BAC Sequence – LE_HBa0246E15

>C06HBa0246E15.1
AAGCTTCAATGACGTTTTCCCTGTGCCCAAAAGCACTCACTCTCACAAAACCTTCACCACCAGGCCCGAAACCACTGCCTGGAGTAGTAACGACATGAGT
CTTCTCAAGTATCTCGCTGAAAACCTCCCATGAGCTTCGTCCAGGGAAGTGTACCCAGACGTAGGGTGCATTTTTACCTCCATACACCTTGTAACCTAGC
GAGTTAAATGTGTCCATTATGATTTGTGTGTTCTCTTTATAGTAACCAACCACGTCCATCATGGCCTGAAATGCAAGGTCAACACACGTACGTTCACATT
GAACTCTTAAGCCTATTATAATGATGTTTTTTTTATGATTACGCGAATAGGGAGCTGACCTTGAAACCATCAGGTGAAAGGCAAGCCAGACCACCAGCTT
GAGCAATGTTGGATGCACCATTGAAGCTTGTACAAACAATGCGATTGAAGTCTTTTGCTACAGGAAATCCATCAGAATATAGGAGTGCTTTGGGAATGGC
AGTCCACCCTAAACGAACACCAGTGAACCCAGCATACTTCGAAAATGATGAAACCTCAATGGCAACCTGCAAGTGCAGTACAATAAGCTTACTGAATCAC
ATGGAACAATCCATTAATAATGTAAGAATCATTCAATAAACTTTGTATAAAAGCATTAGAGATTTGTGTCTCAATAGTAAATATAGAGAATTTCTACTGT
TTGAGATCCACAAATCACTATTAACTAGAATGAAATAGGTCCAAATAGAGTGAAATGAATGGTGAGAATGCATATGCCAACTCTAAGTAACATGAAATTG
AGGTATGGCTGTAATGGAATCAAAAAGAATAATAGAAGGTATGGCTGTAAAGGGATTAAAAAGAGTAATAGAAGTAGAAGGATCGTTATAGTAGCAATGT
ACCAATAAGTAACTGCTAACGAACTGATACACAGACATTATGAGTTTGTCATCGATATTATACTGTTATATGCTACAGGTTTGACCAAATGATAACAGAA
GCTTTCACTAGAAAACAAAGTAAAGCTCAATGTTAACCAAGCAACATGATCTGAACTTACCTCTTTGGCTCCAGGAATCTCAAAGATGGACTTTGGACTG
TCATCACATATATACATAGCATATGCAGAATCATAAACAAGGATCGAGCCATTATCTTTAGCAAATTGCACCAATTTAGTCAGCTGCTCCCTAGATGCCG
CCGAACCAGTTGGATTATTAGGCGAACAGAAAAATATAATGTCTGTCCGAGGAACACTGGATAGATCAGGAAAGAACCCATTTTCTGGAGTACATCTCAT
GTATGCAATATTCCCATACTTCTCCACATCCTTCTGAAACTGACCAGTTTGACCCATAATAACACTCGAGTCCACATAAGCCTACAGTAGAAACAACAAT
CAACGCACATTTCAGAATCTTACACACACCATCACATAAGAGAGCCTTTCTCCAAGGCCTATTAAGAAAACACGGAGTAGTCTAACAGACAATAAAAAGA
TTGCACCAAATAAAAGGAAAAGGTGCAATTAGATGCAATAATGAATTAATGATAATAACAAAAGACATATCAATAACTTTTACAAAGTATAAAAATTAGT
GCTAAGTTATTAAGTAGCACCACTTCACTTAAATATCACAATGATGTGAAAAATCATATTACAAAATAGGCATGGCTAATCTACAATCTTCAGGTATCCT
GGATGAGCATGGGCTGCCCTCGAACTACTCTTTTTCATTTGTGTCATAATACTATAATAGAGAAGAACAGAGGTATAAGCCTGAAACATTTACCGGGTAT
GATGGATCTTGCACAGCCATACTCACATTAGATCCAAAAAGAACCTACAATACAGTGAAGAAATTCATAAACTGATAGTGAAAGACCGCTCAGTAATTTG
AAAAGCCCACTAAATGCAGAGTAAACCAGACCTGAAGTCGAGATATATCACTTTTGGCACCATCAGAAACGAAGATCTCATTTTCTTCTAGTCCAACATT
TGCATAATAGGTAGAAGCAATGGAGGCTCTAAGTTGCTGCTCATGCAGAAACAATCAATGTATTCAGAGTTATTCTGACAGCTGAATTTACATTTGAATC
ACGGATTAAATGCTATGAATAACAAATATGGTGACCAAAGACAAATTTTCTCTTACGATCTTAAAGTACGGATCCAAAATAATGATGCTTGACAACACCA
AACATGAAACATTTCACATCTCTTTTCTTTACTCGGTAGGCAAACCAAGAATTTGTTGAATAAAAAGCAAATTGCAAAGAGTAATAGATTATTGTCGATC
CAAGAAATGGAAATTTCAGCTGCACATCTGCACATCCCTTAATGACGTTATGAATAGAAGAGGAAGTTTTTTAACTTTATTGAGTGGATACCTGAATAAA
GAATATTGCAATGTATTTGAGGAAAGAAAAGGACAAATGAACAATCAAATTGGTACAAAACGAGGAAAGACAAACTATCAGTGAAGGCCAGAACCATTAT
TATTGTAGCAAAAGAAGGAAGAGAAACAAGGATTGGACAATAAATAGTAGAGCTAATATCATATTACTGAAATATGACGAGAGGGGGCACTACTTACTTT
TTCTCCTTGCTCAGCACCATAACCACTGTAACCATTTAATGTTGACAGTTCATGTGCTCTCTGCAAATGAGCAAAGAAAACAAAATCAAGAACAGGAAGT
AAGTTATCGACTTATAGTTCAATAAGCAGAATAGATTAAAAATACACACTACCTATCAAGTTAAATGGTAGTCTATGTAAGCATATGCTGAAATCTATCA
ACAGAAATATTTTATTTTTCATCAACAGAAATATTTAGACAGATGTCTAGTATAAAACCAAGTGTTACCAGCTACATGATTTTTGTTAGTAATCCCATCA
TTGGTCAGGCAGAATAGGACACAAAAATACAGTAAACTTCGAAGTTTTGACCCATAACAAAAAACTATAGTATGATAGAGATATCAGTATTACCTTTGCC
ATGGCAGAAGTTATGACTTCAGGAATGGGCTCGGTAGTGTCACCAATTCCAAGGCTTATAATTTGAGCATCAGGATGTTTCAACATGTGTGCAGATCTCC
TTCTTGCGATCTAACTTCACCAAAGATATTGTTTAGAACTTAACTCGATGCAGGTAGGAGAGATGGTTTACAAAATAAGAGTTCTCTTTGAGTGTATTAC
TATAAAGAATTGAATTATTTCTCCTATTTCAGGATGGAAGCATAGAGAGGTAAAGATACATAATAAGTCATCCAAATTCAGCTAAAAAAGCAAATAATTT
TGCTTCAGGTAACTAAATTTGCTCACTGGCTTATCGTGATTCCAAATTACTGCAATTTCATCTAAATCAATATTTTATTTGCATGTTCCCAAAAGCAATG
CTACATCTTCTATAGCAAAGTACCTTAAAAATACAGATAAACAGCAATCAACTTAATGACAATTGACCAGTTGAAATACAGACCTCAGGAAACAGATAAC
CAGCTTGAAGTTTCGCTAAGTTTTCATTGCGGGAGACCTGTGTCTTGTAAGCTTCAAGACAAACAGAAATTTCGTTAGCGCAGTCAAATGTTAACAGAAT
GCACAGCTATTTGAATGGACTGATACAGATGAGACTAAGACCTCACCTAAACTGACAGTTGTTTTCTTTTTGTTATTGTTGAAAGACAATAATTTTACAA
TTCTTGCATTTCAAAAACGTGCATGTAGCAAACATTTTGAGTCTTAAATTTGCTTTTTCAGCAAGTTGAAATAATTTATATGCAATACATTGATTAGTTT
AAAGTTCTCAACATTAATTGCCAAAGGCTCTAACTGATCCACATTGCACAGGCTCGCAAGTCTACTATTCTCATTTCAACTTGGCAATATATAACTGGAA
ACCAACACTAAAATAAAGGCTTACAAGTTTTCTCCGTAGAGGGTGTTGCAACACATCTGACAATACCACTGGTTTTGCCTGGCATTGACACATTCTGATT
CCTGAAACAATTAATGCACACTTTATGCATTAGAATTAGCAAAGAATTAAGGAAGCAACCATAGTTTTTTATTGAGTTAATCTTGTTATACTACCAATCC
AGATGAGATTCCCGTCAGTTCATAAACTACTAAAATTATCCTAGAACGTAAATGCAGGAAACTTTGTTTAATATGGAAAAAAGGAGAGTCTTTAGCTTCA
TGTTAGTCGAAATGAGAACACTAAGAAAAAAAACAGAATCAAATATTTTTAGATTAAACAATTTATAAAGAAACAAATTCAAGAATCAGTACAAACCACA
AAAAGGTCACCTTTTTCCATTTGAATTTGGGAGAATAAAAAACCCAATAATCAGTGCAAGTACAAGATTAAACCAGAAGAAAAAAGGACTCCTTTTTCCC
ATGAGAACAGTATTACCTTCTTCCCATTAAAATACATAACAAAGTCAAAATGCTGAACCCATATTGGACATTTCTTCTCTACTGCTTCATCTAATGCTTA
AAGCAATATCTATATCTAACGCAGATGATGAAGATTCAAAATAAACGAATAAACTGGAACTGAATCAACAAAATGAAAGAAAATATGTAAGATTATTAAA
TTGGGTACCTGAAACGGAGTTTGTTCTGACCCAGAAAAGTAGATGCTGATGAAGAGATTGAAGTAGAAAGACTTTGCTGAATAGCTGCCATTTTTTCCTT
GTGTAGCTCAGTGGAGTAGAGCCCTCAGAACCCAAAAGCTGCTTTTAAAAGAACCCTAATCTTCCACCCCTTTTGCAATTTGCAAGTAACTAATCATCAC
TTTGAATATTTTATTTTATTTGGTCAGCATCTATTGTAACTGTTTTTATTTTGGAATAATTATTGGAATCTTTAATTAAACAAAAATTAGACCTTATTTA
TTACTAGATCAAATAAAATATCGATCAAAGTGGAAAGCTTTCTTATTCCATGTGTATTGATTTGAAAATAGTTTTTTCGTATAAATTGAGAGATCTTTTT
CTTTAAAATTTTTAAATAAATATATTGACAAATAAAATTATACAGTGAAATATGAAATTATTGAGTCCAACTAAGATTTGCTTACAAATAAAGTATTAGA
ATATAGTAACATAAAAAAAATTAAGTCATTGCAAATGCTGTATTAGAATATAGTAACATAAAAAAAATTAAGTCATTGCAAATGCTATATTTATAATAGC
TCTATGTGAGAATCAATGTGATCTCATTCATTATCAATAGAATTGGATCACATACAAAGTGACAATATCTTCTTTTTATATAATATATTTATGTCTAGGT
TAGTTTTCGCATATTTTAATTAATTTTATGAGGTATAAGTAATCTTATTCACTAATTTAAATTTAAAATTTTAAGGCTTTCAATAACTTTATTGATCACT
AGATCACATTCTTGTCAATAATGGTCATATCTTTCTTCTTATACTAAATTTATGAGTAATAAAAAAAAGAGATACTTGAAAAGATGAAAAATTAACTCGA
GAGCATTTTGCGCTAACACAAAAAATCTATAATATGATTCAGAGGAATTTATTAACAGTGCCTTTTTATTGTATAAGTGATATATTTTAAGTTGAGTTTC
TTATTAAAGCAGTCTTTATAGCTCAGTGGTAGAGCGTCAGTCTTGTAAACTGAAGGTCAGCAGTTCGATCCTGCGTGAGGGCATCTTTTTTTTTTTTGGT
TCACCCTCTGTGATCTTTTTATAAGTTATGTCTCAATTGAAATTAGTAATGAAGGAATAAAATTAACTTTATTTAAATTTAAATAGTTGAGTGTATTTTT
GACCCTTTTACCATTAAAGTTTAGTAGTGTAATAAAAATTGAAACCATCTATTTCCTCGATAAAAGTGGTCGATTTAAACTCTACCAACCCGTCTACAGG
AGACTAGACTAGAATGGAAGAACAATAAAGTTGTTGGGGGCATTTCTTAAATAGAAGAAGATTGGGGTACATTTCTAGAATTCCAAAAGTTCGCCGGATG
CCAAATCTAAAAATTAGGAAAACAGCTCAATTTTTTTCATTTCTACGAAACAATTTCATCAGAGAGATCAGGCGAAATCCTAAGGAAAATTGATTTGAAA
AATTCGACATGGATCTTAATCCAGTAAGCGTCGTAGTTTTCCTTATTTGATTCATTTTTTCACCTAATGCTGTAAATTGATACTTTGAAATCTCACAATT
GTTTTTTTTTTGTGTGGGAATGAGTTGCATTGATGTTAGGGTTTTGTTTGAGCTCGTAATTATTTTATTTGATCTGTTGATTTGCTCTTTTGTTTGGATT
TTCGTGTTTCCATTACTTTTCTACTGCATATCATGTGTTACGGATCTGTCTTTGGGAATTGAAAATTTCTGCTTTAGTGAATTGTATTACCCGGTAGGTG
AATAATTTGTTTTAGTTGGATGAATTGTTACTGCAAATCTAGGTGAAATAATGGAGTTAGTAGGAAGTGTTGATGTGCTAGGCTCAAGGATATTATGGTG
TCATAGTCACAATTTGATGAGTTTAGTATGGGACGAGTAGTCGAGTACTCCCTCATGTTGATCCCCTTGTTTACCAAGCAAGATCGAAATGATTGGGCAT
AAAGTGTCTGTAGATGGTGTCTTAAGTTTTGTCATTGATTGCTTATTTAATATAGTTGTATCTCTTTTTGAGAGACGACATAGTATTCCTGCTTTGTTCT
ATTCTCAAATCAATGTGAGCATTGCACGGATTTCACATCCAGACAAAGGAGGGAAAGTGCGGTTGGTTTATGTCTAGCGTAAAAGAAATATCTTCTAAAT
GTTGAGATCCTAATTTGCTTCAAGGAACAAATTCTTTTACTTGGACTGGACCTAAGTATTGTAAAATGGATGTAGAGGACTTTTTAGCCAATCATTTTAG
CTTGGGAATGGAGCTTGGTGATTGTTTTGTATTACATAGTTTCTTGTGTGTATATATTGATGCAACTCTGAAATTTAAACTTCTAAATGTGTTATTTAAT
TTAATTACCTATATTTATTTATTTTAAAATGTGCTATTAATTTTGGATGACAGGTAAGTCCCACTGTCCCTCTATATCATGTCAGTTTCATGATCGGTGT
GGTTAAGTTTTAGGTTAGTTTAGTAAAAGGTACGAATAGCAGTCTAGCACACTTACCTTGGAGGATAGAATCACATGGATGAAAGTTGTTTCAAAAGACT
TATAAATTCTCAAAATCTACCTGCACTTTAGAGAGAAAATGACGGAAGTAAAGATCCATATAGAAGATACTGGCTAGTTGGAATTATAATCTATGTTGCT
CGTACTCTTCAAAATGTCGACAGGTGTGTGTCAGGTCCTCCAAAAGTAGTGGTTTTTTTGGAGTATTCGACACGGGTGGGGCAACATATTTGGAGAGTCT
GGGCAACATAGATTAAAACTTATTTATATTGGCATGCTTACATTAGCTTAAACATTATAGTAGTTTTTCTTACCCCTTTTTTCCTTGTTTAGATATTCGT
ATGTTAGTAGAAAATCTAGAGAACTCTAGCGGTAGATAATCCCAAACTATTGAAGATTGGAATGAAACTGGTCAGAATGTGGCGAAATAGATCTATAGTG
CCAATATCAACTAGCATGGGATTGAGTGATAGTTGTTTTGTTATTGTTGTAATCTTTAAGTTCGTTCCTTTTAGATCAATCATCTGGATAAAACGGTGAT
ATATGATCTAGGATAAGCAATGCAGGTAAAATAGGATTTTTTATCGGATGTCCCCGAAGGTAATTTTCTTTTTTAAAAAATAAAAATGGTTAACCTTTTA
CATAATACTCTTTAGCTTAGAGGAGTTTGTGGCCTTCCAGTTATCTTACTTTTCTCTGTTACTTATTGTAGATGATCTTCCCTTCTTATTTTCTCTCTTT
TACTACCCTTGCTGCTCCTTTCTCCTTGCACCCCTAAACGCTCTCCGCTGCAAGGAAAGGAGGGAGCACATAGAATTTGTTGACTGATTCTATCATAAAG
TTAATTAAGCTGTCACATTCTTTCTCAGCCTGCAGGGGAGGACTATGCACACCCACAGATATGTTTTTTCCATGTGCTCTTCAAGGTCTAGCTTATTACA
TATGCTTTTTATTTTAATGTCTTAGGTTGTAATTGCTTTCATTTAATACATTTTCTTTGCATTGACAGGCAGCAGCATTAGCGTTTTATATTCTGTCAGC
TTTATTTGTTGATAGTTTTGTTATCATCTTTGTGGTAACTGTTCTTTTAGCTGCTCTTGACTTTTGGGTGGTTAAGAACGTCAGTGGACGTATTCTTGTG
