACGAT
GAAGTCGCTGCCGGTCTGCGGGTTGGCGGAGAGGGCGATACCGGCGACCACGGGGACGCCGTTGATGGTGCCCGCGTTGATCTTGACCGAGTAGTTGGCC
TGCCACTGTCCGTACATGCCGGAGTGCTGCCCGGCGACCACGTTGAACTCCTGCCGGATGGTGGCGAAGTCGCCGTCCTTGAACGCCTGGACCTGCGTGG
CCGCGATGGCCTGTGCCTGCTCGGCGGTGATCTTGGTGGTGTTGAGCTGCTGCACCAGCGCGCCGGTCGGAGAGGTGACATCCAGGTCGGCCTTGCGCCA
GCCGGTGCCATCCCAAATCTGCGTCAGGTACGCGCCGGTCTGCACGGTCTTGACCCAAAAGGTCGGAACCTTGAAGCCGCCAGCGGGCGGGGAGGGCTGC
GCGTCCGAGAAGATCGTCGGCGCGGTGCTGGTCTCCAGCGTGGATACCTGGGAAGCCAGGGCTTCGCGCGCGGACGCTTCGGTGTCGATGCGCTGCTCGA
AGGCGGCCGAAACCGCCGACACCTGGCCGTCGATCTCATTGGCAATCCCCTGCGGCACGTTCGCGCCGTAGCTGGCCGCCATCTGCTGTCGGAATGCCGT
GTTGGCACCCTCGGCGTCCGTCAGGGCTTCGGTGGTCTCGGCCAGGCCAGCGATGTTCTCGCCGTGGCGGACTACTGCCGTCTCAACGTCGGACACGCGG
GCCTTGGTTGCGTCAACCTCGGCCATGACCGCGGTGCGGACCTGCGCCGCGCTGTCCTCGATCTCTGCGCCGAGGCGCTGCTCGGTGGCCGCACGCGCCG
CTTCGGTGGTGCTCTCCACCTCGTCGATGCGCTGGTTGAGCGCTGCGGAGATCGTCTTGCCGTTCTCGACCACCTGGCCTTGCAGCTCGGTGATCGCCTC
GACGCGCGCGGAGCGCTCGTCAGCGATGGCGCGATTGACCTCCAGGAATCGTGCCTGGCTACTTTGCTCGCCGTAGTCCACCCGCGCGAACAGGTCGATG
ATCTGCTGCGCGATGACCTTGTTGCCTTCGGTCAGCAGTCCGATCTCGTGGGTGGCCGTGCTGATCTTGTCGCCATAGTCGCGCTGCACGTCGAAGAACT
CGTGCGAGCGCATGATTTCCTCCAGGATCGCCTCGGCGTTCACGTCGATAAGGTCGATGCGGGTCAGCAGGTCTTGCAGTGCTGGCGAGCGGAGGAGCTG
CTCGATGATTGCGTTGAGGTCCGGGTCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTGGTCCATTATTCCTGTTATAAAATAATGATATATTGTTATTTCTCCTAAATCTTGTGATGTTTCA
TATTTTTTTTTAGATGAACTCATTCTTGATGAGGAAGCTCTAGTCATCATATTTAATGAGTTTGTATTTGGTGTACTTGAGGTACTTAATCTTTCTTTTA
CTATCTCCAATTCTTCTTCTGTATCCATTTCTTTATAACTATAGTCATTATTATCTATTACTGTGATTATTCTTTCAAAAGGATTTTCTATTTTTATTTT
ATCAATTTTATTTTTTGCTGTTATTTTATGTTTTGTTGTTAATATATAAAGATTTTTACATCTTGCTGTGAATACCTTACTTCCTGGTGCTAATTCTATT
CCTGACATTTTCCAATATAACACTAATGATTTATCTATATTTGTATCTGTTAATGCTACTGTATAATTAGCACTTATTATAAATTTAAATTTCTAGTATA
TTAAATTTCCTTTAACTGCTCCTATTACGCTTTTTTCTATAGGATATTTTATTCTATCATCTGCTAAATATATTTCAATGGGCGTATCTATTCCTTCTCT
GAAACAAGCTTTTATTAGTATTTCCGTTCCTCCTAAATGTACATATTTTATCGCTTCTTTATTTTTTATGTTTTGTATTTCTTTATTTATTATTCGTTTG
TTTATTATAGGTATATATGCTTTTCCACTTGTATATTTTCCGTCTATGATATGTTCTTTTTGACTAACCACATAATATTCTTCTTTCTGTCTTTTAAAAA
AGTTTTTTAGTATAGGTATGTCAAGTATTTTTTCAACACTTAAATCTAATTCTTTTCCTTTTATTTGTTCAAAAAGTGTATTATCAAATATGATTTTTTG
GTGTGATGATTCTTCATCTTCATAATTCTCTTTAGATATTATTTCGTTTTCAGACATTATATTTCTTCCTCTTCTTCTATTTCATTATCTAGTTTTTCTT
CTCCATTTTCAGTTTCTATATCTGATACTTCATATATACTATCGTTTTCACTTAATTCATTGTCTATGTATTCTATTTACATATATTCGTCATTACCTAT
AACTATTTTTGCAATTTGTTTTCTTTTTGAATTTTTTGGTTAATTTACAGTCTTTAGCTATGTGTCCTATCTTTCCACAATTATAACATGTACATTGGGA
TATCTTTCTTTTTGGTGTATATGGTCCTTTTATTTTGTAGTTTTTTACATAATATCTTCGTCTTGGTTGTTTATATTTATACTTAGTTTTATTTTTCTAT
AATTTTTATATCTTCTAGATTTTTGTTTCTTATTTGCACACTTAAACTGTGGTGCCATTTTATTTTTACAACATGATAAATTATTATTTAGTACTTTTTC
CATTTTTAATTTTTCTTTTTGGTTTTCGCATAATTGTGTAAACCATTGAGATAGAAATTTTATTCTAGCTCCTAAAGTATCTACCATTCCTTCATTATTC
CAATCCTTTATTATTTTTGTGCTAAACGGTTCTGGTAATTTTGTAAAATATTGTTTTCTTATTTCTTTTGCTTCGTCTAAATTGTATTTAGATTTGTAAT
AGTATTCTTTGAATGCACAAGTATATTCTTCTATATAACACATTTTACATATAGCTAATTTTGTCATAAGTTGTCTATTTATTATTTTTTCCCTATTTTA
TTCTCTTATATCCGTGGTCATACCTCCAAATTCATTTCTTATTGCTGATTCATATTTGTCTAGTATATCTATATTTGATGCTGATGGGGATCCATCCATT
TTCTTATCATTTCTAAGTAGTTCTAAACTTTCTGGGGGTAGATTTTCTATCCATAATTTTGTCGTTCCTATGAATGTTCTTTCTATATATCTTGGCGTTT
TTGTTGTTTCTATTTTGTTATCTATTAACTGCTTAGATATATTTCCTGTCCATAGTAATATTGCTTTTTTTATGTCTGTGACGCAATCTAAATCTAAGAA
ATTATATTGTTCACTTATTGGTTTCGGTATCCAATTTTTATTTAATCTACTATTCCATATTGCATTATTTCTATCTGATTGTTGATAACTTTCTGTATAA
TAAGTTGGTGGTGTCCACCTAGGACTACTTCTAGGGCTATTTCTGGGACTATTATCTGGGGTTTTGACTCTTGACGTACTAGGTCTATTCACATCTCCTG
TGTTTATTTCTAATTTTTTTAGTTTATTTGTCTGTTCTAAAATTTCTGTATATGTTTCACTTATGTCACTTATTTCTGATTTTTGGTCATTTTTCATTTT
CATCTAATTTTCATTTACTTCCTTTACCTCAATATCTTCATTTAATTTCTGTTCCATTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGGTAATGCAAACTGAACCCGTCCATCTATATGGGA
ACTTTCAAAATCCGGAACGGTGACTAGGCCAGCCTGCTCCAGAGAACGACGGACATGCCAGTTAACGTTAGTACCACGACGCAGCGCATCAAACCAGCCA
ATGAGCTCGCGGACAGATATTGGCTCCGGTGCGCGCCCCCCTCTCAGGGTCTCCGCAATTTCGCCCAACAAACGATTTCTTGCCTCAACGTCCATTGTTA
GTACCATCCAGATGATGAACCGACATCTATCGTGAACAAGAATTGACGTCGGCTCAAGGCTTAATAGGGACACTATCAGCTCAGGATCAAGATCGAGTCG
GGCCCTCTTAGGCCCCATCTCCCCTCTCCGCTCACCATGATCGGTGACCTGCTCTGCTTGTGCTAAGTTGTGGGGTGCGCTCCCCGAAACATAGGCTCAG
CCTAGTCATCGGCACCGCGCTTAATTATTGGGAGAGCTGTTAGGCTCTCACTTCTCAGCAAATTCACGCATCCATTCATTCTGCCTTTCACGCGCCTCTT
CCGCGAGCATACTGCGCTCTTGCAACTGCTGCCTAAGGAACGGCATCGTGGTGTCGTCTTCGTCAATTTGGGGGTTTAGACCAGCGCGAGCACGCAGCGC
GGCAATCACCTCAATCGTGGCGACGCCAATTTTTGCATACCTCAACCGCCGGTCTGAGAAGTAATCACTGCGATCACCGGATCCGTCATACTCTGCAACG
AAGTCAAGATAGGCTTCAGCATTTGCGAGCTTGATAGGCAGACTATGGACTTGGTCGAGCAGATCTACCGGCATCGACCTCCACACAACGTCCAAACCTG
ACAGATCGAGCTTCGGAGAGGGCACTTGAACGACTAGTTCGCCTTGCGGGCTGTTCGAGTAGTCGCGCTCTCCATGACGTGTTCCATCATCTGACACTAC
TGCCGCACATAGCGAAGCGAATGAATCTAAGGTAGCGGATACGGTGACCGCCAGATAGAGGAAGTCAGCCAGTCGGACTCTTTCATGGGCATCAGCCTCG
CGACGCCTTGTTAGATACCCATTGATCCAAGTACCTGCGACAGCACCTATTAAAGCTAGAACTCCGGTAACAATAGGTATCCATGGCCAATTGCTGTTCG
CCGCGCACGTGAGCACCTTCGCGCTCGCCGCGGCCAAGAGCATTTGATTTGCGTCTATCGGCCCCATCATCGATTCCATGTAATGACCAGCCTGCTGCCA
AAGTTAAAGGAACTGGAGTACGTCTATTTGAGCACAAATAGCCCCCAGGACAAGGCCCTGTCAGAGACATCGCGGAAAGGCTTAGACTCCACGTCCAAGT
CCAACACCCGCATTGAAGTAGAGCGTTCGTGACGCTCTAACTCCATCCCAACCCAGCTAGGCTCCGGAGAGCGTACTGCCGCCAAAGAGATAATTCGGCG
AGCTACTCAGGGCCACTACTGCTCATTTCCCTTAGAAACACATCGACCCCATCCTCCCCCGCTATAAGCATCACTGCGGGATAGCCATCAGTGCCTAGAC
GTTGTGCCGGGTGCGATAAGAGCTTTTGATCTTGCCCACTAGGAATGGTCTTGATTCCTCGCGGATGCGAATGCCATGCCCCCACCCAGCTGACCATGCC
CATGGTTCTTCGTTGAGCTTCATCGATATCATCCTGAACACCCGCCTTTCCACACTGGGAATCGATCGTTGTCGGTATGCTGTCATCGGGGGCTGGTCGG
CCATCAACCAAGTGAATGGCCCTCAACTTGAAGTCGACTACGCCCAGTATGCCCCCCGTCTCGAGCGGAAGCGCCTGCTCTCTCGCTGCCATGAGTTGGT
CTTCCAGACCTTCGTCCCACATCACGTTCCAGTCATCGATCTTCCTGGAAACCGTTCTTCTAACGCCAATGCTAATGTGGCGCACGCAGCCATCGACTCC
CGCCTCCCATATGTCAATGCTTGCTTCCGCCCCAGTGCCCTCATCCGAATCTGACGGGCAAGTATCCAGGCGTGAAGTAGTACCGGTTCATCGGCGAGAA
CGGACGATACGTCACGACAGCTCGCACCGCTTCGGATGGAGACCCCGACTGACTGGAGGTGTGACAGTCCCCAATCCTCCCGAACGATGGCCCTGTAGCA
CTGAGCCTCGAGCGAGCCGCCTCTTGTGGTTCTGGCATTTTCCTCCGCGCCCACTCCCTGACGGCTAGCCTGCATCGAGTGGCGGCTGAGCATCCTGGCA
TTGATAAGTGCTACGAAGGTTTGAGCGGCCTCATGCAGGCTGTTGCATGTGAGGATGCCAGAGGGGTGATCCCGACTCCTTGCACAGAAGCGTTGGAAGT
CGCTCTCCAGACTCGAACCGAACTGCTTCTATCCTAAAGCCAGCCGCCATGTTGACCTTTCCGAGAAGTAGTCGGTAAGCCAGGGAACTGGCAGCCGATG
GAGAACGCTACCAACAAAAAAGGCCCTTGGCAAATGCGCCAAGAGCCCTTGTTAACAGAAACAAAGAGGTATCCTCTAGAACGGAATGCTGTCGTCCCAG
CCACCTTGACCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCCGCTGCTGCTGCAGATCCACGCCGAGCGGGTTCTGCAACGCGTGATCCATCGAAACGATAGGAGTCACACTTATAAGAAAAAAGC
CACCTGGAATACCAGGTGGCTTCTGTCTTGGTGGGCCGTCAAGGATTCGAACCTTGGACCTATTGATTAAGAGTCAACTGCTCTACCAACTGAGCTAACG
GCCCGTGAAACTCAGACGCACATTGTAGCGTGCTTTCTGTTTATTGCAATACCGTTTCGGCTGCGCCGATGCGGTTGAATCAGTGGGGTGGCTGAGGGGA
TTCGAACCCCCGACCACCGGAATCACAATCTGATTCCGCTGATCTTGAACCCCAGCAAGTGCAAGCACTTACGAGACGCACATCGTAACAGGTGACATCA
CGGGTGACAACTAGGTGACGCCTAGTGCCGTCACAGGTGACGCGAGGTGACGCCGAATAAAGTGGTCATCTTCGGCGGACCTCTCCTAGGACAACCATTC
AGAACTACTCATTGCTGTTCACCACCGAGGACTACTACAGTTCCACATAGGTCCACCCAGGACCAACAACCGAACCACTCAGGACCGTACCGGGCAGCCC
CCGGTGCGGTCCTCCCGTTTTGACTTTTGCATCCCCCGAGGGCAAACGATGACGACTTGGCAAGAGAACGACCTGCACGCCGCCCAGCTCGAACTGGAGA
AGGAAAGCACCAGCCTGGGCATTGCCCGCTACGAGAAGATCAGGGAGCAGCGCCAGGAGGCCGAGACCGGCCCCGGCCGCAAGCTGGTCATGGAGAGCAT
CGACGCCACCGCCGCCGCGATCATGGCGTTCGTGGCCGAAGCCGACACCGGCAAGCCGGGCAAGCGCCACGCCGCCCTCAAGTTCATCCGCCACCTGAAC
CCCCACGCCCTCGCCTATCTGACCAGCTTCACCTGCGTCAACGCGCTGGTCGCCGATCACCGCAAGGCGGTGTCCGTGGCGATCACCCTGGGCCACGAGG
TAGCCAACGAGATCAACTTCTCCCTGCTCCGCGAGAAGCACCCCGGCCTGTACCGGGTGGTCCAGGAGCAGCTCAAGAAGTCCACCTCGGCCCGGCACTC
CACCGCCGTCATGCGGCACGTCATCGCCGACGCCGAGTTCGCCCCCGAGGACGACAAGCGCCTCTACCTGTCCGACAAGGACGCGCTGCTGGTGGGCATG
AAGCTCATCGAGCTGTTCGTCGAGGCGACCGGGCTGGTCGAGCTGGTCACCGTGGCCGAGCGTGGCAAGCGCCACCTGCTCATCGCCGGGAATCAGAAGG
TGCTCGACTGGCTGACCAAGGCCCACGACAGCGCCGCCCTGTACCAGCCGGTGCTGATGCCGATGGTCGTCCCGCCCCGTCCGTGGACCACGCCCCGCGA
CGGCGGCTACCTGACCGACATCGGCGGCCGGGCTGACCTCGTGCGTACCCGCAACCGCGCCTACAAGCGCGAGCTGGCGCTGGTCGATATGCCCAACGTC
TACCAGGCCCTCAACGCCATCCAGGCAACCGCCTGGAAGGTGAACGTGCCCGTCCTGGAGGTCATGCGCGAGCTGTGGAACGCAGGCGGCGGTGTCGCCG
GGCTGCCGGAGCGCGAGCTGATGGACCTGCCGAGCCGCCCTGCCCTGCTGGAGACCGACCCGGACTACTTCAAGGAGCACCACGCCGACGAGTTCAAGGA
ATGGAAGCGCGACCGCGCCAAGGTCTACGAGGCCAACGCGCGCAGCGTGTCCACCCGCCTCGCCGCCGCGCAGAAGATCGCCCTTGCGGAGAAGTTCGCC
GAGTACCCCGCGATCTACTTCCCGCACAACCTCGACTTCCGCGGCCGGTGCTACCCCCTGCCCCCGACGCTGACCCCGCAGGGTGATGATGCGGCCAAGG
GCCTGCTGACGTTCGCCCAAGGCGTGCCGCTCGGCGAGGACGGTGCCTACTGGCTCGCCATCCACGTCGCCAACTGCTTCGGCGTGGACAAGGTGTCGTT
CGAGGAGCGCGTGGCCTGGGTGCGCGAGCACGAGGAGCAGATTCTCGACAGCGCCCTCGATCCGCTGGACGGCCAACGCTTCTGGATGGACGCCGACAGC
CCGTTCTGCGCGCTGGCCGCGTGCTTCGAGTGGCTCGGCTACAGCCTCAACGGCCGCGATCACGTCTCCCATCTGCCCATCGCGCTCGACGGCTCCTGCA
ACGGCCTCCAGAACTTCTCGGCCATGCTCCGCGACTCCGTGGGCGGCGCAGCCACCAACCTGATCCCGCAGCCGAAGCCCGCCGACATCTATTCGCGCGT
GAAGGACGTGGCCCAGGAGAAGCTGCGCGCCCGTGCCGAGAGCGGCGACCCGCTGGCGATCAAGCTGGACGGCCAGCTCACCCGTGACATCGTGAAGCAG
CCGGTGATGACGCTGCCCTACGGCGTCACGAAGTCGGGCATGCGCGCCCAGGTGCTCTCCAAGTTCAAGAAGCTGGGCATGGAGGACGATTGGGAGACCG
CCGAGTACCTGGCGACCCTGCTGTGGGAGTGCATTGGCGAGGTGGTGATCGCAGCCCGCGCGGCGATGGACTGGCTGCGTGACGCCTCCAAGGTCGCCTC
GTCGGCCGACCTGCCGGTGAGCTGGACGACCCCTGCCGGCTTCCCGGTCCTCCAGGAGTACCGCGAGGAGGAAGGCGTCCGCATCCGGCCGCACGTCGGA
GGCCGCGAGGTGAATTTAGTGGTCAACATCGGCGGTACTAAGCTCGACCGTCGCAGGCAGACCCTCGGGATCAGCCCGAACTTCGTCCACTCCTGCGACG
CCAGCCACATGATGCTGACCACCTGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCACAATACCATGGCAGAAAGACACTGCAAACTTGATGCCCTCAAGCTGCGTTTTTCATGTTCTTCACCA
GTCTCCCGTGCCAATGAACATACTTTGGGAACCAAAGTTTCAATGTTATATGTGTATGTTCCATCTACCTGCTTCCAAAATAAGATGGCAAGTAATTTTA
GAAATAAAAGAAACTAATGTCAATCTTCAGCTAGTGCAGAATGACTCTGGGTTTACCATAACTAGGAAGCAGTAATTATACATACAAGATTCGTGGGGAA
TAAAAATTCTATAAACATACATGGGCAGATAGTCATCTCAGATTAACATGCATAAGATGATTAGAAGTGACTCTTTACACTGTACAACTAAAGTGGCATG
CTCATCTATACAAGTAAGAGGAAGAACTCAACCATATGTAACACACTTTAGCTTCAATAACAAAAGTTTTGACTATCAAAATAACTTAGTTTTATAGTAT
GGCTTCAACTAACAAAAGCACACTAGCTTAAACTCCCCTATATTTATTTGAGGTTGCTCAGATATGAATATTGAATACTGATTACTGAATACCACTTTTG
GAGCCCAAAGAAGTTTTTAAGGTGAATTAATCAGCAAAGCTTCTTTAATCAACCAGAACAGCATAGTGCAAAGAATATGCAATTAGACATTCAAGGACTT
TTCTTTTACATCTAATGAAGGTATGAATTTATGTGATTCTGTTACATATTTAGATTTAATAAACTACTCATTACACACCCAAATTGATACCCCAATAGAG
AATTGGACATTATTTTCATTAATCACCTGACTATAAATAAACCTGGTCAGGGTCTGGCAACCAGTAATCCTGACAGCATCTTTCTTAGAGTCATCCAGCA
GTTCAACAACCATGTCTAATAGGCTAGCAGCAAAGTATGCCCTGCAGACACACAAATCGGTAATATATTACATCCCTAGAAGATTAAGTGGAAGCTTACT
CCAACTTGTTATCATTTTACGAAATAAAATGATCTCTGAGTTACCGAGCATAGGTTTTGCCAAACAATGAGAATCTAAAGCATTATATTACAGAATCAGT
CTACCGGTAAGCGCATCAACTGCAATGCAGACTTAACGAAGGGCTAGCAAATAGAAGGTTGGAATAATATAGGACTAATGAAATTATATGTATTATGTAA
ACTTGCAATAGTTGATTACATGCAGCAGCTTGAATTAGTAATGACTAATATCAAACTCAAAATTATGGCATGCCCTACCAGTGCGTAATTTGAAGATGTT
TTAAATTGTTAAGCCTGACACTTTGATTGAAAAAGTGCCAGAAGAAATTAAAGAATAATTGTGGGAAATCTTAAACGTATTGAGTTCCATTATATCATAT
TCAGGAAAATACTACAAGAGAATACTCTTGGTGTTCAAACTCTTATACTTCACTGAGATGGTCATAAATATTGAAAAATAATAACTCACATTTGCTCTTT
GCACATGCAAAGCAACTTATTGTACACCTCAGCAATTACGTTGATAAATTTGATGTGCTCACTTCGCAGCTCTTTGTAGCATCTTTCTTCAAGATACTTT
GCGATCTGATCAAGAAAAGCGACATGTTTAATTTTACTGAAAGGGTTTACATCCACAGGCAGTGAAGAAAACCAATACCTTCGGGATTCTGAAAGGATTT
TTCGCTGCATATTCACATAATTTCACTATTTTCCTTTCATTAGGCGAGCCATCCTGCATACACAAGTTGCAGAGCAATTGAATGTTGCTATCACAAGTAC
CAACAAAGCAGATTCATGGATTGACTATGGCTACTCTTTATATCTTGCATTCTCAAGCATAACAAGGGAGTTACTCCCTCCATTCACTTTTACATGTCAC
TTTCAACATAACAACGAAAAGACACGTATCTTTTTCCGTGTTTTACGCTTAGCATAACTTAATTCCCTAAATCACCTACGAAAATACATCAATTAACATG
GGTATTAAAGTAAACGATTCATCTTAATTATTAGTATTTCTGAATGAGCATGGGAAGTTCAAAGTGGACAAGTGAAAAGTGGAGTTTAAGCTAGACAATG
TACTTACTGGTGATTTAGGGAAGATTTCAGCTAGCAATTTCTTGTAACGCTTAACGGGTTGTCGAGATCGAGACCTCATAGCAGGACAGCAAATGCACAT
GTTCCCACATGCAGGGAATAACTTCCGTGAAATAAATCCCATTTTCCTTCAGTTATCAGAATAAACAAGTAAAATTTCTCAGTCATAAAAGGTAGAACAA
AAGAACCCAACCAAAATAGCATACATACACAACCTTAGTGACAAGATAGATAAGTATTAACCAACCTTACAAAAAAAGGAATTGAACACTTAAAAGTAAA
AACCCAAGAATCCAAGAAAAAAACACCAAGAACTCCAAGAAAAATAACACCAAGAATCAAAAATAACCCACAACACAACCAACTCAAAACTCAAGCCAAA
ATCAAAATGCAGCAAAGAGAGAGATCGATCAACCAACAAGAAACGGTAACAAAAGTAAAAAAAAAAAAATCTGATACACAGAGGCCAAAAGCGTGAAAAC
CAAGATCATTAATGACAAGACAGAGAAAGCATTAATCATCTTCACAAAAACAAGAATTGAACATTTAAAAAAAAAATAACCCAAGAATCCCAAGAAAAAT
AACACCAAGAATCACAAAGGAGCAATAACCCAAGAAAAATAACACCAAAACTCAAAAAACAAACAATAACCCAAGAATAGGAAGAATTACCAGGACAATA
TACACAGCAAAAACTAGTGAAAGAAGTAAAAGCAAAATACCTTCTTCAACTACAGAAGAAGATCTTGGAACTCCCAGTGAAAAGGGGTTTCAAGAACTCC
AACAAAGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCGTAGCCGCCCTTGGTCGCACCAGCGCGGCGCGCGTAGAGCATGCCGCGAAGCATGCCGACGACCGCGTAGCCGGTTTCGTCGCCACCT
CGGCCCGAGGGGTCGATGGCGAGTACCTTGCCGGTGAACTCCTCCATTTCCGAGGCGAGGTACATGGGCCGGTACAGGCGGTCGCCAGTGAAGCCCACGG
ACGGGATGTCGCTGACGATGTACTCCGGGCCGCTGCTGTAGACCACGCGGATCGGAGCGACCTCGCGGTCCACGTCCATCACGATCAGGTCGGACAGCTT
GAGCGGGTACTTCTCGGCGTCGGACAGCGACGCATCGAGCATGAACTGGAGCATGAAGCCGGAGCGTCCGTAGGACGCCTCGCGCTCCATCAAGTCCTCA
TCGGAGAAGCGGACGCTCTCGCAGTTCTTCCAGGCGAGCTTGGGGTTCGCGTCGAACGCATCGGCGATCATCGGCGCGAGGCGGTCGCCGTACACCTGAC
GGTGCTTGGTGTCCTTCGGGTAGCGCGCAGGCCAGATGCGGATGACGTAGCCGCGCTCGGGCAGCTTGTTGTAGAGCGACTCCTCGGTCTGCGGAGTGCC
GAGGTAGATGATCTCGCCGCCAGGCTTGAGCACCGCGTCGAACTCCTTGACCAGCTCGGCGAGCTTCTCGCGCTGCACGACGGTCATGGAGTTCTTTGGG
ACTTCGATGTCGTCCGCGATGATGGTGTCGGCGCGGGAGCCGGTGAGCTGGCCGTTGATGCCGACCGACTTCACCGAGGGCGACTGATCGGGCTGCGCGG
GACCGACATCGAACGCCAGGTTCGAGTTGCGCTGGTCGGGACGCGGGCGCAGGTGTTGCAGCTCAGGCAGGGTTTCGATCAGGCGCTTGACGAACACCGA
GAACGCATCGGCGCGTTCCTTCGATGCCGAGACCACCATGATCTTGTGCTGGGGGTCTTTCCAGAGGAGCCAGCAGACGTAGGCGGCCGTCACCCAGGAC
TTGCCGACGCCGCGGTACGCCATGATGACGCGACGGCGCGGGCCGGTTTTCAGGAACTCGCAGATGTCGTACTGGATCGGAGTGGGGCTTGGTAGCCCCA
GCTCCTTCCAGACGTACCAGGCGAAGTTGCGGAAGTCCTCGAAAGGGTGACGAACGTGGAGGCTCGTCATGCCCTCCATCAGTTCAGCCGCCCATCCTCA
GCGGGATCGAACGGGAACTCGGACACCTTGTCGGCCAGCTTGCCCAGCGGTGAGCCGGGCGGCGTGGCCGCAACGTCGATGCCGTTGTCCTTGAGAAACT
GCCGGGCCACGTTGAGGATCGAGGCCAGGCCCTTCGCGTCCGACTCCATCGAGTCGATGGTGTCGGCGAGCTTGTCAGCGACTGCGGCGTGCAGTCGCTC
CAAGGCATCCTTGGGGGCGGTCACTTGTTGACGACGCGGTTCAGTACGGTCTCCAGCGCGGACGTGCCGAGCGACGCCAGGATGCACGCGAGCGCGACCT
GGGCGACGAAGGAGACGCCGGGGATGAAAATGACGATGGCACCAGCGGCAAGGCCGGTAGCGCCAGAGAGGATTGCGCGGCCGAGCGCCTGCTTCCAGGT
GATCGGATCGTTCGACGTGAGCATCTTTGCGATGCCCACGATGAGGCCGACGCCCGCGAGAGCGCCGACCAGCTTCACTTCATCGTGCATTAGGTCTCTT
GTAGGTGGTGGATGCGTTAGAGCGGACGACCGAAGCTGTACTCGTAGTTGCCGGTCAGGGTGATCTGCGTGACGCCATCGGTGACGACGACTGTGAACTG
CCCCATGCGGGAGGTGTTCCGCCCAGAGGCGGTCACAGTGCCACCGAGGCCGCTGCCGGAGATCGACGCGCCGCCTGTGACGGAGCGGGAGACCACGGAG
TAGTTGCCGGTGCCGCCCGAGCAATAAACGCTGAACGACTCGCTGACCGTGCCGTTGGTGGACTGAGGCCAGTTACCCATCAGGTAGCTCGGCGACAGCG
ATGCTTGGAACGGCGTCGCCTTGACCGCGTTGTAGAACTGCGAGGCGTAGATCGGGCCGCTCGTGGGGACGCCGTAGTTGGCCGGAACGTCGGGCACCAA
TCCACGTCCTCGGTAATACTGGTCCGCGTAGATCGGGTAGCCGCCGCCAAACTCGGCGCGGATCATTTCCCAGGAGATAGGGCCGGAGCCGGGGAGGGCC
ATCAGGCACCTCCCCCAAGGTCCGCGACGCGCTTACGCAGCGCCTGCACCTCAGCGATAAGGAAGGGAATAGCCTTCTCCCACTGGATCGTCTTGATGCC
GTTTGCGTGCGTGGCGACCATCAACGAGTAGACCTCCTCGGCCTCCTGCGCGATGCCGCCGACCTCGTGATCCGCGCTCGGGTGGAACGTGGGATTCAGC
TCGGCGATTGCCTTGGCATCCCAATCGAACTCGCGTACACGGAAGCGGTCGAAGAAGTCGGCCACCTTGGAGGCCGAGGCGTCCACGATGTTCTTCTTTA
GACGCGCATCGGACGCATAGGCGACGATGTTGCCCGTGGCGACCCAATTGTTGCTGCCGTCGCGGTAGGCGCACCACGAGAAGGCGTTGCTGGCGAGGAA
GCCGTGGTTGTTGTCGTTGCAATGGAGCCAGTGCGTGGTCCCGTTGTCGGAGTCGTAACAGGTGATGGTTGGCGAGTAGCTCTCCAAACGGAGGTCGCCA
CCGCTACCGCCTGGGCCAGCGATAAGGAATCCCTTGCCGCCGTAGGTGCGAACCCAGGTGCTGTCCTGCATCCAGATGCCGCCGCCGTGCGCTTCCGAGT
ACCAGCCGGTGCCGGACTGCTGGGAGCGGAACCAGCCAGCGTTGAGGTAAATCTGATCGCCGACCGTCAGGCGGCCCGCAATGTTCGCAGCACCGTTCCA
GTACAGGTTGTACCAGCTGTTCGTGTTCACGCGGGTGATCGAGCAAACGTCATCGCCAGCGCCGTTCGTTCCGTGGATGTACGCGGTTCCCGCTGCACCC
ATGCCGGTCAACCGCAGCGGCGCGCCATAGGCCAGAGTGACCTGCCCGGTGAAGGTTGCGCCACCCAGGCTCGCCTTGCCGTCCAGTGCGGACTGGAGGC
CGCTGACGTTTGCGATGGTGTGCGTGTGACCGGCGTCGGCCTTTCCTGCCGGGTTGAAGTTCGCCGAGGTCCAGACGGTGCCGCCAGCGTTGAGGGACGC
GACGCCACCCGTGCCATCGCCGAATCGGAACTCCAGCGAGTTCGCAGCTGGCGGCACGTACACATAGCGATCCAGCGACCCCAGGTACATGACGCCGGAC
GTGGCCTCGCCGCCAAATCCCTGCACACGAATCTGCCCGGAGGCGAACGTCTTGACGCCACCGATGGACTGATCGTCGGTCACGTTGACGACGTTGGCGA
TCTCGGCGGCGGTATGCGTGTGGCCGATTGCCGACTTCCCGTCGAGCGCCGCTTGCAGCCCGGTTACGTTTGCGATGGTGTGCGAGTGGGACGCCGCCGC
TTTGCCGTCGAGCGCGGACTGGAGGCCGGTCACGTTGGCGATGGTGTGCGTGTGCGTCGCCGCCGCCTTGCCGTCGAGCGCCGTCTGCGTCGCGGTGCTG