GGTTTAAGGTGGTGGAATGAAATAGATGACAATGGCGAGAGTGTGTGGAGATTTGAGTGCCTTGATCAAGAGGTGAGAAATCTTGTTTCAGGTTCCTTAG
CATACATCTTTACCTTCAGACATTCGTTTATTTTTGAAGTGCTTGCCCATTTAGTCATTTTAATAATTACCTTTGTTGCCTTGGACAAACCTTTTTCCTT
CACTTCTCCTTTCAGTCAATGGCTCGCATGAACAAGAAGGATTCCTGGCTGTTTTGGTGGACTTTGTACCTAACAGTAAGTGAAGACTCTATCACACTGG
CTGCTTATTCTAATGTTCAATATAACAAACTGAGCACATGTATTGTACAATCAGAAAACAAGAAAAATCGGCAACAGGCACAAAATATATGTGGATAAGA
ACAATGGCCCTTCACACCTTGGCTTCTCGATTTTTTTTTCAGTTTTTACTTTTTCAAGATTCAGGCTTCAAATATATTCTAGAACTTCTTTTCTTTCTAT
CTGTACCTTATTTTTGCAAAGTGAAATAGTTAGTTGTTGATGTGTTGCACCTGATCCGTGTACTTTGTTGTAGGCTGTTGCTTGGTTCTTTCTCGCGATA
TTCTCCCTCATTAGGTTCCAAGCTGATTATCTTCTCGTTGTTGGAGTTTGCTTGACTCTCAGCGTCGCAAATATTGTTGGTTTTACTAGATGCCGCAAAG
GTGTGTACTTACTTTAACTTCTATGGATTCTGCCTCTAACAATATCTTTACCTCTGGAGTTTTACTTTGTTTGGGTGCTCCAGTTTTCATGCATGAGCAT
AATATGTATGATGATAGATGTTGTCAGGTTCCCTCATTAGTTTGTGTATTCTCTTATTCGCTTCTGTTATGTATATATGTATGTATGTTGTTGCTTCTGT
CTTGCTCTGCTTGTTTCAGTTCTCATTTTTGTGTTTGGTAGTCATGATCAGATCTCTGTGTACTATTCTCTTTTGAATTCTGCTTTCCAGTACGCCCTTA
CTGTTTAATATTCATATATTTTTCTTCTTTCTAATATCCAGATGCTAAGAAGCAGCTTCAAGCATTTGCAACCCAGACCCTCACTTCTCGGTTCTCCTCT
ACTCTACAGTCGGCATTTAGTGTTGTTTGAACAATTAATACAGAACAAGCTACTCGTGAGAGGAAACTGGTCGTCAGTGTCCACCTCTACGAACAATCAT
GTATTGATTATATAATGGTGGTTTGTATACGCTGTGAAATTATGATGGCACATATCGGAAGGATGCTTAGGAGATTTTGACATGGTGTTAATTTGGACCT
CTCCTTTATTGAGGTCTTGTACATGCAGAACATGAACGAACTGGGAAAACGTTTTTGTTCCTTTCAGTTTTCATGAATCCAATTGCTTCATTGTATTTTT
ATTTTTTTTGCACCGCACGGCTGGTGAATCGACGTATGGGCCATATGCATAAATGTATCTGAAATTTGCCATTCACGTTCTGCAGCAAGTGCAACTAGGG
GTAGGGGTAAAGGTTCCATTTGTTTGCGGTGTTCATATCTGTTTTCTAATTTACTATGATATGTGTCCCGAGTTGAGGCTTTTCGGGACAATCTCTTTTT
TTATTTCTACGAGGAAAGGGTAAGGTTACTTATTATACTGCCTTCTTCAGACCCTATTTATGGGATTTCATTGGGGGTTATTCTGTTTCAAGTTACTTAT
TATACTGCCTTCTACAGACTCCATTTGTGGAATTTCATTGGGTGTGTTAGTCTGTTTCGTTTTTTTCCTTTCTTTTCTGGTTGTCTGATATTTTAAGATT
AGTTTCTTTACAATATACACACACTTGAAGATATTTAACCCAGCTTGACTATAATTAGGTGAATTGGGGGTAATTATGATTATGATTGTTTATCGACTAA
TGTACCACAGAATTGTAGTGAAGATAAAAAGGAATCTACAACCATATACTCCGTATATGGTGGTCTGGAGAGGATTAAAATGCAGGTAGATTTACTCCTA
TTTTTTTTTGAGGGTAGAGACTGTTTTCAATTGATCGTCAATTCAAAAAGCTAACAAGCAACCAAGGTTAACAAGAAACTACGCCTAATATGATAAAAAC
AAATGGATATGAGATTAGCCCCTACCTAATGAGCAATATATTACTTATTAAACTTTATGTCCTAATTTTCACCTATGTTTTTTCTCATCTAGGATTTATA
TTTTCAATAAATTGAATATATGTCATGACATGTCAAATCTTCTCCTTCAATAACACATTTATATAACTTATCAAAAACTAATTTTGGTTATCCTCAAAAC
TACCCCTTTACAGTAGAGACCAAAAACTAAAAAGTGCTTTACATATTGTCATTATGCGCCAATCAAGAGTGAGTAGATTGAGAGGCTATGGTTTTGTTTG
AAGTTAAGGCTGAGGTAAGTGTGGATACCTAACTGAAAATTGTGGAGGGATTCTAAGTGGGGTCTCTGTCTTATCTCAATTGTAAGAATGAGAGGAAGCC
AGAACAAATCATAATCACTAGAAGAAGAAGAAGATATGGACATCAAGAAAATCATCATAGCCCTTCTTCTTCTTCTTTATTCTCTGCCCCAAGTTCTTCT
TCACACTGAGGAAGGAAAAAAAGGCACCAAATCAACAACAACATGGCTAGTTTGGTTGCTATTCAACCCAAACAGCCTTCTTTCTCTCTCCTTCCTTCTT
CCAATTCTGACTTCAATGGTGCCAGATTGATCTCCTCATTTCAGGTACCCACATATGTTGGGCTTTTTGTGGGTTTGGGTAGAATTTTTTTGTCACTCTG
TTTGAATACTGGCTTGGGGTTTAGCTAGTATTTCGTAATTTGCATAAAAATCCTACCTTTATCTGTTATGGTTTCAAGAAGATTATAAAAATGTTTTCTT
TACTACACATTAGGTTATACTATTGCGTGGTAATGTTTTTTTCAAATAACATGGTATCTGAACCAGTTTGTGCGATTAGTTACTTGGGTACGGGGTACCT
ACTACATTTCACCACTACATGTAGGATAACTCTGTCCAAAAAGTCTTGGACGGGGTGCTAACGTGATAGTGTTATCTTTGTCTTTTTAAGTTAATCTTTG
GCTTATGCAAGACAGGAAGAGTGAGTATTAATTGTTTAGAATGCTGAGAATTGATGCTTTTCCATATTCCATATGTATCAAGAAGCTGCTACTTTTGCTT
TGCTGCATAATGAGTTGATATGATGGGTTTTTCTGGTTTTAATTTTATATGATGGTTTTAGTATAAGAGGAAACCATGCTTGTCAAAAGGAGCATTGCAA
GTTACAGCCTCGAGTGAAAAGAAAATCCTGATAATGGGAGGCACGCGATTCATTGGTGTGTTCCTATCGAGACTTCTTGTGAAAGAAGGCCACCAGGTAA
TCGACCCAGACTAAGCTCTCTCTAAAGTTCAAATCATTTTCTGACTTCTACGTTGTCATCCAAATTATTACCAGGCGAAGATTATAGTCTTTGATGTTTG
AAGTTACCTTGGAAATTCACAATCTTTTAATGATGCACAAATGCAGGTTACTCTATTCACAAGAGGAAAAGCTCCAATCTCTCAACAATTGCCAGGTGAA
TCGGACCAGGATTATGCTGATTTCTCCTCCAAGGTATGTTGGAATTCAATGAGCTCTAAAGCTTTGGGATTTCATGATTAGAGTTACTCTAAGAGTCTAA
GGAATGAGAGTTTTGTTCGAACTGCAGTTATTGCACTTGAAGGGTGACAGAATGGATTTCGATTTTGTGAAGAGCAGTCTTTCTGCAGAGGGCTATGATG
TTGTGTATGACATAAATGGTACTCATTATTAGTGTTTTATTCTATATCTCAATGTATTCCGCGTTTTGTGTTGTTGCAAACATTTTTTTCTGGTAGAAGT
ATGTTTCTATTGTTTCCTCCTTTTTTGGTCTATTGTTCATGAACAATTCTTTTTTTATTCAGGACGTGAAGCAACTGAAGTGGAGCCAATATTGGATGCA
TTACCTAATCTAGAACAGTAAGCTGTGAATCCTCTTAATACATATCTGCTATGATTCTGTACCAGGAATCATTACTACTATACCAATTAGCTTGAACTAT
TTTACAATATTTGGTCATGAATTGGTCGCATTCATATGGCTTAGCCACTTTTTACTAGGTAAACATATTTGAATGACCGGATTGTGGTATTCCTTTTTAT
CTGATTATTTTAACTGCCTATGAATCTCAGGTACATCTACTGCTCTTCAGCTGGTGTATACCTTAAAACTGATTATTTACCACATTTTGAGGTCAGTTTA
GTAGCATATGATTATTTTAAAAGCTTATATTCTGTCTACTTGTGATACTATGTAGTAAATAACAATAGACAACAACACATTCATGACCGTCATTTTGGTT
AGTAGACACATACAAACAATATTTTTGCTCAAACAAGGTGTAGTTTTACACAGGAGGTTATTGTCAATATTTCAGTTCCAAGTTCTTAAAACTAAGGTTC
GACTGGAGGCACTTGCAAAATTCTTATTATTGAACCTTGTCTCCTGGCAGAGAGATTAGACTTCATAATTATCTCAGAGGTGTAACAAGTAGCAGCTTAT
CTGCTCGGTCCTATTTGCACCTTGCTTCAGCCTTTCTTCTAAGTTTTGGTCTTATCTTGTCCCTTATTCTTTATGTAGTTGTTTTCCCCAAGGTTAACAA
AAACATCTTTCCCAATGTCAACAGGTTGATGCAGGTGACCCGAAGAGTAGGCATAAAGGAAAGCTTGAGACAGAAAGCTTGTTAGTATCACGAGATGTTA
ATTGGACTTCTCTAAGGCCTGTTTATATTTATGGGCCACTTAACTACAATCCTGTTGAAGAGTGGTTCTTCCACCGATTGAAGGCTGGTCGCCCAATTCC
GATTCCTAACTCAGGGATGCAAATAACTCAACTTGGACATGTGAAGGTTAGTCAGCACATATTAAAAGAGTAGTTCACATCTTTCTATTGTAAACTTCAA
GCAATGCTATCGCCCTAGAAGTTCAACGGAGATGTCTTTGCTTAGGTCCTATACATATCCAATCTTTGCAAGTGGCTTCCATTTAGTAAAAACCAGGAAA
TATGTCTTTTCAAATAGGAGCAACGTACTCCTTAGTTCACTTTCAGGCAATACTTCAGTTCGACAGCATTATAACATAATGAGCTTAGGAATCGTCTAAA
GAATCACAGCCTTGCATCTATGTGATAATATTTTTGCTTTCGGTTGATATTGGCAGGATCTTGCAAAGGCTTTTGTTCAGGTTCTTGGAAATGAGAAAGC
AAGCAAGCAAGTATTTAACATATCCGGAGAGAAATATGTCACATTTGATGGATTAGCTAAGGCTTGCGCCAAGGTAATTTTTTTTGGTCAATGTTAGCTT
ATATTGCTTGTAAAAGCTTTGAATGATATACAATTGACTCTCAATATTCCTAATCCAGGCTGGTGGTTTCCCGGAACCCGAGCTTGTTCATTACAACCCT
AAGGAGTTCGATTTTGGCAAGAAGAAAGCATTCCCATTCCGTGACCAGGTAAATATTAGTGTGTTGATTTCAGTTGTTTACCATTCATATTGAAATTCGA
GACATTCTTTATCAAAGAATCAAATGATATGATCAAACTAAATGAATCATCAGTGAAGATTCACAACATGTTCACCGCCTCTTATCCTAGTCCCTTCCTA
AAACACACATCAGTATGCTCACTAAAATTAACACACATTTTTGTACAATCAATCGTAGTCCAAACGAAATACTACAAGAAATATGGTTTATTTCCTCTGT
TGAAGTTGTTAGCTTGTCTGTTTAATATCGGATTCTTGTCCAACACTAGTCTATCTATGTCTTCTCGTTGGTTTTAACATCGAATTTCTACAGCATTTCT
TTACATCCATCGAGAAGTCAAAGGCTGAGCTAGGATGGAAACCTGATTTTGATCTGGTGGAAGGTCTTACAGACTCTTACAACCTAGATTTCGGACGAGG
AACATTCAGGAAAGCAGCTGATTTCTCTACAGATGATATGATTCTTGAAAAGAAACTAGTTCCCCAGAGCTAATATTTCTGTTTTTCATTTCATTAGTTT
TGGTTTCTTGCTTTTTCTCCAAGAAGTTCACAAGTCATTAGTGGCAAACTATTTGAAATTTTCCTTGTATATTAACTTCACTAAAATGAAATGAATGACA
ACTATTGTCATTTTGCCATCAACATTTTTTTGGGGTAGTGTGGCGGTCGTATAAATAACGGTTAAACTATGCGAAGTTGAATAAAAACGTTCTGTATCAA
TATTTTGGTAAATATAAAAAGTCCTTACCGTTAATAGTTTGATTCAAATACATTCCAATAGGTAAAACTTGCTCACATCGAATGTATACATCAAGTCAAT
ACATGTGTCTAAAATTTATAGTTTATTTTACTTAATCATCATTAATTAACATGTGTTACTTCATTAAATTACGTAATAATAGAAGTTGCATTAATTTATT
GTGAACAGCCGATGCGGATAAGTTTTTTTCCCGCTCCAATTGTTACTTTATTGAGTCAAAAATGTCTTTTTTCTTTTAAAAAAAGAGAACTTCTTTCCTA
CTATTTGATAATTTTTTTACTTTCAAACTTTTAGAATAATATGTTTTAGGCTGTAAGTTCTGCGCATCTTTAATTTATTAATATTCAAAATTCTTAAATT
TTATTTCAAGTCAAACAAATCTTAACGATCAAAATACTATACCTATATATATTTGATTTGATTATAATAAATGCTAAAAATGTATGTAATGCTTTAAATA
AAAGTTCAAAAGAGATTCATGCGTGACACAATTAATATTGTGGTCACACGAGTGTGAATATTAAAAGAGCGAGAGCGTAGCACGTACACTCAATATTTTT
CGATATCTTTTAAAAAATAATTATTTTTATCGATTTAGTATAAACTAAAATGATTTTTTTTTTTAATCGATATAGTTGCTGGCCGCTTAGGTGTACCTAA
TTATGACGCGTTTTGGCCCTTCGCCCAATTTCATTCCCCAACGTAAATTATTTGACTTTGTATTTAGATCCGTTATTAACGTTCATTTTTATAAAGTTCG
GAGTTGTAATATAATTGAAAGGATAAAAAGTAGTATTTCAAAAGTTTATATTAAATCAATGTTACTTATTATATTTTTATTTATCTAATGTAAACGTAGA
CTCACAAGATAGTATCACGTAGATCGAAAAGGAGTTGAAAATTATTAATAAAATAAGTTCAGGAGTAATAGACCCTTAGCATAATATAAATTTATCTCTA
AGATTATGAATATAAGTTAAGGTGTACTTATGCATTATCCCAATATAAATCTGAATTAATAGTAATGAAAAAACATAAACTGCCCTCACAAGCTGGAGTG
TCGGTTTGTTTAGCTTAGATTCATTTAAGTAGGGACCTCTTTGTTGGACTTCGTTTTTGAGATCCGTTAGCTATGTTCATTTTTTTAATCGAATTCGGAT
TTTCTATCTTTAATTAAAGATCTTAAATTAAGATTTTGAAATTAAAAAAGATTTTTTTTTGTTTAATAGATCTTATACATAGTAAAATTGAATTAGTAGG
AGACCCAAACAAGTATATCACACGTTAAATGAAAAAAACAAACAAATAATTCAATCACTTTTTTCCAATATAAATATTTAGTATTTTCGTCGTCTTAATT
TATATAACATATTTTACATTTTGAGAGTCAAACATTTTAAGTTTGATCGAAAATTTGCATATGAAATTTTTAATTTTTTTGAAATGAAATTTATATATTT
AAAATTACGTTTAAAATACTATAAATTATAATAATTGATATAACTCGCAATATTTAAAAAATCTTTAAAGAAATTTACGATAAAAAATAGACTTATTTGA
CTATAAAAGTTTTAATGACATATAAACTTGGACAGTTAGATTAAATAGCACGCAAAACCATAACGTTTGTTAAGTCTTGGTTTAGTAAACTTATTCCACT
AAAATTCAACACCAACGACCTTTTTCTTTTTTTAATTTTCAGAAGAAAATTGAATAACGAAAATGTAGTTTACACTCAAAAATATATTCTTATATATATT
TAAAATTACGTTTAAAATACTATAAATTATAATAATTGATATAACTCGCAATATTTAAAAAATCTTTAAAAAAATTTACGATAAAAAATAGACTTATTTG
ACTCTAAAAGTTCGAATGACATATAAACTTGGACAGTTAAATTAAATAGCACGCAAAACCATAACGTTTGTTAAGTCTTGGTTTAGTAAACTTATTCCAC
TAAAATTCAACACCAACGACCTTTTTTTTTTTTTAATTTTCAGAAGAAAATTGAATAACGAAAATGTAGTTTACACTCAAAAATATATTCTTATATATAT
TTCAAGTTTAGGAATAGTAATAAAATAATTTAATACTATGATGAGTATATTATATTCACAAATTACAACTTTAGTTAGACTTTTGAGTTATAAATCAAAT
TATATTTGCTCAACAAGATTAGTCCCTCTACTAGTGAAAAAGCTCAATTAATAAGATTCATTTCTTATTAGGGCTTTCAATGCGGATATAATAATGTTGG
GTGACTTAAGTTTTGACGTAAACATCAAGTAAGAATGAATTTTTTAATTAAATTTTTGACGTTTCAAATTTATTTTAACAGATACTTTCTCTATTTCATA
TTAACTGAATTTTTATATTTTTTTTACTGTTCAAAATAATTGAATTATCCAAAATTTAAGATATATATATATATATATATTTTCATATTTGCCTTTTCCT
TCGCTAAAGTTTAATATCTTTTAAAAGTTAAATTACACTATTTACAATATTAATCGTACTGAGCCATCAGAATAAGAATGATGCCAAAAAAACAGTTTAA
TCTATATCTGTAGAACGAACAAAGTAAAAATGTGTCCTTAAATATTTTTTTTTTTTAAATATGTGTATCATCTCACAGATTTAATTAATATGGAATACCA
AAGTACTATATTACGTTTCATTATTAATAAGTTCCCAGTTGGATAGCATTAAATAAAATAAAATAAAAACTTTAGGTAAACGGAATCAATCAATAATTAC
AACGCGTTTTTTTGAGAATCCCACCTCTTATTATAATTATAATTTTTTTTGTAATAAAATAAATAACCACTCCGTATCCGCAACTATAATCGAACGCGCA
ATTGACAGATCTAATTAATTTATGACAGCTCTAATATCCTCTCATATTATAAAAAGAAAATTCTCCTAATGAAATATTAAACTCAGCTTACTCTTAATAC
AAAAAATAACAATTAATGTTTTGTCTAATCTTAGTAGTGCAAAGATTACGCATCTTTATAGTACAAGTCAGTAAGCTAATCAAGTGGTGGAAGTTATGGC
GAGAGGATTAACTAATGTACAATGATGATGCAAAATAAACTTTATACAATCAAGTCACTTGAGAATTAATTAGAGTTATGAAAATCGAATTATTTTGTAG
GTCATCATAAAATTAGACCTCATGGATCGATGACCAACAATACATGGTAAATAACGTATTATAGCAATTATAAAAGATTTGATAAGAGTAAAATTTCCAT
ATATTGCCCGATTATATAGTCTTATGCGCATACGCATGAGTGAAATCATCATTTTAATAGCTTTGATTCAAATTTTGTATTTATGTCACCTTCTCTTTTG
CTATTTAAAAAAGAAGAATTTTTTTTTAACATTTTAATTCTAGTTTTTTATTTGACATGTTTAAGGCCACAAGATTAAAAGATAATTTCATACATTTGAC
GTAACTTTAATTTATGACCATAAGATTCAAAACTCTTTTTTATTTTCTTAAACTTCGTGTCAAGTCAAACTAAATTATTCTTTGCGAAACGAATGAAAAA
CTTAATTTTATAGTGAATTTTTATTAAGTGGGAGTTTGAGAATGATAAAATCAATGTCTATAGTAACCTTATATTCTAATACGCGACGTCCACTTAGTTT
TATAGTAAATTTTTATTAAATGGGACTTTAAGAATGATAGAATCAATGTCTATATTAACCTTATATCTACGTCCACTCCTTCTAAATAAATTGTTTGGTA
TTTTCCAAACTTGCACTTTATATATTCTCCCAAAAGCTACTCCTAATTTGTCTCCTATTTTTTCTCAACAAAACAAACTACAACCACCCCTTAATAGTTT
ACAATCCAAAAACCAAATGCAATTCCCAGCCATTTTCTTCAAAACTCGTTGCATTTTCAATCTCTTCAACCCAATCCTCCTCTCCTTACTCCCAAAAAAA
CTCATCTCCTTCCTTCCTCCATCTTGGTTCCACCAAAAACGCATCCATTCGCGGTCACCGGCGCCGCCACAGCAGTCGCCGGTTTCCGTTTCCGACGCGG
TTGAATCGCATCAGAAGAGAATGGACTCAGACGAACTCCGACGTATCTTCCAAATCTTCGATCGGAACGGCGACGGACGGATAACGAAGAATGAATTAAA
CAGTTCGTTAGAGAATATGGGGATATTCATACCAGATCCGGAATTAATCCAGATGATCGAGAAAATCGATGTGAATGGAGACGGTTGCGTTGACATAGAT
GAGTTCGGTTCGCTTTACCAGACCATCATGGATGAACGCGATGAAGAAGAAGATATGCGTGAGGCATTCAATGTGTTCGATCAAAACGGCGACGGATTCA
TTTGTGTTGAGGAATTGAAATCTGTTCTCGCATCGTTAGGGCTAAAACAGGGACGAACCGTAGAGGATTGTAAACAAATGATTAACAAAGTGGACATTGA
TGGAGATGGAATGGTTAATTATGATGAGTTTAAGCAGATGATGAGAGGAGGTGGTTTTGCTGCATTGAGTTAGTTTTATTTTTATTTTAATTATTTCGTC
TGTTTTTTTACTCACTATTTTTATTATTAAAATAGACAAGGAAAGAATAACTTTTATTTTTATTTTTTTAATGTCATAGGCGGTGACATGTAAATAAATT
GTTACTGCTATTATTTTATTTTTTCAATTGTTAATTGTGTATGGATTATCTTTCTACCTCCGAAATTTTATTAATGTTACCTTATAATAGCTAAGGATCT
GTCAAGGTGTATTAAGCTTTCATTATACGTTGATTTGAAAAAAAAAATTGAATCATAAAGATCTCCAGAACTTTTTTTGAAGAATTTTTCAAATTAGCTA
AAGATATTCAGTAATATTTTAAATGATTGGTGCATCAGAACTTTAACACTTTGTTTGGATCATTGTTACCCATTGTTTCATAATGTATTGTATTGTATTG
TACGCAATGTTTGACTAGATTGTATTGTTTGTTTTTGTTTAGTAATATTTTGATGGTTTGGTTTGATCGTATCGTTATTGTAATTTATAAATTTATTGGA
ATATCCTTAATTATTCTAGGGTAAGAGGTTTGACTAGATTTAAATAATTAAAGTAAAAGGTAAAATAGTATTTTGAAATATTATACAAAGATATAATTGA
GAAAAGAAATTAAGTAGCAATACATTTTAAGTAACAATCGAAACAAGCAGTATAGGTATAATAACAATACAATACAATATAATGAATAACAATGATTCAG
ACACAGTGTAAATGATTGGTTTAAATTCAATTCGTGGCACTTTTTACCATTAGAAGGAAAGCACTTATTGGTAATACATTTTTAAATTTTTTGAAATTCA
AACTCGATTTTTTTTTTTAAAAAAAAGGTAGAAATAATGAATCAAAGTGCACACCACATTAGCTTCCTTATATTAATGAAAGTCGTTTGTTATCACTTTC
TAAAGATATAATTGAAAAGCTTGAGAAAAATGGATAATTCTGTAAGAGGCTTAGCTAAAAACAAATAAAATTTACAAAATTTATAGATAAGGTATATTCT
AACATCTCCTCCTTTCTTTTTATATAGGTAATGTATCGTTAGATAGGTAACATCTCCTCCATGTGTGGTAAATCATTACCCCCATATGGTTGCTATAATC
TTCTTTTGGATTTTAGTGTATGCTCCTGATTTTGAGTAATATGTGTTTCGAACTTTCGTGTTATAGTAATTTATTATATCATATCGATATTTTATGAAAC
TAATTGAGGTAATCGTATATATCATAATTATATATATAAAAAAAAAGAAATAATAATTCTCGACACTATAAATGAATCTTCTTAGTTTAAAATAAAGAAA
TAAGTTTAAAACTTCTAACCAATTTATGAAGTTAAAATCTTTTCAAGTTTTTTTTTAAAAAAAAAGTAAGTACTATAATTTTCAAATATTTATTGAATTT
TCTAACTCCATAATTCATAGTAAGTATTATAATTTTCAAATATTTATTGAATTTTCGAACTCCATAATTCATTCCTAAAAATTTAGACTGTAAAAGAATA
ATTTTTATAGTGTAAGGTTGCCCTTAAATTATGTGAAAGAAAAAAAATGTCCGTCGTTTATCGTTTGTTTCAAAAATGTTTTTAATATCAATAATTTGGT
CCAGAAATGTCCCTAAAATTACAAAATAGATAAAAAAAATGCTCTTTTTGAATAAATATATATTTTTTCTTTTCAAAAACATATTCTTCCTAATTAAAAT
TTTATTAAATAACACTATACTTGTTTTATTTTTTTTAAAAATCACTTTGTCAGATAAAAACGTAGGAAATATATTTTTCCGTCTTAATCTCATTTTATCA
ATTATAATTGAATAACTTCATGTACCCTTTTGACATATAATATATGTCATATATAAGATTATAGTATATCAATCATTGATTAATATTTATATAACGATAA
AAAATAATGATAATAAAATAAGAAATATTTTTATTTTTTATTTTTTTCTGAATTAAAGTAGGATAAACATTATTATAAAAAGAATGTATTAAAAAATAAT
ATTTATTTGGAAAATAAGTATTTTGACCCATTAAATAACAATAAAGTATTTTTGGACCAAACTAACTGATTGGCATTTTTATTTCTTTATTATATTTTAA
AAGCATTTTAAAATCAAAATATTAACCATAGAAAGATATTTTTGAGCCAAACTATAAACCGAGGCATTTATGTTGCCCTTTTCCCTACTATATATATTTT
AAAAAAAGAACTTCAACATTATTTGTTGATCTCCCTATAGCTGTTTGTTTCGGAACCAAACAACTCCTACTAGATCAGTGACCTTACGGCGTCGTTTGTT
CATCTTCTCCGCAATTATTCTATTCTTCATTCGGATTCAGTTTCTTTGGAGAATTTACTTGGGTTTTTTGCTTAGTGTTAATTCCCTGGTAATTCCTCTC
CCTTGCCGATATAGTTCAATTTTTTTTATGTGGTGTTCCGTTGATTGGGCCTCAGTTTGAATTTTTTTTAATTTTAACTTACATTAGCATTAACAGCTAT
AATTTGCTGTGTTAATTAATCGTACATTGTTTGAATCTCATTAATTATGTGTAATTTAGTGGGTAAGTTGATGTTAACGGGGAAAAGATTATATTCCCGT
AATATTTAAGGTAATAATCTAACAATTGATGGTTTATGAGCTGTTTAATGGCTTTGTTAAATGTATTTGATGCTTTGTAGAATTTAATCTCTCAGTAATA
ATATAACAATTGACTTCTGTGTTTTTTTTTTCTTTATTGACGTTGCGATTTGTATAATTTTCGATCTAGGTGAAATTCTATAGGTTTTGTGTTAAAATAC
AAACAATGTTTGTCTAGTTTTGGATATGAAATGCTAAGATGGAATTAGGAAGGGGAAGAGGTTTATTTTTGGAATTAGTGAAGGTATGATTGGATTAATC
AGCATCGGAGTTTAGATGGAGTAACATGGTCAGTGATGATTCATATAGCGAGACGTAGTTATTTATGATTGTCAAATTGCAGTTTCTGCTATACAAGCAT
ATGGATTGTTTATTCGTTTTGATTATGTATGTGTATCAATTTTGGTGTTGTTTAGCTCTAAGTGTATTTATCATTCAGCCTTCTGATAAATAAGAAGGAT
ATTCAATGTGATTCGCATCTGTTATAGTTTTTTGATGAATGATTTTTCTGTATAACAGCAGCAGAGGTGTTGAATTTAGAAGGATATATACAGATAGATA
GTTCAAATTTGAAGGATTCTTAGTTTTTCATCTTCTTTATCTTAGGTTAGAAAAAAACCGCTTTCAATCACAGCATCTTGACCTCTGAACTATGGACTCA
ACCGTGGAAAATGTAGCTTATTCTCCCAAAAATGTATTCATTCTATCTGGGCAAAGCAACATGGCTGGTCGTGGTGGAGTAGAAAAGCATCACTGGGATG
GCGTTGTACCAAACGAGTGCCATCCAGATGCTTCTAGAATTTTCCGTCTTAGTGCACACCTCCATTATGAGGTGGCACGTGAGCCACTCCACCATGACAT
TGATGCGAAGAAGACATGTGGTGTTGGACCTGGAATGTCATTTGCAAATGCAATCAAGGACCGAGTGGAAGCTATTGGGTTAGTGCCATGTGCTGTAGGA
GGAACTGCGATAAAGGAGTGGGCACACGGGCAACACTTGTATGTGAATATGATCAACAGAGCTAGAGCTGCCATGAGTCATGGAGGAGAAATCAAGGCAT
TGCTTTGGTATCAAGGAGAGAGTGATACATTATCTCAGCATTGCGTCGATACATATAAGGCTAATATGGAGAAGTTAATACATGATGTTCGTGCTGATTT
GCATCTGCCATCTCTGCCAATTATTCAGGTTAGCTAACACAGTTTGCTTCAAGCCTGATGTGAAACTTTTCAAGGATTTTGGCAATTGTGGTTAGGTATT
TCGTGGATCAAAGTAGTTGAACATTTTCACATGTTCTTTAACCATATTGCATTGTCGTATAGGTTGCAATTGCATCAGGAGATGAGAAGTATATTGAAAA
GATTCGAGAAGCACAAAAGGCAATTGATCTTCCAAATGTTGTATGTGTTGATGCCATGGGATTGCAGCTAAAGGAAGATAATCTTCATTTAACTACAGAG
GCTCAAGTTAAATTAGGCCAAATGTTGGCTGATGCATACCTTACCCATTTTGCACCACAAGAACCTTGTGTTGCTACATCTTGAGAAATTTGATGTATTA
TGTGTGTGTAAACTAAAAATTATTTAATCCTGGCTCATGAACATAACGTGAGTGGCTGAGTGCTCATATAAGTATGTTATTACTTTGAAGTAAGTTTACT
CATTTTCTGTATCTCTTCATTTCTTTACTTTAAAATGAGTATTTCCTTGTCTGCATTTCTTCATTTAGCTTTCAAATATTTTCAATTGTACAATTATTGT
GACATATAATACTTATATAGTTTTCAAATATGCAAATTTAATTTAAAAAAACTTTAAAGATAGCAAATTGGGCAACAACTTTGAGTTGGACATCTTGGAA
TTCTTAATCATAAGACTTATGTACACTTCATTAGAAGGAATTTCTATGAACTTCTGCTTTGTCTATTGTTTATTTAACTAACATATCTGATGTAATCACG
TAAATGAGGTCTGAAAAAGGCGAATGTGTGCAGCCTTGTCGATTTGTTCTATCAAAATGCAGATCGTCTTTAGACTTTATACTAACTTCAAATTTGTTTA
GTTGTACATGATTTCAGTCATATCACTAAACATAAATATATTAAATTTGCAAATGATGTCTGCAGCATGAATAAAGCAAAAACTTCAATTGTACCCCCTT
ATGATCCAACGGATACATAGCTATCGTGTTGGTTTATGCAGGTTAGGTAAACCCACTAAGTTCAATTTAGTGTACAGCCTACAATGAATATTGTTCAAAC
TGATGGATTCGTTCAGCGGTTGTGGAATGTTACTTCAAACTCAAACAAGGGATAGCAGTTGGGTATAGTCGCGTCACGGGAAGGAAGTCAGAACTCATTA
ACAACCTCATGTGCAAAGTCCACCTCTATCTCTTGCTTTATAAATTATAACGGTAGTCCAATTTAATCGACACCTTGGTGTATTGACTTGTATGATTAGT
GAGGGTGAACTACTTATCTTATTTCATCTGCTGCTTCCTCCGGCTTTCTGAGACATATTCATAGTATTCCTCTTCTCCATAAAGTTTCCTGAAAAGTCAG
TAAGTATGCAGTCAGTTAAATTAGTAGGTGCCCTACAGAAGAAACACCCAGAGGAAGGAGAAAATATGTTTGACGATGACTTCATATATAAGAAGTGATA
AAATCTTAGGCTGTTGACGTGACTTTATGTCAGTGGCGCCTTGGAAGCAAATGAACATGCAAGACAGATAATACAACCAACTCCCTACTTATTACTATCA
AAATTCTCTGGGTACGCAATTTTTTAAATATAGACTTCGCACATATATTCCCCATTTCACTCTTTTGAAGCAGCCACATGATGCATGCGAGAAGTGTGCA
AAATTCTTAACCAGTGGTACATACAGTATAACCCCTCCATACAAATAAATGCTCACATCACTGACATCAGTAATACACTATCCCAAACGAAAAGGAACAT
GTTCCACCACCCCATTTAGCAAAGAAAGATGATTAGCAAAATTTTCATACCATTCACACATGAACTATCTATTAGAACCACAATCTTCATGCTCTTCTTA
TTGGGAAGATCATCTTGGATAAGTACTGCTTCACAGGTAGCTGTCTGTCCAAGGAAGAAACCTTTGGGAATAAAATCTTCCAAATGCCCTCTCAAACTCA