ATCGGCTTGTCGAGGTCGGCGGTATTGTCCACCTTGTCGAGGCCGACCTGCGCCTTGGTGTGCGTGTGGGTGCTCGGCGGGTAGGTCGTCGGCTTCCCGG
TGACGTGGGTGTTGAAGTCCACGTCGTCGCGGGTCGCCAGCGCGCCCAGGCCGCCGATGTCGCCAGCCACGAGGGTCACGTCGCCCTGCTTACCGGCGAC
GCTGGTGACCTGATCGGTGTTGTCGATCTTCTCCCAGGTAGCGCCGTAGAGCGCCTGGTCGCCGACTCGCCAGTGGATGTCGCCCACAGTGCCTTCGCCG
ACCACCTTGTAGAAGTGACCCTTCACCGGGTTGGCCGGGAACGCACCAGTGCCGGCATCCCACGATCCCATGTAGACCAGCGAGCCAGTGACGGCAGCCT
GCGCCTGGGCGGCCCAATGCTTCGCCGAGAACTCGCCCGGCGAGACCTCGGTGCCCTGCGGCGCGTTCGCGTACAGGCCAGCCTTGTCGCGGGCAGCCTC
GGCAGCGGCCTTGGCCGACGATGCGGTCTGCGCCGAGATCGAGGCGGCAGACGCCGAGCCGGACGCAGCGGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAGACCGGGGCCGCGCTGTCGCGGAG
CACCTGGACCACCTGGCCGCCCCACTCACGGATGAACTGCGCTTCGTTGTCGAAGCGAACGTCCGACACCACGACGCCAGCAGCGCCGTCGCGGCGGGCC
TGACGGATCTTCTGCGCGACCACCTTGACCCACAGGTCGCGGTCGATCATTTCGCGGCCCCACTCGGTGCCCACGGTCTGCATCAGGCGGCGCGGGGTCT
GCCCGTTGAGCCAGTCGAGCGGCTCCTCCTTGAGCGGGCCGTCCTCCATCGCGGACACCGGCAGGCCGGTGATGTCCGCCACGAAGGCGCGGATCGGGGC
CGCGAAGGACAGCTTCACGAAGCCGTGGTCGCTGACCAGGAACTCGGCCAGGGTGTCTTTGCCGCTACGGGCGCGGCCGGTAATTCCGATGATCTTCATG
GGGACTCCAGAAAAGGAAAGGCCCGCACGAAGCGGGCCAGTTACCAACAGGGATGTTAATGCCGCATACTCAGCGGTCAGAAAAGGAGCCGCTTATGGAC
GGGATCGAGTACGCCGAATACGAACAAGTAACGCACACGCAACAGAACTACGCAGACAGGATTTACGGCTTCGTAGCCGCTGAGGCGAGTTACGAGCATT
CCCCTCCCGCTAAGGCTCAGCAAGACCACGACAATCTCGTCAATAGGGTGCAGTCGCTGGTAAATCTCAAGGTGGTCGGCGGGGAGACCGCTGACGGCAA
ACCGACAGTCACAGTGTTTTTGCATGACAAGGTTGTGCGTCCGGTTGCAGCGGATCACGTCCGGGACGAATTAATTGCTGATTGGGAGAACGCTAGGGCC
AAGCGGGGCTAATCGTCACGCGAGCGAGCGTGCGACCAGCCAAGCAACGCCGACAGCGCCGACAGCAGCGGGCCACAGCTTGATACTGGCGGCGTCGCGG
TACATGGCACGTTCGAGGGTGTTGAGGCTGCGCCACCACAGCCAGGCAGCGCCGTAGGCGACGAAGGCGAACAGCACGGCCAGCACGGCGACGATGGTGA
TGAACAGGATCAGGGTTTCCACAGCTTCACTTCCTTGGTCTTGGGGTTGTAGTCGCCGTAGCGCAGGATTCGCGCGAGGCGTGCTTGGCGGATCGCATCG
TGCTTCGACAGCGGCTCGGTGCCGCCGCGGGGGGATGCGGGTGGTGTAGGTGGTGACGACGGTGTTCCACAGCGCGCCGAGGTGCTCCTCGACGGACGCA
TCGCGGTACGCCTCGTGGATTGGCATGAGCAGCTCGTCCGCGCCCTTGTGGCCGATGCCGGGGAAGCCGGGGTAGTTGTCCACCTGGTCGCCCGTGAGCA
CCTGCTTCATCCAGAACAGGTCAGCGTCGTGAGCCGAGATCGGCCGGACGCCCACGTCGGGACGGTTGGGGTTGTAGAGACGGATGCCGGGGATCGTCTG
CATGTCCTTGTCGATGGACACGACGATGCGGCTACCTGGCGCGCGCTTCGGATTCGGGTGCGAGGCCAGCAGGCCCAGCACGTCGTCACCTTCCAGGTTC
TCGATCTCCACGATCTTGTCGCCGAACTCGTCGTATACGAACTCGTCGAGCACGTACCACAGGGCAGGCTTGTCCTTGCTGGCGCGGTTGAGCTTGTAGG
TCGGGTCGATGTCCTTGCGGAAGTTGTGCTTCTTGCAGGACAGGGCCAGCAGGTAATCACGCGCGCCGAACTTCTCGACGATCTCGTCGATGTAGTCCTC
CAGCTTCGCCTTCGCGCGCTCGGGCTGGATCGCTTCGACCTTGTTGCCGTCGCCGTTCCAGTCGATGTTCGCGGTGTTCGAGAACGCGAGCTGGTAGCGC
AGCACGTCGGCGTCGATCAGCAGCAGGGGGCCGCGCTTGTTCATGCGTCCACCCACTGCCATCCCAGGAACGCCAGCGCGAACCAGCGGTGCAGCCAGTT
CGGACGCTCCTTGACCTGCACGAAGAAGTTGCCGCCGATGACCCAGGAACCGGCCGCATGCGGTGGCCGATAGGTCACGTAGGAAGTCATGGCCGCTTCT
CCGGGTGACGCTCATACCACGCCTGTAGCTCGGCGGCGTAGCGCTTCATTCCGGCCTGGTACTCCGGGCCGTCGCCGAGCGGGTACTCGTACTCGTCGCA
GACGTAATCGCTGGTGGGGATGTACGAGAATCCGCCATTGCTGTTTGGGATCAGCATCAGGCCACTCTCGGTGTGTCCTTTCAGGCACGAGCCGTAATCG
GCGCGTGGCGGCCAAGGCTTCATGTCGCACGCAGCGAGGCCAGCGCACAGCGCCAGGATCAGAAGTGCGCGCTTCATGCCATGCTCTCGTGTACGGCGAC
CCAGCACTTCTCGCCAACGCGGCGGATGAAGTAGATCGCGGTGTTCCACTCCACGGGGCGCAGCATGCGCTCCGTGCAGCACGGGCACTTGGCGTTGTAG
GCGTGAACCTCGGGCTGGTGTTCGAGCACAGCCACGCGGTAGGTAGTACACGGAGCGATCAAGCGGACATCGCCGTCAGCGGGGCCGCCAATGAAATGCA
CGCGAAGCTGATTCTCGTTCATCGGTTCGATTCCTTGAGGACTTCCAGGGCGCTCGCCTTGTCGGCGTTGCAGCGCAGGAGGCCGTCCTCGGCGTTGCCG
CCGAAGCGGTAGAGGTCGTAGGTGGTGGTGGTCGGGTCAGCCATCACGGCGTCGAGTGAGGAGTGCGTGCCCTCAATGACGGTCGGCTGGAGGAACTGCT
CCGGCACGACTTTCGAGGTGTGCGCGGCGCAGCTCGTCAGGAATGCGGCGAGACAGGTAATCGCCAGTTTCCGGGTCAGCATTTGCTGCAATCTCCACAG
AGCGGTTGGTGGTGGCGCGGGCGTTCCGCAGCGCTGCATCGAAGGCAGAGCGGCGCACGGCTTCGCGGTTGAGGGTCTCGACGGTCTGCTTGAGGTCGGC
CAGTTCCTTTGCCGACTCCTCCAGCTCCGTCACGCGCTGGGCCATTGCGGTGTACTTCCAGGCTGCGAAGCCGCCAGCCGCGAGCGCGGCAACGACCAGC
AGCGCCGCGAGGGCGCGCAGGATGTTGGTTGGGTTCATCGGTTCTCTTGGACGTAACAGGCGACTCGCAGAAGCTCCGAGGGAGTCGCGTCGGACTTGAT
CTGATTCGCGCGTGCGGAGATCACGCGCACGTTGCCCCGGACGTAGCCGAGGTCAGGTTCGATGCGGTCGAGCGTGGGTGAGTTGGGGCCTTGGGCCTTG
CGCCCGACAGCGCGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCAGCTCCTCCTTGGCGGCCTCGACGTAGAGTTCGTCCACGTCGCGCTTGTTGAGGTAGGCGTACTCCTCCTGATCCAGCAT
CGCGTACAGGCCGTTCATGCCCTCGGAGGTGAGGAACGTGCCGCCCTTGATGCCGTCGCGGATGATCGCGGTCAGCGACTCCTTCTGCCGCACCAGCATT
TCCCGCATCGAGTCGGCCTGCCACTGCTGGCGGACCTGCTGCGCGGCGCGCATGGCGACCGGCATCAGGGCCTTGCGGACCTGCGGGTCTTGGAACTCGG
GGTTCTGCGTCAGCGCCGCCATCCGCTCCTTGATGAGCGGCTCGATGTCGGTGCCGGGTTCGGCCTTGGCGATCTCCTTGGCCGCTTCGATCTGCCAGTC
GCGGACGCGGATGATGCCGTCAGCCTTGAGGTAGCCGCGACGCCATGACTCCGACTGCTGGGCAACGAAGTCCTCGGCCTGCCGGGGCGTACCCTCGGCG
TCCTCCTGCATACGTTGGGTCGCCGCGGCGGTGTACTGCTCGCGGCTGTTGGAGATCATCTGCGAGTTGACGGAATCCGAGACGCGCGTCAGCACCGCAG
CGGCGGTGCGAGAGAGGGCACCGGCACCAGCGGAGGACGCCTGGTCAGCCTGCACCGCCAGAACGGGGCGCTCGGCGAGATGCTGCGGCACCTGCGCGCG
GCGGATGATCTCTTGGGGTTTCGTGCGAGCCACGGGTTACTCGTCTCCGGGGATGGAATAGCGCTTGTAGGTTTGGATGTTGCTGTAGGCGTTCGCGCCT
GACTGCATCACGCCGCCCATCGCCTCGGCATTGCCGGTGCGGATACGAGCGCGTGCTTCGGAGCCGCTTTCGACGACTCCGTTCCTGCGGTTCTTCTCGA
TGAGGGCCACGTCACGGCCAGCCTGGGCCATGATGTCGTTCGCCAGCAGCTCGACCGAGTTGCCGGACACTGCCGCTTCTGCTGCGGAGGCGCGCATCGC
GGATCGCAGTGCGCGGGCCTCCTCCATGCGCTGTTGGGTGCGCTCGGCGGCCTGGTCGTTGATCTGCTCCTGCTGACGCTCCGCGGCTTCCTCGATGGCC
TTGTTGTTCTGATTCTGGCCGTACATGGTCGCCATCGCGCTGACTGCGGCGATACCGACCTGGACTGCTACGGGGTTGCACATGGGGTCTTGGTTACTCG
GACGAAGGGTGTCTTGGCGAAGCCGTAGGCGGACTCGACGCCGCTCTCGCGGAAGCCAAGCCAGCCGAGCCATCGCCGCGTGGTGACGGCGTGGACATCG
ACGAAGTTGAAGATGGTGCCGAAGGTGGCCGCCCACTCGTCGCTGATCCGCCGAGCTTCTCGGAGGAACGTGCGGCGGAACGAGGGAGCCACCAGGGCGT
CGGTGCCCAGCAGCCAAACCGAGGCGATACCCTCGGCGTGCTGGGTGAAGCCGAAGATGCACACGGGAGAACCGTCGTGCATCGCGGCGAAACTGCGGTC
GCTCGCGGTCACTGCGTATGCGAGCGCCTGGAGCGGGGTGTGACCATGCGAAGCCGCCACCTCCAGGATGTCCTCCTGCCGCATGTTCTCGGCGACGTGG
AGGATGTCGCTGGCGGTGGGGCTTCGATAGGTCAGGGTCATACTCGGCTGCGGGAGACGAACATGCCGCGCCACTGTGCTGACTGGAACCAGCACTGGAA
CGGCAGGCGGTTGACGAGGTGCATGCGGACGCTGTTGGCGTCACCCAGCACGGGGAACCGGCGAGAGCCGGAGTGGAACGTCGGGGCGCTGGTGCGGAAC
ACCGAGTCGTTGAGGACGCGCGCGGTGTACGCACCGGAGTGCGACGCCACGTAGGTCTCGACTCGGCCGTTGCCGTGTTGCTCGACCTCCAGCTCGAAGT
ACGCGCCGTCCTTGTAGGCGACCTCGATGTCACGCACCTGCGTGCGGCCCACCAGCACGGCCTGGTTCTGCCCGCCGCGAACGATGGGCTTGGTCAGCGT
GAGGCGGTGCTCGTAGTCCATGCCGACGACCACGCGGCCCTCGGTGTGGTTACCGGGGAGCGCGAGGCGGGTGCGGGCGTTGTCCCAGCGCGCCTTGGTG
ATGTCGAGGTACGCGCCGGGGTCTTGCCAGTCGTCCGTCTTGAGGACGGTGACCGTCATGCCATCGGGCACGATGTAGGGTAGGTCGATCCAGGTCTCGT
TGCCGAACTGCTGATAGGTGGGCTGCACCACCAGCATGCGGTCGAGCAGGAAGTTGTAGTCGCCCGTGGCGTCCGCGTCGTGCTGGTTGAGCACCATGCG
GAACTTGAGCAGCTCGCAGCCGCCTCCCGGCGCTTCCGCGACGGCGTACAGCACGTCGTTGATGGCGTGCATGTGGACGATGCGGCCGACGCCGGAGATT
GACCAGCGCGTCCATGCGGACTGCTGCTTCTCGTCACCGATCCAGCGGACGAAGTAGACGTAGAGCTGCGCGTCGGTCGGCTCGTCAGGAGCGAAGAACA
CGCAGTCGGCACCACTTGCGCTCGCCATCGCTCGCATGCGGCCCGGCATCAGCTTGGGCACATGCGCGGTCACGTCGGCGGCGTCGCCGGTCACCGACAG
GTCGTCGATGAAGTATTCGCGCACGCTTGCGTATGCGCCGCTGTCCTCGGTGAAGTACAGCGACTCGCCCATCAGCTTCGGCCGGATGTACGGCGAGCTG
CTGTAGCTGTTGACCGGATCGCTCTTGACGTTCTTGGCGGCCAGGTACGGCTCGGCGGTCAGGAGGAACTGGCCGCCCGCANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGTGTACCCGTGCTCCA
TCGAGGAGGTGAAGCACTACGGCACCTCGAAGGAGAACCGAATCATCGACGTGCTGGAGCCGGTGCTGAACCAGCACCGCCTGGTGGTCGATGCCTCGAT
CATCCGCGCCGATCAGAAGTCCGAACAGAAGTACCAGCTGTGCTACCAGCTGACGCGCATCACGCGCGACCGCGGCGCACTGCGCCACGACGACCGCCTC
GAAGCGCTGGCGATGGCCGTGAAGTATTGGGCCGACCAGCTCTCCCGAGACGTGTCCAAGGAGGAGCAGCGCTACCTGGAGGAGCTGCTCGACCGCGAGT
ACGCCTCCTTCATCCAGTCCGTGACCGGCCGCATGCCGTCACCCGACAACTACCTCGACATCCTGTAGGAGACCCAATGTCCAACACGCTCGCTGCGTGG
CTGATGGCGCTCGCCGCCGCTGGCCTGCTGTACCTGTTCCTGCGCCGCAAGAACGACGACGACAACGACGGCCCGAGCGCACCCGCGCCGGTAACGCCGT
GCGACTGCAACCACGCTCCCTGCTGCCACACCCAGGGCGGCCAGTCGAACCCCTACGCGCCGGTATGACCGACGCAAAGCTGCCGAGCCTCGTGGAGGTC
AGGGACAACCTGATCCCCGCGGCGGCCCGGCTGCTCCCCGGCGTGGCCTTCACTCCCGAAGCGAAGGTCATGCTGCTCGCCATTGGTCTCCAGGAATCTC
GCTTCGAGCACCGCAGGCAGATCAAAGGCCCCGCACGCGGCTTCTGGCAGTTCGAGGCGGGCGGCGGCACCGCAGGTGTACTCCGTCACCCGGCGACCTC
CGCACGCGCCTCACAGCTCGTCTCCGCGCGTCTGGAGCGTCCCTCGACCGCTGCGGTCAACGAGGCGCTCGCCTCCGACGACGTGCTCGCCTGTGCGTTC
GCTCGCCTGCTGCTGTTCACCGATCCGCGTCCGCTGCCCGCCCTGGGTAACCCCCAGGCCGCATGGGACTACTACGTCCGCAACTGGCGGCCGGGCAAGC
CGCACCGTGACACCTGGGACGCGCTCTACGCGAAGGCCCTGGCAACCATCCGCAACACCTAACCGGAACCCATGAACTTCAAGACCATCTACAACCGCGC
CAGCGAGCGCCTGGTGCGCGCCTACGAGCGCGCTAAGGGGTACGTAGCGCTACGCATTGCCCTCGCCTCGCAGTGGCTCCTGGAGCGCCTGCGCGAGACC
TCCCGTCGCACCTACACCGGCTGGCTGTTCGTCGTCGTGTTCCTGGCGCTGCCCTACGTCGTCCTCGGCGGCCTGTGGGAGCACCTGCGGAATGCCGCGG
AGCGCCTGTGGGATGACGTGAACGACATCGAGTGGGCTGCGTTCACCCCGAGCTACTGGCGGGAGCACATCAAGCAGTGACCACGCTGGCCTTTGACGGC
CGGCTCGTTGCTATCGACTCGCAGGTCACCGCTGGTGATCTGCGGTACGAGGAGGAGAAGTTCTACCGCACCACCGACACCACCGGGCGCGACCTGGTGG
TGTTCGGCGCGGGCACCACTTCCCACATCCAGCGAGCCGTGCGCGAGCTGTCGGAGGGATTCGACGAACTGACCAAGGGCGAGTACACGATCCTCGTGGT
CGGCCTGCGGGACAACCCGGTGGCCTTCTACCACGACGGTCTCCCTCTCGACCTCCGGCGCGACTTCCTCGTCGCCGGTAGTGGTGGTGCGATTGCCCTG
GCCGCCATGAAGGCAGGCCACAACGCGACCGAAGCAGTCCTCATGGCCTGCTCGACGGACCTCTACAGCGGTCCACCGGTGCAGACCTACGACACTTTCA
ACAAGCGCTTCCTTAGAAAACGGACATGACTTAACGGCGCAAGGATGCGCCTAAACTGGAATCCCCATCTGACGCGTCCGTTCCAAGGCCCCCATGAGAT
CGTTTATGCGATACGGCTTTTGAAGAAAGGTAGCCCATTGGTGAATGGTGGGCAGTTGAGGATTGGGAAGCCCCGTGGCAAACATGTAGGGTATTCGATT
CGACAAGAGACAGTCAGCGACCGACATGGAGCCACCATCCTCGATATGAATATCTAAGATTGCCGCGTGGAACACTTTTGCCGCCAGTTGGTCTAAAGCT
TGCGCGGAGGAAGCAACAACCTCGACCTCATAGCCGAAATTCACCAGGATTTCCTGCAACATCTCTGACAGGTCGGGGTCATCTTCTAAGACCAGTAGCG
ACCCCAAGCAACCCTTACCGTTTACCCGCGAAGCCATCTGACACCTCCCATGCGTAGCGGCCCGTACCCTATAACTATTGAAGGGGAATATCGCGCTGAT
GATTTGCAGCGTCCTGAACTGTTCAGCTAGAGAGTCAAGTCGTCTTCCTTGAACCACCACATTACAGCCAAGGCGACGAACCATACGATCAAGGGTATTC
CGACAAGGAACTGGAGTAACAGGTCTCTCATGTACTCGCATCCCGCCGACTCAGTAAGCGCGGAATCAAGGATACGCACCTGCTGCTCCACAACGCTTGG
GGCGGTGTTATCGTCGTTAATAAGTCCGCGGCTTCTTTCCGCCACGGCGTCCGCATCTCGCATCTTTACATGTTGATACAGAGCCGGTACTCCCACAAGG
ATTACACAAGCCAGCGTGATCGAAGCCGCGAACCGGGTGAGGATGCTATTGAGCGATGCCATGTGGTCTTGATGAGCTGTCTAGGGCAAACGCCAAGTCT
ACCGGACCACACAGACCGTCATCTCCTAGGGGGCTTGACAGAGCTGTTATCATTAGATAGACCTAAGTATTACTATAGTGGGACTGTAGAGTTCTATTCA
TTGGTATTCACCACCAAGTAGAACTACAGTCCTCCTATGCACTCTTGGGGTGTTCCTCTGTCCTCCTTGGGTGCCACTGCGGCGGAACTCCCATGCACCG
ACTTCTCCTGATCCTGCTCATCGCGGGCGTCACGCCCATCAACCCGCTCCTGGCGATCCTCGCGTACAACCGAGGGATGACCTGGGCTGTGCCTGTGTGC
GTCCTATGGGGACTTGGGTCGCTCGCCTGGTTCGCTGTCGTGGCAACGCGGAAGCGCTCCGGTGTGACTGAGGCTCCCTCCTCGCGCGACTGAGGGGTCG
AAACGTTTGCGGCAAATTTCCGAAGGGGTATCCAACTACTTGGAACCGCGCGATCACCCCCCGTAGGGGGTCGCCCCCTGTAGCGCAAAGGCACGATGCG
CCCCCCCCTTCGCGTCACCTGCGGCGTCACCACCTCGGCTAACCTGCTGATTCCAAAGGTGAACCACCGGATTAGGTATCCAGTGCCTAGGCAATCCCAT
GCGATACCTGGGCAACCTGCGGACATCCGCGCTCAAACGTTCGCGCCTCTGTCTGTCCCTATCTGTCTTTTTGCCCTGACCGCCACGCGTCCACCTCGGC
ACCACCTCGGCACACCTGCCTACCACCTCGGCGCACCCTGCCCCAGCCTATGCCCACCTGCCGCCCACCACGGCCAGCCAATGCGCCGCCACGGCCCACG
CAAGGCCCGCCACGGGCATCCCTACCGCCCCGCCTATAGAAGCTCCCCACGCGCGCGCTAGGCGCTCCCTGCGACCATCCAAAAATCGTTGCCATCGGGG
TATTGACAGCCATGCGGGGATTGATCTAATCTATACCCGTCGCCAGCAGCACGGCGGCAGCGGAAAAGGCGGCGACAGACGTGCGACCGATGGATCGACA
GCACCTAGAGCTTATCCCGCCAGCACTGAGGACTAGCCCCAAAGGCCCCTGAGCGCACCGCAGGTAACGTCCGGCTCAATCCTCCCACTACCGGGAGTGA
TTGACAAACCGGGAACAAACGGGCATAATGCCCACCATCGAACAACGGTCGCAGGGTGCGGTCGGGACAGTAGGAAAGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAGGTAGCCGTAGCGCTGC
TGACGCGAGAGGATCGGCGCGACGGCCTGCTCCAGCTCGATGGCCTCGGTGGGGAGGCCCTTGCTCATCAACAACGCGAACAGCGCTTGCGTGACCGCAA
CGTCCTGGTCGCAGTAGTCGTCCATTTCCTGAGACCACTGTGCCCAGGGGTCGAGGCCGCGTGCGGCCATCTGCGCCGCGTAGTCGCCTTTCCAGCGGCC
GAGGCGGTAGCCCCACGCTTCGAGGGAGTGACGGCCGATCAGCTTGCCCGGCAACACCGGGTTCGCTCCCTGCTTCTTGCGGGCCTTGAAGTCGCGGTCC
TTGAGGTCCGGGTAGACCAGCGTGGACATCAGCAGCGTGTCGAAGTACGCCTGGACCTTGAAGTCCGGGAACACCTTGGCGATAGCCGGAATGTCGAATC
CGGCGATGTTGTGGCCGACAACGCGCTTGGCCTTCTTGAGCCTCTCGACGGCCTGACGGACTGTCATTTCGCCCGTGCCGTGATCGTTGGCGGACAGGAT
GGGACCGCGCGGTGCGCCGGTCTCATCTACCTCTTGGAGGGAAATGCAGTGGATCGTGTCAAGTTCGTCGAGGAGGCCATTGGTCTCGCAGTCGAATACG
AGGATCAACGGCGGTCCTCCTTACGGGTAGCCGTGGTTGGTTACGGGGATTGCGCGGACGCGGCGGCGGGCGCGGAGGATGTACTCCGGCTCGGGGGCCT
TCGGCGGCGTGTGGACGCCCTGCGGCGCGTGGCCGGAGAAGTCGTCGTCCTCGAACAGTTCGTCCTGCTCGGGCTGGTCGGGATGCAGCGTGTAGCCGTA
GTCCTCGACGTAGTGCGTGATGCGGCGGATGGTGCGCTCGGTGCCGTTGTTGTTCAGCACGAACAGCAGCTTCTCCGATGCGTCGGCAACCGCGCCTTCG
AGGGATACGACCACCACCTCGTCGGTGCTGGGTTCGTAGATGGCGACATGGGCGCAGCACCGCAGATCGAAGCGGGCGCAGTGCTCGTGCGGCGTGCCGA
ACTCGAAGCCGATCAGGCTCACGAGGTGACCCTCGGGCGAGCGGAAGTTGCGGATACCGTTCGGAGCGGCTTCGCTGGTCCAGTCGCTACGGCCGCTCAG
GTACGCGGCCACGTAGGTGTAGCTCGCAAGTGACACGAAGAAGCAGTCGATGTCCTTGATTTCGGTCCCGTCGTAGAACGCGCGCAGGCTTCCGCCACCC
AGGATGACCAGGTGGCGGACTTCGGCCGGCAACACGTCGAACAGGGACCGAGCGTGTTGCTCGGCAGTCATGGTTGGTCCCTTAGCGGATCAGGTTGGTG
AAGCGCTCGGCGACGCGCAGTGCGCGCTCGGCTTCTTCCTCGTGCTCGTCGGCCTGCGAGTGCAGGACATCGGCCTTGTCGCGCAGCGTCGAGGCGGTGG
CGATGCGGTCGGCGCTGATCTTGAACAGCTTGTCCACCTGGCCCTCCAGCACCTTCACCACGTCGGTCACGGTGTCCTTGCGGAACGGGGCGGTCAGCAG
GTCGATTGCGATGGCGACGATCTCTTTCATTGGGGTAGTTCCTCGGCTTTGATGTGGATGACCACGCGCCGCCCTGGCTTGCCGTACATGACACGGCAGG
CTTGGTCGGAGCGCGGGAGTTGGTAGGGGAGAACGAGGCTCTCAGCGAAGGAGAGCGGAGCATCAGCTGGGATGAAGCCGACGACCGAGCGGCCGTCAGT
AGTCGGAGGTGGATACATCGGATGACTCGTCGGCGAAGTCGCCGTATTCGCCCGGAGCATCTGCATTGAGCAGACGGCCGGATGCGTGGTCGTAGCTGTA
GTAGAGAACCTGGCCGTTCGACTGGCCGGTGAAGCGATCCTTGAGGACGCGGAAGGTCGTGCAGTTGCGCTCGGCCTCGTTCTCGGCCTGCGTGTTGCGC
TCCAGGCCGAAGGCGAAGTGCGTCCAGAAGCCGATGGCGCGGCTGCCCTTGAAGTGACGGAGCATCACGCGCCCGCCTTCCTCGTGGGGCTTGCCTTCCG
GCGTGGCGAGGTGCGAGACCAGGTAGATGCAGATGAGGTGGCGCTGCGCGAACTGCGCGATCTTCGCCATCGTGTCCTCCAGCATCTTCCGCTCGTCCTC
GGCACCGGCCGCGAACGACGTGAGGTTGTCGAGGACGATGTGCTTGACGCCCTCGGCGACGACCATGTGGGCCATCTTGGCTTCGATCACGTCCCACTCG
GACGAGCCGAAGTGGTCGTAGATGAACACCTGGCCCTTGTCGAGAATCTCGAACGCGGCTTCCAGTTCCTCCTGCGTCCAGCTCCCATCGGGAACGTGGA
AGCGGCGGCCTGCAACCTTGCCTGCCATGCGCTTCGCCGTCTCGACCGGCTGCTGCTCTAGGAAGAACAGGCCAACACGGTCGCCGGTTTCCTGCGCGAT
GAAGGCTGCTTCCTCCATCAGCCAGTCGGTCTTGCCGATGCCGGTGCCTGCGCCGAAGGTGTAGACCTCGCCGTACCGCTTGCCGTAGGTCAGCGCGGTG
AGGCGCGGGTCGTGCCAGGGCATGCCCATCGAGACCGGCTTGAGTGCCTTCTCCTTGAGGGAGCCGAACGTCACCACGCCATCGGGGCGCTTGGTCTGCG
CTTCGTAGATGGCGCGAGTGATCGCCTCGGCGTCGCCACGCTGGAGCAGCTCGTTCGGGTCTTTCGCTGGGAGCTGTGCGATCTTGGCCTTGCCGGGAGT
CAGCAGCAGCGCCACTTCCTGCGCGGCGGCCTGGCCCGGTTCGTCCATATCGAACATGAGCACAACCTCGTCGAAGCCGTTGACCCACTCCAGCTCGCGC
TTGATGGACTTGGCTGCGCCTTGCGCCCCGTTCGGGACGGACACCACCGGCCAGCGGAGGCCGAGTGCCTGCGCCACGGAGAGCGCGTCGATCTCGCCTT
CGGTGATGACGAGGCGTCGCCCCGGTTCGTAGAGGTGCTGGCCGAACAGCCCGCACGCCTTCGAGTCGCCGATGAACGAGAACTTCTTGTCGGGGTAGCG
GAGCTTCTGCGCGACGATGCCGCCATCGCGCTTGTAGTTGGCGATCTGCACGGTCTTGCCGTGCTTGTCCTTGCCGATCCAGTAGCCGTACTTACGGCAT
GCTTCCTCAGTGATACCGCGCTTCGCCAGGGCTTGCGGTTCACCCTTCGCAAAGTCGCTCATGGTTTTCCTGCTGGTGGGTTGAGAGACCTCCTCGCCTT
CGGCTGGCTCGTAGTGACCGCAGCCGAAGCAGTAGCCGTGCCCGTCGCTGTAGCGCGCAAGGTTGTCCTTGCTGCCGCAGTTCGGGCACGGCTCTTTGTG
GAGGTATTCGGAGTCAGCGCTTTGCACGCTCCACGGACCACATGCGCTTGCGGTAGGAAATGCCGAGGCGACGATTCAGCGCACCCTTGACGGTGCGGCC
CAGGCCGCGGAAGGGCTTGTCGGCGCTCGCCCATGCGCGCTCGAAAGCCAGGCGCATCGCGGACGGAATGACGGTGGTGGCAGTGTTGGTCATGCGTTCT
TCTCCAGCAGGAACTTGGTGAATGCGGCGACTTCTTCGGTCGCATCGTTGGCGTCGAGGCCCAGCTCGTCGGTGCAGTAGTTGCGATACAGCTGGAGCAG
CGCATCGACGCGGTACTGCTTCGGAGCGCGGCGCGCTTCCAGGAGCGGAGCCTTGCTGCGGCGCTGACGGCGCGACAGGCGATAGCGCGTGTACCGCTGC
CCCGAGGCGTCCTCGCAGGTCTGCGTTTCGATCTCGAAGCCAGCAGCGCGCAGCTCATCGACGCGCGAGGCAAGGCGGCGGATGCGGTAGACGCCTTCGG
CCTGCCACGAGGTCAGGTGCGAGTGGCGACGCAGGTGATCCAGGACGACCTGGGTTTGCGGGGGCAGCGGTTTCACGTTGGGTTCTCCTATCGAGGGAAG
TCAGGTGCCCACACGACGGGCTTGCCGTAGGCGGCGAGCAGGCGTCGCAGCGCGGCGTGTTGGGCTTCGGTGAAGTTGTCCTCGGGCTGCATGGCGTCGT
TGACGCCGCCCAGGAGGCAGACTTGGTATGCGGATTGGTTGTGCTTACCGGCGAGAGCGCCGGGCTGATTCAGCGGGCGACCGTCGTAGATCGAGCCGTC
ACGTTCGATGACGAAGTGGACGGCGATCTTCGAGTAGCCCTGCGAGCGGTGCAGGCGTGCGAGTTCTTCGCCGGTCGTGACCTGCTCGGGGCGGGTCATG
CTGGCGAGGACGAACAGCGCCTCTACCGATTCCAGAGGTTTGAGGCGCACTTAGAGTTTGTAGAGGTGGACTTCGGTGCGTGGTTCTTCGTCCGGCTGCG
CCCAGCGCTTACCGGAGAGCAGCCACATGACTTGCTTGTCGTCGGCCCAATAGCCGGTGGCTTTGGTCACAACGTCCATCGGCCCCTTGGCGAGGTTGTC
CACGTCGCCCTTGGGAAACGCGGCCTTCGAGGTCTTGGCGCGTTTGCATACCGCGATGATGACCACTAAAACCGGATCGGTCGGCGACAGGTCCAGGTCA
CCGGCTGGCAGATGCTTCTCTGCGGCTTCCTTCCAGGTCTTGTAGGTCTTGCCGTAGTAGACGCCCCAGCGCGAAACCTTCGGGCGCGAGGCGGGCACCG
GGTCAAACGGGAACGTGAGGGAGGCCAAATGCTCGGCCCCCCTCGCGGTGTCCACGATGACCGACAGCGGATCAGTAGTCGCCGTCATCGCCCTCGTCGT
CGGAGTCGCTGTCGTCGTCCGAGTCGTCATCGCTGTCGCTGAACGGCGCGCTGTCGGCGGCCTCGTAGCCGTCCTCCTCGCCGAAGCCGTAGTCCTTGGC
GTTGCGCTGGCCGAACTCGACCAGCTCGATCACCTGGACGGCGACCATGTAGCAGGTCAGGTAGAACTTCTTGGCCGATTCGACGAACGAGCCGCCGATC
TCGTAGGAGACCTTGAGTTCGCTGCCGCCGCCGATCTGCGGCGGGTTGTCGATCTTCTTGCCGCGGGCGTCGAAGATGTCCGGGCGCATGGTGAACTTCT