TCTTCGACCACTTACAGAGGAGTTGGAAAAGGTGTTACTCCTTCCAATAAGTAACTTTTTTTGCCAAATGAGAGAAATAATGTTCTTCTCTCCCTGTTCT
CGTTACCTCCTCTCAAATATAGCATATTTCACACGTAATTAGTCCAATCATAGTTACTTGGCTAGTTATATCCATCGACAGCTTATTTGTGAAGAGTTGT
AACAATGATAATAGTAAAGGTTGTGGACTTATGGACTCTGCCAATGCTGGACAAATCTCAAAGTGAATAATGGTACAAGGATGAAAGAGAAGATTAAGAA
CCTCATGCACCTTTTCACAATATAAATCCTCCTTTTTACTGAGTCAAACTTTTGAGTAGCTTTTAGAATGAGCAGACTACGCAATTATGTAAAAAAAGAA
GCAAGGGGATGAGGTGAAGCAGATGTCATACATTATCAGAACATGAACAACTTAATTTGGAAACTAACTGAACAGCAACTAAATTTGATCCCAACACATG
TAACCACAGGTGGAAGTAAACGGCAGCAGATAGAAAAACTTACGCTACATCTGCAAAGGTATCTGATTTAATTACTGCCAGCCCCTCTGGGCTCCCAAGG
GAAGAATAGTGTGTAATCATTTCCTTCAGGGTGTGCTTTGTACTTTTGATATCATTATCCCACAATATACTCTGAAATCAAAGCACCCAGACCTGTCACT
TACATTTGCAGTGAAAAGCATATAGGAAGTCAATGACTTCAATTTCAAACAAATGCTGGATATATTTTAGTCTATTTCATTTATATGCTGGATGGACAAA
GTGGCTACTTAATTTAGAGTTAATTTAACATGTAATAAGAGATTGATTCACATCTAGTTCACAGGCCGAATACCTTTCTCACATACTCTCTTTTGACATC
TTCCCATGGTGTTTTTCCCTCAGAAGAGAATATAGAAGCATTCCACATGGCTCCTCTTGCAACCATCACAGATGAAGCACCTATAAGATAAAGTTGTTAC
ATGTTGCAAAACATAAGCAGAAACAACCTGTAGATATTCATAAAAACAGATAGAAAAACCATCATCAACTATATATGAAAAATGCTTTTCTCATACAGAT
TGTTCATTATTTGATGTGTCACAAGGAAGCATGCCTACAAAGATTAATTTTGTATTTCTGAGGCAACAGCATCTCTCAGATTATAACTTCTGAATTGGAG
GCTATGTTGCCCAGATCCTTTAAAAATATCACCTCACCCCAAGTCAGATCTCCTTCAAATATAACACATTTTTGGAGGATCCGAAACTGGTGTGACGGCT
CTTCTGGAAGGGCCTGAACTGCAAGCATCTACAAGACTGTCAAACGCATCCACAGAACTTCACAGCAAAAGAAAGAAATATGCAGAAGCAAGAATTCAAG
CTTTTTTCTACACTTCTTTATAGAATTAGTTATCTCATTGATTGAAGGGAAAATTGTTGCATACACAGTATTTGTTGATTCCATTTCCATAAACCCATGG
ACACCTGATGAAAATCAAACATCCATACCCATATATGGACGACAAAGATATATTTATTGTCATATCGGGCCAAACACTCAGATCTATTTAATATCTAAAT
TTAAAAAATTCACCTAGAAATTGCAAACTGATTCATCAGAGAATAATATGAGAACAAAGAGCAATTATAAGAAGTACAAGCACACCTGTTACATTTCTAA
TACGTTGAAAATCCTCATATTCAAAAACATCACCATTTGCTATAACTGGAATAGAGAGAGCGGCAGCAACATCAGCAATCTCATTCCACTTTGCAGGATC
TCTTGGCCTATCTGGAACTTTCCTGTAGTTCAATCAACAATCATGCAACATTTGCTAGTCAGAGGAAATACTAATATCACTCCACTTCAAGTTAAAAGCC
CAAAATAGGAGGAAGCTCAAACAAGCAACCAGTGAAGACTCCTTATCCCAAACAAAAAACAAACAAAAATGAGCCGTGACCATATTCTGTGTAACAGAGA
CATAGTAAGAGTAGCTGCGAGAGAATTATCAATTGCACCCTCAATAAATCAGTTTTGACATCGTTTCCAAGTATAGCATGTTCAATTTCTGTATTTTAAA
TCTTCTAGCACTGGCTACACATAAAGATAGCACAACATAATTCATGGAACCCACCCCTCAGCAAATGGAAGGAAGATCAGAACCTAAAACAATCCTGTTA
ACCCTAGATGTGGTTAGTAATTCATGAATTGGCATCTTCACAATGAAACTTCAATATTAGTTAAAATTCACAATCACAAAAAGTGAAAGGAGAGAGTAAT
CGGGGAAAGTAGCAATAACATACAGAAGAGACAATACTTTCCAACATAACCAAGAAGCAGACTAAATGGTTCTTCTCTCGCTTCTAAGGTGGACTGTTTG
AATCTACAGCAAGCCCCACCTCGTTTCACAAAAATACTCCAACAACTATATGAAATAACTTGACCATCAAAGTAGGAATCTGGATTACTGGATATACAAA
GGCTTAATTGATGACAGAGCACAAGGTTAAGTTTATAAAAAACATGAGAAGCAGATATACAGAAATCATGTACCTTCCATGGACAGCAAGAGCAGAGACA
CCAGTCATCTCAATTCGTCGTGCCAATTCCACTGTATCTTGCGGATCTTTTAATAACCTAATTTTGCATGTTATTGGTACATCCAAGTTCCTTCGCAATG
TTGTCAAAATCTGAGTTCAGAAGAAGGGAAGCATTATGAACAGGACATGCACTCCTATGCTATATTAGAAGGAAACTCGGATACTGATGAAGGAGCAACA
GTAATTGCATACATCATGGATGAGCTCTGGTTTGCTCAACAGTGCAGCACCCATGCCTCCACTAATAGAGAATGACTTGGGGCATCCCATGTTTACGTCA
ACTGCTGCTACATCCTTACACCTGAAAAGGGACAGACCATCAAATAATTCGATCAGATGCACTAACTTCCTACCCATATCGAGCATAATTGCTGGTTTAA
GCTTTCATGACCAAGTCAGAAGTAAAGACCTAAAAAGAGCAAAGAAACTCAAGCATGTGCTTTGAAGTTTCTTCACTATCTTAAGAAAGTATATTAAGAA
TCATGATAAGAATGCAATTCACAGAATATTATGATAGCTATTCAATATAGAGAAAATTGTTGGAGAAGCGAATTCATATCACTGCAGCTTGTTGCAGTTC
AACATTAATAAATTTAACTCTGACAAGCCTGTTATTTATAAACGAACATCAGCTATATCCATCATCCAATTAATGTCAGAAAAGTCGATTCTAAATACTG
CTAACAACATGAAAAACTTAAAAATCTAGACTTCCAATGCAGAAAACGATGACATCATTTGACAAAATGAAAAGCAAAAGCAGAGAGTCCAGCTTCAAAA
ACAGTTCCTCAATAATTTCTATTTTTCCTCCTTGGGCTGAAATGGGTGATGTTGTGCATGTGAAGGAAGCTTATTCAAGCTGGTGCCACACTGCCACTTG
AGAGTTGACAAGGCCATCAAGAAGATCCGGGTAATGATTCCTGGAATAAATTTTTTGGTGTCTGTGGATTGAAAGAAACAGTAGATGCTTTGATGGTATT
TCAACTCAAAACTCTTCCCTCAAAGCAAAGTGACTGCTAAGTCTGTTTTGCCTGATTAAATTGACACCTATGAGTCTGTAACTAGCCCCGACCATTTTTT
CAGATTGTAAGCTCCCTACGCTTAGGGTAGCACTTTGTATAAGGAATTGCAACTTCACTTTACTAGTAATTGCTAGCAGATTTCTTTAGTAAGTTGCATC
TTCTAGATGCTCCTTAACAAAACACATTACTTCATCAAAGAAAAAGGACAGTTCCTCAAGCAAATTAGTAAAGAATTCCAACAAGAACATTTCTAACATT
GATGTATAATATAGAGAACTGGAATATATGAAATCTACCTCTTAAATCCAACAAGACCACTTCTAACCTTGATGTTCAGTATGGAAATTAGGACATACAT
ACTCTACCTCACCCCTTGTAAAACCCCCCAATAATATCTGTTGTTATCAAGAAAACGTTTCATGGCACAAGAAGACTTATGCAGGTGCCACTATACTCAG
CAAGAGAATGACACAACCTATTAGGAACCCCAAACCGGCAGAAAGGAGTTATTAATTAATGGCATTTGTATTTGCTCAAAATGAATGTTTGTCTTTTTTG
CCTTTTTTGGGTGTGGATGGAGGTGAGGGTATCTGGTTTCGCTAGAGAAACTGCTTGTCTGTTCATAAACTCAACCATACGAGTTCTTACATAACCAACA
GAGATATACTACATAATGCATCACATTACTTAAAAAGAAATACCACCAAAAATGCTAGAAGACGCATATTGAAAATAAAACAAGTGGAAACAAGAGCGAG
ATTTCATCATAGGAATCCAATCCAATCTGTCTGTCTATAAGACTCTGTGTATGACCATGTGAAAAACAGATTGTGTGTGCGTGAGGGGGGGGGAGGGGGG
GGGGGAGGAGAGCAGATGGATTTAAAGTACGAAAATTAGTTATGATAAGGGAGGAAAAAAGAAAGAACTGAATGGAACATACACTATTTCAGCAGCTTTG
AGAGCCCTCATGGCATCAGAAGTGCCCATCTGAAATACAACTCGATTTCTCTCCTCGGGGCACGTTCTGAAAACAACATTATCAGTTCCCTTCTCCACTA
TGTCAGTAGTCCCTAAGACATCTAAGGAATAAGGGGTAAAACTCATGAGAAATATTTTAGAAGCATCGAGTTTAGCAACTTTTTTCTTTTGCCATCTCAA
ATGTACTAGGTAACCTGCATCTAAAGGCAGGCTTCACTATGATATTTATCTTTTCGTTTCTTTTTCATAAGTGACTGTGAATCCTATTCATCTATGCTCA
TAATACCTAAAAATAAAAATATGAAGTAAAATGCAAGGCATAAAGCATAATGCTAACTGCAAAGTCAACAACATATACAGCAAGTCATAAAGCCTTTACA
GAGTAATGACTTTGAATAAATCTTCTCCGCTTGGAAAGCTACTGAATCAGGTATCAGATGTCATCTATACTATGTCAATATACATGAAGATTTTTTCAAT
AAGGGGGTTCAAAATCTGAAGAAATAGACAAACGAAATAGTCGAGGGGGTTCGACATTTACTATGTATACCTAAAAAATAATTTTAACCATATATAAATA
GTACTAATTTTCCGGTGAAGGGGGTTCGGATGAACCCCGTGAGAACAAGGTGGCTCCACCACTGTACACGACCTATATAATAATTTACAAATCCTTGTTT
GGTATTCGAGGGGCAATCAACTCACACTAAAATATTCAGTTCAAGGTTTTAACGTTCCGATATTAACTATCATCAGTAAATGCTCAATCATCTCTCAAAT
ATTCCATTTAAGCCACAGATCCATGTAAAACTTCTCGTTATCAAATTTCTTCAAATAAAAGGCTCATTTTCTTGATAGAGACTAGAGAGCCATAACATGA
TGAAATTAAGAGTTCACATCCTTCTTTCATTAACATAAAAGCATAAGATCTGATAATCCATTAGAAATATAGAAGTACTCAAATTGACATATACATCACA
TTCAAACCAAGGTTATATTCATCAAAGAAAGGGTCTTGAATAAGAACAATAGTGGTCACGTAATTGGTGCCTTGGCATTTTTAGGAACTGTTCGTTTCAT
TCTTTCAATAGAGGTAGTATGTATTTAGTTTACATGTTACATGAAAAATGTTCAAGGATAATCCAGACGAAGGATGCAAAAGGATGAACAAGAAATTACC
ATTAACTCGCCGCTCACATTTGATGATCTTATGATCAATAATCTCCTCTCCATAGGTTATGTCAGCTCCATATTGGGCAGCAAGCAGCCTAAACGGCAAT
GTACCCTGGCCAAAAGCAATGAAGAATACACATGGGCATTTAAAGCATCATTTAGTAAAGTAAAAAACACATTAAGAGCAGTTTTAACTATGCTTCCTGG
TGAATTTAAAAAGAGCCACACACATCTAGAAATGGGAACATGAAGTACCAAAACAGGACTGCTCTAATTTAAATTCACTTGAAGGTACTTACCACTCGGA
CCATTGGAGCCAAGACTAGCTTGTTTCTGTAATCCATCATTCTGACGAGGCAGATAAGTTAGTGCGATGCCTGAGACAATAGTATACATTGACCAAATTG
AGTATAGTCAGTATACTGTACAAAGAGTTACAGGTTACGAATAGCTGTTATGCTTATAAATTATTCTCTCCATCCATTTTTATTGTCCACTACACTTAAA
AAAGATGTCCAATTTTACTAGTCCAGTTAAGAAAATTAAAAGATAATTTACCATTTTACCCTTATTACTTTTTTTTTCTTTCTTATATGACAAGGGAAAC
TGTAGCCGCTACCTTTGGGTGCACACCACAGCTCCCAAACTACACACGATAGGTAATCCGCATTAGGCAAGCCCCGGGTAATGAGCTCAACCCAAAAGGC
AAACCTCTTATTTTTATTGGCAAGGGGTTACAAACTTGAGATATCCAACGTGGAAGTCCCAAGCTCAAATCACTAGGTCATCCCAAATAATTTTACCCTT
ATTATTATCTATACTTATTTTCCAAATTATTGACTTTGTTTCATGGACAAGTAAAAATAGACTGAGCAAGTAACAAATTGTACATAATTCCTGACCATGG
CTAGCATTTAAGAAACACAATGTATATACAGATTTGGATCTTACGTTATATGGACAATTAAGAACAGAAATTTATTCAATCAAAACATCAGCTGTCAAAT
AAAATCCTGATGCTCTCACTCAAAGCCAACCTACGTTTCAGCAATTGCAAATTCCGAGGGACAATTAGACTTCAACGATACAATTTACATATATAGCTTC
GGATCTTACAGTATTTGCTCAGTAAAGTTTAAAAAAATAATACTGATGAGTCTCTCGTCTCTAAATATAAACATTGACCAGTAAAGAGAAAGAGCAGGTC
AACAGTTGTTACTGACCTTGACTTGAAAAGAGAGGAAGAATTTTCCCAGCCGGCGGCGACCAACCACGGCGGAGTATCGGAGTGGTTGCAATTGACGAGC
GGCGCCGCGGAAGGGTCCGAACGAACTTTACGACGACTAAAATGTCATTTTACAATATTTTTGGTGGCTATAAATTAAACGCCAGTTTTTTCCATTATGC
ATTCATTTTAATTAGAGAATAAAAAAATCTGATTATGCTTTTCAAAATAAAATAAAATTGAATAGTAATACAGTAGGAGTTATTTTTCAAACGTTAAAAA
AAGAGTGAAAAAGAATTCTCTTTAAAATTTTAGTGAAGCATAAATTATTATTATAATATTGACATATTTTCAGAATTTTAATACTTTCATGAATATTTTG
ACAAAAAGAAGATAAATTTACATTAATTTGATGACTGAAATCTAACTTTCGAATTTAAACTCATTAAAAAGAGAATTTCATTGTATTAGACTTTTTCATT
CTCAAAATAATGGATATAAAAAAAAATATTAATCATTTTATTTTTCAACAAATATTTAATCGAAGAATATAAATATCATGCATGAGCTCTTTATCTTATT
ATGGGATCATTTTCACTAGGGTCCATTGTATTGATGAGATAGTTAAGCATAACAGACACTATTAATTTTTGGAGGTTGGTTTTATAAGAATAATTTAATG
TAAATCAATTTCCATAGATCGAGTTTTCTTTTAAATGTAATTAATTATTTACTCTATAAATTAATTATTATTTTTTGTGAACAAATAAATTTAAAGTGTA
TATAAAGATGACCGGCTAAGAATTATTTAGAAATAATTGACTTTAAATTCTATTTTACTTTGGTAAATGGTGATATGATTTTATCATCTCATAATTGTCA
TAACATGTTCTAAGACTGCATGTTCAGGTATTTTTCTTTCTTTCTCAAATGTCTGTGCTTAGTCAAACTTTTAAGATATTAAAAATATTTAGATTATTTT
TTTAAAAATAACTTATAAGTTAAAAGTCATAAGTTAAGAATGTTAAAAAAAAAATTATTCTTTTTAAGTGATAAAATTCAATTAATCAAAAATGGATTAA
AATTTCACAATGGAGGAGAAAATTTCATATTTTATTTTTTAATCTACGATTCAAAGTTTTTCAAAAATTTTTATACACACCATTATTCACTTGCATTTAA
TGCCAAGATATAACATAGACACTTCTCTTCTAAGTAGATTTCATCATTGAGAAGTTGCTCCTTATCTTTTTTAATTTTGACAATACTAGTCAACTTTTAT
AGGTAATTTTAGTAACAACATAAAAAGAATAATAAAAACTGGGAAATACTAGATAACTAGTACATAAAATTTTAACACAATTAATATATTGCATCTAATA
GAATTTCATGAAAAAAAATCTTAAGTTTTTATAAATAAAATTTCATGAATTTTTTTCTTCCAGTTATTAGAAAAATACATTGTTTTGTAATTTTTAATCA
TAAAATTTTAAATGATATAAATATTAGATAAGGAAACAATCAAAACATAAATAAATTGTGGTTTATCGTGAAACTTTAGGTTACAAGCACATTATCTTAA
CAAATTATCAAAATATTAATTTAATATAATATTCTATTTTTATACTTCGTTTCATTATCATAAAATTAAACCAATCCATCCCATTCAATATGTCTTCTAA
TTTGCCCTTTGCTTTAAATTATATCAGTATATGTCTATTTTGTTGTCGATCCAATTAATCATCTACCACAAAATTATTAGAAAGATTGTTTGTATTTTTT
CATAGAAATTAGAGATGTTAAATGTCAATGGTGACGTTAATACGTTTCCAACAATTGCACAACGGGAGTTTATAAATGAATTTTTCCTTCCCAGGTTTAA
AACATTTTTTCTTACGTTGCAAATTCTTTTTCTATAAATACATGATAGGCTATTAAGACGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTATCAAGTGGATAGCCGTTTTCTAATACCTACTC
AATTAGTTTCTTGTAATGAAATGGTAAATACACTTTTTTTCAGTTTTTTTTTCCTTCAAAGCATTCATTAATTTAATTCTCTTATTAACGAGAACATATG
TTTCAATTTTAATTATTTATTTTAATTCGTATCTCTTAAACTATCTCATTCGCTTTTATTTATCTAATAGAATTCAAATATTCATATTATAAGACTAACT
TCTGTGATCACAAGTCACAACAATCTTAGAAAGAAGCCATAGTTTGAAATCACCCATACTTGGACACAAATGTGATTGAACCCATAGGCCATTATATTGT
AACAAACCTAATAACAACCAACACAATTCACATTCAAACAATAGATAAATTTAATTATACTAACTCAGATTTTAATAAAAATATATTGTAACAAACCTAA
TAACAAGACCAACACAATTCAAATTCAAACAATTAATAAATCTAATTGTACTAACTCAGATTTGAAACTACAAAAGGAATTTGAGAACTAAATGAAAATT
AAAGAACAACGGTAAAAGAAAGGAATGAGAATCAGAACTCGAAGTAATGCTGCATTTAGTCATATTTTTAATGGCTTACAAATAGTTTTAAAAAATAAAA
TAGTTCTACATTTGAGTATTACTCTTTGTTATTTGTGAAATTTTTCCTTTTAGATTTCACTCTCAGATACCTTTTTAAGGAATTTTTTACATATATAATA
TATTTTATTTGGTTAATTACATTTTTAAATGTTACTTTACTTTTGTTACTATATATGATAAAAATTTAGCTTTTACAATTATTTGATGTAAATCTGCTTA
AAGTTGTATTAAAATTGATTACTGGGTGAAGTTTTAAAAAATTGTATTAAAATTGTATTAAAACTATATTGAATATAAAAAATTGGTGGTCTCATTGTGG
TGCTTACGAAAAAGAAGAAATAAATAGTATAAATATAAAAGATAGTTATAATACAATTCAAATTTGATATCATGTATTACTATGAATTTGATAGTTATTA
TTCCAGAACAAATATTTTACATTTCTAATAGTGTAAGCTAATTTAAATAGTACCAAAACCCTGTAATGTTTGAAATTCACATATAATACTTAAAATATAT
GTTATGAACTAGCTTCGACTCAATGTCGATACCTATACGGATGTCACAAACACTAGTTATTAGACCGAGAAGAAACAACAAAATTGAAAGGTCTTTGCAA
AGGCTGATTTGGGACCCAAACCCATTAAACAACTAGCTAAAAGGATGATAGATGGGAAGAAATAGTTTATGCAAATTGCTAGAAAAATGTCTAGTCCTCT
CATCTCCTTTCTCCGAGTTCAGATTCTCATCCCTTTCTTCTACTGGTGTTCTTTAATTTCCATTTAGTTCTCAAATTCCTTTTGTAGTTCCAAATTCGAG
TTAGTACATTTAGATTTATCTATTGTTTGAATTTGACTTGTGTTGGTCTTGTTATTGGGTTTTGTTACAATATATTTGTATTAAAAAATGTTTCAGTAAT
ATACTAGATGAAGTTTTGAAGAACTGTATCAAAACTGTTTTAAGTATAACTAATCGGTGGCCTGACGATGTTGATTTATCAAAAAAAAAAGGTGAAATTC
AGAAAAATTTATATTAAAATTGTATAAAATTTGTATAAAGAAGCGATGATAGTGGCTATGTTATTTGTGTGAAGAGAAAAATAGAGTCCAAGAGATATGT
TATAATTCGTAAATAAAGTTATATAGTAGTATGTTAATTATGTAAATTGCCCTTTATTTAGCCCGGTCCATATTTTAAACCCGGAGTGTTGTCGGGTCCA
GAAGAAATAATAATGCACAGTCCACTCCACAAATGTATAACACGTGTCAATATTCCATTGGATGTTACCAAAATTGCTGACTTCTTATGGCTGGTTCAAC
CCAATCAATTCTCAACATCTCATATTTACAGTTTAGCCACTGCCTGAACCCTCAACCCCTCTTTCTCTTCTCCGTTCCACCCACCCACCCACCCCCACCT
TCTGTCTGTTCCGGCTAAACCTTCACAACGTGGATTCATTTCGTTATTTATACGATTTTGAGTAAGTTTCTTGTTTCCGATTATCTGTTTGTTTTGGGGA
ATCCGCAAAAAGATTGAATTTTTATTCAAAAATTTGCTTTCTTTTTGTGTTTTTTGCTGTTGGGTAATTGAGTCCCCGAGAAATTTTCATTTTTTTTGGT
GGTGGGTATAGTAGCTGAATTGGGTAATGACTATAATTTTCTGGGTATTGTTCTTTTCCCTCTGGGAATTAATTTATTGGTTTCCCCTGTATTTGGGTAT
TTTGGAGCTTATGTTTCAGGCTGAAAGTTATGTGTTTGGTGCCACAGTATTAGTTTGGAATTGGCTTTTTGAATCAATGATTAACCAATAATTTAAGTTA
TTGAAAATGTTGAATTTTTTGCCCTTTTGTTTTTTTAACTGTGATGCTTATAGAATTCCTAGGTTTAAGAAGCCTTTGGACATATTAGCAAATGTTGGAG
TGAAATGGACCTAGATGGAGTGAGATGAATATTGAGGATTTGTATGGAAACTCCGAACTAGTATAGGATTGAGGCATAAATATTGTTTTTGTTATATAAA
GAAGGGAGTATTTTTTTAAGTTGGGGATATGCAACTGCTAGAGTGTAGAATCTTCATAAAGGATAAATTAATCCGATAGAATTAAAATGGTATAGGACTA
GCTAAGTTATAAGGATGACTATGGAGATATAGTCAAGAGGAGAACTTTTTTTGTGGAGTAGAAGTATCACAGCAAAATATGGAAAAAGTGATTGCTGGTG
CACTAATGGAGTTAGTTCTTCACACGGTCATGGACTGCGGAGATATATTAGAAGTTTATTGCCTAAGTTTCAAATACTTATTACTTCTCTGAAAGTTTTG
GATGGCCAGAAATTAGGGTCTGGAGGATATATGGTTGGGAGATCTTTAGATTGGCGACTATAGTTTATTGTAGAGCTTGACAGAGTTTGGAGCATCTCAT
GTAGAACGAATTGCCAAGGCCTGAGAGTTTAGAGGACTTGATTCAACTTTTCATTATATTAGAAGGTAGCAACTGGCTGAGACTCTTTGAGATGGCTCAT
GATAGAAAGGGCTTATAGGTTAAATCAAGGTTTGAAATATATTCATAAACGGGGAATATGGTTGTTCGTGGATTGTTTTAAAGGAAGTACTATCCAATGA
GAATCCTGAGAAAAGAGGGATTTGTTTGTGCACCTGATGCTTCGTGTGCAACATGGAAACAAAAGTTTGTATCATTAATTTATGCATTGCTAAATAACAA
CAAAAATTAGGACTTGTTTTTGGAACATTTTTGGCATTTACTGGTTAACTCCCAAATCCATATTTTAAAAAGCAGAAAAAAGACAAAAAAGTTATGTGGG
AAATTATACCTATGTGCATTACATGGACCATGTGGGCCAAGAGCACGAGTGTTTTGAGGCTAAAAGCAGGTCACTTCATCAACTAAAATGTCACTGTATT
TATTTTCTATTATTGGTGCAAGTTAAATGATGAAAATAATGCTACAATTCCCATAGAATCTATTTGCTCTTTACATCTATTTATAGATTAATCTACAGTA
AGCACTTGTATTGCAGAATATGGCATCCCCTTATTCTCCCTCTTTTAGCTTAAGCTTGTTACATAGCTTGTTAGTTGGCATGGGGAATTGTAAGCTTATG
CTGCCCACATCATCTATTTCTGTTGTTCAAACTGTGAGGATAATCCATTCTCTTATTTGGACATCCTTGCCTGTCTGCTTTTTCTATAACCGTTTTATCT
GTGAATTTTATGTTATTGGAAAATTACTGACTGTATTGATGCAACAGTGGACTTTGTGGTTGATGATCACATCAGTGCTGATGAGGAAGAGGGCTCAGTT
GTGGAACTCAGAACAGTAGATGAAAATGTGATTGGAGGAAGTTCCAGTGAGGAGGCACTTCACCAGGTGCATGATGTCAAGGTGGATGAAGACCTTCCTG
AAAGGGAGGACCTTATATTAGAAGAAGCACAATCTCTCGATAATTCAACTTCAGATGAACCTTTCGTTGGCCTGGAGTTTGAATCTGAAGCCGCAGCACA
TGCATTTTATAATGCATATGCAACAAGGGTGGGTTTTATCATCCGGGTTAGTAAGCTTTCGCGATCTAGGCGTGATGGCTCCGCCATTGGTCGAGCACTA
GTTTGCAACAAGGAGGGTTTTAGAATGCCTGATAAGCGGGAAAAGATTGTGCGACAGAGAGCAGAAACAAGGGTTGGTTGCAGAGCAATGATATTAGTTA
GAAAAATAAGCTCTGGGAAATGGGTTGTCACAAAATTTGTCAAGGAGCACTCTCATCCATTGTGCCCAGGCAAAGGTCGCAGGGACTTGATCTATGATCA
ATACCCGGTTAGTTTTCTGCCTTATCTTTATTAAGGTCTTGTAACATAAGGTATCCTACTTTCTTTTTGTACATACATGTCATTTAATTTTCTAGACTAT
ATCATCCTATTATTGCCTTTTGCCTTTGATTAAACGTCTTTTGTTTGTACCATTTGATGGAATCTGAAATTTTAAAGGAGGCAACAACATGTATGTTATA
ACTTATATGTACTAGTTTCTGGATACCGGCTTTGCATGTGTACCTCATTTAATTAGTACATGATTTTTAAAACTCACATAAATCTTAATAATCAATGTGT
TTTAGTTATCAAATAAAATTTATAGAGAAATGGAAGTTTATGAAAATGATGAATATTGAACTCATTTAGCTAGCTCAATAAAGGAAGAAATCTTGTGCCA
CGGAGGTCCTCAAATGCCTTATTGCAAAATAGAGACACATATGGGAGCAAAGTTTCTTCTAAACTGAAATCTTAGTTTATCCCAAAACCTAATTAGAGAA
CATGTTTAGGACTACCAAATGCCGAATATAAATATTATGAAAATTGTAGTTAATAATGCTATTGTCGAGTTACTTATTTTGCTATTAAAAGACAAAAAGC
AAGGCATGTTGGCAAATGTTTTTAAGTCATTGCCGCTTAATAAATTTTATTTCTATAACTTAAATTTAAAAGCCAAATGACGATATGAAACAGAGTGAAC
ATGGCTGCTTCTCACTGAAATCACTTAAATTTATAAGTGAATGATTTCATGGATATATCAAGTGGGTGTCAACATTATATTCCACCTTCTTACTTTTTCC
CTCACAAAGGCAACACCAGCTAAACATCATCCTTCTCAAACTTTCTACTGTTAGTATGCTGTGGCAAAATGGTATAAAGGATAGTTCCATTTTGGTATGA
GGAACTTATGGTTATGAGAACAAAATGTTGTAGTAACCAAAAAAGGAACAACAGAATTTATATCTTACCTCTATAAGTGCAACCTCTATTTTGCTGGGGG
GAGAGGCGTGTGTGCAAATATTTGCCCATTTTGCTTTCTTTTATAGCACCATTATCCTGCTGTTCTCTCAGAGCTACCATTTAAGGTGGAGTGCTAATTG
AATTTTAAGAGAAATTCGACAAGAGAAAAATCATTACGAAGGAAAAGGGAGAAATTCGGCAAGATATATCCTTCTATGTTGTTTGGACTCACTATTCCTT
GATTGCAAATACTAATAAATGGTAGTCCATCTTTCCATTTTGGGAGTTCTGTAAAAGTGATGGCGTGTTACTTATACAAATTTATTCAGTTAGCACTCTG
TTATGTGGATAAAAGATGATATAAAGTGTTTTCATTTGTGTCTTTGGACAGGTTATATATTCGTGAGTCACCTTACCCTTCAATTTCCGTCATCATTCAT
ATTGATATTACATGAACCTAGAAATGTAATCCTTTTTGGCTTCTTTGGTGTGCGAGAAGAAGTGTTTATAGAAGTCATGACCGTTGTGCTTTTGGTTGTA
ATATGCACTTAAAATACTGATCAAGTCGAAGTATCAAATTCAAATTTGAAAACGTTAACTCTAAATACTACAAATAGTTGGAGATGGTAAATCTGTCATA
AAAGTACATATTATTGTCATCGCGAGGACATTTAAACTAGAAACTAGATCATATAAACTGGAGTGGGGGAAATTAGTCGATTTAACAATTGCCACTTGTA
GCAGTAGTTTTAAAATTACTGATTTTCTCTGTCAATGCATCTAAAACTGAGTATCTTATGCCTAGTTCATCTTCAAAGAACTAACTTTACCCGATTTCAG
CTAACACTTGTTTTGGTTTCTCAACTTCTTCCTGCAGAACGAGCATGACAAAATCCGGGAACTATCTCAACAACTGGCAGCTGAGAAAAAGCGATCTGCT
ACATATAAGAGGCATTTGGAAATGATTTTCGAGCACATTGAGGAGCACAATCAATCTCTGTCTAAGAAGATCCAAGATATTGTACACAATGTTAGGGAGT
TGGAGTCCAGAGATGAACATCATCATAGATAGTTTTAGCTTAATATGCCTTTGTTGATATTAGTGTAGAACCTAAGTTCAGTAAAGATCATAATGATTAC
TGTCTTGACTTGCCTTTTTTTCCCTCTCCCTGTTATCCTTTTCATTTTCTTTGGGAAGAGTATGAAAAATTTAAAACCAGACCATATCTTGTGTTCACCT
TTTTTTTCCTTTTTGGGTAGAATTGTGGAAACGTAGGAAAAATTGGCACAGAATGTCTACTTCTGGTGCTTCCATTATAACATTCTTTTGGAAGGTTGGA
GTCACCTTTTTTCATTTTTGTAAAATCTCAAGTCCATTTCTTTTAGATAATAGTTAACTGTATTTCAGTTTTCTTTGGGACGCTTCAAGGATTACTTTGA
GACATATTCTAGAAGGTCTGCGTACTCTCTACCTCTAGGCTCCATTTGTTGAATTACGCCAAGTATGTCGCTGTTGGATTTTCGTTTGTGCCTTGCATCA
GTTCTAACTTTCTTGACCATCTTGAAGTGCTTATGGCATAGTTACATTTGACAGTCCTATAACTGGTATCTGCTGACTCGATTATCCCGGATCAAGAATT
TCTTCACGCAAAGTTTGAACATAAGATTTTGGTGAAGGAATCTCATCCATTTCACCATATTGAAACTAGAGTTGGTAATTGATGGAACAGGCAACCATTG
GTGGTTTCAATGCATTAGCTGTAATTGCTAATACATATGGACTATAGTATGTGTACAATAGTTAAACGTAACAAAATATTACGGTTGTTTAACATAAGGG
ATGAAGGTATAGTAAATTCGATCATATACATATTAAAAATTACTAATTATTAAAAAATCGAACTGCTGTGCTAGTAATTTGCATGATTAAGAAGAACCTT
AATCATTAACATAATTCCAAAATTAATTAGTCTCTAGCCAAACTTTTAAAATCAATTTTTTTCATAGGTCCTTTAAAGAAAAATAAAATGCTTCTGTGAG
AATCAAATTGTGTTTGACTAATCAATTTAAAAAGTACTTTTGATCAACAATTAATATTTGATCGATTTTCTCATTGTACTTTTGAGAAAAGAAAAACTTT
ATAAAATTTTAAAAAATATTTTTTGCATATTCCAAACATGCCTAAACCTTTTTGTCCATTTTAGCTTTTATTTTAGGGCCAAAGTTTTACTTCAGAAACA