TGCCGGTGCGCTTGCTGACGCCGCTGGCCTTCATCTTGAACTTCACCAGCACGCGGCCGGTGTCATCGCCGTTCTCGTCGGTTTCTTCGGTGAACACCGG
GGCCACTTCGGCACCCTTCTTCTTCTTCGGGTTCTCGCTCAGGAACTCCTGGAACAGCTCGTCGCGCCGGGTTTCCAGCTTCTTCGCCAGCGCCTTGAAG
TCCTTGTCGTTCGGGTCGAACGCCAGGCTCACGGTGTATTCGCCTTCCGGCTTGAACTTGGTGTCCGGTTCGTTCAGGCGCGGCCACACTGCGGTGCCCT
TGGGGGAGACGAATCGTTCGCGCTTCTTGGTTGCCATCAGTTGTCGGTCTCGTAGTTGGTCGGGAGATAGATGCCCGCGCGCCACAGGTCAGCGGCGGCG
GTCAGCGGGGTGTCGGCGGAAATGCCGAAGGCTTCGTCGATGTCGAAGCCGATGAGCGCCTCGTCGATGAAGGCGTCGGTGATCGGGTCACGCATCACGG
GTAGTGCGGTTTCAGCTCGCGCTCCGCGTAGCGGCGCACGGCGTTGAGGGTGTTGACCTGCCGGTAGCGGCAGTCCTGCTCCATGCGCGAGACGACCCGC
AGCACTTCCATCGGATCGAGGCTGAGCACTTCGCAGAAGTTCTTGAAGGCACACGCCAAGCCGATCACCTGATCGGCCGGGTGGCCGAGGGACTGCACGC
TGTCGATCACGACGAAAGCGCCGCGTGCGGCGCTCTCGGCAGAACGTGAGTGCAGTCCGTCGATGACGCGATCACGCACCTGCGTGCAGCTCCGTCATGC
GGTGCTTGAACTCCTCGACCGTGCCGTGTTCGGCCGGGTTGTAGATGCCGAGGACCACACCGAAGTGGTCCTGAGCAACGTAGGTGTTCAGTGCGTGCTG
GTAGTTGATGCTCATGTGGATGTTCTCGTTTGGGGTATCAATTGCCAAAGGGGGATGGACTAGGCAAAGAAATAGCGCGACTCCAGCACCAGGCTGAGGT
CCAGGTCGCCATGCGGCGGGAGGGGTGGGAGTTTCTCTGCCGCTTCTGGCGGGAGCTGCTCGACGAGTTGCTGTCGGAAGTCGGCCAGTACGTCGCCGCT
GTACTGATCGACGAACGCCTGTCGGAGTGCGGCGGCGAGGATTGCTGCCTGGCCTGCGTGCGTACCGTAGGAGTCGTGGATCATTGCGAACGACTCGATG
CCGTTCTCTGCCGCGAGGCAGGTGGTCAGCATCATGGGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCCACGGCGACCTGATCGACACCGTGCTCGACAACAACGGCCCGATCCACCGCC
TGCGGATGGTCGCGGAATCGCTGGCCCGACTCTAAGGGTTTAGTGGTCATCATCGGGGGAAACGACAGTTTCCCCACCTATTCATAACCCAGGAGTTCTA
TGCAAATCCCTCTGCACTCCTACGACCTGATCGACCTCCTGGACGAACTGCACCCCGAAGTGATCTACGACCCCGCCCAGCCGAAGGAGGAGTTCCTGCT
CCGGCAGGGCGAGCGTCGCCTGATCCTGCGGCTCAAGGCGCTGCGGAAGGTCGAGCAGATGGATCACCGCGCCCGCTAACCATGTGCAGCAAGCCCAACA
TGCCGGACCAGCAGGAGAAAGACCCGATCCTGCTGACCCGCCAGGACACCCAGCCGACCGGCCACGCGGCCGATCAGCGGCGTAAGTCCAAGGTCCGCCT
GGACCTGAACAACGCAACGCAGTACCAAGGACTGACCATCCCGAATGGCTGACGCCAAGCAGACCTCGGCCGAGAAGCAGACGGCCGCGAAGCGCTACGG
CGATCTCAAGTCCAACCGCAAAGAAGCCGAGACGCGCGCCAAGCGCTGCGCCAAGGTCACCCTGCCCCGCCTGTGGGTGGACGAGGGCGCGAAATCGCGC
ACCCCGGTTCCGCCTACATCGACACCGGCCCGAAGTGCGTCAACGCCCTGGCCTCGAAGATCGTGCTGGCCTGGCTCCCGCCGAACGCCTCGGTATTCAA
GCTCGCGCCTGACCAGGCCGTCGCCGAGAACATCGCCGAGCAGGCTGGCGTGGAGACCTCCGAACTGGAGGCCGCGCTGGTGGACGTGGAGCGGGTCATC
GTCAACGACCTGGAGACCAGCGGCGTTCGCCCGGTCCTCAGCGAGGCGGCCAAGCACGCCATCGTCCTCGGCAACTTCCTGCTCTACGACCCCGACGAGG
GCAAGCCCAAGCTGTACCCGCTGACCTCCTACGTGACCGACCGCGATGGCCTGGGCAACGTGCTGGAGATCATCACGCTCGACAAGATCGCCCCGGCCAT
GCTGCCGGACTCGATCCGCGCGGCGGTGATGCAGAAGCTCGCCCAGGAACGCGACGAAAAGACCAAGAACGACGACGTGAACCTCTACACCTGGGTGCGT
CGCTCGGAAGATGGCAAGGAGTGGGAAGTGGTCCAGGAGGTCGAGGGCGTCGAAGTCCCCGAGACCGTGGGCACCTACCCCATCGACGCCTGCCCGTGGA
TTCCCCTGTGCGCCCCGCCGTCCCTCGTGGACGACTACGGCGAGGGCTTGGTCTACGACTACGTGGGCGCGTTCGAGTCGCTGGAGGCGCTGCGCAAGGC
GATCCGTAAGGGTGCCGCCGCCCTGGCGAAGATCATCATGTTCCTCAAGCCGACCTCGACGATCCGCGAGCGCCAGCTCACCGAGGCCGAGTCCGGCGCG
GTGCTGCGTGGCGAGGCCAGCGACGTGACCACGCTCCAGCTCCAGAAAGCCTACGACCTGAACTTCGTGCGTCAGGAGGCCGAAGGGCTGGCGAACTCGC
TGGAGCTGATCTTTGGCGTGAAGTCCGCCGTGCAGCGCCCCGGCGAGCGTGTGACCGCCTACGAAATCCGGGTGCTCACCCAGGAACTCGACGACGCCCT
CAGCGGCTTCATGGCGATGTCGGGCGAGCAGCTCTTGCTGCCGCTGATCCGCCGCCGCCTGCACAAGCTCCAGAAGCAGGGTCGCCTGCCCGAGCTGCCG
CAGGAACTCATCAAGCCGCGCATCACCGTAGGCATCGCCGCCCTCGGCCGCGGCCACGACCTGAACAAGCTGATCGAGTTCGGTCAGGCAGTGGATGCGC
TTGTCGGCGCAGAGGAGAAGGCACGCCGCCTCAACAGTGGCGAGGCGATCTCCCGACTGGCCGCCGCTTCCGACATTTCCACCAAGGGCCTGATCCGCTC
CGACGACGAGCTTGCTGCCGAGCAGCAGGACGCCTCGGCGCAGGAGGCGATGGTCCGTGCCGCTCCGAATATCGCCTCAGCGATGACCCAAACCCCGTAA
CCCCCGAGAAGGACGCAATGTCGAACGAAACCACCGAGAAGCCCGCCAAGCCGACCAAGGAAGCCCCGAAGGCTCCGAGCGTCGAGCGTAAGGGCAAGGC
CGAGATCACCCGCAAGACGAACGGCCTGGTCATCGTCAACTACAAGCCCGAGGACAAGTAATGTCGCAGCCGGGCAAGTCCGAAGTGACCGTCAGCCTTG
ACGGCATCAACGGCCAGCCGACCCCAGGTCAGCAGCCGCCGCAGAACTCCCAGGACACCCAGCAGCCCGCACCGGGCGCGCAGGGTGGCACCGATGGCGA
GCGCCTGTTCGGCGGCAAGTACAAGACCGTGGAGGAGCTGGAAGCCGCCTACGCAGAACTGAGCACGCCAGCCGACGACAAGGGTGGCAAGGGCGGCCCC
GCGACCATCGACGACGCCACCGCGGATGACGCGCGTGACGCCCTGGCGCGGGCTGGCCTGAACCTGGACGACTTCGCCACCGAGTTCAACTCGAACGGCT
CGCTGTCCGAGGAGAGCTACAAGAAGCTCCAGGACGCGGGCTATCCGAAGGAGCTGGTGGACGTGTACGTCGATGGCCTGCGCGCTCGCGTGCAGACCTA
CGAGAACGCCGTCTACTCGCCTGCAGGCGGCAAGGCCGGTTACGACGGCCTGGTCCAGTGGGCCAAGACCAACCTGAGCGCCGAGCAGAAGCGGGCGTTC
AACGAAGCGGTGCAGTCCGGCGACGCCGGACGCGCAGCGCTGGCAGTCCAGGGCCTCGTCGCCCTCCGTGGCGGCAACGGCCGCCTTCTGAACGGCAAGA
CCGCGGCGAACGCCGATGCCGGTCCCAAGCCGTTCCAGTCGCAGGCGCAGGTCGTCGAAGCGATGCGCGATGTGCGCTACCACCGTGATCCGGCTTACCG
CGCGGAAGTCTCCGCCCGCCTGGCCGTGTCGCCGCTGTTCAAGTAATCCACTCAACCTCAAGCAAGGACTAAATGTCGGACGCAATCCCCTCCCGCCTGG
GTCAAGCCCAGGCCAACGGCGACGCCTGGGCGCTGTTCAAGCAGAACTACACTGCTGAAACCATCACCAGCTTCGTCGAGAACTACAAGCTGGACGGCCG
CGTGTCGGTGCGCAACATCGAGAGCGGCAAGTCCGCCTCGTTCCCGAACGTCGGCACCATCGGCTCCGAGTACCATGTGCCCGGCACCGAGATCAAGGGC
ATGGTGGTCGAGCACAACGAGACCATCATCACCCTCGATCCGATGCTGATCTCGCACGCCTTCATCGCCAACATCGACGAGGCGATGAACCACTACGACG
TGCGTTCCGAGTACACCCGTCAGCAGGGTGCGGAGCTGGCGCTCAAGCGTATGCAGAACGAGCTGCGCTGCGCGATCCTGGCCGCTCGCACCACCGAAGG
CAAGGTCGAAGGCCAGCCGGGTGGTGCCATCATCAAGGCCGCCACGATGGCCTCCGATCCGACCGTGCTGGCCGATGCGTTCCGCAACGCCCGCATGCTG
TTCGACGAGAAGCTGCTGCCGGACAACCCGCAGGAGTTCACTGGCGCACTGGCCCCGGCTCAGTGGTATCTGCTGACCGAGAACAAGGACTTGATCGACC
GCGACATCAACGCGGAATCGAACGGCTCCTACGGCCAGGCGATCATTTCCTCGGTCGCTCGCATCCCGCTGGTGAAGATCAACGCGATGCCGCGTGTCGA
TGAGTCGGCCCTGGCCTCGATCCCTGCCAAGTACCGCGGCAACTTTGCGGACACCGTGGGCGTGATCTTCCACCGCTCGGCGGTCGGCACCCTCAAGCTG
CTGGACCTGTCCCTGGAGGACGTGTACCAGGGCGAGAAGCAGGGCACCCTGATGCTGGCGAAGTACGCGCTGGGTCACGGCATCCTGGCTCCGCGCGGTG
CCATCGAGCTGTCGAAGGCTCCGTAAGCAATACAGCGCCGTTGGGCAAATCCCGCGGCGCTTCAATCTCTCTCCATCTACGGGGGACATCCACATGGGTG
TCCCCCGTTTTTTTGCCCCGAATCCATGAACCTCGAACTCACTCCGACCACGGAACTCGAAGCCGTCAATGTGCTGCTCGGTGCTATCGGCGAAGCGCCG
ATCAGCGACCTCGAAGCGCTCGGCAACCTGTACGCCTCGCAGGCGCGCGACACCCTCCGCGCGGTGAGCCGCGAGGTCCAAACCGCTGGCTGGTGGTTCA
ACACCAGCGAGTCGTTCACCTTCACGCTCAACGCGGAAGGCAAGGTGCTGCCGCCGCAGTCGATCCTCAAGCTCGTCCCCGCACGCGGAAGCGAGCCGCT
GGTGATCCGAGGCACGCGCCTCATCAACCCGCTCACCCTCGCCGACACGTTCTCGTCGGCACCCACCGCCGACTTCGTGACCTGGTTCCTCGCCTACGAG
GAGCTGCCCGAGTCGGCCCGCCGCTACATCGCCGTGCGCGCTGCGCGTTTGTTCCAGACGAGCGTGCTGGGTAGCGACCAGCTCTACGTGTTCACCGAGA
AGCACGAGGAGGAGGCATACCTCATCTTCGCGCAGGAGCACGCTGACTTCACCTACGCCCGCGGCCACAACTTCCTCAGTGGCTCGACGGACGTGTCTGA
TATTTGGGACCGCTGATGCCGCTAATCACGGGGGACTATCCCTCGTTCCTGGGAGGCGAGTCGCAGCAGGACGATACCGTCCGCTCGCCGAACCAGCTCA
CCAAGGCGATCAACGCCTGGCTGCATGCCGCAATGGGCGCGGGCAAGCGCCCGCCCGCCGAGTTCGTTGCTGGACTTGGCGTCACCCTCGATCACGACTG
TGCCTTCCACTCCATCGTCCGCGATGAGAACGAGCGCTACATCGTCGCCGTGGGTCACCGCAGCATCCGCGTGTTCGACCACGAGACCGGCAAGGAATAC
ACCGTCAATGCCACGGGCGACGCGCTCAACTACTTGGACACCCAGGGACAGCGTGCGTGGTCGTGCTTCGCGCTGGCGACGTTCTCCGACACCACCTTCA
TCGTCAACCGGCTGGTAGACGTGAAGCAGAGCGACGAGCTGTCGCCCGGTTCGCTGTACGGATCGGCGCAAACGATGTCCGACCTGCCGAAGCCCGGTGA
CAAAGGCTCGGCCGTTGTGCCGACCGGCGCGATCTACAACATCATCGGCTCGTCCGAGTCGCAGTTCGACGACTACTACGTCCAGAAGCAGTCCTCCTCG
GTCTACCTGGAGGTCGCCCGGCCGGGCATCAAGCACCGCTTCGATGCCAAGACGATGCCGCACATCCTCAAGCGCATCCCCGATCCGGTGCATGCGGACG
GCTTTTGGTTCTCCTTCGGTGGACCGGAGTGGACCGCTCGCCTCGCGGGTGACGAGCAAAGCAACCCGTTCCCGTCCATCGACGGCCAGCGCATCCGCGA
GGTGTTCAAGCACCGGGACCGCCTGGGCTTACTGGCCGGGGAGAACGTGCTGATGTCCGAGGTCTCCGACCCGTTCAACCTCTGGCGCACTTCGGTGACC
CAGGTGCTCGACGCCGACCCCATCGACGTAAGCGTCAGCGGGTCGAACGGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCTGCAAAGACTCCGAGAGGCAGCCGAGAAAGCTAAGATAGAG
CTTTCATCAACATCTCAAACTGATATTAACTTGCCGTTCATCACAGCCGATGCATCAGGGGCTAAACATCTGAATATCACACTGACAAGATCAAAATTTG
AGACATTGGTGAACAACTTAATCGAGAGGACAAGGAATCCTTGCAAGAATTGTTTGAAGGATGCTGGAGTATCTTTAAAAGATGTGGATGAGGTCCTCCT
AGTTGGAGGTATGACGCGTGTTCCTAAGGTGCAGGAAATAGTTTCTGAGATATTTGGTAAAAGCCCCAGCAAAGGTGTTAATCCAGATGAGGCAGTTGCC
ATGGGAGCTGCACTTCAAGGTGGTATTCTCCGTGGTGATGTTAAAGAGTTGCTTCTTTTGGATGTAACTCCGCTATCTCTTGGTATTGAGACATTGGGAG
GTATCTTCACTAGATTAATAAACAGGAATACTACCATTCCCACAAAGAAAAGCCAGGTGAGCTGTTGGATCTTAATGCAGTCTCCTGTTTATTTTTATTA
ATGCCTAGTTTCAACAGAATGGTTCTCCTTTCGTCCAGGATCCACATAATCTTTTCCATGTTGGGAGATTTGTGACTGTTCCATGTTTATACAAATATTA
CAATTTTCAAGAAACCTAAGTCACTGAAGTTAAATTTTTAAATTTGATGTGATTTTTCTTTGTCGAACTTTTCGTTTCTATTGCATCGTCCCTAATGTGA
CTTGACAAATTAGCATTTTCAAGAAACCTAAGTCACTGAAGTTAAATTTTAAAATTTGATGTGATTTTTCTTTGTTGAACTTTTTGTTTCTATTGCATCG
TCCATAATGTGACTTTACAGCATCTTAAATTTTGTCTGCTGTCAAAAATGGGTCTGGAGAAGGATGACACATGGTGGTTGTCGAGGTCATAATTTCCAAT
GTGAAGTACGCTTGTTTTTTTTAGGTGTTTACAGTGTGTTGTTGCTTTGTGTATTTCAGGTGTTTTCTACTGCTGCGGACAACCAAACGCAAGTTGGCAT
CAAGGTATTACAAGGTGAACGTGAAATAGCATCTGATAATAAGCTTCTGGGTGAATTTGAGCTTGTTGGTATTCCTCCAGCCCCAAGGGGTTTGCCTCAG
ATTGAGGTCACCTTTGACATAGACGCAAATGGTATGGTCACTGTATCTGCCAAAGACAAGGCTACTAGCAAAGAGCAGCAGATTACCATTCGGTCATCTG
GTGGTCTATCAGAAGATGAGATTGACAAGATGGTCAGGGAAGCAGAAATGCATGCCCAGAAGGATCAAGAACGCAAGGCACTTATTGATATCAGGAATAG
TGCAGACACTACCATATATAGTATCGAGAAGAGCTTGAGTGAGTACAAGGATAAGGTCCCCAAGGAAGTGGTTACAGAGATCGAGACAGCTATTTCTGAT
TTGAGAGCAGCAATGGGGACTGAGAACATTGATGATATCAAGGCGAAACTTGATGCGGCAAACAAAGCTGTCTCAAAGATTGGAGAGCACATGGCTGGTG
GCAGTTCTGGTGGTGCATCTGGAGGTGGTGGTGCACAAGGAGGAGATCAGCCACCAGAGGCAGAATACGAGGAAGTAAAGAAATAGATATTTATTCTAGG
CATAATTGAATAGTGCATGAAAAAGACAAGAGAGAGATGTTATAGATCTACTTTCCTTCTAAAAATGAGTTTATTTTTTCCATCACTTTTCCCCTTCCCC
GGAAGTATTTTGTGCTCAAGCTCAAAACTGGTTGTATCAATGGTCTTGAGTTGTGAATTTCTTAGCGTCTAGTCTTCTATGTTCAGTAGAACAGGTGAGT
ATGATTTTTGACAGCCCTTCAATGTTAAAATTGACAGAAACAATGCTTTGTTTCCACAATAATATGATACTGTCCTTTTAATTTACAGCTTTTTGCCCGC
TTTACCTTTCCATATGTATCTGTCTCATCTTAGCAACCAGTAGAACTGATGTCAATATATAATTTAATTCTTTTCTCAATATTTTGGTATGGGAATAGGC
TCTGAAAATTGTTTATTTTAGTTTGAAATTGCCGTAATGGTATCAAATTTTATGGAGAATTTTTTACAGCTTAACTATTATACCAAATTTTATGGAGATT
TTTTTACAGCTTAAACTATTTAATAGTGTATTAGGTATATATGTGCTCATGTTTTGTGGCTACGTGGATATATATATATACCTTTAAAATACACTATTAA
ATAATGTAGCAGGCTAAAACATTTTTTTAAAAATTTGGTATCATAAAATAATTTTGATTAAAATTTAAATATATTTCATACTTTTTTTTTTATTGACATT
GCTTTTCATTTTGGAACTGTTTCAGTTAGAAGAATAATAAAATTTACGCATATTTTGATAGAATAAAACAGCAGTTAATATTCTCATTAAGACAAAACGT
GAGCATTTGTTTCAAAACTAACCTTTCCTATGTTTTCCTGTATGAATTCGATTATGTTCAATTATAAAAATAAAGATGAAGATTTGTTTGATTATCTTTT
TTTTTGATGTAATCCTTTAAGAACCATTGAACGTGCCATAGAACTATTAATTAAAAGAAAACTATGATTTCTTCTCAATATTTGTTGTGTATTATGTATT
GAACATAAATTTTGAAATTTATTTACTTGGTGCTTTAAGAAAGCAAAACTTTTCGATAAGGAGCATAGTATATCATTATTGATCTTACAGATTGAATTTT
GTAAATTCAAATGTCAATATGGAAATTGCACATTTATTGCTAAAAACACATGAGGCTTGAATGCACATTAATCAAGCTAGTAAATTTGAATTTCTAATGC
TTAAAACAAAAATTTAATTATAACATGAGATTTCTATTGATAATTTCAAGCGGAAAATTATTAAAAAAACAAAGAATACTATATAATGTTTTTTTTAAAC
TCCTTTAACATTAAATAAGAATGGTGCTTTTAAAAATATTTTGAAAAAAAAACATTCCACAAACCATTTATTTTACCATATACTCTATCTTTTATATATA
AAGAATACAAGGATGGACTTAGAATATGCCCCATACTTCATGAACACATATTTTAAATCTTGAATAAATAAAAATAATCACAGTATAACTATTAGTAATA
TTTTGCCTCTTAAAATTGAATCAAACAAAATAACGTGTGTATATAAGTTGAATCACAGCTATTTCTAATCTATTTGTCCCTTTTTCTTTGCCTCTCTCTA
AAACCCTAAACCCTAACACTGAACTTCCCCTTTACAGTTATAAAGTAGCGTTGGCCACACAGCCGCCGCCTTGCTCAATCTCTCCTCGCCGTGAACTACC
TCTTCTCTGTTATGATCTTCTTAAGATCACAAGCTCAATTCACCAACAAATCAAAAAATGCAGAAGAAAACCAACTGTAGAATTTATTGATACCGAAGTT
CTTTATTACAACTACTGATACTATAACTATGGAATCTACTGCTACGCCATTGATGATCTGCAAGGAGAAGAAGAAGAAGAAGAAGAAAAAGAAGAAGATT
CTGGATAGAAGAAGAAAGAAGGAAAAAGAGAAGAGAATTGGTGTGACTTATTTTTCAGTTATTTCCCTCTCTCTTCCAGCATGACCACTTATAACAACCT
CCACCAACAACCTGTACCCACGTGTCATAATCCTCACCCTCAACTTTCCTTAATCAACTTCCAATCTCATCCGTTCATTTTATATTTCTGTTAACCTTTC
CATTTCCTGTTATTGCCAGATTCAAGGATCGAATCCCTGCAACCCATATTTGTTATACCTTTAACTGTTTAACTGCAGTTCATAATTGTCCCTTCCCCAT
CAAAGCATCCTTGACCTCAAGGATTAGAATCAAAACCAGGAAACTTAGCCTTCAAAAAATCATAATCCTCCCAAGTGGCATCCGATTAGACCATTGAACC
AAAACCCGAACAGCAGCCACATTGTTTCGTTTAACCATCTGCCGCTGCAGAATTGCCACTGGCTTAACCAAAAACTGTCCGTTGTCATTTGTATAAGGCA
ATTCTGACTGTATAACCACTCGATCTCCGACCTTCTTCTTTAACAACGAAACATGAAAAACTGGATGAATCTTATAATGCGAAGGTAGAGCTAATTTATA
AGCCAACAACCCAATTCTTTCGACTATCAAATAAGGACCATAATATTTAGAACTGAGCTTCAAATTCCGTCTCAAAGCAATAGAAGTCTGCCGATATGGT
TGAAGCTTTAAGTAAACCCAATCTCCCACTAGAAACTCACGCTCGGTCCTTTTCTTATTCGCGAAAAACTTCATTCTAGCTTGGGCAGTAGCTAGATTGT
CTTTCAACAATTGAAGAAATTGTTGTTGATGCATCACTGCGTCTTCTGCTGCCTGTACTACTGTCTCCAAAAGAGGGTCAATTGAAAGTTGAGGCGGAGT
ATAACCATGCAACGCTTCGAATGGAGTACATCGCAGACCCGTGTGGAAGTTGGTGTTATACCACCATTCTGCAACAGGTAGCCATTGTTTCCACTACGTA
GGCCTGCTTGTAGTCATACATCGAAGGTAATTTTCCAGACACCTATTGACTCTCTCAGTTTGTCCATCACTCTGAGGATAATAGGCCGAACTATAGTGCA
ATTGTGTACCCATTAGTTTGAACATTTCCTACCAGAACTTACTCAAAAATACCTTGTCTCTGTCAGACACAATACTGTCGGGAGTACCATGTAACCTATG
AATATGTCTCCAATACAACTCAGCTACTGTTAGAGCAGTATATGGATGAGACATAGCTATAAAATGGGCATACTTGGTAAATCGATCTACCACCACCAAT
ATCACGCTTTTAGCTTTCGACTTCAGCAAACCTTCTATAAAGTCCATGCTAATATTACTCCACGCTTGATTAGGAATTGGCAATGGCTGAAGTAAACCGG
GATAGGCTGCATTGTCGTCCTTGTTACGATGGCAAACCTCACACTGAGCTACAGATTCATTCACCATAGCTCTCATTCTTGGCCAATAGAAATCTTGAGT
TAACCTTTTGAAAGTGCCCAATTGGCCCGAATGTCCACCCAAAGGAGTGTCATGAAAAGTAGAAATTAGTTGTTGTCGTAAGGGCCCTTTGGAACCCACA
TAAACCTTGCCTTTCTTCCTTAAAACCCCATTGACGTTATGCCACAAACTAGGCCCGTGAACATCAACTGATATCAAGGTTAGCAGCTCTTGAACATAAG
GATCCTCCATATAACTATGCATAATTTCTTGTATCCACATTGGCATAATCATACTCACAGCCATCAGTAAACCAGCCGAAGACTTTTCACTCTCTTGTAA
CCTTTCGTCTCGCCTGGATAGAGCATCTGCTACCCTATTCTCCGCTCCTTTTTTGTATCGCACCTCATATCAAGGTCTAATAATTTCGTTATTCCTTTTT
TTTGTATAGCTGATGTTACTCGTTGTTCCAACAGATCTTTCAAACTGTGATGATCAGTCTTGACCACAAAGTGTTTGAACTGTAAATAATGTCTCCATTT
ATCCACTGCGTTAAGTAGAGCCATATACTCCCTCTCATAAATCGACTTGCCCCTATGTTTAGGAGCCAATACTTTGCTAAAGAAAGCAATTGGCCTCCCT
TGCTATGTAAGTACAGCTCCAATACCCCTATGACTAGAATCAGTCTCTACCACAAACTCTTGGGTATAGTCAGGAAGAGTCAATACAGGTGTATTCGTCA
TAGCTATTTTAAGAGCTTCAAAGGTAGTTTTGGCATCCACACTCCATTTGAAGGCTTCATTTTTTAACAAATGAGTGAGTGACCTGCTGATGGTCCCATA
ATTTTGCACATACTTCCGATAGTAACATGTTAGCCCAAGAAATCCTCTTAGAGCCCGTAAGGTCTTAGGTCTAGGCCATTCTATCATAGCTCAAATCTTA
TGAGGATCGGTAGCCACCCCTTCCTTAGTAATAATATGGCGTAAGTATTCCACTTGAGCTTGCCCAAAAGAACATTTAGACTTCTTTGCAAACAACACAT
TAAGCCTCAAAGTTTCAAATACCACCTGCAGATGCTGTAAATGCTCCTCCATATTTCGGCTATAGATTAATATAGCATCGAAAAGGACTAGAACAAACCT
TCTGAGCGATCTAAAAATCTAATTCATTAATGCTTGAAATGTTGCTGGAGCATTGGTAAATCCGAAAGGCATTACTCTAAACTCATAATGGCCCATGTGA
GTCCGAAATGCCGTCTTGTGCATATCTTCCATCTTCATCCTAATTTGATGATAACCAACCCTCAAATCTACCTTAAAAAAGATTGACGCCCCATGTAGTT
CATCCAACAAATCACCGACTATAGGTATGGGATACTTGTCTTTAATGGTCAAGTCATTCAATCCTCTATAATCGACACAAAACCTCCATGTTCCATCCTT
TTTCTTTACTACCAATGTTGGTGAAGAATAAGACGATTGAATAGCCTGTATGATTCCACTACTAAGCATCTCTTTCACTTGCTTTTCCAACTAATTCTTT
TGATGGAAGTTATATCTATATGGCCTCAGACTAACCGGTATAGCTCCCGTCTTAAGAGGAATCGCATGGTCAAACAGTCTTGCCGGTGGCAGTGACTTCG
GTTCTGCGAAAATATCAGCATATTTAACCAACACATTATGAAGTCCCTCATCGATTACCTCCTCCTCACTGTTTGTCATCATGTTCATCATAAAAAGATG
AGCAACTATAGCTTGACCCTTCTTCAACATCTTTTTCATTGATCCACTAGATAGCATACTCAAACTTCCCTCACCTGCAATTCCTGGCAGCACTAATTTA
TTAACTTTCCTGCCTATAGTAACACACTTCCGTTCATGATCAAACTTAGTCGGATTATGTTTCTTCATCCAATCATTTCCTAACACCAATGCACAACCAC
CCAAGGAAATAATGAGCAAATCTTCTATGAAAATTCTATCCTGCATTTTCCACGAAAATCCTTTACAGTGAGAGTTGCACATTACGTAATTACCATCTGC
CACTGTCACTCGTACAGGAGAACACAGATGAGGTTGGTAGCCTGATGCAGCTACAATATGCTTATCAATGAAGCTATGTGTGCTCCCGAATCAATTAAAA
TTGCCAGTTGTCACTTCTTCACAGTCCCCCCGATAAGAATTGTATTCTCTCTTTTGTTATGACCAGTTAATGCATTAAGACACACAGCTTGTTGTACCTC
TTATTCGACTACTCCTTCAATGGTTATCTCCTCCATGTCTTCCAATACTGACATCTGATCAACTTCCCTTTCCTTCTCAACGAATCCAGTTAAATAATTC
AACTGTCTCGTTTTGCATATATGTCCCAACCCATATTTCTCTCCACAACGGAAACACAAGTGATTCGACTTCCTAAACTCATAAACTTCAGGAGTAAGTC
GGTAAGGCCCATTTCTGTTAACCATCGCATTAGATGCTTTTCCTACTTCCTGCGCAGCTGCCGGCAACACTCTGTTCACTGTTCTATTCCTCCTTCGTGC
AGCTTCAATAGCCATTTCCTTCATCCTCGCTTTCTCTACCGCTTCTTTCAACGTCCTCGGCTTGAACATTTTAACCTCAAATCTAATTTCCTCCTTCAAA
GCTCCAATAAAACTAGATAAGAAATGATCTTCGTTCAAACCGGATTTCGTATAAGCATTCGAGCTTTAAGATCTTCAAATCTCCATATAAACTCATCCAC
AGTACCGATTTGTTGTAGCTTGTTAAACTCTTCCACCACATCACTTACTACAATTTCTCCAAACCTGCTGATTAAATCCTCTTTAAACTCGATCCAATTC
GGTATTCCTCTGCTTAACACCATCGACTGATACCATACTTCAGCAACATCAGTCAAGTATAAAGCAACTATTTCTATCCTCTGTTCATTACCTACTCTGT
ATTGTGTAAAAAAACCTCTCACACTTTCGAATCCACACCTTCGGCTCTTGACCTGCGAAACCAGGTAACTCCCACCTCAGTAACGTCACTGCATTCGGCT
GAACTCTATTGCGATTATCCCCATTCGGAGTAGGTACTAAGCCTGCTCCCACATTCGGAACTGTCACGACCGGAATCTAGACCCCAGACGAGACCGGCGT
CGTTGACCTCTCGGAGGTCGCAGACAAGCCTGCTTACGTCATTCTTACTTTACATAGATTAATTTTAGCGGAAAATTTGAAATTTTTGATTCTTTAATCA
TACTTGCTGAACATTCTTAACATTTCGTAATCGTTCATCATCAACCATCTAACATTTAAGAGATAAGCAACTGAAAGAAATAATTCATTAAGTATTAATT
GTATATCGGCCAAAATAGCACCAATACAAAGTTTGAACCAAAACAGGAAAGAAACGCTAGTGGAACATGCTCCGCTAGCTCAACTCTAAAACTACGCTAG
AATGTAAAACAGTAGCATCCTCGAAAGCATGAGGACCTACCAAACTCCGGATGAATACTGATGTCCGGATAGCTGCAACAACGAACCTGTAGCTCTAGCG
TCCACCTGTGCCTGCACCTAAAAGTAGATGTTCGTATGGAATTAGTACACACTTGTACTAAGTATGAGTATATGCAAGTACACACCAGGGACATGCATGA
GGAAGAATAGCTCTTTCCTAACAACATGATTTTTGGAAGTCAAGTCAGTGGACTTGCCAAATTGAGATTGGGAAAGTTATGCCATGAGAGTGACATGCAT