GAGTAAAGTGTTTCCCCCAAAACACTCAATTTTTGCTCAAGGGATGACTAGTAAGTCCTCTTTCTTTCATTTTTGTTTTTGGGTTTCGGTAAAGATCACT
GCTTTTTGTTTACATGAATGCAATTATGTATAAAACTAGCTCAATAACAGCATAAGATTGTTTCTTTTGGCATTGCAATTTCTTCAGCAAGATTAAAGCT
TTCTGTTCCTGCCACTTCTCTATATATTTTCAGTTTTTCCATCATTCATTTAAAAATTTTAAGATGGGTATTGAGTTCTTGAGGATTATTTATTTTCCCA
TGAAAACTTTTCTGGAACTTGTGATCTTTCTAATTGCTGAGTATGGGAGTTCTCTTGAAAGGGGAAAGTTAGGTTATATGATGCGTGATATAGATATAAT
TTGGTCCATTTTATAATTAGAAATTTGTTGTTTCAAATTTGCTTTCTTATGTGCATATTGCTGACACCCCTTTTCTGTTCTGTCTAAATTTGTTGCTGGT
TTTGAATTGATATGAAGTTTAAAAAAAAGTAGATTTAGACTTCTAACTCTTGGGGTCACAAACTGAAGATATGTAAAATCTGCCAAAATGCTCCTTTTAA
TCTTGTGGTCTTATAACATGTCACGTGGAATATTATAAGAGTTGCCAAACAAGGAAAGAGGCATACTTCTGGAACGGACTAAAATGGGAAATAAGACAAA
CTAATTGAAACGGGGGAGTACAATTTTTAAGTTTGAAATCAGTAGTGAAAAAGCAAGTATTTGCTCGTCACACATTATCCTGTTTTGATTGATGCTACCA
GCTCCAAATACCTTTGAAAGTTGTTTTAGACCAATTTCCCACCTTTCGTGAGGTTGTTAGGCTTGTTTGTGAAAGTTCAAAATTTAAAAATTATTTCTTT
TTGCGGTATTACACTGGGTATATTGTTGTTTCTTTTGGTCTTGCTGTCTACGTTGCGAGAAAGTCTGCCAACTGAAAGTTCACTTATTTGTTTGTTTATC
TCAGTGGATGTGCACAATTTAGAGGATAATGGTGCTGGAAGAGTAGAATCGTCTGCAGAAGGACAAGTTAGTACATCTGAAGCTGATAGAACCCAAGAAC
CAAATGAAGGTATGACATTTGAATCTGAAGAAGCTGCCAGAGCATACTACGATGAGTATGCTGGAATGACAGGATTTATAACCCGTGTTCTGTCATCTCG
CAAGTCAGAGCGTGATGGGTCAATTATATCACGTGGACTTGGTTGTAGAGGGATACCAGATAATCAAAGGCCAGTAAGTTTAGTCAATCAAAAGCGAGAT
AGACGACGTGATGGTTGTACAGCAATGATCCTAGTCAAAAGAGAGAAGCCTGGTACGTGGGTGGTCAGAAAATTTGTTAGGGACCACAATCATCCTTTAG
TTATACCACCTTCCAAGAGACGCCCAACTTCCGTAAGCTTTCTTAGTCTTACCTTTGTATCAACATTTAATTGAAATTTTTATCTCAATTTCCCTAACTT
TAACCCCTCTCTTTTATATTCTTTAGGCTTGTTTTTTGCTAATATTTCTTCGGCTACACAACTAGGTATCTACTTTGGATGTGTTTATTTGCATGCACGA
GGCATTGAAGAATATTTTTACTTGTCTGCACAGCCTCTTGGATGACTGCCTGATTTATTTGTAGTACTTTAGTCAACATACCTAGAAGTCCCAACTCTCT
TGCTAGTTGTTTCAAATAAGTAATCCCTGGTAAAACCAACTATTCAAGAATGCTTGATTTGGTATGCTCAATAGGTTGCCGATGGTTATCCACAGTAACA
TTACAGTATTAAACTTTCCATTTTTTCACATGGTACTATATTTGGCTTGGGGTGTCAAAATTGTACGTAGGATGTACCACCCCTGGTACTACTCATCGTT
GCTTAAGCAGTGGTCATTTTGCTTGGAATCCAGTTTAACGCAGAAAGAGATATATTGAATGCATTAATAAGTGGTCTCATTTAGACTCTGCAATATAACA
CGAGAAAGATTCATTTTAAAACTTTTAATAAGTACATGAGATTGTGGTGCTCTTGGTTGTTAGTGATAGTGGATAAAAGTGAGTATCTGTGACAGTAGAA
TCTAAATGTACAGGCTTCCTTATGTTTCCATCAATTTTTGTTTATCTCTAATTATTGTCCTGCAATTTTTTATGAACTTTTCGCCTTGCCCATCCTTTTC
GGCTGGGAAAGAAAACATTAAGTGCATAAGAACATATAATTATAGGGAAGGAAAAATTATAGTTAGGGGTGAAGTAAAAGCTGCTTGTAGATTATTAAGT
GTGTTCGTAGTATCGTTTCTGCTAGTTTGCAGGGTTTAGTTTTAGAGAGGAAGTTGGTGGTTGTTTATGCATAGTATATGACTTTGTACATTATTACGCC
AGCGTAGTTTGACAAGACATTAGTTGGATGGTTGGATGAGTACAAAACATAGATTGACTAATAGGAACTTATGTAAGATAGTTCTAAATTTTAAGCAGTC
AGGCCACTTGGAGCCAACTTTTGCAATAACCAATTGCTGATGATTTCCCATTTTATACTTGGAGCCAACTGAGGTTTGATTATGGGACCGTCATAAATTG
ATACCTTTTGTGTAATTCTTGTAGGATGAGAAAGATAAAAGAATTCAGGAATTAACAGCAGAACTTCGCACCAAGAAACGACTAACTGCAGCATACCGAG
AACAGCTCCTTAGTCTCATGAAAGATGTGGAAAGCCATAGTGAACATCTATCTGCAAAAGTTCAAGCTGTTCAGAGTATTCTTAAAGAACTTGAAGCTAA
AAGACAGGAGCTTTCCAATCATAGTGGACACCATAAGTAGGGTAAGCATTTTTTGTTTTTAATTGATATTTCTCTTTAAAGTTTTTAGCATATGTGCTGA
TATCGAATGCAACTCCATCTTTGTAAGTTTTGCAAAGCCTGCCTATTGCAAAGACGTAATGTCTGGGTTGGATGAATCTTGAAATTGCCCATTTTGCCAG
AACCTACTGGTGATGCCACTGGATTTCAATTGCCCTAGACATTTGCTCCGTATTAGGATAAACCGTATCATTTCCATGGGTGTGTATAATGGTGCTCTAT
AGGAAAGTATATAAACATTAATTAGTTTCTGATGCATCGTGAGGAATAAGTGGAATGGCTGATTATCAACATGAAACACAGTGCTATTCTTTATTTGTTT
GTTTGTTTTGGTTGAATATTTTGTTTTCAACTTCATCCTCGAAATATTTGTTGCCGTTAGCAGAGTTGCAAATAATGCTTTCGGTATCTTACATGTGTAA
AGACCTAGACATGTTTACCTTTTTTCAACAACTTCCACAACTACCTGAATCTTGATTTGACTTGCTCATCGTCTTGCAAATGCAGAAACTCTAGAGTTTA
TACCCCTGTCGAAAGTGATTATGATGGGACTGATTAGAGCCAAAGATGTCTAACTGAAGGCCATGAGTTGAAAGCTGATACAAGCTTGTGCTTTTGGCTG
CGCAGCGGCTACATTAAGTTTCATGCAGTCGGATGGGTGCAGCCACGAATCAATATAATAGAGAGGAAGATCTTGTCGGAGAGATTTTCACAACTTTTTC
GCGTAAATATGATGTGGGAATCTCTAGATTGAACCCCTGGTACATGATATCTGTATTTAGGAGCCTGTTCAGAAGTTGTACTAACCATATGCATTTGCTA
GGATGGTTGATTCTTGTTTCTTGGTTTCTTAAAGTGAGCTTTTGGAATGGAATTGAGGTTTCCATATTTTAGTTCCTCAACTATTATTTAATGAGAAAAG
TGGGCTTCGACCCACTTTGAATGTTGAGCTTCTCGTCGAAGATAAAAAGTACATACGAAGTTTTACCATGAGCGGCTTGTATCCATTGCACAAATATAGG
TTCCGTCGAGATTTGCTTCTTCCGATAGGGACAGAGCTATGGTGTATCAAAGAATGATCAATCAAACACTTTTCATCGAAAAATTATAATTTATACCACG
ATATATATGAAAAATGACACTTTATGTGGTTTAATGATATTGTCGTGGACACCCTTGCAACAACTAAGTGAGGCAGCCCAATGTTACCTTTTTCAAATAT
TTGTAAAAGAGCTCCTAAATTAGCATTTTGTGGTAGTAATGATTAATAAATTTGTAATTTATAATATAATTCAAAATTAGTGGTGCTTATTAAAATAATC
TTTAATTAGAAACCTACAACTAATTAGATTTCAAATACTTTGTCTTTGATTTTAAAATTTTTGAGATATTTATTCATACTAAAAATCAATTATTAATACT
ACCTAATTTGATTTTAAAAGTTCTGCTCACCCTTGATCAGTTTTTTTTTTAATTTATATAAAATTATGACTCCGTCAAAAATTGTCGAGCCTTAATTATT
CAAAACTCAAAAGAGTGTCAGTAAATTCATCCAAAAATAAAAATAAAATTGAGGAAGTGAAGTTTGATATTTGAAATCGGAAAAGGGTCATATTTGCCCT
TGTACTTTTAGAAAAGGGTCATATTCATCCTTCGTCATATTTTTTTTGATATATTTGCCCTTACCATCCAACTTTAGGTATATATTTATCCTTGAACAGC
TAAGTATTGTATCACCATTTTTATTAATCTACGTGGCGCCTACATGACACCTGCGTGGTTCCATGTGTATATTATTTATTACAATTAAAATTTTATTTTC
TATTTAGTGATACAATACTTAGCTGTTCAAGGATAAATATGTACCCAAAGTTGGATAGTAAAAACAAATATATCAAAAAAATATGACGAAAGATAAATAT
GACCCTTTGTAAGAGTACAAAAACAAACAAATATGACCCATTTCCAATTTGAAACAGTAGAAAGTGTCTAGTTACATAGAGTAGAGATTTATATTATACA
TTAATACCTTTGTTATAGTTCCTTTCTTCATGGAGAGGTAAAACATTATTATAAAATTTTTAGACATGGTTTTCTTGTTACTTTCCCTATTAAATTTATA
CTTCTTAATTACTTGTTCATTTTTTCCTTTTATGGTTGTCTCTAATTACTTGTTCATTTTGACAAATTACGAAAGAATAATTTTTTTTACCTATTATATC
CTCAATTAAATGATTAATTACTTTAAAATATGTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAATCATTTTTAGTTTCCATGAGCAACAATGTCTAAGATTTAATTTTAAAGAACTTCTTGTA
GAAAATAATGAAACTTTTCAGAATAACTTTTGTTGATAGTTATGTTAACTACACATTTTCTCGTAAGTAACCTTAATTTTTTGACAATATCTAATAAAAG
AATGAAAATTGTTCTTACAAATATTTAAAGGATGTTTTCTGCTAAAAATGATATTTTAAAGATTTAGTTTAAGTTTGGGATATAGTTAAATAATTTTTTC
TGCTAAAAATAATACTTTAATGATGTAATTTATGTTTGGAATTTAGTTAAAGGATATGTATGATCAAAAACTCACAATATGGATATTTGAATCTAAATTT
GTGTCTTTCCTTAAACTAATTAAGATAGTATAGTCCTCCTTAATGAAACTTTTCCATTTACTAAAAAAGGGAAAATAGTGATAATTAATAATACAACTAA
GAATTAGATAATATTAGCACAATAATAATGATAATAGAAGATGTAGAATTGTAGATGCTCCATATTAGGACGTTGCTATCATATTTAGAAGAAAGAAAAC
ACTTCATTTTCTATTACCTATCTATCATAAATGCTAGACCTTCATGCACTTCTATTTAGAGTTATATTATCGCTAATTTAAAATACGTCATGTCATATCT
AATCATGTTTCTCACTATTTTCTTGATTTGCCTTTACTTCTCCTTAAGTCTAACACTGGCAACTCTTGCACCCTCACCGAATCACATGTACACTTTTCCT
CTTCACATGTTCAAATCATTTTAGTCTGAATTCTTGCATCTTGTCTATAATAAAAATTACTGCCATATGCCCCATATATCTCAATTCATAATCTTGTCTT
TTATCCATCTATGCATCCTTATCTCTCAAAACGTGTAATTTTAACTGATCAAAAACATAATTGATCTAACAATTCCTTTACAAAAACATATTTTTAAATT
TTGATAACACATTCTTATCACCCCTCTCCAACGAACAATAAATTAAACGTCATCTCAAATGTTGGGTTCTAAAGGTATAAACAGAAAATGAAGGGTCTAC
TGAAAGGTTAATTATGAAAGGTTATCTTATTTCCAAAGAGTTGTAACCTTTATCCTTTGTTGACTATAAATAAAGAGGTTTTCTCTCATTTTCTACATCG
AATTCTTCACTCTTCTTGCATACATTTCTTACAAAACAAAATCGATCGATCGTGTCTGTGCGTGACTCATTGCTGTCATTTTGAGTTTGTTGAAATTTTT
GAAGTTTCAGACACCACCACTTCTTTAATGGTTAATCTTCATTGCTGTCATTTTGAGTTTGTTGAAATTTTTGAAGTTTCAGACACCACCACTTCTTTAA
TGGTTAATCCGTTTTATCTCCGGAGAAATTAATATGAAACATCAGATACTTAAGAGGATTAAATTTCTTAAGAGACACACAGCGGTTCTGTGGACTTGAA
TAGTTCTTTATATTTTTCTCTTTAACTTTTATTATTTTTAATTTGCTACTTTGAATACAGGAGATAACATACTATAAACTTCAAATCCTATATTCGTTTT
CGACTCCAAAAATATCATTGATATATTGAGGTAGATGCGTGTGAATCTGGTATTTCAAACCCCCACCAACAGCCATCGTCCACGAAAGGGGAGTAGAAAT
AAATAATGCCCAAATATTCATAGCCACTAATATTAACGGCAACCCAACAGCCACACAAAAGGGAAGAAAGTGGAGCCCTGCTAATACTGTGCTGTCTCAA
TACTCATCAAGTATTTTATACGCAAATCTTATTCTCTTATCCACACAAATCTCCCTCTTCCACTCATTTCATTGTCTATATTCTTCTTCTTTTCTACTTT
CTCCTCCCATTTTTCCCATTACAAACACTACATTTTTCTGTTTTTGATTGAAAGTTTTCATTTTTAGTATTTTGGACTAAATCACCTGCTTTGGGTTTTC
TTGATTTTTGCAGGGTTTTTCTTTTTTGTCTGACTGACCCTTTTGGGGGTATTTTCGAATCTTGAAAAGTTCTGAGTTCTCTTCATAAAAAGCTTCAAGA
CACTATTTTTTCAATTTTTCTTGTGTGAAACTCAAATGGGTATGTCTTGAATTAGTGTTAGGAGGCAAAGAGTTAAGTAATAAAAGATAAAAAGATGAAG
ATACAGTGTGATGTGTGTGAGAAAGCTCAAGCTACTGTGATTTGCTGTGCTGATGAGGCTGCTCTGTGTGCAAAATGTGATATTGAAGTTCATGCTGCTA
ATAAATTAGCAAGCAAGCACCAAAGGCTTCATCTTCAGTGCCTATCTAACAAGCTTCCTCCTTGTGATATTTGCCAAGTAAGGGAACTTCTTCTTTTTGT
TGCCCTGTTCATGGAATAATTTGTTTTTAGTCTAGATTGTGTTACTAATATTTCAATGTGGTAGTTGTGTTGCTCCTTGATTAATGGAAAGTTAACTTGT
GTACCCTCCCACTGGTTTGGGCTTTGGACTTTCAACATGGAAGTCTGAAGTGCCTTCTGGGTCAATCTCAGTGCACCGGACTTGCCTAGTGCTAATTACA
TCTTCCATGTGGTTTGCAAGCTATTATATAGGAACGGGGTTTGCAAGCTGTTAAATAAGAGCGGGGTTAGCCCCTATGCGCACTCAAGGGCAGCGGCTGC
GGGTTTCCTTGTCATAAAAAAAGTTGGAAAGTTAACTTGTGATGTTCCTTTTGATTAGACTCTGATTAGATTATTAATAATACCATTTCACATATAGTTA
ATTTTGTATTTCTATGTTTAGTATTAATCACTCTGTTTCTTTTAATTCGTGTGTCTTGTTACCTTTTTAGCTCCTGATCTTCAATTCCAACATGTGACAT
CTTTTAAGGTCATAGTATTTAAAGGGTGTAATGTTGCCCTCAAGTTTAAGACCACTCAAGTCTCTGGCCACTTAATTAAATTTCTTGATCTGTCAACCCG
AAACGCAAAATGAAAGCAGAGGGAGCAAAGGCAGATCTAGGATTTGAATCGTAGAAAAAGGTTGCACCACAAAAACAATGTGTTAAGTGGAAAATTGATC
CCGAGTTCTCTATTCGAATAACTTAGCATTCAACCAATCAAGTGCACCATTAGCTTTACAAAATACATACCTAAAATATCTAGTTTCACAGAGAGACCAT