CATTATAATTATCGTATAGCACACAAAACATAACATATTCATATAACACATAACATATAACACATACTTTCTTTCATATTATTCATTCGTATACCATGAG
ACCTTATTATCATAGACTTAACTTTAAGACTTTCCAAAATGAGGGCTCAACATATGGGACCTCAACTAGGGAGCCTTCTTTAGCAAACACAGAGTCTGCT
TCACTCATTCATTCGTATTTCATTTCAATTCATTCATAGGCCAGTGCGAACACCAGGTATACCTAGGATGTAGTTTAAGACTCTCATCGGGTTTGCTGTG
CAATGATCAGGAATGACCTAATGTCATTACCTGAATCTAGCTCACCTCTTGATTATCCTATCCTAACACCTTCGGTATCATTCATTTCTTTATATGATTC
GTTTGAGGCTGGCCTCATTCATTCATTGGGAACTTTAACTTTAACCGACATAGATCATGTGAGCATCATGAAATCCAGTGTCTTCCCCACACCGAAAAGA
GGTGGAATCACCGGCCAAAGCGATTCAATAACATGCTAGCGTATATGGGAATTTAACCCCGCCAGATCCCTATAGTGGCAATATAGGTTCAAAGACTAGG
AGATGTATGGAGACCCATACCCGGCAAGCCGGACAGTCTCATCTCATGAGAATTACGTGAACCTCCGCCCTTCCCGAAAGAAGGCATCACCACTCATAGC
TAGCCTATCGGTGCTCGGTATAAAGTTCCATTACATGCAACTCATACATCATAGAAGTTTGCTTCTAGTATGAAGACATCATAGCTCAATAGATGATTTC
TCATCTCATCATTAGTATTAAGTGTTTTAAACTCAATATTTTTATTAGAGTATTCATAGAGACTGGTCTCTTCATTATCTTACACTCTCATTGGTGAGTA
TGTATCGGTAACATTTACTTAAGCTCATTTAAGATTGCTCTCATCATATGCATTAACCTCACATCATGATTGTCGCCACATTCTTCATTTCATTACGTAT
ATCTTAGGTTCACTTATTCTTGAACGTATGTTAAACTTATATATCTATACATACAAGCCATGAGGCTTCATTTATAGTTCGTTAAGTGAATTCTTGTTTT
TCTAAGATTATGTATTACAAGACTTATGTATCTTGTATATATGCCAAGATCTTTGATTTTTGATCTAAGTAGATGACATTATTCTTGAATATTTCACTCA
CGTATGACTTATGTATCAATACGGAGGTTTGGACACGAGAACCCAAATTTTGAATTATTTGGATATCATTTATATTTTTCATTGATTTTAGTTCTAATAT
TCATAAATTTAGAACTCTAAGTTAAGTCTCAACATTTTCGTGAAATAATAAATTTTCTATTTTAATTAGAATTCTAAATTAAATTTCAATCATTTACATG
AAAGAATAATTTTCTAATTTAATTAGAATTCCAATTTAAATCTCAATATTTACATAAAAGAATTAATATTCTATTTTTAATTAAGATTCTAAATTAAATC
TCAATGTTTACATAAGAGAATTAATTTTCCAACTTTAATTAGAATTTTAATTTACTATTATTATTATTTTTAATTAAATTCGCTTGAATAGGGAGGTTGT
GGGTTCGAACCCCCACAGCCCCCCTCATTTTCCTCTTAATTTCGCTGGGAATGGAGGCTGTGAGGTGGTGGGTTCGAACCCCCACAGCCTCACCTTTATT
CCCTTAATATTTTTACCCCCCCTTCAGCCCTGAGGTCGCGGGTTCGATCCCCACGCCTTGCATCCCCCCTTTTTATTTATTTATTTATTTTTTTTAATTC
TTTGACATCCCAAAAATTTCCAGATTCTTTTTAAACCTATTTCTATGTTTTTGGAAATTTATTCCACTATTTTTCTGCACTTTTTCATCAAGTTTCACAT
TAGTTCTTAGGGAGATTTCATGGTTCATTCACTTCACTATGCTTCATCAAAATAAACATCACATTGCACACCCATTTCACACATAAAATACATGATAAAT
AAACAACTTATATACCCCAAAACAATGCCTAAAACACTGCCCTATACACACCCATACATCAACTTTTTCCGATCATATTCTGATGATCATTATCGCGATT
TCCCGCACATAAACACATTCATATTTAATTTAAACACATCATTCATGCAAAAATCTAGCAGCACAACATACCCATCCTACAAATTCATTAGGGAGCTAAG
GACAAGGACATACGAAGGGGAACAACCTTAGTTTCAAGAGTTTAAGAAACGTCCGAAAGAAAGTACTCTTGGAGAAAGAATTCCATGAGAGAAACTCATA
CCTTAATCGATGTTCAAACTTTAATGTTGCTGCCCGGAAAACTCCTCCAAACCACTCCCAATTCACTTCAAAGTATACCTCTCTCGACGAACCTCTCTTA
GCCTTGACGTTTTGATTACTTTTTCTTTTGCTTAAAAATTTTTTTGTGAGTTCTTCAAGCATGAAAATTATTGATATTTTGGCAGAAATAATGTGAGGAA
GATGGAGAACGTGAGAGAGGGAGTTTAGAAGCGTGAGAGAGAGAGGGCTAATTGGATTAGGAGACTAATTCAAGAATTAGTCAAATAACATTAAAATAAA
TAAATACAAATCTGTTTTATTTATTTATTTATTTATTCATTTAAAACGTGAAAGGACAATTATGCCCTTAAATACCTATTTATTCTTATTTACATAATTC
TCTCTTTTTTTGAATCGTTACATTATCCCCCCTTAGGAACATTCGTCCCCGAATGACACTACCATTTCACCTCATAATGCCAATGAGATCATAACTTAAT
TGCTATGTACAATCAGCCAATAGCAACAAATATGAAGAGATAAGGAACTATAGCCTTACGAGTAGGAAGCCTAACCTCAAGAGTTGAAAAGATGTGGATA
TCGGGATCTCATGTCGGCCTCAGCCTCCCACGTAGCACCCTCAACAAGATGGTTTCTCCACAATACCTTCACTGTGGCAATCTCCTTGTTCCTCAGTCGC
TTGACCTGTCTGTCTAAGATCTCAACAGGTACTTCCTCATAGGACAAGTCTTCACCAACCCCCAAACCTTCTACAGGTAGGATTGATGCTGGATCACCTA
GGCACTTCTTCAACATAGAGACATGAAAGACTGGATGAACAGAAGCTAGCTCCGCAGGCAATGCTAACTCATAGGCCACCTCACCCACGCGCTGTAGGAT
CTCATATGGCCCCACATACCTCGGACTAAGCTTCCCTTTTCTACCAAATCGCATCACCCCTTTCATAGGCGATATCTTCAAGTAAACCTGGTCACCAACG
TTAAATTCTAAGGGTCGTTTTCTATTGTCTGCATATGACTTTTGTCGGCTGTAAGCGGTAGCCAACCTGTCTCTAATCATTCTAACTTTCTCCAAGGCCT
CATGAATGATCTCTGGACTCAAAATAGATGACTCTCCAACCTCGAACCACCCAACTGGAGATCTACACCTCCTACCATACAATGCCTCAAATGGTGCCAT
CCCAATGCTGGAGTGGTAGCTATTATTATACGAGAACTCTATCAAAGGTAGATGGTCATCCCAATTACCTCTAAAGTCAATCACACACGCTCTCAACATG
TCCTCCAATGTCTGAATAGTGCGCTCTGCCTGCCCATCTGTCTGAGGATGAAAGGCAGTGCTAAGTTTCACCTGCGTGCCTAAGCTTTTCTGGAAAGATC
TCCAAAAATGCGAAGTAAACTGAGCTCCTCTATCTGAAATAATAGACAAAGGAATCCCATGCCATCTCACAATCTCATCAATGTAGAGTCTCGCGTAATC
CTCGGCCCTGTAAGTGGACTTCACAGGGATAAAGTGGGCAGACTTAGTCAGTCTGTCCACAATAACCCATATAGAGTCATGCTGCCTCCTAGTCCTCGGA
AGACCAACTACGAAGTCCATATTAATGGCCTCCCATTTCCAAGTCGGAACCTCAATAATCTGAGTCAGACCACCAGGCTTAAGATGCTCTGCCTTAACCT
GCTGACAATTAGGACACTTAGCCACATAGTCTGCAATATCCTTCTTCATGCCATCCCACCAATAAATCTGCTTAAGATTATGATACATTTTTGTGGAACC
TGGATGTATGGAATATCTGGAACCATGGGCCTCTGTAACAATCTTGGTCCGTAAATCATCTACATCTGGTACGCACAACCGGTTCTGGTATCTAAGTATG
CCATCATCTCCCAAAGCAAAAGACTCATTCATTTTTAACAACACTGAGTCCTTCATCTCCATCAACACAGGATCGAGATGCTGACCCTTCTTGACTTCCA
CTATCAGGGATGATTCAGAACTAGGGTGAACTGAAACACCTCCACTAGTAGAGTCAACTAACCGTACACCCAGCCTGGCCAGTCTGTGTACCTCTTTCAC
TAGCTCCTTCTTCTCATCCTCAACGTGGGCTGTACTCCCCATGCTCATCCTGCTCAAAGCATCAGCCACAACATTAGCCTTACCTGGATGATAGTGCACA
TTCATGTCATAATCCTTCAGCAGCTCCAACCATCTGCGTTGCCGTAGATTCAGCTCTCTCTGCGTGAACACGTACTGGAGACTCTTATGATCCGTGAACA
CATCCACGTGTACTCCATATAGATAATGCCTCCATAACTTCAACGCAAACACCACAGCTGCCAACTCCAAGTCATGAGTGGGATAATTCTTTTCATGAAC
CTTGAGCTGTCTGGAAGCATAAGCTATCACCTTACCAGCCTGCATAAGAACACATCCCAAACCGACCCTAGATGCATCGCAATAGACAGTGTAATTCTCG
CCACTCTTAGGCAGAGTAAGTACCGGGGCTGAAGTGAGTCTGTCCTTGAGCTCCTGGAAACTCTTCTCACAAGTATCCGTCCATTCAAACTTGGATTTCT
TCTTTGTCAAGGTTGTAAGTGGGGCAGCAATGGAAGAAAATCCTTCCACGATCCTGCGGTAGTAACCAGCCAATCCCAGAAAGCTACGGATATCGGTGGG
TGTAAGAGGCTTTGGCCATTTCTACACCTTGACCGGACACAACATGGCCCAGGAAGGTCACTGATCTCAGCCAGAATTCACACTTGCTGAATTTGGCATA
CAACTGATGCTGTCTAAGTACCTGCAAGGTTAGTCTCAAATGCTGTTCATGCTCTTCCTTGGTCTTAGAGTAGATGAGAATGTCATCAATGAATACTATG
ACGAAAGAGTCAAGGTATTCACGGAAAACTCTGTTCATGAGGTCCATAAATGCAGCAGGTGCATTCGTGAGACCGAATGACATAACCAAGAACTCATAAT
GACCATAACGGGTACGAAAAGCTGTTTTTGGGACATCCCTATCCCTAACTCTAAGTTGATGATACCCTGAACGAAGATCAATCTTAGAGAAGAAACTAGA
CCCTTGGAGCTGATCGAACAAATCATCAATTCTGGGAAGTGGGTACTTATTCTTTATAGTGACTTTGTTGAGCTGCCGATAATCGATACACATTCTAAGG
GTCCCATCCTTTTTCTTTACAAACAACACTGGAGCGCCCCAAGGGGATATGCTCGGCTGAATGAAACCCTTATCCGTGAGATCTTTTAACTGCAGCTTCA
ACTCCTTGAGTTCTGCTGGAGCCATTCTATAAGGAGGAATTGAGATTGGTTTAGTATCAGGTTCTAAGTCGATACCAAAGTCAATCTCTCGAAGGGGAGG
GACTCCAGGCAAATCTTCAGGAAACACATCTAGGAATTCACTTACTACAGGCACCGAGTCTATGGAAGGAACGTCATGATCTAAATCATTAACACTCACT
AGATGACATAGTAACCCTTTGGCCATCATTTTATTGGCCTTGAGATTTGAAACCAAGGGGTTAGGACGAATCGGATTGTACCCCTCCCAGACTAACTCTT
CTCCATTAGGGAAGCGAAACCTCACCACCCTACTACGACAGTCCAAACAAGCATAATAGCTGTGAAGCCAGTCCATGCCAAGAATAATATCAAAATCGCG
CATGGGTAACTCAATCAAGTTTGCACACATAGCCTTGCCACTCACAACTATTGGGCAATTCTTGTATACCCTATCGGTTCTCACATTTTCTCCTAAAGGC
GTACTAACCACTATAGGATCATGCAGAACTTCAGGTAGTATTTCAAAGGTAAGGGCAAGCAGAGGAGTCACAAAGGAAAGCGTAGACCCTGGATCAAGTA
AAGCATAAACAGAAGTTGAGAATACTTGCAGCATACCTGTGACCACATCAGCGGACTTCTCCTGCTCCTCCCTACCTTTCAAGGCATAAAATCTGTTCCT
CTTCGGAGGTTCGGCTGCTGCTGCATTATGTGGGGTAGGCCTAGGCTGAGCATTACCCCCAGCCTGACCTCTGTTCTGGGGACAGTCTATGACCATGTGT
CCACTCTTACCACAACCGAAACAGGCATTAGTGCCCTGTCTACATTCTCCAAGGTGCATTCGGCCACACTTAGTACAAGTCTTCCTTGGACGCTGCATCT
CACCTCCATTGCCCCTCTTGGGTTCGGGTCTGCCTCCTCTAGGCGTTGTATTTCTCTGAGGGTCAGAATTTCCAGCACTCTGTTGCCCCTTCTTGAATTT
GGGCTGCTCGCGGACGCCAAAATTGTTTCTGTGGCCTCCATGGCTGGGACCTGCCTGATCTTGAGGCCTAGGCCTCCTAACATCACGTACACCTCTCCTC
TTTCGGCTGTCCTCTACCTGTTGGACATGCATCATTAATCTAGAAAGGTCCATATTATCATGGAGCATCGCAGCCCGACAATCTTCCTCTAGGTCTCCAT
TGATTCCTGTGAGGAATCTGCTCATCTCCTCCCTGCTGGTAGAAACCAAGGGAGTAGCATACCTGGATGATTTCAACAAAGTTAAGTACTCTCATCATTC
TTGTTATCAAATACTAAGGGAAGCACATACCTTGATAACTTCACAAACTTCAGGGAATACTCCCTGACAGTCATGGATCCTTGCTTGAGGTTGATGAACT
CCTCAACCTTGGCCTCTTTCATCTCTCTAGGGAAGAACCTTTCCAAAAATGCTGTCTTGAACAGCTCCCAGGTGACTGGCACCCCTCCTAGGACACGGCT
ATCTCGCCACATTTTGCACCAAGTCTGTGCAACATCTTTGAGCTGGTAGGAAGCCAACTCAGCCTTCTCAATATCAGTGGCCCCCATGGCCACCAGTATC
TTATGCAACTCGTCTATAAATTCCTGGGGATCTTCTGAAGTCTTAGCCCCTGTGAAAATTGGAGGATTCATCCTCGTGAAGTCTCGCAGTCTGTCAGCTA
TGCTGCGAGCCGGTGGGTTTTCCCTCAGAACATCCTGCCGGTTGACTTGGGCAGTCATAGCTTGGGCCTGCATCGTGATGGCCTGTGCCATCTGGGCTAG
AGATGCCCTCACCTCCGCATCAGTCAACCCAGCTGGGTTCACTGGCATGGCCACTCCTTCAGCTGGAGCCTGGGGTGGATTCTGATTACCCCTAGCTGCT
GCTGCTCCCGTCCTCAGACCCTTAGTTCCCCAGGTATTCATTCTCTGAAAACAGCAAGGTTGATGTTAGACACGTTCGTAACACCAAGAATTTAAACATT
AGGAAAAGCACAATAAGATAAGAAGAAGGGAAGTCTTTCCTACGCATCGTGCAGTCTCTAATCCAGGATAGTGGTGCACTTCACTACCATGACTTAGAAA
CTACTCAATGTGGTTGATGTGAACTCATTATTCGAGGAATTTAACCTAGCGCTCTGATACCAACTTTGTCACGACCGGAATCTAGACCCCAGACGAGACC
GGCGTCGTTGACCTCTCGGAGGTCGCAGACAAGCCTGCTTACGTCATTCTTACTTTACATAGATTAATTTTAGCGGAAAATTTGAAATTTTTGATTCTTT
AATCATACTTGCTGAACATTCTTAACATTTCATAATCGTTCATCATCAACCATCTAACATTTAAGAGATAAGCAACTGAAAGAAATAATTCATTAAGTAT
TAATTGTATATCGGCCAAAATAGCACCAATACAAAGTTTGAACCAAAACAGGAAAGAAACGCTAGTGGAACATGCTCCGCTAGCTCAACTCTAAAACTAC
GCTAGAATGTAAAACAGTAGCATCCTCGAAAGCATGAGGACCTACCAAACTCCGGATGAATACTGATGTCCGGATAGCTGCAACAACGAACCTGTAGCTC
TAGCGTCCACCTGTGCCTGCACCTAAAAGTAGATGTTCGTATGGAATTAGTACACACTTGTACTAAGTATGAGTATATGCAAGTACACACCAGGGACATG
CATGAGGAAGAATAGCTCTTTCCTAACAACATGATTTTTGGAAGTCAAGTCAGTGGACTTGCCAAATTGAGATTGGGAAAGTTATGCCATGAGAGTGACA
TGCATCATTATAATTATCGTATAGCACACAAAACATAACATATTCATATAACACATAACATATAACACATACTTTCTTTCATATTATTCATTCGTATACC
ATGAGACCTTATTATCATAGACTTAACTTTAAGACTTTCCAAAATGAGGGCTCAACATATGGGACCTCAACTAGGGAGCCTTCTTTAGCAAACACAGAGT
CTGCTTCACTCATTCATTCGTATTTCATTTCAATTCATTCATAGGCCAGTGCGAACACCAGGTATACCTAGGATGTAGTTTAAGACTCTCATCGGGTTTG
CTGTGCAATGATCAGGAATGACCTAATGTCATTACCTGAATCTAGCTCACCTCTTGATTATCCTATCCTAACACCTTCGGTATCATTCATTTCTTTATAT
GATTCGTTTGAGGCTGGCCTCATTCATTCATTGGGAACTTTAACTTTAACCGACATAGATCATGTGAGCATCATGAAATCCAGTGTCTTCCCCACACCGA
AAAGAGGTGGAATCACCGGCCAAAGCGATTCAATAACATGCTAGCGTATATGGGAATTTAACCCCGCCAGATCCCTATAGTGGCAATATAGGTTCAAAGA
CTAGGAGATGTATGGAGACCCATACCCGGCAAGCCGGACAGTCTCATCTCATGAGAATTACGTGAACCTCCGCCCTTCCCGAAAGAAGGCATCACCACTC
ATAGCTAGCCTATCGGTGCTCGGTATAAAGTTCCATTACATGCAACTCATACATCATAGAAGTTTGCTTCTAGTATGAAGACATCATAGCTCAATAGATG
ATTTCTCATCTCATCATTAGTATTAAGTGTTTTAAACTCAATATTTTTATTAGAGTATTCATAGAGACTGGTCTCTTCATTATCTTACACTCTCATTGGT
GAGTATGTATCGGTAACATTTACTTAAGCTCATTTAAGATTGCTCTCATCATATGCATTAACCTCACATCATGATTGTCGCCACATTCTTCATTTCATTA
CGTATATCTTAGGTTCACTTATTCTTGAACGTATGTTAAACTTATATATCTATACATACAAGCCATGAGGCTTCATTTATAGTTCGTTAAGTGAATTCTT
GTTTTTCTAAGATTATGTATTACAAGACTTATGTATCTTGTATATATGCCAAGATCTTTGATTTTTGATCTAAGTAGATGACATTATTCTTGAATATTTC
ACTCACGTATGACTTATGTATCAATACGGAGGTTTGGACACGAGAACCCAAATTTTGAATTATTTGGATATCATTTATATTTTTCATTGATTTTAGTTCT
AATATTCATAAATTTAGAACTCTAAGTTAAGTCTCAACATTTTCGTGAAATAATAAATTTTCTATTTTAATTAGAATTCTAAATTAAATTTCAATCATTT
ACATGAAAGAATAATTTTCTAATTTAATTAGAATTCCAATTTAAATCTCAATATTTACATAAAAGAATTAATATTCTATTTTTAATTAAGATTCTAAATT
AAATCTCAATGTTTACATAAGAGAATTAATTTTCCAACTTTAATTAGAATTTTAATTTACTATTATTATTATTTTTAATTAAATTCGCTTGAATAGGGAG
GTTGTGGGTTCGAACCCCCACAGCCCCCCTCATTTTCCTCTTAATTTCGCTGGGAATGGAGGCTGTGAGGTGGTGGGTTCGAACCCCCACAGCCTCACCT
TTATTCCCTTAATATTTTTACCCCCCCTTCAGCCCTGAGGTCGCGGGTTCGATCCCCACGCCTTGCATCCCCCCTTTTTATTTATTTATTTATTTTTTTT
AATTCTTTGACATCCCAAAAATTTCCAGATTCTTTTTAAACCTATTTCTATGTTTTTGGAAATTTATTCCACTATTTTTCTGCACTTTTTCATCAAGTTT
CACATTAGTTCTTAGGGAGATTTCATGGTTCATTCACTTCACTATGCTTCATCAAAATAAACATCACATTGCACACCCATTTCACACATAAAATACATGA
TAAATAAACAACTTATATACCCCAAAACAATGCCTAAAACACTGCCCTATACACACCCATACATCAACTTTTTCCGATCATATTCTGATGATCATTATCG
CGATTTCCCGCACATAAACACATTCATATTTAATTTAAACACATCATTCATGCAAAAATCTAGCAGCACAACATACCCATCCTACAAATTCATTAGGGAG
CTAAGGACAAGGACATACGAAGGGGAACAACCTTAGTTTCAAGAGTTTAAGAAACGTCCGAAAGAAAGTACTCTTGGAGAAAGAATTCCATGAGAGAAAC
TCATACCTTAATCGATGTTCAAACTTTAATGTTGCTGCCCGGAAAACTCCTCCAAACCACTCCCAATTCACTTCAAAGTATACCTCTCTCGACGAACCTC
TCTTAGCCTTGACGTTTTGATTACTTTTTCTTTTGCTTAAAAATTTTTTTGTGAGTTCTTCAAGCATGAAAATTATTGATATTTTGGCAGAAATAATGTG
AGGAAGATGGAGAACGTGAGAGAGGGAGTTTAGAAGCGTGAGAGAGAGAGGGCTAATTGGATTAGGAGACTAATTCAAGAATTAGTCAAATAACATTAAA
ATAAATAAATACAAATCTGTTTTATTTATTTATTTATTTATTCATTTAAAACGTGAAAGGACAATTATGCCCTTAAATACCTATTTATTCTTATTTACAT
AATTCTCTCTTTTTTTGAATCGTTACATTATCCCCCCTTAGGAACATTCGTCCCCGAATGACACTACCATTTCACCTCATAATGCCAATGAGATCATAAC
TTAATTGCTATGTACAATCAGCCAATAGCAACAAATATGAAGAGATAAGGAACTATAGCCTTACGAGTAGGAAGCCTAACCTCAAGAGTTGAAAAGATGT
GGATATCGGGATCTCATGTCGGCCTCAGCCTCCCACGTAGCACCCTCAACAAGATGGTTTCTCCACAATACCTTCACTGTGGCAATCTCCTTGTTCCTCA
GTCGCTTGACCTGTCTGTCTAAGATCTCAACAGGTACTTCCTCATAGGACAAGTCTTCACCAACCCCCAAACCTTCTACAGGTAGGATTGATGCTGGATC
ACCTAGGCACTTCTTCAACATAGAGACATGAAAGACTGGATGAACAGAAGCTAGCTCCGCAGGCAATGCTAACTCATAGGCCACCTCACCCACGCGCTGT
AGGATCTCATATGGCCCCACATACCTCGGACTAAGCTTCCCTTTTCTACCAAATCGCATCACCCCTTTCATAGGCGATATCTTCAAGTAAACCTGGTCAC
CAACGTTAAATTCTAAGGGTCGTTTTCTATTGTCTGCATATGACTTTTGTCGGCTGTAAGCGGTAGCCAACCTGTCTCTAATCATTCTAACTTTCTCCAA
GGCCTCATGAATGATCTCTGGACTCAAAATATCTAATCATTGATGGTTTAGCTGAGTTTATGGTTGATTGTAGAACAGTAAATTTGTTCAATTGTTATAG
AGGTTGTAGTTGGATTGGATTGAATGGAAGTATGTGTGAACGACTAGTAGGTATTATTAAGCCGGAAGCTTATTACTACTGTTCTTTTATTTATAAAATA
TTAAAAAAATTATGTAACTATCTATGTCACTGTTCCACGAAATAAAATCTGCAGTTCTTTTTCCACTATCCTGTGAGCATGGAATTCAAAAAATTTGGGA
GAACTTTGTTAATGTTTGCCAAATTGTCACTTTAATGCTTACTTTTACTTTTAGTGGATTTTTCTTTGCAATCACCACTAAGCAGCACCAAGGAAAAGTG
ACATTCTTTTTGGGACAAGGCTAAAAATGTAGAGGGTGCCGCATAAATTGGAGTGCTATAGAAGTTTTGCATTCAAATAAAGAGTTCTTTTTTACCAGAT
ATGAAGTATTGAGTAATTTGGAAGATGTTGGTTGGGTTAAGGGAAATTTTGGCTTTGACAAGTTTAGATGCTGACTGAACTGCGTGTAATAGTGTTTATG
CATTAACATGTGTCTGTATCTGAATTAATGATATAGTTCTAGAACTTTGCAATTTTGTTTTCTCTCAGAATATAGATTAATATCGAGGAATTTAAGCTTA
ATGTCCCCGTTCTATTTTCATCAAGAAAACATTGTCTTTAAGTTTTCAAAATCTTATGTATTTTAGGAACTACCAAAATTAAACTTAGGATCTTTGCAAT
TTTTTATATTTATTTTCATCTTAGAAAATATCGTACTATTTTTTAGTACCTCACAAATTGGATATTTGACATGATAGACAAATATTGGAATTATGAGCAT
GGAGACGGTTGGGTCTGAGCAATCAAGAGAGAAAATGAAGAAAGACAAGAAAAAAAGGAAGGCTGAAACAGAGGGACCTGATACCCCATCAACCTCTCAC
ATTTCTAGCAATCCTATGGAGAAGAAGAAGCAAAAAAGAGCTGTAGACAAAGAGAGGCGCAGGGTGGAGACCGAGAAAAAAACCGAAGCCCAGCAAGTAG
TGGTGTCCTCTGAATTGAAAAGTAATAAGAGCGCGGTGATTTCTCCCACTACTAGTGGATTGCCTGAGTTCCACATTGCTGTATTTAAGGACCTTGCAGC
TGCCGATGCTTCTATTAGAGAAGCAGCTGCTAATTCTTTAGTTGCTGAGTTGATTGAAGTTCAGAAGGCTTATGATATTCTAGAGAACAAGGAAGTGGTT
GAGGGACAGCTCAAATTGGAAGCTGAAAAGGATGATGGGTTGAACAACTGTGCCCCTTCGTTGAGATATGCAGTTCGGAGGCTAATTCGGGGCATTTCTT
CATCAAGAGAGGTGGGTTAGGTTAACTTTTAGCACAATGTTCTGTGGGTTTGTTTAAATTTTGTGCCTTGTTATATTTGACGATTTAATTTGAATGCTTC
AATAAGGGCTATATGCCTTCACATTTTCATTTTATTGTTGAATAATTTTTAGGGAGACTTATATCTCTATGGGTTCTTGTTGACATACCCAACTGATGAA
AGCACATTCATGCTGGAAGGGTTGTATTGCACAATACGACGCTTAGGCTGTCTTTCCTGTATTGACCTTTAAAAGGTTATTTTATTTTAGAATAGAACCA
TAAAAGGTTACCTTCTTGCAGGTAGATACTCACAGCTTGTGTCATTGAATTTTTTCAGTAGTCCTATGGTCTACAGTTTTGAATTAAAAGGTTAAATGAT
ATAATGTAGGCTTAAGAGACAGGTGTCTCTTCTGCTTATAGTCCCATGTTCCATGGTTGTCTCGATCAACTGCTCCCATATAAAGCCTCATCTATTTCCT
TGTTTGTGCAGTGTGCAAGGCAAGGGTTTGCATTAGGCATGACAGTGTTGGTTGGTGCTGTTCCATGCATAAAAGTGGATGCCCTGTTGAAGCTTATTGT
TGAATTATTGGAGATCTCTTCTTCCATGAAGGGTCAGGTGGGAAGGATCTCCTTTTGTGAAATGTTACCTTTCTCAAAAAAAAAATAATAAGGATCTCCT
TTTGTGAACTGATAGTTTTCTTATGGTCTGTCTGAAAAGCTTAACTTGGTTTTGTAGGACATGAAAGATTGCCTATTGGGACGCTTATTTGCTTACGGAT
CTATTGCAAGATCAGGGAGATTAACTTTGGAGTGGACTGCTGATAAGAACACTCCTTATATTAAAGAATTTGTTGGTTCTCTTGTCTGGCTGGCAAAAAA
GAAGCTCTACTTACAAGAGCCTGCTGTCTCAATTATTTTGGAATTGGTTGACAAGGTCTTTCACTTTTACAAGCCTATGAATTGCAAATTTATTCTCTGT
ACATTCACTTTAGTTATCTATTGAAAATGACTTCACTGATTGCCTTTTCCTGCGTCATTATAAACTCGTATGAGCTCACCATCCCCTTATTGAACTTGCA
GTTTTTTTTTTTACTTGCCTATAAAACATAAAACATCATCTCTTCCTACTCTTCCCGCTACATCTTACTTATTTTTGGGCAAGAAAATGTTATACGCTTA
TCCAAATAATATCACCTCTTCCTACAACTAAGCTGTGGTTTTGTTATGTTGCCGATTTAACTTTCTTCATTTAGTGTGTTTTTGCTTCAGCATGCTGTCC
ATTTCACTTTCTTCATTTAGTTTATTTTTTGCTTCAGCATGTTGTCCTCTATTTGTAGTCTTTGCTTAGGCTGCATTCAGTTTAGCCGTCTCACCATCCA
TATTTTTGCCATGCCAGTTACCTGTTGAAGTTTCATTGAACCATGTTCTTGAAGCTCCTGGGCTTAAAGAGTGGTTTGAAAGTGCAACGGAAGTTGGAAA
TCCTGATGCTTTGCTTCTTGCCCTTGCCATACGTGAAAAAACTGGTGTTGATAACAAAGATTTTGGCAAGCTTCTGCCTTTTCCTTATAGCCCCAGCCGG
CTTTTCAGTGTGGAACATTTGTCCTTGCTTTCCAATTGCTTGAAGGTGCTACTGAACTTCTTCATTTTCTTTCCTTGAAAAGGATTGTTCATTAGTTTGA
TTTTTGTCGACTTTATGGATGTGCAGGAATCCCACTTCTGCTTGCCACGAACTCATAGTGTATGGTATTCCTTGGTAAATATTCTTTTACCTGAAAATGT
TCAACAAGATTTTGATCCCTCAGCAGCTTTAAATTCCACAAGGAAGCACAAAAAAGGCCGCAAGGGTAGCTCAGCTGAAGAAGATATTGAGAAAAATCTT
AAAAACTTTTGTGAAGTTATCATTGAAGGATCACTTCTTCCATCATCTCATAATTGCAAGAATTTGGCGTTCAATGTTTTGCTGCTTCTCCTTCCAAAAT
TGCCCACATCGTGCATCTACAACGTCCTGTCTTACAAAGTTGTCCAGTGCTTAAAGGACATACTTTCTGCGAAAGACACTAATCTATTCAAAGCCAGTCA
ATACTTTTTAAGAGAATTTTCTGAGTGGGTCAAGCATGATGATGTTAGAAGAGTGGCAGTTATTATGGCTTTACAGAAACATAGTAATGGGAAGTTTGAT
TGCTTCACCAGGTCAAAAACAGTTAAAGAGTTGATGGCTGAGTTTAAAACTGAGTCTGGATGCATGCTTCTCATTCAGAACTTAGTTGACATGTTCCTGG
ATGAAGCTCGTGCTTCAGAGGAGACTTCAGATCAGAGTCAAACTACAGATGACAACTCAGAAATTGGTTCCTTAGAAGATAAGGATTCTGTTGGAACAGT
AGGAACGCCCGATTTTTTGAAAGGATGGGTTGTAGAGTCACTTCCAAATAGCTTGAAGCATTTATCTCTGGATACAAATGCAAGGTTCAGGGTCCAAAGA
GAAATTCTAAAATTTTTGGCAGTGCAGGGTCTATTTTCTTCGACACTTGGAACTGAGGTGACATCTTTTGAATTGGAAGAAAAATTTAGGTGGCCAAAGT
CTGCCATTTCAAGTGCTCTTTGTAGGATGTGCATTGAGCAGCTGCAGTTACTGCTATCCAATGCTCAAAAAGGCGAAGGACCTCAAGTTGTGCCTAGTGG
TCTTGAAGCTAATGATCTTGGAGCTTATTTCATGAGATTTCTTACCACATTGCGAAACATTCCTTCTGTTTCGCTGTTTAGATCCTTGGGCGACGATGAT
GAAAAAGCTATCAAGAAATTGCAGGCTATGGAGTCTCAGCTCTCAAGACAGGTGCTATTTTGTGTTGCTTCATTTTGTAGAATCGTAATAATGTTACTGA
CTTCAACACTGGTCAAAGTTTTGTTTCTCTGTGAAACCAATGCCGCTTGCTTTAGGCCTTTTAATTCTCTCTTTTATTGTTTGATAAGAACGTACTCCAA
CATTGGTGTGAGGTATATCAGTTAGCTCTTATCTGAAACAGCCATAACTTGTTATTACTCATCTTATATCAATTATTGCCATCAACAACTTGTATTTTAT
TTATGCATATTGACCACTATTCACCGTGTACAGGAAAGTGAAAACTTATCAATATTATCTGTGTGGAAGTTTGATTGTTAATCCTTTTCTTCTCTGACCT
AAATCTTTTCTCCAAACAATTGCAGGAGAGAAGCTTGGGTCCAGGTATTGCCAAAAATAAGTTACATTCCATGAGGTACCTTCTGATACAATTGTTGCTT
CAAGTCCTACTTCGCCCTCAAGAATTTTCTGAAGCCGCCTCTGAATTGGTTATTTGCTGTACCAAAGCTTTTCGATCTTCTGATCTTCTTGCTTCCTCTG
GAGATGATGAAGCAGAGGGAGATGATAGTCCTGAATTCATGGATGTTCTAGTGGACACTATGCTTTCGTTGCTGCCACAATCATCAGCACCGATGCGGAC
AGCTATTGAGCAGGTAAACAATAGGAAAAAAAAAGCATAATATTCCATCAGTTCTTATGGTGATTTAATATTTCCCAAAACCATGACCTTGTGACATGCT
AGTCATTATTTCTAATGCATTATTGCACCTACTGTATTTTGATGTGAACTTCATTCTGAATCTTTTTGACCAAATTAATAAGAGAAGCAACCTAAAAGGA
GGTGAAGTTTTTACTTATACGGATGTTTTGTCTTAGAAGACTGAGTTCTCAATCTCAAGCTGTTAGGTGGTGTAGGCGATATGAATTTTCACTGTTCATG
CTGCTCCATTTAGACCCATCTCAATCTTTTTTAGCACTAGAAGTTCTCTACATATTTTACTGGCAAACTAACCTCTTGAGAAATAATTGTCAAAAAAAAA
GCATCTTGAGAAAAAACTAGCGGACTCCTAGTCTACATTGGACTCAAAGTAAGCATACCAAGATGACTATAATTTAATCACAACTGATTCACATAACCAA
TCTTGATTTTTCCTTATTGTACCTTGGCCCCTCTCTAATTAGTGACCATGATTTATGTAATCTGTTTAGTTCGCTCTTCGGTTTTTAAAGTTTTTTCACC
AATTGTTAACACCCCTAGGTAATGCAATAGTTCTCCTGGGAAACAAAATTCATGATGATATGTCACTCATGCTGGACGATTGGGTCTATTTAGTTATCTG
ATAGAAGATATCTTTTCTTTTTCCTTTTTTCTTTTTAATTGTTGAAAGGTAATATTCAAATTTTAAGCACAATATTCTTAGCACTGCAAGCCTTATCTAA
AGGAAGATGTGGTTTTTATAACCAGGACATTTCTCATGTCCAATGACGCAAAGTTTGAAACTCGGTGGATAATTGGTTTGGCCTTCTACCCTTTTGCGCT
TAAACATTAGGCTATTTCGTACGGCAAGATTCACACTTGTGATGTGCTCCTAACTTGCACATCCTGCCCTTTGCTCTTGCCCCTAGACAAAACCCTTCGG
GTCAAGTTTTTTCTGAATACAGGACTCAGTTTATCCTTTTTCTGTGGTTTTGCACATGGATTTACTGTTAATTATTTGATGAGAAAATAGTGAATGCAAT
GCTTCATTTAATTCCTTTATTGGGATACACCTGTTTTGGTTTTTATATCAATGGTATTCCGTCTTGTTTTTCTTTGTTTCCTCTTCGGTTAGTTTTAAAC
AAATTGAATTTTTTAGTCTTCTCTCAAATTGTTAAAATTTATGATCTTCACTTTGGAAAAACACCTTATAATAATGGTATCATATTTCAAATTAACTTGA
CATGGTCAATTTTAAGAATTCGTTAGGACATGTTTTTGCTGATCTCTTCATTACAGAGTTTGCTTATCATGCAAAAATAATATTTTCTTGTTCTTTCGGT
GGTAAAAGAGGATAAAATGTCGATAGCTCTACACTATCTTTCCTTGTCCATTGATGCTCAACATTAAAAGCACGTAGTAGATGCATAGTACGAGTACATG
GTAATTGTTGGGAGCTTTTTTTTTTCTTTTTTTTTTGCAAAAATGCTCATGTTTGCATTCTTTTTGGATAACCTTGTAGTCTGGGCTAGTTTGTGCGCCC
TTTAATTAACTCCATAGGTACTGCACCTCCCACCTTCACAAGTACTGCGTAATCCATCCACTAAGTCCTAGGTAAAGGGAAAGAAATCATTGGAGTGTTT
TTACTCCCTTGGGATTTGAAATTGAGACCTCACGACTCGAACCACCTCATTGAATACTAGGCAATACCTTTCTGTGCATGTATGAATACTTGAAAATTGA
TTGTTTCTGTTCTTTTTAATTATGTTTCTCTTTGTGAAGTACTTGAGTTTGTTTGAACTCTGCAACAGCTGCTGTTGCTCAGGCTCTTCTTCAGCTACTT
AAAAACATTTTTTCCTTTATAGGTTTTCAAATGTTTTTGTGAAGATGTTACGGATGATGGGTTACATCGAATGTTGCGGGTTATAAAGAAAGATCTCAAA
CCAGCCAGACACCAAGAAACTGACAGTGAGAATGAAGATGACGATGATGACGACGTTCTTGACATTGAAGAGGCTGAGGAATCTGATGAAGCAGAGATGG
ATGAAACTGCGGAGAGGCATGCACATGTGGATGACTCAGAGACAGTAGTTGGTGTTGAGGGTGTTACCTCAGAACTTCCTGTAGCTTCTGATGATGATTC
TGATGAGGGATTAGATGATGATGCAATGTTCCGCCTGGACACACATCTTGCTAAAATGTACAACGCTAAGAAGAACCAGGCTGGTAGTGAAACTGCTCAT
TCACAGCTTGCCCTCTTCAAACTTCGTGTCCTCTCGTTGCTGGAGATTTACCTACACGAAAATCCAGGCAAGTCTTTCTTCATTCACTAAGGGGTCGTTT
CGTGTGAGGGATAAGAATAAATAGTTGTTCTATAAAATTTTGATGTCTTGTTTGGTTGGCATGTTTGGAATAACTTATCCCACCATTTATAGCATAGTGA
TTGGATAAGTTATCCCCTAAACATGGTGGGGAAGTAATTGATCTTGGGATAGGTAGTTCCCAACCAAACAACCCCTAAAGGATTGCTGTTTCCTGGCTAG
GATGAGGATGATTCATGTATTTAAAGTAGCATACTTTTATCATCTTTGATATTTCTTTAGTTGCTTTGTTTAGAACTCAGCAAACCCAGTACAGTGGTTG
GTCATTATTTTGCAATCCCACATATATTACAGGTTTAAGTTATGAGTTAAAATATGTATTATTTTATGTGGAGTAGTAAATGGAATAATTAATAGAAGGA
TTGGTAATACATGGATTAAAGTACTACAATGATAAATTTATCCTCTATTACTCCACAGTTAGATTCTTGGCTTTGGTTATGGTACTTTCATGTCCCAGTT
CTGTTCCTTGCATCATTTTTATAGATTTAACATTTTTTTATTGACACTGGTAACTTTAGTCTTAGTCTAAACTGCTACCTATAACTAGCACATCAAAGAT
ATCATCTGTCCTAGTCCATCTTGATCTTCTGTAAGCTATTCTGCGCACATCAAAGATTTAACATTTTATCATGCATTGTTAATAAGTTTTTTATTTTAAG
AGTTATATAGTTTATATTAATTTCTAATACAACAAACAAATATTAACAACCACATATACTGTAAAATCCCACAAGTGAGGGGAAAACCGGAAAAACAAAT
ATGTGAAGAAATAATTCATGCATTGTGTGATCCCTACATAACCAAGCTCTACATATCTGACCCCCACATTACTTATTCCTTCATAACCTACATATTGATG
CATTTTGGGGCGAAGTCAATTAGACTAACTTTTCTCATTTAATTTTACATGTACTAATTGCTCCTCTTGTGCGTCATCATTCCTTGTTCTGTTCAATTTA
ATTAACCGTATTTCAACCTTATTTGCCTTGTATACATGTTGACTTGTAGATGCCTAACGTCTCCTAAAGATGTTGTTGGACTCACTATTCTTATGTATCA
ATCACTTTGGGCATCTTTATATGGCATGTCATTCCTATGATCCTATCAAATCCTCGCTTCAGCCTTTCTATTTTAGTTCTGCATGTATGGCTTTTAATCT
GTCGATTCTCCTCAAAAATATTACCTATTATAAATACCATGAATAAAAGATTCTCCTGTATACACTTTGATCTTGTGGCTGAATATCATGATCTGAGGCT
TTTGTTCCTCTTGTATTAAGCACTGCTGTATACACTATTTGTTTGATCTTATTGATTCATTAAGGTGTTAATTGTTATCTAAATTTTCCACTTTGCAGAG
AAGCCAAAAGTAGTGAAAATATTCTCAAGCCTAGCTCATGCATTTGTAAACCCTCACACTACGGAAGGTAACGAACAACTTGGCCAGCGAATTTGGGGAA
TTTTACAGAAGAAAATCTTCAAGGCAAAGGACTATCCAAAAGGTGAAGTCATCGAATTCCCAGTTCTTAAGTCTCTCTTGGAAAGGAACTTGGTACTGGC
AGCAAAACATTTCAAGAAAAAGAAATCTGCCTCTAGTTTGTCAAAGAAAAAGCTGTCTGCTGCCTTGAATAGATTCAAAATGATCAATTCTCTTGCCCAG
AGTTCAATATTTTGGATTTTGAAGATTATTGATACGAAAAAACGTCCAAAATCTGAACTTGAGGAGGTTTCTTGTATATTCAGAGAAAAACTGGAGGGTT
ACTTAGATAGTAAAAGTACTCGAATGAAGTGCGAGTTTCTAAAAGAAGTCTTTAAAAGGCGACCACGGATTGGATATCCTCTATTTGGGTTCCTTTTGGA
GAAATGTGCTAGTGCAAAGCTACAGTTTCGTCAAATTGAAGCTCTTGAACTGGTCATCGAGATGTTAAAATCGTTTGTTTCTTCAAACCCTGATGACAAC
AGCCATTTTGCCGAGTTAGGCAGCCATCTTGCCAAGTCAGGGTGTCTTGTTAATGTGTTGTTGAAAAATATGCCGGATAAGGCATCACGACGAGCTGATG
TTCGTAAGTTTTTTGGAAAAGTGATTCAGGTCTTAACAGATGTTGAACTGAGGGCCTTGTTTCTTAAGGCTCTGGAACCTGATTGTGAAGCTCAACTGAA
GGGCATGTTTCCTGTTTTAAATCAGTGAATGGTAGGGGCAAAGGTATATGACAATATTCATAATTCGCATGTTGGGGTGACCAATTTGTCATTGTTTCCT
AGCGTTTAATCAGACCATAAGTTATTTATAATTTTGTTTACTACTGGAATTTACTGTTTTCACCAAGATTTTTCTTGGGTTGTTGAAAAACTTGTAGCAA
CACCAGTTTTGGTTATATGTAATACTTCATAGTAACTGTACAATTCCAAAATTTTGGCATACGTGGCGCGAATTGACATCTTACCAATGATTGTTTCCAT
TCGTCATTCTTCACCCCTATTATTTCACGTCATTATTTATCATTGTGAGTCTATAGTTGATAAATTCGTCTCAGTGAAACAAGAGTAATTTTTTGCACAA
ATTCTTACCAGCCAATCATGAAGCCAAATGAACTTATCTACACAACGAGAGAACATCAAGCTTTTTTGACAATATGTAGGAGTTCATTAACAGTAGAAAG
ATGCAACAGAAGACTCCAATCTTGGATTTGAAGAAAAAGAAGGATAGAAGTACACAATTCAAAGTAGCTTAAGAAAGAGTGACACAACTCTAGTCTATAA
TGTAACAGAACTTTCTCCTTCACGGAGAACTTGAACCCGTAAGTGAAGGTCTTTGTTGCGCTTTCCTCTTACAAATTCACAAATACAATGGTCATTTTTC
TCCACAAGGTTCCATCTACATAAACTGCGCCATCCACCTACAAGCCATATTCTACCGTCCTTCCACTTGTTGAGTTTCGTCACAAATTCTCTGCCAATAG
AGTCGCGAATGGTCATACTTGAAGGCAGTTCAAGTTTGTAGTCCTTTACCACATCAACCGGAACATACTGAATTGGGAACAAAGACTTTGTCAAGTAAGA
AATGATATAACGATTGAACTACAAAATCATTCACGAAATAGTGAAAATGATTATAATTACCAGTTGATCTCTCCTCTTTGATCTTATTTTTGCTACAAAA
TAAGGATTTTTCGGCTGTGTTGCACGTCCACTTTTGAATATATCTACACCAAAATGGTCGTGACGATTCCTCACCTTGCAAGCAAAGGCTGTTTTGCATC
TAGATTTAGTTGGTTTGGTTCATAAACAAAAATCTCATGAAACACAAATATCTACCCATGTAATTTTACAATTTTACTAACATGAATTTAAGAATGAAAG
AAAAATTTTAACATGTACCAAAAGTATTAAAAAATGAAATTTAACTTTATTCCAAAAACTAAAACAAAAAGCACCCTTAGGCTTGTTTCGTTAGCCTTTC
GAACTTATTATCTTAAACATTTTATATGACTTGAAGATGATCTCCAAATATACAAAGATTTTCTTTTTTTAAAAAAAAAAAAAACTTACTAACAAGAAAA
AAGACGATACAAAAATATTAATTGGTGTTTACCTTTTGATCGTAGCGCCTCTTTCTTATGTGTGTTAGTTCTTTGATTCTCTCCCTCATCTTCTTCTTCT
TCATCTTCATCGTCTTCTTCTTCATCTTCCACGTAACATGCTACCTTTTTAGTCTCTTTATATTCCTCGTCCTTATCCTCGTCCTCATCCTCGTCCTCAT
CTCGTTCTCCCATGTACTCCACATCGTTATCGTAGGAAGAAAAACTATTACAGCTATCACTAGCCCAATTCTTCTCTTTTGACTCTCTACTCTTTTGATG
TTCAACAATCATTTCTTCCGCTTTTAAACCTCCAACTCCGTTCTTTTCACATTTAGTTCTTCCAAGTAATTTAAAGTCAAACATTTTATTTCCATCATAG
TCAAAAACAAGAAAATCTCCAACCTCTACACTATTATCCTCAATAAATTTCTCCCATCCATATTGAAAATACAAATTTCCTCCGATTTTGTTCACTCCTA
CAGGCCACATATTGCCAAATCGATCCCTAAGGTTAATTTTCATTGGTAATTTTCTATTCTTGTAATATGTAAAAGATGTGGGAATTTTCTGTGAAAAAAC
ATAACAAACAAGTAGAATAACATCAATTTTTTTTTCATCATGTAGAAAAATATTTCAAAAAAAAAAAAACTTACGAGCCTCTTTCCACTGTTTTCAGGAG
AGAAAATCTTGACGAAGCCCTTTTCCATCTTCTCTTTTGTTGTCAAACTTTAAGAGAATAGGAGAAAATACAAAAAGAGAAGAGATTATAAGAAGAAAAA
TAAAATGAAAATTCTGAGTATTGTTCTCTTCTCAAGTAGTAAATGCAGAAGAGAAAGCTTTTTCCTCATATGGAATACTATTAATTTCAATAATTCAGTC
AATATACAATATTTGATTTTCTCTGTTTACTTTTAATAATACACAGTCAATATACAATGTTTTACTGTGTGATTCATGACAACATTCTCTAATTTGAAAA
AATTATTCTAAAAAAGACCAGACACTCATTAATATGCTCTTGTCTATAAAAAGTATAAAGACACCACTCCATATGAATTGTTTGGTACAAAATTTGTAAT
GCAAAATTTAGTAATATTTGGTTTGTTGCTTCTCACCGTATTTTGTATTCGAATTTAAACTCTATAAAAATGTTTCTTTCCAACTATATCTTTAGAATTT
TTCGTTTCATGTAATCGGACCAAAGTAGATAATTATAGGACAACATTATTTTTTATGGTCCTCTAACTAGATAGGAGAAGAACAATATTATTGTTATATT
TGTTATCTTCTCACTTGAATTATTTGAAGGTAAATAACTATCATCTTAATAAATTGATCACTAACAAAATTTTAATTTCAATTTATAAAAGGTAGAACGT
CTAATTTAAAACCCTAAAAAACGATAAAAAATAGTAAAATTGAACGAACCATCTACGTTTACACATAAATTACAAATTGTAATTTTAATATATATGCAGC
TTTATAAATTGTTCAAAATACAAATAATTAGAAAATCACTTATAGATCAATATATAAAACATTTAATTAAGATCACAAACGTCATGTAGTTTCTCTTTTC
CATTAGTAAATGTTAAACAACTCACAATTCAAATACTTCTTGATTTATATTGAATTTATTTAACAACAAACAACTCTCTCTAAATAGTAAAAGTTTTAAG
CTAATTTACTCGAATAAACTTACTAATATAGATATAAAATATAGAATTAAAAAAAAATTAACAAATTGATTAAAAAGAGTTTCGCAATATTTTTATCTTT
TCATCAATTAATCCTGAGTGCGGAGTTAAAAGGGTAGAAAAATTGTCAAAAATTCTAAAAGGGCATATTAATTTTTTTTAAAATCAAAACGGTAAAATCG
CTCATGATATAGCGACTTGTCGTCTGAAAAAGAGAAATCGCTGCTATTAAATTTGGTTTTTTAAAAAATAATAATAATAAATTAAACAAATCGCTCCATA
CGGAGCGATTTTCAAAATCAAAAAAAATTATTTTTTTTTATAAGTCGCTGCTTCTGCAGCGACTTCTATTAAAAATTTTAATTTTTTTTCTTTTTTGCTT
TACAATTGGTTGAGATTGAAAAAAGAAACAGATCAATGAAGAAGATGAAATGTGGTAATATATATAGTTATGATTTGTAATTTCTAATTTAGTTTAACAA
CTCTAAAATTTAGCTTCTGAATGGAACAAAATCCGTAGTAAATAAGTAGAGAAGCAAATAAAAGTAAAAAATAACCAAGAAAAAAACTGATTAAAAAATA
GTAATGAATAATGAAGTGAAGAAAGTAGAGTAAAATGTTTGGAAAAAAATAAAACAATTTATAAATCTGACCTTGCTTGGTTTATTGAGAAGACTGCTTA
ATTTGATGCTTTTGTGTTGAGATAAATGGAAAAAACTGAGAAAGAATATAGAGGAAGGAGATGGTGGACTTCAATGATATAAATATAATTGTTAATTAAG
TTTTCAAAAAAAAAAATTAAGTGTAAAACAAAAAATGTGTTAATTAAGAATTTATTTTATATAAAATAAAGCAAAAATAAAAAAAATTAAAAATTTTAAT
ACTTATAAAAAAAATTATTTTTTTGATTTGAAAATCGCTCCATGTGGAGCGATTTGTTTAATTTTTTTTTTAAAAAGCAAATTTAAGAAATCGCTGCTAT
TGCAGCGATTTCGCTTTTTCAGAAGGCAAAAGTCGCTAAATCGTGAGGAATTTTACCGTTTTGGTTTTTAAAAAAAATTGATATGCCCTTTTGGAATTTT
TGACAATTTTTTTACCCTTTTGAGTCCGCACTCAATTAATCCTACTATATTAAATCTTATATTATTTGACCCGAAATTCCTACTACATAAAATTAAATAT
TACCACACATAATACCTGTCGTAATATACTTCCTACCAAATGATCCATTATGCATTTATTCAACTACTTTAAAATAGCAATTTTGGCATTCTATTTTCTT
TTAAAAGATATTATAGTACCATGCAAAGTTGAGCTAGTAATAGAAGTTTGATGCTATTCTCTTTGCCATAGTAAAGATCTTTTAATTTTGATTAAAAACA
AATATAAAATCTTTTAATTTTTTTAAAATAAAATTTATATATTTATAACAATATAGAAAATACTATAAATCACAATAAATAATAATTTAAAATATTTAAA
AGGCATATTAAAAATTATACAAACAAAACTTAATTTGAATATCAAGATAAAAAATATGTCACATAAATTAGGAGAAAGAAAATAACAACGATTACTAAGA
CATATTGTAAAAAAATCAAAGAGACAAAAAATAATGTTGTCATTATTGTCGAATGTCGAGGAAACAACAAATAAAATGAAGTTGTACGGTACAAAAAAAT
TGAAGTAAATGTTTTGATATTCTAGTAGATAAAAATAATAATTCTAATGAAAAATATATCAACTTTAAATTTTGAAATTAAAAAATAAAAAAATCTCGTG
AAAATATAATGAAATATTTAAAATAATAAATAATTAACAAAGATGTCCCTTGATTTATAAATTTTAGATGATAAGAGGGTATATATTTTGTTCGGTGAAA
ATTATAGTTTTCAATTATTTATTCGAAGTTAAAAGGCCAATTTCAGAATCCATCAATTATGCTATAAAATGTATAATAAGAACTATATGGTAATGAATAA
CTTGAGTTCTACAGAATTTATGTTAAAGCAAGGCAAAGGTCTTGTTGTAGACACCACAAGCTATGTTGAAAAAGACAAAACTTAATTTTTACAGTCAAAT
TAAGGTAAAGTTCTATTTTATAATTAAAAGTTAATGTCATAAAATACGTGACTTAATTTCTACAAATTTTATACCTAGTAAGGTAGAAGTTTAGTTTCTG
AACCATCAAGTTATGTCGTTAAATGTATAACTCAATCCCTGCAATATTTACAGAGAGCTGCATAAAAAAATTTGAAACTTATATTGAGTAATTAAATTAT
ACAAATACTAAACAACTTATGTCGCACAAGTTAAATACTTATAGAATTTATTCCGAGCAACTTAGGTCATATATAAGAGTTATTTAGTAAAAAAAAAATT
CATTAAATGAGTAGTAAAAAAAAAAATTAAGACTACGTAAAGATCACCATACTGAAGGAAAAAAAATTAAACACTACACTGAAATAGAAAGAGGAGGATG
CTAGAAAGAGTGAAATATTATAATTGTAATGTATAATTTTTTTAAATATAGCTATGGATGTTAGATACATAGTATACATTACTATATCATGTACTAAACT
TCTTCTTTTTTTTTTCAAATTAATGAGGGATAAAAGTAAGTTTCAGTGAAAATATTTAAAATTATGTAATCAAACTAATATATTGCATATAGTCATAAAA
TAAATTTCTTTAGTCGAAAATGAACAAAGAAAGAATTCTTAAAGAATATAATATATTATATTATTTTTATATTAGGCATTGCTAAATGGTGCGGCTATAT
ATGGTTGGCATTTGGCTTCTTCTTTGTAAATTCTAAAACCCTATAAAAACCCTAACACGGTCCGACCCGAACCAGTCTCACTCTGCCGATGACTTCCGCC
GGCCTGCTCCTCCGTCGTTCTGCCCATAAAATTGTAAGATGTTTGTCTTATTCTCTTAGATCTTTCATATTCTGAGATTTTAAATCTTGTTGTGAATGGT
TTGATCTTACTGTTTCCGAATTAAAAAATTACAAACATTTTTTTATTAAATTAAACATCACTTCAAAGAGGTTGATTTGTGTTATTGATAGTTATAGCTC
TGAGTTTATGGGTAAAGAAATAAGAATATGTTCGTTCAATTGTCTCTGTCTGTGGGAGATCAACATTATGATTATAGAGATTGTCCGGTGAATTACATTG
AACACAAAACAGATTGGACCATACACCCGTAAGCAGACTCCACTGTTATGAAAAAAACTGAACACTACTGATATTTTAAATTTTACAGTCAATGGTTTTA
GCTTACTATATCACGTTCTTGATTTGAAATAAATATCCCTTCTTGATTTCTTGAAAGAGTTGATTTTTGTTGTTGATTGCTTAGCTCTGAGTTTATGAGT
AAAGAATGTGTTCTATTTTCTGTGGGAGATCAAGATTATGGTTATAGAGATATTCCGGTGAATTACATTGAAATTTTTGATTCTTTAATCATACTTGCTG
AACATTCTTAACATTTCGTAATCGTTCATCATCAACCATCTAACATTTAAGAGATAAGCAACTGAAAGAAATAATTCATTAAGTATTAATTGTATATCGG
CCAAAATAGCACCAATACAAAGTTTGAACCAAAACAGGAAAGAAACGCTAGTGGAACATGCTCCGCTAGCTCAACTCTAAAACTACGCTAGAATGTAAAA
CAGTAGCATCCTCGAAAGCATGAGGACCTACCAAACTCCGGATGAATACTGATGTCCGGATAGCTGCAACAACGAACCTGTAGCTCTAGCGTCCACCTGT
GCCTGCACCTAAAAGTAGATGTTCGTATGGAATTAGTACACACTTGTACTAAGTATGAGTATATGCAAGTACACACCAGGGACATGCATGAGGAAGAATA
GCTCTTTCCTAACAACATGATTTTTGGAAGTCAAGTCAGTGGACTTGCCAAATTGAGATTGGGAAAGTTATGCCATGAGAGTGACATGCATCATTATAAT
TATCGTATAGCACACAAAACATAACATATTCATATAACACATAACATATAACACATACTTTCTTTCATATTATTCATTCGTATACCATGAGACCTTATTA
TCATAGACTTAACTTTAAGACTTTCCAAAATGAGGGCTCAACATATGGGACCTCAACTAGGGAGCCTTCTTTAGCAAACACAGAGTCTGCTTCACTCATT
CATTCGTATTTCATTTCAATTCATTCATTCATAGGCCAGTGCGAACACCAGGTATACCTAGGATGTAGTTTAAGACTCTCATCGGGTTTGCTGTGCAATG
ATCAGGAATGACCTAATGTCATTACCTGAATCTAGCTCACCTCTTGATTATCCTATCCTAACACCTTCGGTATCATTCATTTCTTTATATGATTCGTTTG
AGGCTGACCTCATTCATTCATTGGGAACTTTAACTTTAACCGACATAGATCATGTGAGCATCATGAAATCCAGTGTCTTCCCCACACCGAAAAGAGGTGG
AATCACCGGCCAAAGCGATTCAATAACATGCTAGCGTATATGGGAATTTAACCCCGCCAGATCCCTATAGTGGCAATATAGGTTCAAAGACTAGGAGATG
TATGGAGACCCATACCCGGCAAGCCGGACAGTCTCATCTCATGAGAATTACGTGAACCTCCGCCCTTCCCGAAAGAAGGCATCACCACTCATAGCTAGCC
TATCGGTGCTCGGTATAAAGTTCCATTACATGCAACTCATACATCATAGAAGTTTGCTTCTAGTATGAAGACATCATAGCTCAATAGATGATTTCTCATC
TCATCATTAGTATTAAGTGTTTTAAACTCAATATTTTTATTAGAGTATTCATAGAGACTGGTCTCTTCATTATCTTACACTCTCATTGGTGAGTATGTAT
CGGTAACATTTACTTAAGCTCATTTAAGATTGCTCTCATCATATGCATTAACCTCACATCATGATTGTCGCCACATTCTTCATTTCATTACGTATATCTT
AGGTTCACTTATTCTTGAACGTATGTTAAACTTATATATCTATACATACAAGCCATGAGGCTTCATTTATAGTTCGTTAAGTGAATTCTTGTTTTTCTAA
GATTATGTATTACAAGACTTATGTATCTTGTATATATGCCAAGATCTTTGATTTTTGATCTAAGTAGATGACATTATTCTTGAATATTTCACTCACGTAT
GACTTATGTATCAATACGGAGGTTTGGACACGAGAACCCAAATTTTGAATTATTTGGATATCATTTATATTTTTCATTGATTTTAGTTCTAATATTCATA
AATTTAGAACTCTAAGTTAAGTCTCAACATTTTCGTGAAATAATAAATTTTCTATTTTAATTAGAATTCTAAATTAAATTTCAATCATTTACATGAAAGA
ATAATTTTCTAATTTAATTAGAATTCCAATTTAAATCTCAATATTTACATAAAAGAATTAATATTCTATTTTTAATTAAGATTCTAAATTAAATCTCAAT
GTTTACATAAGAGAATTAATTTTCCAACTTTAATTAGAATTTTAATTTACTATTATTATTATTTTTAATTAAATTCGCTTGAATAGGGAGGTTGTGGGTT
CGAACCCCCACAGCCTCACCTTTATTCCCTTAATATTTTTACCCCCCCTTCAGCCCTGAGGTCGCGGGTTCGATCCCCACGCCTTGCATCCCCCCTTTTT
ATTTATTTATTTATTTTTTTTTTAATTCTTTGACATCCCAAAAATTTCCAGATTCTTTTTAAACCTATTTCTATGTTTTTGGAAATTTATTCCACTATTT
TTCTGCACTTTTTCATCAAGTTTCACATTAGTTCTTAGGGAGATTTCATGGTTCATTCACTTCACTATGCTTCATCAAAATAAACATCACATTGCACACC
CATTTCACACATAAAATACATGATAAATAAACAACTTATATACCCCAAAACAATGCCTAAAACACTGCCCTATACACACCCATACATCAACTTTTTCCGA
TCATATTCTGATGATCATTATCGCGATTTCCCGCACATAAACACATTCATATTTAATTTAAACACATCATTCATGCAAAAATCTAGCAGCACAACATACC
CATCCTACAAATTCATTAGGGAGCTAAGGACAAGGACATACGAAGGGGAACAACCTTAGTTTCAAGAGTTTAAGAAACGTCCGAAAGAAAGTACTCTTGG
AGAAAGAATTCCATGAGAGAAACTCATACCTTAATCGATGTTCAAACTTTAATGTTGCTGCCCGGAAAACTCCTCCAAACCACTCCCAATTCACTTCAAA
GTATACCTCTCTCGACGAACCTCTCTTAGCCTTGACGTTTTGATTACTTTTTCTTTTGCTTAAAAATTTTTTTGTGAGTTCTTCAAGCATGAAAATTATT
GATATTTTGGCAGAAATAATGTGAGGAAGATGGAGAACGTGAGAGAGGGAGTTTAGAAGCGTGAGAGAGAGAGGGCTAATTGGATTAGGAGACTAATTCA
AGAATTAGTCAAATAACATTAAAATAAATAAATACAAATCTGTTTTATTTATTTATTTATTTATTCATTTAAAACATGAAAGGACAATTATGCCCTTAAA
TACCTATTTATTCTTATTTACATAATTCTCTTTTTTTTTGAATCGTCACCAGAGCTCTTTCCAACACTCCTAATCTCTCCAAAATTAAATCTAATGCTCC
TTGAATTCCAGTTTGAGCATTGCATACTTCCTCTTGCGAATTCAGCAGATCGGAGAGCATTTCATCGTGCCTTGCTATCTTATCCTCTGTAATCTTCCAG
CGTGTGCCCTCAGCCATTACACAGGTTCGAAGGCTCTGATACCAAGTGTTATGATCTTCCTAAGATCACAAGCTCAATCCACCAACAAATCAAAAAATGC
AGAAGAAAATCAACTGTAGAATTTATTGATACCGAAGTTCTTTATTACAACTACTGATACTACAACTATGGAATCTACTGCTACGCCATTGATGATCTGC