GATTTACAAGCCCCAAAATTAGCATATAAATTTGCCACTGAGAGGCAGTATAGTATGATAACAAAGTTCTTGCTTTTCTAGCTAAAGATATAGGGGAGAG
GGAGGAATGGAGGCTTACCAGACTGCGCATCTTAAACCTCATGTCATAACCACTAAGTATCTCAAACAAGAAAGAAGTTATAGGTGTAGATAGGGCATAG
TGAAAATGATTTCATGGATATGGGATAGTTTCAGAGGGCTTTGGTTCAACATCAAAGGTAGTAAGTACAACATTGAATGTATGGTAGGCGCACGTCACAA
GTTTTACCTTGATGGGAAACTAAGCCTAGTGTTGTAGTGGAGAAAAGTAGATGTGTGGACTTGTTAACCACCGAATTTCAGAGTTGGAATCAATACTTTT
GTGATGGTATCAACCCTTTTGAAGACCCGAAAACTCAAAGATATTTCATGTCTATATTATTGCACATAGAATTTTTACCTTATATTTGAATTGGAATATG
CATATGTAAGTCAATTGATAATTAAAAGTGATTTTTCTGAACATGGTTATATCTGTCAAAATGATGTAAACATACCCGAGAAAAAAGATTGGAAGTTAAA
GATCAATGTCTTTTCCAGAAATTCTCTGACCATCTTTGCGAGACTTTTATATTTGCTTGCATTTAACTTGAACTGTTATGTATGCAGGATAAAGCAGCCT
TCATCTTCTGTGTTGAGGATAGAGCTCTCTTTTGCAAGGACTGTGACGAAGCAATTCATTCAGCCAGCAGCCTCGCTAAGAACCACCAACGCTTCTTAGC
CACTGGAATCCGTGTAGCCTTGAGCTCAAGCTGTAATAAGGAATCAGTAAAAAACCAACTGCAGCCACAACCACCTCAGCAGAATTCCCAACAAGTTGGC
TTGAAAATGCCTCCACAGCAGTTGTCCTGTATAACATCACCATCTTGGCCTGTCGATGATTTACTAGGATTTCCAGATTATGAGTCGAGTGACAAGGTAA
TACAAACTTATTCCTTTCATTTTGCAAGTATCCTATATTTTCTACCACTTGGGTTGGTGGCTGGCGGATTGACGTATAGAGGACTTCTCTAGATGAGAAG
CTATCGATTTTCTTGGTAATGCAGCTTATGCATAGCATTGAACTTGAATTTGAAACACTCAAATATGCAAAACGACTTCCTTAGATTCCTCGATACATAG
GGAGACATTTTATGACACCATTACATGTATATACGAAGTTGGCCTTGGGTATATTCCGGTGTCAGTCTAATATGTGAAACTGTGGTGACCATTGATTCAG
TATATTACGGTGTCATTGTCTGTTCATCTAATATGTAATGAATAACCTATATATTGGTTGTTTCAATCTAATACAGAAGGATCTACTTGAGCTTGGTGAA
TTTGAGTGGTTAGGGGGCATTGATCTCTTTGGTGAACAAACAGCAGCTGAAGTGCCCGAGCTATCAGTACCTCAGTCGAGCAATACAAATATTTACAGGA
CAACCAAATATCAAATGCCTTACAAGAAGTCCAGAATTGAAATCCCAGATGATGATGAGTATTTTACTGTCCCCGATCTTGGTTGAACTCCAACTTCAAG
AAGTTTCCAATTAAATGTGCATGTGTGCTTGTGTGTAGTACTTAATCAGTGCTCTCATACTGTCAACAGATATGTTCAGTAAGTAGAAAAAGTATTGTTC
TGCTTAAGATACTCCTTATCTTGCTTACTTTCGCAGTGCGCTCATATTGTCAACAGACATGTTCAGTAAGTAGAGGAAACACTATTCTGCTTAAGATATC
CTTTATCTTGCTTACATTTCGCCTCCTTGGTAGAATTGCATCAATTTCTTCTTCTTATAGCAATTTTATAAACATATTGATGCATTCTTGGACATGCTAT
GCATATTGCTACATAGTAAAATCTGGTTTTGTTACAAGAACTACTCCACAGTTGTGATTTTACCTTGTAGACTCTACCCTAGGAACAAATTTTCTTGGCA
ACAACTCCTCTATCTCTAGTTGTGCTACAGCAATTGAGTTAGTAATTTTGCGCTGGTTATGCTCTATATTTTTGCAACATTCATGTTCCAAGCGCCAGTT
TTCCTGGGAGCCTCTTGCAATCCTTCATCAATTACTGCACACAACAGTTGAAGCTATGATCGAACTCATGAACTCTTGGGCAAAATTCCCAACTTTACTA
GGATTTGATGACAAATGAAATAGGTGAAAACTATGTCTACTAGAATATAGAATTGGATAATGAAATACTAGTATGATGATGTAAAGGAGAAGTTACAAGG
AAGCTGCATATGAAGAAAGCTTAGTTTATTAAGTGTCTTGATGGACATTCATCACAACAAAACATTAAAATCCAAAACTGAAAAGGCTTCCTACTAGCTT
CAAAAAAACTCATAAAGGGGGGGAAATATATGAAGATGGAAAAAAGAAAAAAGATAACACGATGTTTCTATGCTCCTCCCTTGAGCAAAGTGAGGGCTTC
AGATGCAGTAGGCAAAGCTGGGATTGCTCCTTTCTTGGTTGTAGTGATGGCTCCACATGCACATGAAAACCTAAGTACTTCCTTCAACCTTGCTTCATCC
TGCATTTTTTTTTCCACACAAATTAGTATATTATACGACACGTTATCGCTTAAATTAGTTCTAAGAAAAGGTAATTATTTTACCTCGAGAATGGTTTGAT
CATCAACAATCTTGGTTAGAAGGGCACCAACAAAAGAATCACCAGCTCCAGTGGTGTCAACAGTCTTCACATGGAATCCTCCAACGGTTCCATGGAATTT
CTACACCCCAAAAAAGAACTAAGTCAGATCAAATTATCAAAACCAATTACACAATATTCTCTATTCTAATTTAAAAAATAAACGCCTTTATTAGGCATGA
GGGGACACACTAATTTAGTGTTGTAGGTCCTCCTTGGCTTACTTTAATTACAAATTAAACAACAATGGTTCGTCTAAGTTGTTCTTACCTACCACTTTAC
AGCTATCTACTAGAGAATTCAATAATAAGCAATTAAATAAAATAGGAACGATTACGAGTATAAAAATTATTTAAAAAACGAAATACCAAAAGATAGAATA
TACCTTGGTGTAGTAATTGCAACCCTTTTCACCAAGAGTGACCAAGAGTAGCTTCAAGTTAGGATGCCACAAGGACATGGCGGATTCATCATCAATCTTG
TTGCTTCCAGTGAGGAATTCGAGCTCCACATCGCTGACCTTGATCACATCAGCAGAGTCCCATATGCTCTTGATTTGCTTCTTGGCCTCTTCTGCTGAAG
GCCACAACGGCAAACGAAGGTTTGGGTCATAAGAGAGCAATGCCCCTGCCTCCTTTGCTACTTCCATTGCCTTCATATGTGCTGCTCTACATGGCTCCAC
GATCAAACTAATTGATCCATAGTGGAACACCTTAGCCTATATACACAAAATTCACAAATTAAACTATAATCCATACAAAAATTAATTAGTTTGTGAGCTA
CAATTAATGACTGACTCCATGATAATGACACCTGACATGAATTTAACTATACTTCCCCACCTACCCCTTTTGGCTCCACTCGATTTCGATACACTCTATA
CTATTCCTCCTAGTATGTATCGTCATTATACACTTTTTTCCGTGAAGCTAGAATTTTCGCTTGATTCAAAATATGAAAAAATAAACACATAAACTACCCA
TTTGAATGCAAACAAATCAATTTGGTTTTGTAGCAAATATCATGTGAACTAAAAATCTACAATATAAGAGGCAAGTGGGAACAAAAGAGAAAGAGACAAA
GCATAGGTTTTTGAGATTTCAACACATGAAAGGCAGGAAAAGTTGTGTTAAGCTAACAGACAACACTCACCCACTCTTCAAGAAAAATCCGTGTCACTTA
CACCTTCATCTTAATTGCATGCAACACAATAATTCCTAATTTTATCTCTAACTAAAATCCTAAGTGACAAAATTCTAGCTGTCTCTCTTTAAACAAACAA
AATTTTAAAAAAGTGGATAGGGATCACCTTTTACTTACAAAAGCGAAATCGCTATTGAAATGGATGTGTGGGCATACTAAGCGATTCCGGATCGGATCCA
AAAAAATGATACGTTGTTAATTAGAAAAATGACAGTAAAGTCGAAAAAAAAAAAGACACCAAACCAACCCACCTAAAAATAAAAATAAGTTTTACGTCTT
TTTCAATTTATTAATTAATTACTACAGTTGAGTCAAAAACAAACAACAACAAACTCACCAGCTTCTTCGTGATCACAAAACTACGAAATTGCACGTGAGA
AACACGCACAGATCATCAAATCCAATGCGAGTTGGGAAGAAAAAAACAGATTAAATAACTTACAGATCTAATAAGATCAAGATTCAACTCAGCGGGCGTG
AGCAACATATCGGCACTGGGATTTCTGTAAAACATAAACTCACGCTCTCCGTCGGCGCGTAGCGTCACGAACGCCAAAGCCGTCCTGGCGCCCTTGTCAA
AATTAATTCCTTCGGCTTGTACGCCGTTCGTTTTCAGAATCCCGGCGAGCATGTGACCGAACTCATCGTCGCCGAGTTTCCCGACGAACGCCGACTTCCC
TCCGAGCCTCGTCACCGCGATAGCGACGTTCGCCGGTGCACCGCCGGGAGCTTTCAAAAATCCGGGAGCCTCGGCAAGGGATACGCCGGAGACTGTCGGA
ACGAAATCGATCAACATCTCACCGAAACTGACGATCAAACCAGAAGAAGAAGCACCGTTAACTGCCATGGCTACGATGAATAGAGAAAATATATGTATCT
ATAGGTGTATCTATAGATTTTTATATAGTATAACAGAGAGAAGAAGAGGAGGATAAGTGAAAATTATAAGGAGCTTTATATAGAAGGTGGTTGAAGAGTT
CTATGAAGAAGAGAAAACTATTTAATTACGCATAGAGATTTATTTTATTTTATTATTAAAAAAACTATTGTAGTAGGAGTAATAATTATCCAAAAAAAAA
TGCTAATAGTAATTATTATTAATCTTAAATGGCACGTCACTTTTATGTGGATGTAGGACCTTAATTATCTTGATTAAAGACAGAAAAATATCCCACAAAA
AAAAGTGAAGATTTTAGAAAAAATAGATAAATATTTTATACGATTTTTAGTTAAACTAGTGCTAAAAAATAAAATAAAAGGGGGAGAGAAGGAAAATCTT
GAAGAACTTTGTTGCTAATTTTTATTTTGTTGACTTGTTATTAGTTAATGGCAAAAATTATGCTAAATAATCTCCTAATTATTCAACTAATAACTAATCT
TCTAGGATCTAGGTGTTAAATCATTCTAAAAGTTGAACAATTTGAAGTCTAATTAATAATTAATTGACTAGATCATTGATGGTTTAGTTATTTTTGGTTT
TAATAATATATTGTTTTGATTTCTTTATTAATTGATTGAGTTTTTTTTTTTAGTATAATTAGTGAAAAGATAAAAGTATGAATTTCAGTGGGAGTGAACA
TTGGGACAAAAGACCGGTAAAGAATCTAATTGGTAGAAGAAGGATTAGTATTTAATACAAATGGGATTAGGATTCAACTAAGTTAACAATTAGTACTCCT
TATCCTATTTCAATTGTGGCTTAAGTTTTCTTAAGCTCATTAAAAATAATTAAAAGATGTTGGTAAAGTAGCAGAATTATTGTTTTATGATTAGTCATAA
GTTCGAGTAAGATATAGTCTCTTACAAAAATATAAAGTATAGTTGTGTATAATAGATTATTTTAATTCAGATTTCCTCCTAAATATAGCATAAAATGAAA
AGCTTAATACATCATATTACTTTTTAATAATAATAACTACGTGATACAATTTATTTAAATTATTCCTATTATCACCATATTTACTAATTTTAATCCTGAA
TTCCTAAAACAATAATAATTTCTAGATAATTTTTAATATTATTATAGAGATAAATGTTGAATTTTTTTTTTAATTACGTGGAAAACCTAGTTTGTTTAGA
ATTTGATATTTGTTAATTTATTTAATTTATCTCTAAAAAATGTTGTAGTAAAAATTATATATATTTAAAATTTCTATCCTAAGTATATTTGAGTTAAAAT
TTTATAGAAAAAATATTTTTAATTTTATAGTCAAAGTATATCTGATTTATACAATTATAAGTAGAGGTATTTTTAGTAACTTTTAATGTGAAAAAAGAGT
GGAAATTATACTTTCTCTATTTCTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAATAGTTCAAACTTGAGATATTTAGCTAAGCGTGGAGAACTAGTAATTTCATAGTGATGTAGCTTAAA
GTTTATTAGTATTTTATTGTTTTCTCCTTTTTATCATGGCTTATGGATAATCCACTATATATTGGCTTTTAACTTAATTATTTTCTAGTTGGTAACAAAA
ATGCATGCATTTCTAAAAGATACTATTTCCTCTGTCCCGTTTACGAAAGAGTTTAACTCGGTATAGAGTTTTAGAAAGAAATAAAAATTTTAAAAATTAT
AATTTAGAATAAATGATAAAAATTTGTGTGGCTATAAATTATTTTATTAATAATGAAATATATTTTTTATAATTAAATTATTACTTAATATAGAAAATGT
ATCATTCTTTTAAAAGTTAACTTAAAAAAAATAAGTTATATAAATTGAGACAGACAAAAAGTAATAGAGCAGTTGTTTTTTCAACATTAACCACTATTTT
CTCTTGTTAGCTAATAATGCAAGCAGCTGCAATATCATTGTCTTGTCCAAATAATCTAGAAAAAAAGTTACTCTCTATGTTTCACGAATAACGATCTAAT
TTGATTTAACACGGAATTTAAAAAATAAAGAAGATTTTTGATCATGTGATTCTAAGTTAAAGATATGTAAAATATATAAAATTAGCCTTTAATCTTATGC
TTAATATGCCACGTAAAGATATTACCAAAAAAAAAGAAGAAAGATATCATTTTTTTAAAACAGACTAAAAAGAAAAGAAAGTCATTTTTTTCAAACGGAG
ATAGTACAAAATACGAGTGATATATCTCTAGTTAAATTGGCCATTTGCATGAAAAAGAGACTTCTACTTGTGTATAGTATACATTATTTCAAGAACTTTA
ACATTATTTAAGTGTAACTTGATATCACAATGTCTGGGATTTTCACATTATAAATAAGGAAGTTTCTTAAGATAAAAATATCTCAAGTAACACTAAGTCT
TCCCAAAAAAAAAAAATGGCTACTTCACATTGGTTTATGTTTTTCTTGTCAAGTGTCTTGTCTTTATTTGCTTCTTCTACTTGTAATTCTGTACCATTTG
TGGGTTCTAATCAACTCAAGTTTTGGAAAGAAAATGTTGTCAATGAAATGCCTCCATCTCTTGTTTCTAAATTATCTCCAATGAACATGATTGACTCTCA
ATATTACACTTCATTAGTGTCCAAAAAGGCATTTTCTTTTGATACTCAAAGTTGTTTGCTTGCTGATATATTTTGTACTTCTGAGACTAATGCCCAAACA
TCCAAAATCACCAATCTAGATTCTAAGATATTCTACACAACCAGAACCCCTGATCAAGCTAAAGTCTATGCTAAACTCCCAAATCAAGCCAAAGTTTATC
CCTCCAAAATTCCTAATCAAGCTAAGGTCTACACAACCAAAATCCCTAATCTAGATTCTAAGATATTCTACGCGACCAGAACCCCTGATCAAGCCAAGGT
CTATCCAGCTAATCTTCCCGAACAAGCTAAGGTCTATACATCAAAAATTTATGCAACTTCACACTCTCATAGTCATCATCTTGGAGAAGTCTCTTTCTTC
AGAGTCTCTACCCTCAAACCTGGAAACACAGTCCATCTAGACAACTTAGTGAACCCGTTCCCTCATCGCTCATTTCTTCCATCACAAATTGCCTCAAAGA
TCTCCATTAACTCAAACCATCTCCAACACTTATTCCCTCAAACTTTCACTTCACCATACACAAAAGATACCACAAAAACTACCATCCTCAATTGCAATGC
ACCTACTCTAAAAGGAGAAGTTAAAACATGCGCGAAATCCTTGGAAGAAATGATAGAGTTCTCAAAGAGAAGCTTGAAACAGAACCACCTAATTTCATTG
ACAACAGAAAGCATACAAGGGTCAGGACAGAAACTAAAAATTGAGAAATTTCATAAAATCAATTCCCAAAGGAGTGTCTCATGCCATGAGATATTCCTTC
CTTTTGCTACATACTTTTGTCATTTGCTATCTTCAACTAACATTTACGCGGTGGAGCTAGTTGATTTAAACACTAATGTTCATGTTAATAAAGCTATGGT