AAGGAAACAAGAAGAAGAAAAAGAAGATTCTGGATCGAAGAAGAAAGAAGGAAACAGAGAAGAGAATTGGTGTGACTTATTTTTCAGTTATTTCCCTCTC
TCTTCCAGCATGACTACGTATAACAACCTCCACCAACAACCTGTACCCACGTGTCATAATCCTCACCCTCAACTTTCCTTAATCAACTTCCAATCTCATC
CGTTCATTTTATATTTCTGTTAACCTTCCTATTTCCTGTTATTGCCATATTCAAAGATCGAATCCCTGCAACCCATATTTGTTATACCTTTAAATGCTTA
ACTGTATATCATTATTGATCTTACAAATTGAATTTTGTAAATTTAAATGTCAATATGGAAATTGCACATTTATTGCTAAAAACACATGAGGCTTAAATGC
ACATTAATCAAGCTAGTAAATTTGAATTTCTAATGCTTAAAACAAAATTTTAATTACAACTTGAGATTTCTATTGATAATTTCAAGCGGAAAATTATTAA
AAAAACAAAGAATACTATATAATTTTTTTTAAAACTCCTTTAACATTAAATAAGAATGGTGCTTTTAAAAATATTTTGAAAAAAAAACATTCCACAAACC
ATTTATTTTACCATATACTCTATCTTTTATATAGAAAGAATACAAGGATGGACTTAGAATATGCCCCATACTTCATGAACACATATTTTAAATCTTGAAT
AAATAAAAATAATCACAGTATAACTATTAGTAATATTTTGCTTCTTAAAATTGAATCAAACAAAATAACGTGTGCATATAAGTTGAATCACAGCTATTTC
TAATCTATTTCACTCTTTTTCTTTGTCTCTCTCTAAAACCCTAAACCCTAACACTGAACTTCCCCTTTGCAGTTATAAAGTAGCGTTGGCCGCACAGCCG
CCGCCTTGCTCAATCTCTCCTCGCCGTGAACTACCTCTTCTCTGTCCGCCGCCGATAAAACTGTGAGTTATTTTTTCAGCCTGTTATGTTTCTGACTTTG
TGTTCTCTAATTGTGGTTGATTTATATCATTGATGGTTTAGCTGAGTTTATGGTTGATTGTAGAACAGTAAATTTGTTCAATTGTTATAGAGGTTGTAGT
TGGATTGGATTGAATGGAAGTATGTGTGAACGACTAGTAGGTATTATTAAGCCGGAAGCTTATTACTACTGTTCTTTTATTTATAAAATATTAAAAAAAT
TATGTAACTATCTATGTCACTGTTCCACGAAATAAAATCTGCAGTTCTTTTTCCACTATCCTGTGAGCATGGAATTCAAAAAATTTGGGAGAACTTTGTT
AATGTTTGCCAAATTGTCACTTTAATGCTTACTTTTACTTTTAGTGGATTTTTCTTTGCAATCACCACTAAGCAGCACCAAGGAAAAGTGACATTCTTTT
TGGGACAAGGCTAAAAATGTAGAGGGTGCCGCATAAATTGGAGTGCTATAGAAGTTTTGCATTCAAATAAAGAGTTCTTTTTTACCAGATATGAAGTATT
GAGTAATTTGGAAGATGTTGGTTGGGTTAAGGGAAATTTTGGCTTTGACAAGTTTAGATGCTGACTGAACTGCGTGTAATAGTGTTTATGCATTAACATG
TGTCTGTATCTGAATTAATGATATAGTTCTAGAACTTTGCAATTTTGTTTTCTCTCAGAATATAGATTAATATCGAGGAATTTAAGCTTAATGTCCCCGT
TCTATTTTCATCAAGAAAACATTGTCTTTAAGTTTTCAAAATCTTATGTATTTTAGGAACTACCAAAATTAAACTTAGGATCTTTGCAATTTTTTATATT
TATTTTCATCTTAGAAAATATCGTACTATTTTTTAGTACCTCACAAATTGGATATTTGACATGATAGACAAATATTGGAATTATGAGCATGGAGACGGTT
GGGTCTGAGCAATCAAGAGAGAAAATGAAGAAAGACAAGAAAAAAAGGAAGGCTGAAACAGAGGGACCTGATACCCCATCAACCTCTCACATTTCTAGCA
ATCCTATGGAGAAGAAGAAGCAAAAAAGAGCTGTAGACAAAGAGAGGCGCAGGGTGGAGACCGAGAAAAAAACCGAAGCCCAGCAAGTAGTGGTGTCCTC
TGAATTGAAAAGTAATAAGAGCGCGGTGATTTCTCCCACTACTAGTGGATTGCCTGAGTTCCACATTGCTGTATTTAAGGACCTTGCAGCTGCCGATGCT
TCTATTAGAGAAGCAGCTGCTAATTCTTTAGTTGCTGAGTTGATTGAAGTTCAGAAGGCTTATGATATTCTAGAGAACAAGGAAGTGGTTGAGGGACAGC
TCAAATTGGAAGCTGAAAAGGATGATGGGTTGAACAACTGTGCCCCTTCGTTGAGATATGCAGTTCGGAGGCTAATTCGGGGCATTTCTTCATCAAGAGA
GGTGGGTTAGGTTAACTTTTAGCACAATGTTCTGTGGGTTTGTTTAAATTTTGTGCCTTGTTATATTTGACGATTTAATTTGAATGCTTCAATAAGGGCT
ATATGCCTTCACATTTTCATTTTATTGTTGAATAATTTTTAGGGAGACTTATATCTCTATGGGTTCTTGTTGACATACCCAACTGATGAAAGCACATTCA
TGCTGGAAGGGTTGTATTGCACAATACGACGCTTAGGCTGTCTTTCCTGTATTGACCTTTAAAAGGTTATTTTATTTTAGAATAGAACCATAAAAGGTTA
CCTTCTTGCAGGTAGATACTCACAGCTTGTGTCATTGAATTTTTTCAGTAGTCCTATGGTCTACAGTTTTGAATTAAAAGGTTAAATGATATAATGTAGG
CTTAAGAGACAGGTGTCTCTTCTGCTTATAGTCCCATGTTCCATGGTTGTCTCGATCAACTGCTCCCATATAAAGCCTCATCTATTTCCTTGTTTGTGCA
GTGTGCAAGGCAAGGGTTTGCATTAGGCATGACAGTGTTGGTTGGTGCTGTTCCATGCATAAAAGTGGATGCCCTGTTGAAGCTTATTGTTGAATTATTG
GAGATCTCTTCTTCCATGAAGGGTCAGGTGGGAAGGATCTCCTTTTGTGAAATGTTACCTTTCTCAAAAAAAAAATAATAAGGATCTCCTTTTGTGAACT
GATAGTTTTCTTATGGTCTGTCTGAAAAGCTTAACTTGGTTTTGTAGGACATGAAAGATTGCCTATTGGGACGCTTATTTGCTTACGGATCTATTGCAAG
ATCAGGGAGATTAACTTTGGAGTGGACTGCTGATAAGAACACTCCTTATATTAAAGAATTTGTTGGTTCTCTTGTCTGGCTGGCAAAAAAGAAGCTCTAC
TTACAAGAGCCTGCTGTCTCAATTATTTTGGAATTGGTTGACAAGGTCTTTCACTTTTACAAGCCTATGAATTGCAAATTTATTCTCTGTACATTCACTT
TAGTTATCTATTGAAAATGACTTCACTGATTGCCTTTTCCTGCGTCATTATAAACTCGTATGAGCTCACCATCCCCTTATTGAACTTGCAGTTTTTTTTT
TTACTTGCCTATAAAACATAAAACATCATCTCTTCCTACTCTTCCCGCTACATCTTACTTATTTTTGGGCAAGAAAATGTTATACGCTTATCCAAATAAT
ATCACCTCTTCCTACAACTAAGCTGTGGTTTTGTTATGTTGCCGATTTAACTTTCTTCATTTAGTGTGTTTTTGCTTCAGCATGCTGTCCATTTCACTTT
CTTCATTTAGTTTATTTTTTGCTTCAGCATGTTGTCCTCTATTTGTAGTCTTTGCTTAGGCTGCATTCAGTTTAGCCGTCTCACCATCCATATTTTTGCC
ATGCCAGTTACCTGTTGAAGTTTCATTGAACCATGTTCTTGAAGCTCCTGGGCTTAAAGAGTGGTTTGAAAGTGCAACGGAAGTTGGAAATCCTGATGCT
TTGCTTCTTGCCCTTGCCATACGTGAAAAAACTGGTGTTGATAACAAAGATTTTGGCAAGCTTCTGCCTTTTCCTTATAGCCCCAGCCGGCTTTTCAGTG
TGGAACATTTGTCCTTGCTTTCCAATTGCTTGAAGGTGCTACTGAACTTCTTCATTTTCTTTCCTTGAAAAGGATTGTTCATTAGTTTGATTTTTGTCGA
CTTTATGGATGTGCAGGAATCCCACTTCTGCTTGCCACGAACTCATAGTGTATGGTATTCCTTGGTAAATATTCTTTTACCTGAAAATGTTCAACAAGAT
TTTGATCCCTCAGCAGCTTTAAATTCCACAAGGAAGCACAAAAAAGGCCGCAAGGGTAGCTCAGCTGAAGAAGATATTGAGAAAAATCTTAAAAACTTTT
GTGAAGTTATCATTGAAGGATCACTTCTTCCATCATCTCATAATTGCAAGAATTTGGCGTTCAATGTTTTGCTGCTTCTCCTTCCAAAATTGCCCACATC
GTGCATCTACAACGTCCTGTCTTACAAAGTTGTCCAGTGCTTAAAGGACATACTTTCTGCGAAAGACACTAATCTATTCAAAGCCAGTCAATACTTTTTA
AGAGAATTTTCTGAGTGGGTCAAGCATGATGATGTTAGAAGAGTGGCAGTTATTATGGCTTTACAGAAACATAGTAATGGGAAGTTTGATTGCTTCACCA
GGTCAAAAACAGTTAAAGAGTTGATGGCTGAGTTTAAAACTGAGTCTGGATGCATGCTTCTCATTCAGAACTTAGTTGACATGTTCCTGGATGAAGCTCG
TGCTTCAGAGGAGACTTCAGATCAGAGTCAAACTACAGATGACAACTCAGAAATTGGTTCCTTAGAAGATAAGGATTCTGTTGGAACAGTAGGAACGCCC
GATTTTTTGAAAGGATGGGTTGTAGAGTCACTTCCAAATAGCTTGAAGCATTTATCTCTGGATACAAATGCAAGGTTCAGGGTCCAAAGAGAAATTCTAA
AATTTTTGGCAGTGCAGGGTCTATTTTCTTCGACACTTGGAACTGAGGTGACATCTTTTGAATTGGAAGAAAAATTTAGGTGGCCAAAGTCTGCCATTTC
AAGTGCTCTTTGTAGGATGTGCATTGAGCAGCTGCAGTTACTGCTATCCAATGCTCAAAAAGGCGAAGGACCTCAAGTTGTGCCTAGTGGTCTTGAAGCT
AATGATCTTGGAGCTTATTTCATGAGATTTCTTACCACATTGCGAAACATTCCTTCTGTTTCGCTGTTTAGATCCTTGGGCGACGATGATGAAAAAGCTA
TCAAGAAATTGCAGGCTATGGAGTCTCAGCTCTCAAGACAGGTGCTATTTTGTGTTGCTTCATTTTGTAGAATCGTAATAATGTTACTGACTTCAACACT
GGTCAAAGTTTTGTTTCTCTGTGAAACCAATGCCGCTTGCTTTAGGCCTTTTAATTCTCTCTTTTATTGTTTGATAAGAACGTACTCCAACATTGGTGTG
AGGTATATCAGTTAGCTCTTATCTGAAACAGCCATAACTTGTTATTACTCATCTTATATCAATTATTGCCATCAACAACTTGTATTTTATTTATGCATAT
TGACCACTATTCACCGTGTACAGGAAAGTGAAAACTTATCAATATTATCTGTGTGGAAGTTTGATTGTTAATCCTTTTCTTCTCTGACCTAAATCTTTTC
TCCAAACAATTGCAGGAGAGAAGCTTGGGTCCAGGTATTGCCAAAAATAAGTTACATTCCATGAGGTACCTTCTGATACAATTGTTGCTTCAAGTCCTAC
TTCGCCCTCAAGAATTTTCTGAAGCCGCCTCTGAATTGGTTATTTGCTGTACCAAAGCTTTTCGATCTTCTGATCTTCTTGCTTCCTCTGGAGATGATGA
AGCAGAGGGAGATGATAGTCCTGAATTCATGGATGTTCTAGTGGACACTATGCTTTCGTTGCTGCCACAATCATCAGCACCGATGCGGACAGCTATTGAG
CAGGTAAACAATAGGAAAAAAAAAGCATAATATTCCATCAGTTCTTATGGTGATTTAATATTTCCCAAAACCATGACCTTGTGACATGCTAGTCATTATT
TCTAATGCATTATTGCACCTACTGTATTTTGATGTGAACTTCATTCTGAATCTTTTTGACCAAATTAATAAGAGAAGCAACCTAAAAGGAGGTGAAGTTT
TTACTTATACGGATGTTTTGTCTTAGAAGACTGAGTTCTCAATCTCAAGCTGTTAGGTGGTGTAGGCGATATGAATTTTCACTGTTCATGCTGCTCCATT
TAGACCCATCTCAATCTTTTTTAGCACTAGAAGTTCTCTACATATTTTACTGGCAAACTAACCTCTTGAGAAATAATTGTCAAAAAAAAAAGCATCTTGA
GAAAAAACTAGCGGACTCCTAGTCTACATTGGACTCAAAGTAAGCATACCAAGATGACTATAATTTAATCACAACTGATTCACATAACCAATCTTGATTT
TTCCTTATTGTACCTTGGCCCCTCTCTAATTAGTGACCATGATTTATGTAATCTGTTTAGTTCGCTCTTCGGTTTTTAAAGTTTTTTCACCAATTGTTAA
CACCCCTAGGTAATGCAATAGTTCTCCTGGGAAACAAAATTCATGATGATATGTCACTCATGCTGGACGATTGGGTCTATTTAGTTATCTGATAGAAGAT
ATCTTTTCTTTTTCCTTTTTTCTTTTTAATTGTTGAAAGGTAATATTCAAATTTTAAGCACAATATTCTTAGCACTGCAAGCCTTATCTAAAGGAAGATG
TGGTTTTTATAACCAGGACATTTCTCATGTCCAATGACGCAAAGTTTGAAACTCGGTGGATAATTGGTTTGGCCTTCTACCCTTTTGCGCTTAAACATTA
GGCTATTTCGTACGGCAAGATTCACACTTGTGATGTGCTCCTAACTTGCACATCCTGCCCTTTGCTCTTGCCCCTAGACAAAACCCTTCGGGTCAAGTTT
TTTCTGAATACAGGACTCAGTTTATCCTTTTTCTGTGGTTTTGCACATGGATTTACTGTTAATTATTTGATGAGAAAATAGTGAATGCAATGCTTCATTT
AATTCCTTTATTGGGATACACCTGTTTTGGTTTTTATATCAATGGTATTCCGTCTTGTTTTTCTTTGTTTCCTCTTCGGTTAGTTTTAAACAAATTGAAT
TTTTTAGTCTTCTCTCAAATTGTTAAAATTTATGATCTTCACTTTGGAAAAACACCTTATAATAATGGTATCATATTTCAAATTAACTTGACATGGTCAA
TTTTAAGAATTCGTTAGGACATGTTTTTGCTGATCTCTTCATTACAGAGTTTGCTTATCATGCAAAAATAATATTTTCTTGTTCTTTCGGTGGTAAAAGA
GGATAAAATGTCGATAGCTCTACACTATCTTTCCTTGTCCATTGATGCTCAACATTAAAAGCACGTAGTAGATGCATAGTACGAGTACATGGTAATTGTT
GGGAGCTTTTTTTTTTCTTTTTTTTTTTTGCAAAAATGCTCATGTTTGCATTCTTTTTGGATAACCTTGTAGTCTGGGCTAGTTTGTGCGCCCTTTAATT
AACTCCATAGGTACTGCACCTCCCACCTTCACAAGTACTGCGTAATCCATCCACTAAGTCCTAGGTAAAGGGAAAGAAATCATTGGAGTGTTTTTACTCC
CTTGGGATTTGAAATTGAGACCTCACGACTCGAACCACCTCATTGAATACTAGGCAATACCTTTCTGTGCATGTATGAATACTTGAAAATTGATTGTTTC
TGTTCTTTTTAATTATGTTTCTCTTTGTGAAGTACTTGAGTTTGTTTGAACTCTGCAACAGCTGCTGTTGCTCAGGCTCTTCTTCAGCTACTTAAAAACA
TTTTTTCCTTTATAGGTTTTCAAATGTTTTTGTGAAGATGTTACGGATGATGGGTTACATCGAATGTTGCGGGTTATAAAGAAAGATCTCAAACCAGCCA
GACACCAAGAAACTGACAGTGAGAATGAAGATGACGATGATGACGACGTTCTTGACATTGAAGAGGCTGAGGAATCTGATGAAGCAGAGATGGATGAAAC
TGCGGAGAGGCATGCACATGTGGATGACTCAGAGACAGTAGTTGGTGTTGAGGGTGTTACCTCAGAACTTCCTGTAGCTTCTGATGATGATTCTGATGAG
GGATTAGATGATGATGCAATGTTCCGCCTGGACACACATCTTGCTAAAATGTACAACGCTAAGAAGAACCAGGCTGGTAGTGAAACTGCTCATTCACAGC
TTGCCCTCTTCAAACTTCGTGTCCTCTCGTTGCTGGAGATTTACCTACACGAAAATCCAGGCAAGTCTTTCTTCATTCACTAAGGGGTCGTTTCGTGTGA
GGGATAAGAATAAATAGTTGTTCTATAAAATTTTGATGTCTTGTTTGGTTGGCATGTTTGGAATAACTTATCCCACCATTTATAGCATAGTGATTGGATA
AGTTATCCCCTAAACATGGTGGGGAAGTAATTGATCTTGGGATAGGTAGTTCCCAACCAAACAACCCCTAAAGGATTGCTGTTTCCTGGCTAGGATGAGG
ATGATTCATGTATTTAAAGTAGCATACTTTTATCATCTTTGATATTTCTTTAGTTGCTTTGTTTAGAACTCAGCAAACCCAGTACAGTGGTTGGTCATTA
TTTTGCAATCCCACATATATTACAGGTTTAAGTTATGAGTTAAAATATGTATTATTTTATGTGGAGTAGTAAATGGAATAATTAATAGAAGGATTGGTAA
TACATGGATTAAAGTACTACAATGATAAATTTATCCTCTATTACTCCACAGTTAGATTCTTGGCTTTGGTTATGGTACTTTCATGTCCCAGTTCTGTTCC
TTGCATCATTTTTATAGATTTAACATTTTTTTATTGACACTGGTAACTTTAGTCTTAGTCTAAACTGCTACCTATAACTAGCACATCAAAGATATCATCT
GTCCTAGTCCATCTTGATCTTCTGTAAGCTATTCTGCGCACATCAAAGATTTAACATTTTATCATGCATTGTTAATAAGTTTTTTATTTTAAGAGTTATA
TAGTTTATATTAATTTCTAATACAACAAACAAATATTAACAACCACATATACTGTAAAATCCCACAAGTGAGGGGAAAACCGGAAAAACAAATATGTGAA
GAAATAATTCATGCATTGTGTGATCCCTACATAACCAAGCTCTACATATCTGACCCCCACATTACTTATTCCTTCATAACCTACATATTGATGCATTTTG
GGGCGAAGTCAATTAGACTAACTTTTCTCATTTAATTTTACATGTACTAATTGCTCCTCTTGTGCGTCATCATTCCTTGTTCTGTTCAATTTAATTAACC
GTATTTCAACCTTATTTGCCTTGTATACATGTTGACTTGTAGATGCCTAACGTCTCCTAAAGATGTTGTTGGACTCACTATTCTTATGTATCAATCACTT
TGGGCATCTTTATATGGCATGTCATTCCTATGATCCTATCAAATCCTCGCTTCAGCCTTTCTATTTTAGTTCTGCATGTATGGCTTTTAATCTGTCGATT
CTCCTCAAAAATATTACCTATTATAAATACCATGAATAAAAGATTCTCCTGTATACACTTTGATCTTGTGGCTGAATATCATGATCTGAGGCTTTTGTTC
CTCTTGTATTAAGCACTGCTGTATACACTATTTGTTTGATCTTATTGATTCATTAAGGTGTTAATTGTTATCTAAATTTTCCACTTTGCAGAGAAGCCAA
AAGTAGTGAAAATATTCTCAAGCCTAGCTCATGCATTTGTAAACCCTCACACTACGGAAGGTAACGAACAACTTGGCCAGCGAATTTGGGGAATTTTACA
GAAGAAAATCTTCAAGGCAAAGGACTATCCAAAAGGTGAAGTCATCGAATTCCCAGTTCTTAAGTCTCTCTTGGAAAGGAACTTGGTACTGGCAGCAAAA
CATTTCAAGAAAAAGAAATCTGCCTCTAGTTTGTCAAAGAAAAAGCTGTCTGCTGCCTTGAATAGATTCAAAATGATCAATTCTCTTGCCCAGAGTTCAA
TATTTTGGATTTTGAAGATTATTGATACGAAAAAACGTCCAAAATCTGAACTTGAGGAGGTTTCTTGTATATTCAGAGAAAAACTGGAGGGTTACTTAGA
TAGTAAAAGTACTCGAATGAAGTGCGAGTTTCTAAAAGAAGTCTTTAAAAGGCGACCACGGATTGGATATCCTCTATTTGGGTTCCTTTTGGAGAAATGT
GCTAGTGCAAAGCTACAGTTTCGTCAAATTGAAGCTCTTGAACTGGTCATCGAGATGTTAAAATCGTTTGTTTCTTCAAACCCTGATGACAACAGCCATT
TTGCCGAGTTAGGCAGCCATCTTGCCAAGTCAGGGTGTCTTGTTAATGTGTTGTTGAAAAATATGCCGGATAAGGCATCACGACGAGCTGATGTTCGTAA
GTTTTTTGGAAAAGTGATTCAGGTCTTAACAGATGTTGAACTGAGGGCCTTGTTTCTTAAGGCTCTGGAACCTGATTGTGAAGCTCAACTGAAGGGCATG
TTTCCTGTTTTAAATCAGTGAATGGTAGGGGCAAAGGTATATGACAATATTCATAATTCGCATGTTGGGGTGACCAATTTGTCATTGTTTCCTAGCGTTT
AATCAGACCATAAGTTATTTATAATTTTGTTTACTACTGGAATTTACTGTTTTCACCAAGATTTTTCTTGGGTTGTTGAAAAACTTGTAGCAACACCAGT
TTTGGTTATATGTAATACTTCATAGTAACTGTACAATTCCAAAATTTTGGCATACGTGGCGCGAATTGACATCTTACCAATGATTGTTTCCATTCGTCAT
TCTTCACCCCTATTATTTCACGTCATTATTTATCATTGTGAGTCTATAGTTGATAAATTCGTCTCAGTGAAACAAGAGTAATTTTTTGCACAAATTCTTA
CCAGCCAATCATGAAGCCAAATGAACTTATCTACACAACGAGAGAACATCAAGCTTTTTTGACAATATGTAGGAGTTCATTAACAGTAGAAAGATGCAAC
AGAAGACTCCAATCTTGGATTTGAAGAAAAAGAAGGATAGAAGTACACAATTCAAAGTAGCTTAAGAAAGAGTGACACAACTCTAGTCTATAATGTAACA
GAACTTTCTCCTTCACGGAGAACTTGAACCCGTAAGTGAAGGTCTTTGTTGCGCTTTCCTCTTACAAATTCACAAATACAATGGTCATTTTTCTCCACAA
GGTTCCATCTACATAAACTGCGCCATCCACCTACAAGCCATATTCTACCGTCCTTCCACTTGTTGAGTTTCGTCACAAATTCTCTGCCAATAGAGTCGCG
AATGGTCATACTTGAAGGCAGTTCAAGTTTGTAGTCCTTTACCACATCAACCGGAACATACTGAATTGGGAACAAAGACTTTGTCAAGTAAGAAATGATA
TAACGATTGAACTACAAAATCATTCACGAAATAGTGAAAATGATTATAATTACCAGTTGATCTCTCCTCTTTGATCTTATTTTTGCTACAAAATAAGGAT
TTTTCGGCTGTGTTGCACGTCCACTTTTGAATATATCTACACCAAAATGGTCGTGACGATTCCTCACCTTGCAAGCAAAGGCTGTTTTGCATCTAGATTT
AGTTGGTTTGGTTCATAAACAAAAATCTCATGAAACACAAATATCTACCCATGTAATTTTACAATTTTACTAACATGAATTTAAGAATGAAAGAAAAATT
TTAACATGTACCAAAAGTATTAAAAAATGAAATTTAACTTTATTCCAAAAACTAAAACAAAAAGCACCCTTAGGCTTGTTTCGTTAGCCTTTCGAACTTA
TTATCTTAAACATTTTATATGACTTGAAGATGATCTCCAAATATACAAAGATTTTCTTTTTTAAAAAAAAAAAAAACTTACTAACAAGAAAAAAGACGAT
ACAAAAATATTAATTGGTGTTTACCTTTTGATCGTAGCGCCTCTTTCTTATGTGTGTTAGTTCTTTGATTCTCTCCCTCATCTTCTTCTTCTTCATCTTC
ATCGTCTTCTTCTTCATCTTCCACGTAACATGCTACCTTTTTAGTCTCTTTATATTCCTCGTCCTTATCCTCGTCCTCATCCTCGTCCTCATCTCGTTCT
CCCATGTACTCCACATCGTTATCGTAGGAAGAAAAACTATTACAGCTATCACTAGCCCAATTCTTCTCTTTTGACTCTCTACTCTTTTGATGTTCAACAA
TCATTTCTTCCGCTTTTAAACCTCCAACTCCGTTCTTTTCACATTTAGTTCTTCCAAGTAATTTAAAGTCAAACATTTTATTTCCATCATAGTCAAAAAC
AAGAAAATCTCCAACCTCTACACTATTATCCTCAATAAATTTCTCCCATCCATATTGAAAATACAAATTTCCTCCGATTTTGTTCACTCCTACAGGCCAC
ATATTGCCAAATCGATCCCTAAGGTTAATTTTCATTGGTAATTTTCTATTCTTGTAATATGTAAAAGATGTGGGAATTTTCTGTGAAAAAACATAACAAA
CAAGTAGAATAACATCAATTTTTTTTTCATCATGTAGAAAAATATTTCAAAAAAAAAAAACTTACGAGCCTCTTTCCACTGTTTTCAGGAGAGAAAATCT
TGACGAAGCCCTTTTCCATCTTCTCTTTTGTTGTCAAACTTTAAGAGAATAGGAGAAAATACAAAAAGAGAAGAGATTATAAGAAGAAAAATAAAATGAA
AATTCTGAGTATTGTTCTCTTCTCAAGTAGTAAATGCAGAAGAGAAAGCTTTTTCCTCATATGGAATACTATTAATTTCAATAATTCAGTCAATATACAA
TATTTGATTTTCTCTGTTTACTTTTAATAATACACAGTCAATATACAATGTTTTACTGTGTGATTCATGACAACATTCTCTAATTTGAAAAAATTATTCT
AAAAAAGACCAGACACTCATTAATATGCTCTTGTCTATAAAAAGTATAAAGACACCACTCCATATGAATTGTTTGGTACAAAATTTGTAATGCAAAATTT
AGTAATATTTGGTTTGTTGCTTCTCACCGTATTTTGTATTCGAATTTAAACTCTATAAAAATGTTTCTTTCCAACTATATCTTTAGAATTTTTCGTTTCA
TGTAATCGGACCAAAGTAGATAATTATAGGACAACATTATTTTTTATGGTCCTCTAACTAGATAGGAGAAGAACAATATTATTGTTATATTTGTTATCTT
CTCACTTGAATTATTTGAAGGTAAATAACTATCATCTTAATAAATTGATCACTAACAAAATTTTAATTTCAATTTATAAAAGGTAGAACGTCTAATTTAA
AACCCTAAAAAACGATAAAAAATAGTAAAATTGAACGAACCATCTACGTTTACACATAAATTACAAATTGTAATTTTAATATATATGCAGCTTTATAAAT
TGTTCAAAATACAAATAATTAGAAAATCACTTATAGATCAATATATAAAACATTTAATTAAGATCACAAACGTCATGTAGTTTCTCTTTTCCATTAGTAA
ATGTTAAACAACTCACAATTCAAATACTTCTTGATTTATATTGAATTTATTTAACAACAAACAACTCTCTCTAAATAGTAAAAGTTTTAAGCTAATTTAC
TCGAATAAACTTACTAATATAGATATAAAATATAGAATTAAAAAAAAATTAACAAATTGATTAAAAAGAGTTTCGCAATATTTTTATCTTTTCATCAATT
AATCCTGAGTGCGGAGTTAAAAGGGTAGAAAAATTGTCAAAAATTCTAAAAGGGCATATTAATTTTTTTTTAAAATCAAAACGGTAAAATCGCTCACGAT
ATAGCGACTTGTCGTCTGAAAAAGAGAAATCGCTGCTATTAAATTTGGTTTTTTAAAAAAATAATAATAATAAATTAAACAAATCGCTCCATACGGAGCG
ATTTTCAAAATCAAAAAAAATTATTTTTTTTTATAAGTCGCTGCTTCTGCAGCGACTTCTATTAAAAATTTTAATTTTTTTTCTTTTTTGCTTTACAATT
GGTTGAGATTGAAAAAAGAAACAGATCAATGAAGAAGATGAAATGTGGTAATATATATAGTTATGATTTGTAATTTCTAATTTAGTTTAACAACTCTAAA
ATTTAGCTTCTGAATGGAACAAAATCCGTAGTAAATAAGTAGAGAAGCAAATAAAAGTAAAAAATAACCAAGAAAAAAACTGATTAAAAAATAGTAATGA
ATAATGAAGTGAAGAAAGTAGAGTAAAATGTTTGGAAAAAAATAAAACAATTTATAAATCTGACCTTGCTTGGTTTATTGAGAAGACTGCTTAATTTGAT
GCTTTTGTGTTGAGATAAATGGAAAAAACTGAGAAAGAATATAGAGGAAGGAGATGGTGGACTTCAATGATATAAATATAATTGTTAATTAAGTTTTCAA
AAAAAAAAAATTAAGTGTAAAACAAAAAATGTGTTAATTAAGAATTTATTTTATATAAAATAAAGCAAAAAATAAAAAAAAATTAAAAATTTTAATACTT
ATAAAAAAAATTATTTTTTTGATTTGAAAATCGCTCCATGTGGAGCGATTTGTTTAATTTTTTTTTTAAAAAGCAAATTTAAGAAATCGCTGCTATTGCA
GCGATTTCGCTTTTTCAGAAGGCAAAAGTCGCTAAATCGTGAGGAATTTTACCGTTTTGGTTTTTAAAAAAAATTGATATGCCCTTTTGGAATTTTTGAC
AATTTTTTTACCCTTTTGAGTCCGCACTCAATTAATCCTACTATATTAAATCTTATATTATTTGACCCGAAATTCCTACTACATAAAATTAAATATTACC
ACACATAATACCTGTCGTAATATACTTCCTACCAAATGATCCATTATGCATTTATTCAACTACTTTAAAATAGCAATTTTGGCATTCTATTTTCTTTTAA
AAGATATTATAGTACCATGCAAAGTTGAGCTAGTAATAGAAGTTTGATGCTATTCTCTTTGCCATAGTAAAGATCTTTTAATTTTGATTAAAAACAAATA
TAAAATCTTTTAATTTTTTTAAAATAAAATTTATATATTTATAACAATATAGAAAATACTATAAATCACAATAAATAATAATTTAAAATATTTAAAAGGC
ATATTAAAAATTATACAAACAAAACTTAATTTGAATATCAAGATAAAAAATATGTCACATAAATTAGGAGAAAGAAAATAACAACGATTACTAAGACATA
TTGTAAAAAAATCAAAGAGACAAAAAATAATGTTGTCATTATTGTCGAATGTCGAGGAAACAACAAATAAAATGAAGTTGTACGGTACAAAAAAATTGAA
GTAAATGTTTTGATATTCTAGTAGATAAAAATAATAATTCTAATGAAAAATATATCAACTTTAAATTTTGAAATTAAAAAATAAAAAAATCTCGTGAAAT
ATAATGAAATATTTAAAATAATAAATAATTAACAAAGATGTCCCTTGATTTATAAATTTTAGATGATAAGAGGGTATATATTTTGTTCGGTGAAAATTAT
AGTTTTCAATTATTTATTCGAAGTTAAAAGGCCAATTTCAGAATCCATCAATTATGCTATAAAATGTATAATAAGAACTATATGGTAATGAATAACTTGA
GTTCTACAGAATTTATGTTAAAGCAAGGCAAAGGTCTTGTTGTAGACACCACAAGCTATGTTGAAAAAGACAAAACTTAATTTTTACAGTCAAATTAAGG
TAAAGTTCTATTTTATAATTAAAAGTTAATGTCATAAAATACGTGACTTAATTTCTACAAATTTTATACCTAGTAAGGTAGAAGTTTAGTTTCTGAACCA
TCAAGTTATGTCGTTAAATGTATAACTCAATCCCTGCAATATTTACAGAGAGCTGCATAAAAAAATTTGAAACTTATATTGAGTAATTAAATTATACAAA
TACTAAACAACTTATGTCGCACAAGTTAAATACTTATAGAATTTATTCCGAGCAACTTAGGTCATATATAAGAGTTATTTAGTAAAAAAAAAATTCATTA
AATGAGTAGTAAAAAAAAAAATTAAGACTACGTAAAGATCACCATACTGAAGGAAAAAAAATTAAACACTACACTGAAATAGAAAGAGGAGGATGCTAGA
AAGAGTGAAATATTATAATTGTAATGTATAATTTTTTTAAATATAGCTATGGATGTTAGATACATAGTATACATTACTATATCATGTACTAAACTTCTTC
TTTTTTTTTTCAAATTAATGAGGGATAAAAGTAAGTTTCAGTGAAAATATTTAAAATTATGTAATCAAACTAATATATTGCATATAGTCATAAAATAAAT
TTCTTTAGTCGAAAATGAACAAAGAAAGAATTCTTAAAGAATATAATGTATTATATTATTTTTATATTAGGCGTTGCTAAATGGTGCGGCTATATATGGT
TGGCATTTGGCTTCTTCTTTGTAAATTCTAAAACCCTATAAAAACCCTAACACGGTCCGACCCGAACCAGTCTCACTCTGCCGATGACTTCCGCCGGCCT
GCTCCTCCGTCGTTCTGCCCATAAAATTGTAAGATGTTTGTCTTATTCTCTTAGATCTTTCATATTCTGAGATTTTAAATCTTGTTGTGAATGGTTTGAT
CTTACTGTTTCCGAATTAAAAAATTACAAACATTTTTTTATTAAATTAAACATCACTTCAAAGAGGTTGATTTGTGTTATTGATAGTTATAGCTCTGAGT
TTATGGGTAAAGAAATAAGAATATGTTCGTTCAATTGTCTCTGTCTGTGGGAGATCAACATTATGATTATAGAGATTGTCCGGTGAATTACATTGAACAC
AAAACAGATTGGACCATACACCCGTAAGCAGACTCCACTGTTATGAAAAAAACTGAACACTACTGATATTTTAAATTTTACAGTCAATGGTTTTAGCTTA
CTATATCACGTTCTTGATTTGAAATAAATATCCCTTCTTGATTTCTTGAAAGAGTTGATTTTTGTTGTTGATTGCTTAGCTCTGAGTTTATGAGTAAAGA
ATGTGTTCTATTTTCTGTGGGAGATCAAGATTATGGTTATAGAGATATTCCGGTGAATTACATTGTACAGAGAACTGATGGTACTATACACCCACAAAGA
GACGCCACTGTTATGGAAAATAAAATAAACTCCAAAGGTTAGATTGCTTAATATCTTGTAGTAGTTCCCAATGTTTCCCCTCAAATTAGGAAAACACTAT
GTTATGATAAAACTTAACAGACCTTTTCTCCAAAAGAGAGAGAGAGAGGAGAAAACTAAAGAAATCTACAAGGAAATGAACATCAACTACTTTAAATCGT
ATGTCAATGGTTTGATCTTACTATTTCCAACATGACCTCTTGATTAAATTAAACATCCCTTCTTGAATTCTTGAAAGAGTTGATTTGTGTTATTGATCGT
TTATCTGTGATTTTATGGCTTGTTATTGTCTGTGGGAGATCAAGATTATGGTTATAGAGCTTGTCCGGTGAATTACATTGAACAGATAACAGATGGGACT
ATACACCCTAAAGAAGACGCTACTTCTATTTAAAAAAGTATATACGGGCAAGGCTAGATTGGCTAATATGTTGTAGCTCTCAATGCTTCCCCTCTGATTA
GGACAAGTCCTCGAATTTAGATGCTACGGAGAAACTTAAAGAAATCTCCAAAGGAATGAAGATTGACTACTTTTGCCAATATTGAATGGGCTTTGAACAG
AGTGGGAGTGAAAAGTTGATTGGTTTGAAAAATCTTGCTAGTAGTTGCTCATTTCCTAGCTTTTAATTATCTAATCTTTCTCCACTATGGCTGTTCGTTT
ACTTGTGCAGTTTGCTTCCAACACCAAGCCTTCATGGTGCACGTCACATTTTGGTGCTAAATGGGCTGGTCTAGCTAGACCATTTAGGTATGCGGTTTGT
AGCATTTTTTATTCTTTTCATCTTGTGCGGATGCATATGTTTCTCTGTAAGCTTAATTGTCTTCCGTTGTAGCTCTAAACCTGCTGGAAATGAAATTATT
GGTATTGACTTGGGAACTACCAACTCTTGTGTCGCTGTGATGGAGGGGAAGGTAAGGATTATATTTGTCGAAATGCAAAACTTTTGTTGAGATCATTTCT
GTGATACTTATGATGGCTTTGGTGGATTATGTATATTTCCTGATGCCCTTGTTTATGCAGAATCCTAAAGTCATTGAGAATGCTGAGGGGGCAAGAACAA
CTCCTTCTGTGGTTGCGTTTAACCAGAAGGGAGAACGACTTGTTGGTAGTCCAGCCAAGCGCCAGGCAGTGACCAATCCTGCAAACACACTTTCCGGGAC
CAAGCGTCTAATTGGTAGACGCTTTGACGATCCTCAAACACAAAAGGAGATGAAGATGGTTCCTTACAAGATTGTGAGAGGCTCAAATGGAGATGCTTGG
CTTGAAGCAAATGGACAACAATATTCTCCAAGCCAAATTGGAGCATTTGTTCTGACAAAGATGAAGGAAACTGCAGAAGCCTACCTAGGGAAATCTATTA
GTAAAGCTGTGGTCACTGTCCCAGCTTATTTCAATGATGCTCAGAGGCAGGCAACAAAGGATGCTGGGCGAATTGCAGGTCTTGATGTGCAAAGGATTAT
TAATGAGCCTACTGCAGCTGCACTCTCTTATGGTATGAACAACAAAGAAGGTCTTGTTGCTGTTTTTGATTTAGGTGGTGGAACTTTTGATGTTTCAATT
CTGGAGATATCAAATGGTGTTTTTGAAGTAAGTGAAATTTGTGATGCTCTCTAAAGCTGTGTATCTTCCTGTGTTTTCCCCTGTCTAAACTCATCTAGCT
ACTTCCACCAGGTCAAGGCAACCAATGGTGACACATTTCTAGGAGGAGAGGATTTTGACAACGCATTGTTAGAGTTTTTAGTGAGCGAGTTCAAGAGGAC
TGAGGGGATTGACCTGTCAAAAGACAAGCTTGCCCTACAAAGACTTCGAGAGGCAGCCGAGAAAGCTAAGATAGAGCTTTCATCAACATCTCAAACTGAT
ATTAACTTGCCGTTTATCACAGCCGATGCATCAGGGGCTAAACATCTGAATATCACACTGACAAGATCAAAATTTGAGACATTGGTGAACCACTTAATTG
AGAGGACAAGGAATCCTTGCAAGAATTGTTTGAAGGATGCTGGAGTATCTTTAAAAGATGTGGATGAAGTCCTTCTTGTTGGAGGTATGACACGGGTTCC
TAAGGTTCAGGAAATAGTTTCTGAGATTTTTGGTAAAAGCCCAAGCAAAGGTGTCAATCCAGATGAGGCAGTTGCCATGGGAGCGGCACTTCAAGGTGGT
ATTCTCGGTGGCAATGTTAAAGAGTTGCTACTTTTGGATGTAACTCCGCTATCTCTCGGTATTGAGACATTGGGAGGTATCTTTACTAGGTTAATTAACA
GGAATACCACCATTCCCACAAAGAAAAGCCAGGTGAGTTTTTTGGATAATGGGATCTCCTCTTGATTTTACTATTGTCTTGTCTCGCCTGGTGTTGTACT
CCTCCCATCCAGGAACTATAATTTTTTTTCCATATTAGGAAATCTGACCATTCTATGTTCATACAAAAATTTCAAGGATTCAAATTCACTTAAAGCAAAA
CATTAAATTTTGATGTGGTTTTTCTTGTGAAAATTACCTTTTGGTACTACTTTTATTTTCTTCGGACATCGGTAGTATGATTTTTTATTTTGTCTATGGT
CAAATATGGATCTTGGGAAAGATGACACATGTCTGTCCTGGACTTCTATTTCCAATGTATGTTTTTTTGTAGTGGTTACAGTGTGCTGCTTCCTTTTGTA
TTTCAGGTGTTTTCTACTGCTGCTGACAACCAAACTCAAGTGGGTATTAAGGTATTACAAGGTGAACGTGAAATGGCATCTGATAATAAGGTCTTGGGTG
AATTCGAACTTGTAGGTCTCCCTCCGGCGCCAAGAGGCATGCCTCAGATAGAGGTGATGTTTGACATAGATGCAAATGGAATGGTGACTGTGTCCGCCAA
GGATAAGGCTACTGGCAAAGAGCAGCAGATCAGCATTCGGTCATCTGGTGGTCTGTCGGAAGATGAGATAAACAAGATGGTCAGGGAAGCTGAGATGCAT
GCGCAGAAGGATCAAGAGCGCAAGACGCTTATTGATATCAGGAACAGTGCAGATACTACCATATACAGCATTGAAAAGAGCTTGAATGAATACAGGGACA
AGGTCCCGGCAGAGGTGGTTACAGAAATTGAGACAGCTGTTTCGGACTTGAGAGCAGCAATGGGAGCTGAGAACATTGATGATATCAAGTTGAAACTTGA
TGCAGCGAACAAAGCTGTTTCCAAGATTGGAGAGCACATGACTGGTGGCGGTTCTGGTGGTGCCTCAAGTGGTTCACAAGGAGGAGATCAATCACCACCT
GAGGCTGAATACGAGGAAGTGAAGAAATAATTTTTTTTCTAGGCAAAGCAGAGGAGCGTCTATAGATCTACTCTCCTTCTGAAAATGAAATTCATTTTTT
CCAATACCCATATTCTAACTCGCAAAAATGCAATTGTGTTGACATCTTTTCACTAGAGATGTATGATTTTTGGCGAACGACTCTATTTATTGAAATGGCA
CTTTGTTGCCTCTTGGTGCTTTACACGAATTCATCAGCTGAACGTGTGGTTGATGTATAGACATCGTTAATTTCTTGGTAGATTTTGAAGAACATCGGTG
AAATATTGTACTTGTCAGACTTGTTTGAAGCTCTTCAGACAGAATAATTGGTATCCGAATGCCCAGAATTGTGCTCGGAGTTTGAACATATTCCTCTGAA
ATGAATGCATTGCAAGCTTGCTATTGTCTCTAATCATTTGTGAGTTTTACGTATTATCTTTTTGTTACCCCCACTTAACACAAAGTTATTCGTGCAATGT
CTCAATATTGATATTATCCGATATAGGATAGTCCTTTTCCATGTTGCTAGAGAACTCCGATTTTACAAGCAAATTAATGGTTTTTCCTGAGATTTTGTGT
TCCTATAGTAATTTTTCTTGCGGTTTAAGTGTCAAAAAAAAGAACTTGTTGATCAGGGAAATAAATTTTTGGAGTGTATTGCTGGTGAGACCATTCCTTA
TATTAAAGAACTTGTTGGCTCTCTTGTCTTTTTGGCAACAAAGACACGTTGCTTACAAGAGGGCTCTCAGGAGTCACTTTGTAGGATACTTGGCCAAAGT
GTGATCTGTTCTCCCTCAAGTAAGTTTTTAGATACTGAGACGAAGAGGCTGTTGCTCACCTGACACATCGTATGAGGTCACAATTTAACCAGGGTGAACA
AGCATTGGGGATCGCATGCAGGCGAAATTCCCGAGAATGGCTGAGATGTTCAGTCGACTGCCGTCTCACTTAGTTTGAAGTTGGTTGACATGAAGATACT
TAAACTTTAACAAGCCTGTGAATTGAAAATATAAGCTTAGCACGTACGCTTCTAGTTATTAGTTGAAAATAAATTCACAAATTAGTGCCATTATTAACTT
GTATGAGCTTGTACATCTCTTGTATGAATCTTCTCTAGGATCTTTTTCACTTGTCTATTAAACATCATCTCTTCCTCCTACTCCTGCAGCATCTTACTGC
CGTTGGGCAAGAAAATAGTTTGCACTTACCCAGGAAGATATGTGCCTTTGTCATGTTGCCAGTTTAGCTGTTTGCAATAAGTGAACTTGTGCTTTTTCTC
TAGTTGGTCTTTCCGTAAGATGTATTCTGTTTAGCAGTTCACCATCCATATTTTTGTCTTGCCAGCTACCTGTTAAAGCTTCGTGAATCATCTACTTGAA
GCTCCTGAACTAAAAGAGTGATTTGAAGGTGCTACAGAAGTTGGAAGTCCTGATGTTTTGCTTCTTGCGTTTACTGTACATGAAAAGCTGGTGTTGAAAA
TAAAGAGTTTGGCAAGCTTCTGCCTTTTCTATATAGCACCAGCAGGCTACTAGACTTTTTCACCCTCCTACCTTGAAAAGGTTTGAGGGGGGGAGCCTTG
GAGTAACTAGCTAAGTTATTGTTACATGCCCAGGAGGTCATGGGTTCGAGTTTTGGAAAAGACTCTTGCAGAAATGCAGGGTAAGACTGCGTATAGTAAA
TCCTTATGGTCCAGTCCTCTTCGAACCCCGCGCATAGCATGAGCTTAATGCACCGGCCTGGAAAAGGTTCGTTCATGTTTTAATCTTCTGGTTTTTCGAT
GCACATGATTCCACTTTCTGCCAGCCACGAGCATAATGTATAGTATTCCTTGGTAAATAATCTTTGACCTGATAATTTTGTACAGATTTTTGATCCCTCA
CCAGCTTTTAATCCATAAAGAAACAAATAGAGGCTGCAAGGATAACACAGCAGTAGAAGACACTGAGAATATTCTAGAGAGAGTTTTGTGAAGTTATCAT
TGAAGGATCTCTTCTTTTATCATCTCATGGCCCGCTTCATGCACTTACAACATCCTGTCTTACAAAGATGTGCTATTCAAAGCCAGCCAACACTTTTTTT
GACAGAAATGGCTGAGCGGGTCAAGCATGATGATGGTAGAACAGTGGAAGTTAGTGTGGCTTTACAGAAATATAGCAAAGGCAAATTTGATTACATTAAC
AAGACAAAAACAAGTAAATAGTCGATGGCTGAAATGAGTCTCTGTGCATGCTTATCATTCAGAATTTGGTTCACATGTTCCTCGATGAAGGTCTTGCTTC
AGAAATTGGTTCCATAGAAGATAAGGATTCTGTTGGAGCTTTAGGAACCTTGGAATTTAAAGGTTGGGTTGTAGAGTCACTTCCCAATAGCTTGAAGCAT
CTTAATCTGGATATAAGGTTTATTCTCTTCAACTCTTGGAACTGAGGTGACAACTTTTAGATTGGAGAAGTGTAGGTTGCCTATGTTTACCATTTCAAAT
GCTCTTTCTAGGATGAGCATTGAGCAGCTAAGCTACTGCTGTGAAAATTCTCGAAGAAGTGTTTTAGTACCTCATGTTGTGTCAAGTGGTGTTAAAGCTA
ATGATCTTGGAGCTTATTTCATGAGATTTCTAACCACATTGTGGAACATTCTTTATGTCTCAATATTCAGGTCCTTGAGCTGTGATGATGAAGAAGCATT
GAATAAATTGCAGGATATGGATTCTCAGCTCTGAAGATAGGTGAGAATTTTTGTTGCTTGATTTTTTAGCACCCTAATAAGTTGCTAGCCTACGCCCTAG
TTGAATGTTTCTTGTGTCTTTGCTTAACCAGAGTCCCTTGCTTTAGGCCTCCCAATTCTTTTTTGCTGTTGGATAACCTAGCTCCGGCATTTCTAAACGT
GCATAGTTTGGTCTGAAATTCTACAGAACAAAATTTGGGGAATCCATCCAGCTCTCTGTGATCAAGCACAAGAAAGGTAATTGATGCTAAAAGTCTCACC
TCAGGCGGTTTCATGTATATTTAAAGGAAGTACTTCTGAAAAAGCCAAGTTCTCTTCTATATCCTGAATTGCTTTTATAGATTTAAAAATTGAGCGACAT
TGACATTGATGATCATACAGCAGCTTCAATTTTGACAGGATGTCGCTGCTAACATATATGTTTGTGGAAAACATAGACTCCCTGCTCTGCAAGCAGCTGA
ACGAGTAAGATAGGTCATTTTTAAAACCAAGTGGTTGGAAGTTTCCCATGTGTTTAACAGGATTTGGTAGTAGATCATCCTTTGAGTCACTATCACGAAC
AGAACAAATAAATGGCTTGACTTGCAATCTCACTTCAGTTGGTGTTGGACTTGGGATTTCAACCAAAGGACCAAACTGTTGATAAATGGTATTCTCCTAC
TGTTCAATCTTGTAGTTTGGTCTTAACACTTTCTTGTATAATATAATTTGTGTTGGGTGGTGGCACCTCATTGACTCTCCTATGAGTTTATGACGTATAA
AGTCAGGCCACTGTAAAAACTAGTCGCCACACCACTTTAAAGTTGGAGTTCAACTCAAGCAAAGCAAGTCTTTTTAAACACATCTAGGTATATTGAAGTA
CTAACACTTTTTGAGGATCTGAATCAATATTCTAAACAGTTCATTTATCTGGCTTTGTTCAGTGACTCAGATAATGCCACCATCCGGATAACTATTCAAT
TTGATGACTTACATTTTGTGTGGACCTATGTTACTATAGTTAGCTGGTCGATTTTTCAATTTTTTGGCTTTATACTACATTAGTGCAAACTTAATACATA
TGTATGTGGCTGTGTATATTTCCCATAAAAATGTACACATGGGTAGATTTTCCGTCGAGTCCGTCATTTCTGCCATATTTGGATCCTTCACGTGAAAGGA
GATAGTTTACGTCTTTACAAAAGAAAGTTTCTACCAGCACTTGTTTAAGTAATACTGTAACTGCACAGCTACCCATTAAATAATACAAGTACCTAAGAAT
TTAAATATATGAAAATAATTGTTCGCATACACCATTCTCTTCAAACACGTTGAATGCTTTCTTAAATCTTCATTCTGCTCTCAGGCCAAAATAAACTATT
CCCAATCATTTTAGGGTCGATTAGAACATGGTTAAGCCAGCAACTTTTAACATATTTGCCACATTTCTTTTTTCTCAAAGCTGTTGGCACAATTAGTGGC
TGGTCAACCGACCAACACAATGTACCACAAACAATATGTTTTAAGTTGATGGAGCTTGAAACCAAAGAAGTAGAAAGTGTCATGTGTTATCATCTTCAAG
AAAAATCAAATATTTAGTGTAAACCAACTGTACAAAAGGTGTCTTCTCCTCAACTATCTATCTACATATCTCACTCTCATTAACAGAGGGACCATCTCTA
AAATTCCTAAAATTGTGATCCCTAACGCCATAACTTCTCTGCCATCAACACTACAAAGTTCCCTGAGCTTTTTGATTTTGCCTATGTCATATAAGCAGAT
CAATTTTTCTTCCTAGGTTGCCCATGTGTTTACAAACAGCTGGTTTTCCCCAACTTATCAGAATTCGAGTCCCCAACTTTATACCTCGATAAAAGAAAAT
TCAGCAACAGCCTATGCACTGCTTGAATCAACAAATCTCAAGAGTGTGCATCATCAGCATCAGAGTCACTTCCGGATGAACTTCCTGAATCAGAATCTGC
ATAAGAAACTATGTTCAATTAATCTGCTCTAATTGAGTCGCAAAAAATATCATTTTTTTGCATTTGAAGTAGAACATATACCACTAGAAGAGGAGGAGCC
ACTGCTTGAGCTACTAGAACTACTAGAGCTACTACTACCACCACCACCACCATTCTCTTGATCCCGCCCACCACCTTCATCCTTCTCAATTTCTACGGGA
GGAAAATGGGTAGCTGGTTCATCATCCTCTATCTCTACATCCTCTTCACCAACATCACCCTTCTTGGCCTTTTTGAAGGAATCGTTTTTCTCACTAGTAG
TAGGCTGCAAAAGAAAACGCATTTGTTAGAACTTCCAATCAGAGAAAAGCACAGGAGCACAGAATGTGCTCATCAAATAGATTCAAGATAAATGCAATAT
AGCATTACCCCATCTGCTTCGGCAACGGATGTAGTTGCAGCTGAAGCTGCAGCACTGGCGGATGGTGGTCCCAAATTGTTCATCAAGGCTTGCCTCTTGG
TTTTGCTCACCATCTTCTTCCAATTGGTCACAAACCGATCAAGCTCCCATAGAGTCTCGGTGTCAAGGGCCTCAATGTCGAGCTCAATCTCATCACCGTC
TTGGGCTAAATGTTCATTCCTCTTCCTTATAATCTGCACCAACTGCGGCATCTTCTCTTGTGGCAAACTTTGCAACCCAACTCCTAATTTATGCTTTTCC
TCCATATTCATCTCTCTTTTATTTGGATCCTTGGCCCTCGGTTTAGGTTGCTTTCCCATAGTAGGAACTTTAGCAGCTGATTGAGGCTTCGCAGCTGGTG
CCCTCACTGGGGACGGAGTTGACAATGGTGACTGCTGTCGGGCTGGTGGATTGGGTGGTGGCACTGGCAAAGAGGGTGTTGACGCACTAGAATGATTTTG
CATCCGCTCTTGCTTCTTTGAAATGTTAGGGACTGGGGTAGGTTTGGGTTTCTTCACTCTCTCGGGAGTAGGTATGTGATTCCAAGAACTCCCCTGCAAC
TCATCTACAGGGTGATAATCCCGCCTGCCGCCTTCAAGCTTATTCATTTTATCCTGGAGCGGTCTAAACATGTCCTCAAATCGTCCGAGAAGCTGCTCAG
CGAAGCCATTAACTTGATCTGTTTTAGGGTTATACAACAAGGCATTATTGAAAGTAAGCCTAACATCAGCAGCAAATTCAAAAGGGGAAGGGTAAAAATT
CTTAGCCAAATTTGATTTAACCGTCCCCAAATCCATGGGTCGCTTAATAATTTGGTGGTAATCATGAAGACCCAAGGCTTCAGCATCAACAGGGATATTG
AAAATCCACCCATTTTTGTGCTTCATCAGCTTTGCCAAAATCTGCCTACATTCCTTCATCATACTTTCCGTTCCGATGGCCTTCACACCATCCACACCAC
CTGGATTACCAAAATTCCTATTTTCAACTCCGTTTGGGAGCTTCTTCAGATCCTTACTGGATCCGGAAGGGGTAGGCCGTTTATTTCCAGATTGTTTCTT
CGATTTGCCTTGAGATCTGGGGTTGGTGGTGCTCAATTGACCGGATTCGATTCGATCCTTGAGGTTTCGGATCTGTTCGACCTCCGCCATCAGCCGACTC
CGTAGCTCATTGACCTCGGCTTTGTTGTAAGAGACGACGTTAAAAGTCAAATATCCTCCGAAATTCAGGCCGTCAACGTTGGTCGTTGATTCAATCGGCC
GTTGATTGAACGAGTAGGCATCATCAGACGCCGTTTGCGTCACTGCTGGCGAATCATCCATATGCCGACCATTAGAGGTGTGATGGAATTGCTTCTGCTT
CTTCTTAGGGTTAGGGTTGTGATTAGGGTTCAGTTGCGTATGAGAATAAGGGGTTTTCCCCATGAATCCACCACCTGCACCACCAGACTGAGCCCAGCTA
GATTCATTCCGGCTAGCTAAGACGGCGGATGCCATGAATTACACCGGCAAATCTTAATACCGGCGTTCGTCTGGTGGAATTTATCGTTATCAAATGGTGT
TGAAATCATGAAATTAAAGAGGTACGTGACAGCTACGCGCCTGCCGGAATCTACCGAAACTCCACCCGACCTTCAATTTCCGGTTTTAATCAACCAAAGA
AGGAAGTAAAAAGAAAACTCTATAAATGTTGGAACCCAAATGAAGGCAAGGGTTTGAAGGGATTGAGCGAGGAATGAGAACGAGAGGGCATCGCTTCTTA
AAGGCGATGAGATCTGCCCGTGCGAACTTCGGGCAGATTCTAACCCGTTGATCACACCTCGTCTTTTAATCTAACGATGTATAAAAATTTGTTTGCTGTC
TGAGAAACTGACCGAGACAATCTGTCATCAACGGCTAAGATTTAAGCAAATACACACGTGGCGACAGATCTGGGGTCAGTTGAGCAGGGGTTTAAATAGG
AGATTTTTTTTTATTTTTATTTTTTAAAAAAATTGAATGATAAGGAAAAGTAGAAGAGAGGGAGGGAGGCGTTGTAGTTTGAGTTTGAAGTGAATTTGGG
TCGCATGTGTCCTGAATTTAGGGTTTTTGAAGGGAGTGGGACCCACTGATAATTTAAAACGGGGGTATGGGGGTGGATGACGTGGCAGAGGGAATACACA
TGAAGTCGTGAAAGAGAAGCAAAACGCGCATAGATGAAAGTGTTGACGTGTCAGGAAGATACTGTCAAACAATGGAAGCTTTGTTTAATGTTTTGTAATT
TTTGCCCATCAACCTTTTAAAAGCCGACTTTCCTTTTTCCATAATTCCCACTTGTACCCCTCTTGAGAAAAAAAAATATGGAATTTTTGTTTATATTTAA
AAATTTTGAAGTGATTATTAAAGCTTTTAATATAATGAGTAAAATTTAATTTCTAAATTAGATAATGAAATATTTTAAGATGGTGCGTTAATAAATTATA
GAAAAGTAGAAACAAATATAGAATAGTGATTTTCATATCCTAAATGTAACAACTCAACTTCTGATGAATCGTTTTAATTAAACATCTATGAAATCATATT
TTATATATTTATACATACAAGCTGCTCAAATACTTTGTTTAGAGAACTCCTTAATAAGAACATTTTTCTGTCGATAAAATTTTATATTATACGAATATGA
ATAATCGAACTGTAACATGGAAAAAAAGTCTTGGTACTTTGTTTCCTAATCCCAAACAATAAACAAAGAGGGTGATCATAATTTTTTTAGGCACCAAATT
ATATAGTGGTAGACAATGAAGAGGGCAAAGTGGGAATCCAAATACTTGAAGGGTGTAAATGATTAAAAAAATATATTTTATCACCTTTTTTGGGTCCTAC
AAAAGAGTAAAGACAACTAAAATTAGCTAATGTATAGGTGGCGTCACATTCTTTACAAATATAAAAGGTACCCCCTACCCCTACACCCCACTACCCCACG
TCTACCTCGCTCTCCTAGAACCTTCTATTATTACCATTACAAATTTACAAATCCAGATCCAATTTCTCTTCTTCACATACTTTTTTTCATTGCAAATTCC
CAAAATAAACTTCAGTTTTTTTTTCTTTGTTTTCTCCGATGAGGGCATTTTTCAACAGAAAGCTTTTTAGATCTGTGGTCTGGTAGTTTTCCGATGATAT
CTGAGCTGATCTGGTTGTCCGGCAGCAATTTTCCGTGAAAGACTCGCCGGATTTTTGTTCCCGCCGGCGAGGTAGTTTAGTTTTGAGTTGCAGGCGGCGT
TTGTATGTTTTGGTGAAGAGAATTAGGGTAAGCCGGCTAAGATAGTAACTGGGCCTTGAGTTGTTTTTGGGCTAAGAAGCCCAATTGACAGCTGGAAGTT
TGTAAGGTCCAGACTAATTCTAAAAAAATATTATTGGTTCTGTTTGTTTTGTTTTTTTTTTGTTGAAAATTTCTCCTTTATTATACGCACAATTTTTACG
TTTTTTTCTAACAAAGAAATTTGTTCAATAACTAATTTTGCAGAAATCTAGTGAAATGGCTGAGATATAATCTAACCAAAAACTGATTTATTTATTTTTT
TAACTTTGCTGTGTTTGGTAGGGAAAAATGTTGAATATGGAAATATTAGAAAGATTTACACGTATAAGAAAAATATACGAAATAAATTAGTAATAATAAC
TAAGTTTATAAATATTATTTGTTTCTCTATTTACTCTACTTGATTATGGTTCAAAACACAATGAATTGATTGATGCTTAAAAGTAAATGGCATCGGTTTG
ATTTTTGGGGTGATAACAAATATGAGAAAGTGCATTTTTTGTCACATTTTGTTCTAAGTGATTCTTTTTATTAAAAAATACAAAAACAAAAAAGGGGGGG
TGAATGTGTAGATAGATTTTCAGTCCTGTCTACGAACCGACTTCACACACAATCTTTAGTTTTAGTGAAGTTGCATCATATAATAGGGAGAAATTATGCC
CCCACGTATTTCACACGTATTTGCACCATTTATCTCTTTTTTTAATTACTCATAATGTTTTTTTGACTCTTATATAATTAATGCGTGGAATATGTTTCAT
CTACGCTCGAAAAATATTATTATTATTATTGTTGTTATTATTATTATAATTTTGTGGCTTATACTAAAGTTGTGGGGGATAACATTTTGAGGAAAAGATA
AAAATAGTCTCTTCTGTTTATGTTAAGGTTGTGATCCTTCTGTTTTTACGTGGAGCATTAATACTCAGATTTGTAATATTGGTTCATTTTTTATCCTTCT
CTAAAATTTTATTTATTTTTACTATTGATTTTATTCATAATCTACGTATGGTATGTTCAAATAATCATTTTATTTATTTATTAAAAATAACAACTTCATA
TGAAAGAATGTGAAAAAATTTATTTTGTTTAATAGAAATCGTATTGCAGGTAAAGTCGTGAGCGTGAGATTTATAACAATAATTTCACGTCTGAAGAGGA
GGCGGGCGCCCTCTAAGTTGACCACCCTACCCACTAATGCACTATGAGGGGGAAGGCGAACGGGAACCGACCGAAAGCGTGAGATTTATAACAATAATTT
CACGTGCAATAGTGTAATTTTTTCTTTTCCTGCAAATTCATATGTTAAAGTTTTTAGTTTACTTTTTTGTGAACAAAACAATGTGTTTTTCTTATTACAT
TTTCTCAAATAGAGTTGTTATTTTTATTATATATAAAATGATTGGACATTCTTTATATAAAATTTTGAACAAAGTTAATGTTAGAAAATAGGTAAATTTT
TATGAGAGGATCAAAAGTGCACTAGTATTACAAACATGAAGACTATTAATGTTTCATTTAAAAATTCAAGAATCACTTTAAGCCTTAGCCCAAAGACGAG
GGATTATTTTGAGCTTTTCCTCTAACATTTTAGTTCATTCATTGAAATCCTGTAACATTTATGTCAAACCAACTTCCTGATTGTTTCTCTGATCCAATTA
TAAAGATTGTTTGCTAACCTAGAACTAGAAGGATGATTAGATTTATGATCTGTCTAAGAATAAAATTAAGCAAATAAATTAATCTATTTTACCAAATCCA
AATCATGCTTTGGCATAAATACCAAAATATATTTGTTCTTGTATAGTAATAGAAGGATGAACAACTCAAATGAAAATCCAAATTTCTTTTTTTCACGCCC
TACCTCCAACGGATCAATAATATTCTGACTTACTTTTTCTTTGGGTATTTCTCATAAATATAAGAAGCTCCAAGTCTACTATATTGGCTAATATTCCATT
GGGTTGTATGTCATGAAACTTCAACATATACACACAAACTACCACTAACTAATGTAGCTATAGCAGGACTGTCTAACAATATGGTAAAAACAAATTGAAC
AGTAAAAGAAAATTAAGAAAGAACAGTAAAAAATGAACCTACTTAGAAAAAGTTATTTCACCAAAATCTCACTCAAGGTCACGTGTTCAATCAAATAGAA
TCAATATTTCACGATCACATGTTCAATCAGTCACCAATATATGCGTCAAAGGAAATCAAATATTGCGATGAATTATCTGCATTACACCTCTAAACAGGGG
AGATTCTCAAAGGGTAACGAAAACACGAGATGATGAATTATCTGCATTACACCTCTAAACAGGGGAGATTCTCAAAGGGTAACGAAAACACGAGATGCTT
CATGTATACATAATATATAACGTATGAAATCCGTTACACTTTTATTCATCACTTGGAACAACACTCAGACTTAGGACAAGCTAAATACAGAGGAAAGGAT
CCCAACAGCAAGAGTCAAGGAGGCAACAACAACATAAAGTTGCCAAGCTGCAAACAAATCATAAACATATTAAAAGTAATAAATAAATCGTATCACATAG
ATTAAAATCGAAACGGAATATTTACCAAGCCTCGAGTGAACCTGATTGTCTTCTAGGGGGAGCAGCAGTATAGGTATATATAGGGGGTGCCATCACTGGA
GGTCCCTCGTAATAACCTGTTACAGTAAATAAAAAAATTACACTATACTTTTTTTTAAAAAAAACATTTGTTAGCTACGTGCAATTTAGCTTATTTCATT
GAATTTACCTGGAGCAGGGTAGGGATAAGATGTTTGCTTTGGTACTTCACTCATATTTTTTGAGTTAAATATGAAGTTTTAATTTGGGGAAAAAATATGA
ACATTAGAAAAAATGTTGTATTTATATTGTTTGAATATGTTGTGTCACGGTGACACCTGGGTCGGTTATTCATGACAAACGATTATTTTATTATTATAAG
CGGCACAACCATATTATATAAAATCATAAATACAACAACGTCACTATTTACTACTTTTATGGATAAATACGATCTATTTTTTCGAGTCCAGAGCCTAAAG
AATATAAAATATTAATAAAAATTTTGAAACGAATTATAAAATTTTATGTTAGTTAAAATGGTAAAATCGCTATAACAATAGCGATTTCCTCCTCCGGAAA
AAGTAAAATCGCTGATACTGCAGTGATTTTGCAAAATGTGATTTTTTTTCTAAAAAAAATCGTTTTTTTCTAAAAAAAATCGTTTTTTTAAGAAAATCGC
TGCCCTAGGCAGCGGTTTTTTTTTAATTTCAAAAATGTTGTAACACCGATTTTGCTTTTTTCGGTGGAGAAAATCACTATTGTTCCAGTGATTTTATCAT
TTTAATTAATATAAAATTTTATATACCATTTTAAAATTTTTATTAATATTTTATACCCTTTAGACTTCAAATTTCTATTTTCGTGTTTAAACCTTAATTA
GCTTAAGTTTGCATTCTAGGATGAATGAAATAATAAATAATTATATATAACCACTTGGTGTTAACATTGAAATTGAAATTACATTGTCATGCCAAAAAGA
AAACTTCCTATGATATTATTTAAAACTACGTACATACAAAATTTACTTCGAATATTTTTTTCTTATGTACGTAGATTAGTTGATCTATCTAGCATCTTTG
TTATTTTATCTTGTTTATACATAAAATTTAATCGATTATCTTAATATTATCTAAAGTATGTCCTCTAATTAGGAATAAAATATGAAACACGCGTTAAAAT
ATTTCTTATTTCTTCTCGATTCGTGTCAAAAAGTATTTAAGTAAATATACATTCCCTAGTTTAACATTGCATGTATTTAGAATGTGAAGGAAAATGGGGA
AGGAATTTAAAGATACACGTACATATTTGACAACCCAACCAAGAGAATAATTTTTTTTTTTATAGATTCTTATTGAAATTTTTTTCGCATTATTACTTGA
TGGACATTGTTAATGGGAAATTCAATGGGACAGTTTGTAAATGCTTATTAAAATGAAAAAAAGATCGAATAAATGTGCGACACATGATTAATGCTTTGCT
TCCTGCTTAGTTTTGTTACGTTAGGCTACAAAATACGTGTTCTCGAAAAGTATATTTTTTTTTTCTATATCTCAAATTATGTCGTTAAATTAATCATATG
AAATATGAAAAAACTCTTTTGTTTTTTCCACTGTATTAGTAATCTTTCCTACTGTCAAAATTGTGGTGAAGTTAATTGTATATGTTCTTTCGTCCTTAAT
TAAAAAAAAATTAATACAAAATCACTTTTAATAAAAAATATTTTACGTAAATATACTTGAAAAAAACTTTCATTTTGATATGTTTGCGTTGATTTGGGCC
TTTTTATATGCTTAATTGTGATGGATTTACAAACTGGCTGTGCAATAAAAAGATTTAGGGAACAGAAAAAGGGGGTAGGGTGAGGATATGGAACTTCAAT
TTTGGCTTTGTAGTTTACAGTATTACATCCTTCACATATCTGGTGAAGTCAGTCAAATAATTTCACTAAAAAACATTAAAAAAATACGAAGAAAAAAAGC
ATATCAATAGAGCTGTCAAAATGGGTTTGATCTGCTAGGCCAGCTCAACATAATTCTTGAATAAAAGCAAAATTATAGAAATACATACTTTTGGGTTCAT
TTATTTCTATTATCTCCTATTACTTTTTTCTAATTGTATCTGAGTTGCATATTAATGTAACTGAACCACTATTTAATGTATTCGAGTCGATATTTAATGT
ATTTGAACTACATATAATGTATCTGAACTAATTTTCAATGTATTCGAGCTACATATTAATGTATCAGTGACACTATTTACTGTACCCAAACATCATATTA
ATGTATCCGGACTTCAATTATTATATCCGGATTTTTTAATTTTGAAGGTACTAGAAATTTATTAAGATAGATTGTAATTTCATATTAAAATTACATGAGA
TTTATGTAATTTTCACTGATATAAATGGGGTTGGACTCAATTTTTTCGGCACATCTAGGCATAAAGCTTTAGCGTAGCTTCATTTGGCCCGCTGGCCTCG
TAGGCTCAATCCGTAAGCCTCGGAGCCCAGCCCGCAGGCTGTGAATTTTGAAAATATTTATTATATATATTTTTAATGTTTTACTTATTAAGATTTTGTC
AATAATTATTTTTGAAATATCAATATAAAATCAAAATCATATTTTTTTCATATCTTTTACATTTTGGGGTCATTATCCTACTAAATTTTTCTTATTAGCC
CAAGTTCATTGTTCTATTATAAATCTTTGACCTCTCTTATTTTTGTTTTTATGCCTAATTTTTCACTTCTTCTTTATTGTCTGTTCATGATAATGCTCAG
ATGAATTTTATGAATGTTGTATATTTTGTAAATATTCATTGAAATATGTGTAATTTATGAATGAATTTATATATGTATTGTTATCGTGTTCATCGGACAA
CAATGTTCGTATCTTTTCTTTGAGGAAAATGTTGTTCCTATTTTGATTGAAGAGTCGATCCGTTCCTACCTTGGCCAGCTTAATGCTAGATTGAACTGTT
ATTCTGTAGGCGCTATAATTAAAAAAGGTTAAGTCCCAATCAATTTAACTCATTAAGTTTGAGTTGGAATGAATCGAGTCAGCTCATTTTGACAACCCTA
CACACAAGGAAAGACAAAACAGCTATAATCTATTTCATATTCATTAAAAAAAATTATTATCAACCTCGTATAAAGATATTCAAAAATTAATTTTATAGCT
AAAAAATTAAATGAACCCTCGTGCTCCAGCTTGGTGCCGCCCGAGCTTCTATATATTGTACATTACTATTCAATAAGGAACCAAGTCCATGGGTTGTGGA
TTATTAAATTCTAATTTCTAAGGTAGACAACCAAAAAATAGATGAAATAGAAGTTCAATGATTCAAATCAAAAAGATTATTACAACAATATAACTCCTAA
TAATAGTGTTCATAAAGAACTTATTCACATTATACAATTCTTATACATTGGTATATGTACTACAAATTAAAGCAAAAATAAAAAGGTGACCTTAATAATT
AATTACAAGACACAGATTACAGAGGGATCACAGCAACACTCATCTAACAGGCAGCAACAACACAGAGCTGCTAGACTGCAACAAATCACAACACAAAATT
AAAAAAATTCAAAATAAGAGAACCACAAATACCAAAATTGCATTCTCCCTCCCATTCGTAATTTATTTTATAATCTTTTGAATTTTAAAATTTGAACAAA
TTTATCTTTAATTATAATGCTTTTATGTACTTTTAAGGGTGCGTTTGGTATGAAGAAAAATATAAATATCTTTCAATCTTTTTATGTTTAGTTGGGTCAA
ATATTTTAGAAAATATTATTCAAATCAATTTATCTTCCTCAAATTTAAAGAAAATTAATTTAAAGAAAATAATTTTCTTTCAAAATTTAAGGAAAATATT
TTTTCAAAATACATTTCAACCTCCCCCTACCCACCCAACCATACTAGCCCCCCATTCCCGCACCACTCACCCCTTCCAACCCCGCATCCACACCTATTAG
CCCCCAACCCACCCCCTACCCCTAAAATAAGTTTATTTTTTAAAAAATATTTTCAACTTTAAGATTTCATTTTTTACAACAACCCTCCGCCCAACCCCAC
TACCACTTCCCCCCCCCCCCCCCACACACACACAAATAAAAAAAAAATTAATATTATTTTTAAAAAAATAAAATCAACTTTAAAATTTAATTTTTTCATT
CCTACCTTCGAACCCCCCACCCCTACCACGCAAAAGTTTTGAATTTGGCAAAAGAAATTCAACTTCAAAAATTATTTTCGTCTCTAGTAAAAAATAAAAA
AGATTTCTCAAAAACATTTTTCATTCAAAAAACAAACAATAACATATTTTTTCAGAAATATTTTCTACTCGTCCACCAAACATAAGAAAACAAGTCAAAT
ATCCACTTGTTTTCTAGGAAAACACTTTCCTTGATACCAAACACACTCTAAATATTTCAAATTGTCTATTATAGTGAGTTATATTTTTGAAAATTTAAAG
ATTTCGTACCAAAATCATGACCAAACTTAAATTGGTTGACTATAAAAATTTAAATTGTGATACATAAATTGAGCCAGAAAAGAGTTTAATTTATGTAAAT
CAAATTGCTTACCATCCTTCAAGAAAACCTCTATTTTTCTGAGGAGGAGGAGGAGCAGCATATGTTGGTGGTGCCATCACAGGAGGAGGACCACCTTGAT
AATACCCTGTTTATAAATATTTCACAAACAAAATTAATCAAAGAAAATATTGATATGCTTAACAAATTATTATTTTTTCAAAAAAAAACAAAAATCTAGG
CAAATTTTATTAATTTCTTAATATCAGAAAGATTGTTTCTAATAAACAAACCATAATCTAGCCAGCATACACAAAATAAATTTGAAAAATGAATCATGTG
TTATTTTTACCTTGACCTTGAGAGGGATATGGATAACCATATTTTGGTGGTTCATTCATCATGTTTTGAAAATTAGTAACTCAACAGAGAAAATTAAAGA
AGAGAAACTTGGTATAATGGTATATGAAAACTACAACTTTGGAGTGGATTTATTCTTATGAATATATATATAAAATAAATAAAAAAAGATAATGTCAAAA
AAGCTTTTGATGAGAATATGATTCCTTTCATTTGTATTAATGTTTATTAGGTACTACTTTAATTTAGATAGAGAAAGGAACCAACTAGAGAAAAAAGGAA
GAGTCTAGAAGGAGGTAAAGAACAAATGCACCTGCTTCCTTATCTTTGTAACATTGTCAAGAATTGCAGCTCCCATATAAGAGAAATTTTATTTTTTTTG
GTTAAGTTTTGAATAATTTATGTATATATTCAATATAAATATATAATTTAAATTAAAATTATTGAATTTTGTCGAAATTATAATAATCGCACTTGCTCTG
CCCCTCCCAAATACACAGAAAGAAAATAGCTTGATGTTTATTGTTGTTGCAATCAATGTTCTGTGCTAGGGTTTGTTGCAACTTGAAACTCTATCTATGC
AAACCCTCACAATTGGGGCACACATTTAACATAAAATAGAGGTGATCGGATAGAATATAGTGTAATCTTATTTTAATGAGAAGGATGTTGGATTTTTTTT
TTAATAGAGTAGAATGTTTAATAGATAACGGGGTGTTTGATTATTTGAAAGTTTAGATTTGTTGATATTTACCGAGTAATTAGTTGTATTTTAATAGTTT
TTGTTTTTGATATCTATTATTTTAGATTGTTTAGTGAGTTTCAATCATATTTTTATTTGTTGTTATTGTTTCTTTTTCTTTTTATATAGTTATTCGACAT
TGCTTTTCTTATAAATAGTTATATTTTCTTCATCATATTTTTCTTCTTTTGGATCAAGTATTTAGAAAACAGTTTTTCTATCTTCATGAAGTAATTGTAC
CATCTGTGTCTACTCTATTTATCTAGATCTCACTTGTAATATATTATTGTTATACTTGAGTATATAAATCTATAGCAAATTTCTAATAATTAAGTATGTA
TTCTTATTTTATATTTTTTGAATGGAATAAGAGTTAAGCGAGGATCACGAACGATTGAAGTGAATTTGAAAATTTTAGTTAAATTATTTTATTTATTTAT
TTTTATTTGTTACATTTTAACATGACATGTCTTTTAAAAATGAATATTGATGTAGGTATTTTTCAAACTATTCTCGTTAAATAATATATAGTATTAAGTT
TTGAAAAATAATGTTAAAAAAACTATTTAATGCTAAGTTTAATATGAAAAAATATTACTATTATTATTTTTGATATATCAAAAGTTACACGTAAAAATCA
TTTTCTAAAAGATGACAATGAAAAATGAATAAATAATGTATTTGATTTGGTATAAATGAGTATTAAATAATGAATGCGTATCTTTTTTCCTAGTTAGGCT
TTGTCCTCTAAGCTATCAGACTTTTGCCACAATTTTTGGTCAACAGCGAATTTATTGCAAATACAATTTTATTTATGCTTGGATGGTCCAAAATTAAAAT
CTAATTTTCACTTTTGAAAATACATTTATTTTTTAAGATCGAGACAGCAAAAGTTGTGGATATTAATTGGATGCAATCATGAAATGTGAATGTAGCACTT
TCAAAAAAATCAAACATTTTTTGACTGAATTAAATTATAAGTGATGTTAATTTTATGTACAACTATTAAAATAGTATATACATATCTTTGATAACTCATA
ATAATAGAAAAAGTAAAAATTAAATGAACAATATTAGAGAAATCTTTTTAGTCAGAATTTCATCAAAATAGTAAAATAACATATTTTATTCTATGTTAAT
TTATTTTTTAAAATGTTTTTTTTGATTTTATTATCTTTTAATTAATAAACACAAAGAATATCAATTTATTTTAAAATAAAAATGATATCCTGGCCATTTA
GCAATCCAATAATATATTCTTTTTTGGGAAAATTATATATAATAGCAAACTAATAACCTAAATTAAATGGAATAACTAGGGTTTGATTTAATTGTGCTCC
ATAGCAAACATTAGCTAAAATTTGCCAGAGTCTCTCTCCCAAAAATCTCGCTCGCCACTCTCGCTTTATACACAGAAGTGTATAATTCTGTTTTTGTTTT
GTATAAAGCGAGAGAAAATTGTATATACACATGCAAAAATGTATATCTTCGTGTTATACACTTAATTATATAATTTACAAACATTTTACTTCAAATATTG
CAGAGGAAAAGGTCAACGAATTATACAATTGCGAATTATATAATTGCAGTGAAATACAATTTTCTCTAGCTTTATACAACAGAAGTGTATATATTGTGTT
TCTGTTTTTGTATAAAGCGAGAAAAACATATATCTTCTTGCTATACACTTATAATTATGCAATATACATACATTTTAATTTGATTCAACTGTATGCAAAA
CAAATTATACAATTGCAGCGAAATAGGCCAGCGAATTATACAATTTAGGCCAGCGAATTATACAATTTAGGTCAGCGAATTATACAATTGTATATGTATA
GCAAATTATACAGTTTTATGTTTGTTATGGAACGCAATAATACAAAGTTTGCTACAGTATACAAATATGAATTTTTTGTTTGCTATATGTGAAAGTTGTC
CCTGTTTTTTTAATTAGAAAATGCAAATTGGTTCCGTTGGTTATGGTATTAAAGTATTGCATATTTAGATTTATTTCTGACCATTTAAAATAGATTTTTG
GATCAATTTTGAAATAAAAATCTGTGATAAAATTTGTACACGATATAACACCTCTATTAAGATTTTATGGTCAAAAACTTAAAATTCAGCCTATTTATGT
AAATGGTTCTCACCTCATTCCCGTACCGATGGGGGCCCAAATGAACCTGTCTAGAGAATATAAGGGTGGACATAAATATAAAAAAATGGAAAAATTAATA
AATTAGTGAAAATAAATAATTTATTATAAACAATTTGTATTACTGTCTAATCATTTTAAAATATAGTTAGAAATTCTATTTGAGACAAAAAATATTCTTC
ATAAATAAAAAAAATTTTCTTCGTTGTAAAGAAGATCAATGAATCATGAATATATAAAAAAAAATCAGAATTTTGTATCCTTTTTCAATTTGTATTTAAA
ATCATATGTATACAATTAATATTTGTATTCATTTAAAATTTGTGCTGCATAGTTTATGAATTTGACATTTTTTTCTAATTTGTATTTATTCTAAAGGTAT
ATTAACTAGTTATGTATTTTATTTAAAAATGATTACACCAAATATTCAATTATTTCTTTTCAATTTTATATTTCATTCTCACTTTTTCATCATACTAATT
TTTTATATTTTATATATTATTATACAAAAATCTAAATAAAAACTAGAATAAATAGAAATACGAATAAAATACATACAACATTTTTGAAGGTAAAAATTCT
GGAGAAAAAGAGAACAAAATTTAAATTTTATTTGAAAATATAACTGAGAAAATTAAGTGATCATTACCTTTTTTAAAAAAAATATTCTCTCTCTTGATTT
TCTCTTTTTTTTTATTAAATAATTATATTCTTTAAAAAAAAAAAAAACATAAACTAAAATTTGACATTTCTATTAAATATTAAAAGTGTCGCTAATGAGC
CCTTTAAATGTTAAAATATTGACATTTTGAAGAATTTCTCCAGAAAAATAATGCGATTTTAGGTTTATTGTTTCAATATTAGTGTTTTTTTTCCTTCAAA
AATTCGATTCTCGAATAAGGGTCATGAAACTTCATTGCACCAAGTTTTTTATACTTTGATTTCATTCTCATTTAATTTTTCATTCACACCCAAACCAAAC
GAATAGAAATAGAAGAATTATATTAATTTGGTTCAATATTCAGTGAACACTTTTTTTAAAACGAAAATCAAATAACCGAATCGAAGAACCCTTCGCCCTC
ATCAAAATTTGACTTTTGCAGAAAAAGGAATAAAATTTCGATTCAAAAATTAGTATGGGCCTGAAGCATCTTCACTTTTAAGGTAAGCCCAATAGTACAA
AACCCCGCAAGAACAAATTCCTTTCACACATTCATCAAAAACTTGTTTTCGCGTTTGTTTTTTTTATAAAAGTTCTCTTTTACTTTTCCATAATTTTATC
GAGAAAATGAGATTTTTTAGTCACCTATAAATTAAATAGAAGAAAATAATTTTTATATATAAAAATAAAAACATCTTACAAAAAATTCATAAACCTAAGA
CACATAAATTTGTAAGTGAACTACAAATCTATTTTTTCTAATTTTATCACTAACATGCGACACAACTACGAAAAAACTTTAACAAAAGTAGGTTTAAGTT
TTACTTGAAATTTAGCATCACGTTCTCAACCTTGTAAGTCTAGTGTTCTCACTTGACCCAAAAGAATAATTTTTGTTTTCTCTCTATTTCCAATTATTAA
CATTTATCACTTATCAACAACCATAACCCCTTTAACTAGAATATGTAGAAATACTCATCTTTTAGGCTTTGTTTTAAGAAAATAACGTTACGCAATATCA
AATTTTACAGGTGAAACTCTATGTCAGTAATTATTTTTCATTATAGCAATTAAAAATTGGTTGTTTTTTATGAATATTACCTTTGGAAACAAGAATTCCG
TCCTACTATACAACAACATTAATTTTGCCAAAATACTTTTTTAAATAGTCATCATATTCAGATCAACCTCTGACGTTAATTTTGTTCTTCATATAAAATT
CTGACTTTATCACATAAACTTTTATCGATACTCTAAGTTTTGGTAAACTTACTTCAATTAAAATTTTCTTTCTCTCTTGGAGGATATAATTTTTAATTAG
GGGAGCATGACATAAAAGATGTTGACCTTTTATCATTTCAATAATTTGTGGAAACAGTTTTGACTAGAAAATTATTAAATCCCTATTATGTATCAACTCA
TTTACGCAACTTCAAAAGCATCATATCACGTTACATAGTTGCAAACAATTTTGATAATGACCCCAAAACCATCTTTAAGTTAAAAAAATATATATATTGA
ACTATTAAAAAAATAAATAGAACTTACTAAATTATACTAAGATTATGTCACTAATATTCAAATATGCATGTCTATGAAATTAATCATTTCTAAAAACTGT
CCAAATTGTAATAAGCAAGTTTTATACGATAAACTCAGCTCAAAAGATATTAAGGGGATTTGAATTCGGGTCATACGTATGAATGAGTCTACATGCGAAA
TTAGAATTAAGGGTATGTAGGTTCTAAATTCTATGGCTTCTTTCTTATCATTGAGTAGTCAATCAATTTTATCAAAGGGATCACAAGTTAATATATATTT
ATCAATTAGCTAATATAAATATAAGATCTACGAAAAAATTAATAAATTCGTTTGAACCCACGAATCCTAATTTAGCTCTGTCAGTAAATGATCACCTTTC
AAATTAACTGAATAATCTTTTAACTTAAGAAAAGTACCGAATCAACTTTGAAAATTGAATTAGTCAGTTGGTTTTGTGGTTTAGTTCATTACAATATTAT
TTCTCAGTTTTATATCAAATATCTCAAAAGAATTATATTTTAAATTATACGTATGAGATTTAGCACTGAAAGATAAGATATTTTTGCAGGATTAGTTTTT
ATTTAAATTATAACATGAAATCGAGTTTTAGTCTTTTGGAACAAAATATTTATCCTAAGATCTGATTATGTGAGATTTGAAACCAAAATACCGAATACGG
TCAGATAAATTTTATTTTATTTCTTATATGTATGTATATTATACTTCAAAAAATCAACAGGATCTTTGCTTACCAATCACATGACGTTTGGATTTACAAA
TAAATAGTCTAAATAATATTTACAAATAAATAGTCTAAATGAATTGAAACACTCATCTCTAATTGTGTTTGGATTTCACAATAAACTTTCAAAAATAATT
CATGAGAATATATATTTCAAACTTTTTTCTAATAAAATTAGTGGAGAATGAATGCACCTAGCAATCAAGGTTTTTACATAATCGTCAATGAATTAATTGG
GTCAAAAATTTTAAATTTAAGAATTCAAATTTCAACAGGAAAGAAAAAAAGTACTAGGCCAAACTTTATAAATGATCAAAATGTGAAATTAATGGGAAAG
GAATGATGAAAAAAAAATGCAATTTTAAGTTTGAATTGTGAAATAAGTAGAGTCGTAAATGAGGTGGCTATAGTTATCAATTTATAATAGCAATGTATAT
ATATTATTTACGAGAAAACATATATTTTATGCAAATATTAGTTATTTCACCTATTGAATTCTCTCATAATTTATATATACATTAGTTATGTGAGTTTCTA
AATATTATATTAGATATTATATTATTCTGTTTGTCTCATTTTTATGTGGTATTTTTTATTTTTCGAGAGTCAAACAGGTTAACTTTAACTGGACATTTGC
GTATGGTTTTTCAATTTTTTAGAAATGAAATTTATATATTTATAAACTACGTAAAAAGTACTTACTATAAGTCACAATAATTGATAATTCAAAATGTTAA
AAGGATCCATGAAAAACGTATGGTCAAAGATAAACTTATTTGAATCTCAAAATGTGAAAAGTGCCGATAAAATGAAACGAAGGAAATATATAATTTTATA
GACGAATTCATTTTATCTTTTAACCAGATACTAAACTTTATATTACTTATATTAAATATAATACATGTACAATTCACCTTCGAACCAGCTATAGACGCCC
CTATGAGGATGGGAATGAAGGAATTTCCTTCCAAGTGTGGGTCATAAATGTTGAAGAAATTTCAAGGCTTCAACCAAAAGAGGTTAAAGGAGTTCCATAA
ATATAGCAAATGGCATTTCCAAAGAGATGGATGGACCCAATGATGTCTATGGAAAATCTTTTTTCTAATTTTCTAGAATGGTGATGTAATGTTAATCCTT
GTTATGTAATTTCATCTTGGCTTAAGTCATTGATAGCCACTTAAAGTTGTCCGCAAATTTCACTTAGACACCTCTTCTTAGGATTGTTCCAATTGAACAC
CTAGACAACAAAATTTTTTGTCTATTAAACCCTTTTTGCTGACATAACAAAGCGTTTGTAGTACACACAAAGAAAGGAGCGTGAAAGCATAACTTGTCAG
TAAAAAAAAAAGGTTTTATATCTTCTTCTTCTTTGAGAAAGCTCATCACCATTTTTCCATGGCAAGCTGCAACCATCACCTCATAATTCTGCAACCATCA
CCACTCATAATTCTTTCTCCTTCTTTTTCGATTTTCAGCATTCTCTTTCTCCAATACACCAGTTTATTAAATCGGTTGCTATCATCCACAAGTCTATCAT
TGTCAAACAACCTTAGCCTTTCAAACAACCAACTACACATTCAAATTACCCACCGTAAGTTTTTCAACCGTAAAAAATGTTATCTCTGCTGCCATCAAAA
GCATCTAACCTTGTTCATCTATTTTGTCAATTTAAACCCAAACATAAATTAAATAAAAATCTTAAAACAAAAGAAAAACAAAAAAAAGGAAGAAGATGAA
ACAGAGATTCCTTTCCTTTGAAATGGGATGTTAAGCAAATTTCATTGAATAAAGATTAAAAAAAATTAAAATAACGAGCAATTAGTGATAAATCATCTTT
TTACTTTACTTTAGTGTTCATTATTTCCGGCAAACTCCATTTTTTGGGGCAAGAATAATATGAATTTGAAATTATTCTTTGAAATTGTTAATTTATTTAA
ATTTTAAAACACAAGAAGAAAAAAGAACATCAATAAATCTAAATGAAGTTTGAGGATAAGAGTAAGATTTAAAAATGGTAGTCTATGGTGTATTTGGGGA
AGGTTATGGAGAAAGAGGAGAAGGGTAATGGTGATTTTCTTTTTTCTTTTATTTCTAAAAAAAAAATATAATTTTTCCTTATTATTTTTTTAGTTATTCT
AGGTCCAATACCACGTGTCTTTTTCTAATTAGTTACTATGTCACATTACCAGCAAGTGTATAACACACACTCTCTTATTTCAGCTGATTGTCTATAAAGT
GTTTGATAGGTAAATTTTTTTATTAGTACGGAGGTTCAATTGGAACAAGCCTAAGAAGAGGTGTTTAAGTGAAATTTGCGGATAATTTTAAGTGGCTATC
GATGACTTAAGTCTTTCATCTTCATATCATTTCCAATGACAATAACATTTTACCAAACATATCCACGCTTGTCAACAGCACACTCTTTTTCTATTCCAAT
ATTTTGAGCCCCTCACCAAAAAAAAATTAACATCATTTCTTGATTCTACTTTCATAAACTTTCGAAATTTAACAACTACGTACTTCAATGTTTCACTTTT
TCCTACTCTAAGCATATGGAAGGAAATTCCTATGATAACCTATCTGGTATAATTGAAAATGTATATAGATATTGTGACTATCTCGTGAGAACAGAGATTG
CTTTTAATAAATTTTCTGAATGGAAATAACTCTCAAATAATTATGCTATAATATTTGATAAATTTTAAATTTTAACTATGGATAATATATAAACGAGTAA
ACATATTTTAAGAGGAAATTAAAGATAGTGGGGAACCAAATATCTTTAACTTCGCTAGATATTTGTCTTCTCTTTCACTTTACTAGATCTCATTAACCTA
AAGATGTTTTGCTTTTTGGCATTTTGTAAAATGGAAGTGGCAACTTTCTCACCATTTATGTTAAAATAAAATAAAGATATGTGTGTGATTTAACTATTGA
ATTGAGATGTTTGCCTTGTAAGGGCAATGAAAGTTCTATTTTAAAGTATACTTCCAGACTATTCAATTACCATTTTGTCATTGTTTGGCAAGTAAAGGAT
AGGGTAATAAAGAAGAAATTGGAGTTTATATATTACTTTTACTGAAAATTAAATTAAGCTAGTAGTGTCACACATGCCATGCCATTCTTGGGACGTGACA
AATCATTGAAATGGCTTCAGTTGGTAGGTGAGAATTTAGGTGCCCATTCAGACGACAACATTTAATCATCAACCACAAAACCCAAAACCTTTCTACTCAA
TATCAGATCGAGTTCAAAATTGATTTAGTGCGTCCTTTTATTTTCTTTATAATTTATATCAAATCAATAAACGCAAAGTCGAAGTTAAAATACTTATCAT
TGTGGCAAAACGTTATATTAAACTCATTCAAGAAAAAAGGATACTTTTTCTTCAAGTTAAAAAATGGAAAATCACAAAATGCATTGCATGATATAAAGGA
AGATATAATCTTGAAGAAGCATAGAAATCAATCTCCACTCAAAATGTACACGATATGGCACATAAATCTTCTCAAGATAAACAGGATTATACTATAAACT
CCCCTACTACTTTTATTTTATTATTTTGATCATTTTTATAGGAAAGCACAGATCAATCACACTGATGTTTGTGTAGGTTTCACAGGTACGACTTTAGCAG
CTTCTTGAGGTCTCATATCGGAGCCAACAACAGCTTGTGGCGGCATTGCGTGGTACTGCGGTTGTTGTTGTGGTGGCGCTATGACACCACCTTGGGGAGG
ATAGTACATCTGCCTTCCTACTCCACCATCGTACGCCATCTGTGTGTACCCACCTGCATCTGCTACACCAACTCCCATGGTAGTTGCGGGTCTTACCATG
CCATATCCTTCCGAATAACCAGCCACCTTTGGAGGTACCTGAGATTGTAAAGTTGGTGGTGCCGCTGCAACTGTCGGTACTGCTTGTGGTAAACTAGGCA
TGACATTGTAAACTGGTTGATCCCTGTAAGGCTCCTGTGGCATCCTCTGTACGGCGTAGTACCCTTGACCCGGTGGTCCGGCCATTGGCCTGACAAATTG
TGGGTGTTGGTGTTGGTGCTGGTGTGGTTGATATGCTCCGGCCGGTGCTTGATGAATCATGTAAACTGGTTGTTCCATACCGAGACTGCTCGCCGGCAGT
ACTCCTCCGGGAACTTGTTTTTCCTGCCAATAGCCAACCTGTGCAGGTACTGTACCCGGCACGGTAGGAGAAGCTATTTTCTCCGGTCCTCTCTGAACAT
AATAATCACCTCCGGGGAAAGCCGCTGTCAGATTATCGTCGCTTTTCCGACGATACAAATTTTGTTGCTCTTCTAGATGCAATCTCTGCAGATCCTGAAT
GTGCTTCTGGATCGGATCAGTCCCCATCATCCTATCATCCACTCCATGAACCGGCATCTCTGGTTCCTTAACAACTTGCTCAGAGTTCGGATCTCTCAAT
TTCACATGTGGCGGTACCATCCCTTTCTCTGAACCAAACAGAAAATCCGCGTTTCCAACCTGCTGTGCAACAGCCCCCGCAGCCGGAGACGCCTGAATCG
GACCAGAATTCAACGCATCGACAAACCTATCCTTCTCCGATTTGGAATCCTCCGAACCAAAACTCCGGCTCTGCGACACCCCACTCCCAACAGTCGCCGG
CGTATTGGCCGGAAACAAAAACAACCTAAGCCTAGCTGGTTTAGGTGAAGCTCTATAAAGACGATCATACTCATGCATCATATGTTCTAAATCATCATCA
TTAGTAACAGAAATTAAAGCATCAAGGTCCTCACCTGGCAGCTGATACTTAAAGGAAACAGTATCCGTATCACAAATAGCAGCA