TGTTTGTCATATGGATACTTCTTCTTGGCCAGCTGATCATCCAGTTTTCAAAAAATTGAATTTTTCACCTGGAAATGGAGAGGTTTGTCATTGGATGTCA
CAAGCTGATCTTGTTTGGGTTGGAGATGATGCGCATGCATAAAATAATTTTTTAAAAAAAGTCTACTTATGTTAATTAAGCTTTGAGTTTAATTGTAAAA
ATGGATTGTCTTTTTTCTTGTTTCTATGTGTTTAGGAATAGTAAGGTATTGTAATTATGGGGAAAAAAGTCCAAATCCTTACTTTCCCTTTCTTGTGTGA
AGTGTGAATTGTGATGGTTTTTGGTCTTTTTATGTGTATTTTAATAACTTGCAGTTAATACTCCTATTCTAAGTTACTTGGACTTGAGTACGGGTGTCGA
TCAAGAGATCGGATTCTTTATGATCTAGCTTTTAAGATTCAGGAATATGGATATCGATGTGGGTATTCGTCTAAAAATAATTAAAATATCTAAAAATAGA
ATTATAAAACCTAAACTATGAGATATTTTATGGAGAACTTGAGGAGAATCCTGCGAGGAGATTAGAGAAAAAGGAGTGACATAGAAATTTTTATATAAAG
GGTATCACATTTTCTTCAATTTCATCTTAGCTTTTGTATTGATTATAGAAAATATTGAAACTGTTTAGACTTTTGCCCCCATCGATTTTGGTCAAATTAC
CCAAAATTGATTGACCAAAATAAACACTGATCTCACACCTACACCCATGTTGTGTCGACACGGGTGCGGCACAATCCAAGCAACTTAGCTCCTATTACAT
TTAAGTTAAGTTTTCTGCAAAAGCAGTACAATAAAAAATTATTTGATATTTATTACATTTTGATATTTCGTATTAGAGGCAGTGGTGAATCTACATAGAG
TTGAAAGTATTTATCCGAACTCTTGAATCGAAAAATTATACAATGATATAGAATCAAATGTATATTTTATGTCCATATATTCTATATTGAACCCCTCAAC
ACAAGTAAGAGGGCTTGGGCCGTTATAGGGGTTCAAAAACTAGTTAGCACGTGAATTCAGATACCGTTAGCAACATTTTTCAATGTTTTAGCTTGAAATT
TGCTACGAACCATTTGTCAGCATTATTTAACATGTTATTTAAACCTCTCTATAAAAATCCAAACTCCGCCACCCTCTTAAAGAAAAAAGATATTTTGAGG
GACATGACACTCAATTTTCTCTAGTCGATAATCTTAGGGCCCGTTTGGATGGGCTTAATAAAAGCAGCTTTAAAAAAGTACTTTTGAAAGTGCTGAAACT
TATTTTTAAAATAAGCAGTTATGCGTTTGGATAAAAGTGCTAAAGTTGTTATGCCAAACGTGAAAAGGGAAAAATAGAAGAAAGAGATGTTAGGGTTATA
TGGGTAATTTGGAGATTGTATAAAAATATTAAAGGAAAAAACATTAAAATATGGTCAACTTAAAACAGCTTATAAGCTAAAAAAAAAAGCACCACTACCC
CAGCTTTTAACTTTTGGCTTAAAATAAGTTTTTTTTAACTTAAAAATAAGCTATTTTGAGTATAGTATGGCCAAATAGTTAAATAAGTCAAAAACCAGCT
TTTAAGTCAGTTTGACCAGCTTTTAAGCTGAGCCAAACAGGCTCTTAGGGCCCGTTTGGATGGGCTTAATAAAAGCAGCTTTAAAAAAGTACTTTTAAAA
GTGCTGAAACTTATTTTTAAAATAAGCAGTTATGCGTTTGGATAAAAGTGCTGAAGTTGTTATGCCAAACGTGAAAAGGGAAAAATAGAAGAAAGAGATG
TTAGGGTTATATGGGTAATTTGGAGATTGTATAAAAATATTAAGCGAAAAAACATAAAAATATGGTCAACTTAAAACAGCTTATAAGCTAAAAAAAAGAA
AGCACCCCTACCCCTACCCCAGCTTTTAACTTTTGGCTTAAAATAAGTTTTTTTAACTTAAAATAAGCTATTTTGAGTATTGCCAAACAGTTAAATAAAT
CAAAAACCAGCTTTTAAGTCAGTTTGACCAGCTTTTAAGCTGAGCCAAACAAGCTCTTATAACCTCATATAAAAATGCCTAAATAAGCTAAACTTCACAC
GTATGAAGTTATTTTAAAGTGTTTAAAGTGCAAGAAATTGATATTTTGGCTATATTTTAAATACTCGCCCGGATATGGATATCCTATTATGGGCCGGATA
AGGGTGTATCTGACCCATGAGAAATTCGGGTCAAAACTTCTGATAGCACCAAAATATCTGAAGCAGGGAGAAGAAGCACAAAATTGACTTACAGCTATGG
GGCTCTCAGCTTCTAAGAGAGTTAGCAATTCACTCCAAAATTCATCCGAATTCAACTCGGCATGTGATTCAGTCTATGATGATTGTCTCTCCCTATCACA
GCACGCTTTCGCCGGAGTGAAACCCTACCAGCTTTTCTCCGCCGTGGAACGCCTGCACGCTTCTCTCTCTCCCTCCGTACCTCTCATAAAAAATTGGGTT
AAATCGCCTCCGACCCGATTACAGGTCGATAAGGCCTTCAAAATCGTGTCAACGCGCCGATCCGGCGAAAAGGAGAGTGAAATTGTGCTTGGGAACGAGG
AATTCAAGGAGTTCTCAGTGGAGGTATTTTCGGACGCTGTCGTTTCGTGTGCAGGGAAAGAGCTTCTAAAGCGGGTTCCGGTTGGTGCTTTGGGGATCGC
TGGCGTTGGTGCGGTGGTGAAGCCTGGGAAAGAATTAATTGCGGCGGCGATTGGTGCTTACGCGCTCGGTGTTGCAACATCGGTATACGTCAGCTTGGCT
TAAACGTATTTTTTTTGTTTTTTTTTAAAATTACAAAAATGAATAAAAGTTTTTACAAGTTTGGTTAAGCCCAAAAGTACAAATTAGTCATGTTTTAAAT
TATTATAACCCCTAATAAGAGACTGAAAGCAAGTAGAATAATTGTAATTAGATGATTAACAGTCTTTATCCACATTTATATAATTTGTATAAATTATTTT
TTTTTTATAAAAAAAAACAGATTTGCTAAAGTGTTTGCTTAACATTGCTAGTATTAGTTGTTGATCACGTAGTGTCATGTTTTTAATTTTTACTCTCTTT
TGTTGATTCATAGCTCTGGTATTTAGGGCTATTCAAAATCAAATTAAAATTGATAATTTGAAACCAAAAAAAGAATATTGGTTTAGCGGATCTTCTTGAT
AAGGTTTTGACTATTTTAGTATTGACTTATGGATGCTTAACGAGTTAATTGATAATTTAATAGCAAATTAATAAATTATATTTTAATCATTTGGTATATA
AAGTTCTTAACTTAAAATTTAATTTTATAAATTTTTATTTTTGGTTGTCACAAACTTTCGATTATTGTACGATGTCTGTGTTTATTTTGAGCAAAATTTA
ATATATCTACTCAGGTGTATGGTTATTTGGTTTGTCATCTTATTTCTAAGAAATTTCAAAAAAAAACTTTGGTATTATAGCTTAACGATTCACTCAATAA
CGATCAATAATAACACCAATAATGAATAAATATATATCTTAATAATTTAGTATATTGATAATCAAGAAGTTATACTAATAAACCAAAAAAAAAAGCGAAC
ATAAGATACACATATCCATAGTAATGTATGATAGTGACCATAAATTAGTTGAAGTTTACCTTACTTGCGCTTAAATATCTAACTTTATTTTGATACGTCT
ATATCGATATTTATATAATTTTAAATCTAATTATCTATTATATAATATGTAGTTGAGATTTTAAATATAGATTGAAAGGGTTATACATCATTTTCTTAGA
ACGATTAAATTTGTATCGTCTTTTTCTCATCCCAATTCAACACGTGGAATCAAAAGAGGGATTAGAAGGATCTGGATTAATAATACAAAAGATAATATAT
AGTGTGTTGGGATAATTTAGAACCACATAAATTGGATCATCTGGACCATGAAAAACAATAATTCAAGAATGATCTTGATCGTTTATAGCCAATGTACTAA
GTATGAAAAACACCAATATTGAAAGTGAAAGTGACACTTTAATCCACCAATCTCAAATCTTCACTTGTCACCCCACAAAACAACAATAATTTGAACTCCC
AACCTCCCAATTTATTGTTGTGTTAAAAGTTGGTGTGAATATAAAATAAAAAGAAAAAAAAAACGAATGGTACATGAAAAATAAATTTTATAATCTTATC
GATTATGAATTTATAATATGTATATCGATTATGAAATAAAAACATTATATTTCGAACAGACATTTTTCACAAACTCCAAATTGCGGCTATATAAATATAG
AGGCATTGCCTTAAACTTTGATTATTTAATTTTTTGCACTTCTTTCTTCTGTATATAATTCTACAAATAAAAATTGAGTTTTTGTGTGATTAATAAATGT
CTTCAAGTTTTTTGTGTATGAGTTATGATATTTCAATCATATATCTTTGGAGAAAGAAAATATGCTCTTCAAATACACAAGGGAAAAGGGTCTGATATAC
TCCTCAACTTTATCATTTAGAGCTGATATACACCTTGTTATGAAAGTTGCTCATATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAATCACATATAACTAGTAAAAATATGTATATAGACGAAA
CTAAATATTGTTGATGTCAAATATCAAGAGTGAAAAATTGAGAGGAACTTTTTAAGTATGATTTTAGTACTTCTGTGAGAAATTTAAACATTTAACTTTT
CAGCCGGTAATTCTTATTTATATTAGTAAAGGATTGTCTCAAGTTAACAAAATACTATCCATTTAATTCAATACATTACCTTGGCTCTTGTTATAAAAAA
TCTTATTGAAAGATAACAAAATTTAGATGGTTTAATTTTATTTTTTTTAGAAAATGTATAAGTACTTTCAACCTATGTTCGAAATTTTAGAGACATATTT
ATACTATATTAAGGTCCTATTACCCTCTTAAACTTATTTCATAAATAATTTTCTATCTTTTTTCGGCCTACGTGACACTTGCTTGAAAAAAAATGACAAC
ACAAGCTGGGCTCACAAAATAGTGTCATCTAGGCCGAAAAGAAATAGAAAATTATTTATAAAATAAGTTTAGGAAGTAATAGGACCTTATATAGTATAAA
TGTGTCTCTAAGATTTCGGGCATAGGTTGGGGAGTACTTGTGCGTTTTCCTTTTTTCTTAAGAAAGTTAGGTATTATAAACAGTGAAGTACACCAATAGT
GAACTCCTATAGTAATTACATCAAAAGTATAGAGGGTTTATAAAAAAGAATCTGAACACCTATTTTCCTCATAAACTATCTAAGAATATGGTGATGTCCC
TCTGAATTCTAGGGAATAGAATGGATACACCAAAAGTAAAAGTCACTAAAAAAGTTCATTTTAATGCTTTGATCAATACAGAGAATTTCACTGTGGTCAT
ACAAAACCTCATCCATTTTATTCAGGTGTTGCCAAACCCCATCTCCCTGAGTGTGCTCCACAAATATTCCCAATTCAAATGATCATAAGTTTTTCTCTGT
GTTGGTTTAATTCAAAATTTCAAAACTTAAAACAATTAAGCTTCTATAATATCACAACTTAGAAACTTTGTAAGTTTATTTATTTACATTACTAATTTAA
TTTAAAGTTTGATAATTTAAAACGTAACTGAGAAGTGGTATTGTTTTTAACACAAAATGAATTTAAAAATTGAATAAAATTAATCATTATTAACAAAATT
GAATAAAGGGTATGAAATATTAACAAAAATTCCAAAAACGGTATATAAAATTTTATATTAACCAAAACGGCAAAATTGCTGGACCAACAGCGATTTCCTC
CATCGGAAAAAGCAAAATCGCTGCTACTGCAGCGATTTTGCAAAAAGCAACTTTTTTTTAAAAAAAATAATTCAAATCGCTATCTAGGCAGTGATTTTCA
TTTTATTTTTTTTGAAAATCGCTGCCTAGGTATAGCAATTTGAATTTTTTCTTTAAAAAATTTACATTTTGCAAAATCGCTGCAGTAGCAGTGATTTGCT
TTTTTCGGTGGAGGAAATTGTTGTTGTTCCAGCGATTTTACCGATTTGATTAATGTAAAATTTTATATCCCGTTTTAAAATTTTTATTAATATTTTATAC
TCTTTCGACTCCGGACTCGAAAAAAGTCTTACAATGTATTGCACTTTGATTTTTTTACAAATGAAACTCAAAACTAAACTCTAACATAATATGATAAAAT
TATAAATATTTATATGTGAAACTCCGATGAAATTTTAATTCAAACGCTAAGTATATCCTTATCTTTTAAGAACCTAATTTTTTGAGTTCTTAGTTGTAGG
GGTGTGCATCGGTCGGTTCGGTTCGGTTTTACATATAATCGGTTCAGTTTATTGGTTTTCGGTTTTAAAATATGCTAACCCAATAACAAACCAATAAGAC
ATTTTTTATCGGTTTATCGGTTTTTGATGTTATCGGTTCGGTTTCGGTTAACCCAATAAGAAAATGTCGATCAAATAATATATAATAGTACGTATGTTAT
AATTACATGTTACCAACTTACCGCCAAAACATAATAGAAAACTTTGAATGTTGATTAAATTACTAACATTCACAAACTTGCAAAAGCTATCGCCTACAAT
TACGAACTAGAATTAAAACTAAAATAAAATATTTCAATGAGACAATCTTAAACAGTTGCTTGATCCACCGGATAATCAACAAAGTTCTCACCAATTTCCT
AACAAAAAAATCATATAGCCTAAAAAGCTAATATTGAATCTATTTATGTATTAAATTATGTATATTTAATATTGAGGAATGGTAAAGTAGTAAATAACTA
TCGTCTTATTGGGTTATCGGTTTACCCAATAATCCAATAGGAAAAACCGAAACCGACCCAATAACCCAATAATTATTTTTTCTAAACCCATTAAAACCCA
ATAATCCAATAACATTTTATCAGTTCGGTTTACTGATCGGTTCGATTTTTGCACACCCCTACTTAGTTGTAGAACCATGTGCTAAACATTTACAGCATCT
TAAAGTGTGCCTAGAATATGTACAAAGTAATTAATGCATTATAATTTTGTTATTCATTATTTGGTTAGCGTAACTTTTCTACTTCAAGATCAAATCTTCT
CATTAAGTACTCAAATATCATTGTAAGTGGTGTTATAAAAATAAAATGAAAATACACTAATTAGCACCTCAACTTTGGGATGATCTTAAATTATATACAA
TAAAAGAAACAAACATGGCCATGTTTTATGTACATTAAAAATGGTCAAAAAAGTTATAAGAAAATATACACTAATTATATATTGTTGTACACTCAAAAAG
TTGAATATAACTTCTATATAAATGAGTTATTATGATACACTCAAAAGGCTGAATATTGCTTAACTAAAGTATACACCATATATTTATTAAACTATTTTTT
TTGTTAGTGGGCTAAATTAAGAAAGAAGGAAAAGGAGGAGAAGTTGTTAACAAAATATTTTTGATATATTATTCGCTCGAAATGATTCACGTAAAAAGGG
AAATGAAGAAGCAATTAATAGCAAAAGTGGAAATTAAAGGTTTAATAAAGTTGAACCAATCGCATCAAAGTTTATGAGCATATATCCCTAGCTATTAAAA
TAAATTTGTTTACAAAAATACTTATCAGTATACACTCTGTATAAAATTGTTACACCATACATATATATGTACGTATAAATCCCATATTTCTTAGGAGTAA
CTAATTAAACCACAAAATATAAATGTGGTTAATTACATTTATTGGTAAAAATGAATATTTTATATGTATAAATTGAGCTTTTCTTCCACTAAAAATAGTA
TTTTTATGAGTCAAACATCAAAAGTAAAGGTCTTCATCGATCCATAATTAGGCATAATCACATATGCCATAGAAACAATATCCACCTGTCATGCACCTAT
TATTGCAATATCCACAATGCCTTTTGTCATAAGACAAATTCACACATTGGCCTCTACAACAAGTCTCTGTGAATGGACATTTTTTCTTGCAAGCACCACA
ATTGTGATCATCGTAACCTAGATCCATGCATTTGTTGTTACAACATGTCGAATTTCGACCACCTTCCGACACGTGGCATATTTCATTGTCTTTATGGCAA
TGATCCGCGGCCCTAGGGTTCTTGATTTCTTGTTGAGCTAGAAATCTACTTACTTTCACCCTCTTCGTCACTTCCACGTCTGAAACTTTTACATCCTCAT
GAAATTCAGGGTTGTTTGATTTGTGTTGCATGGTGAGTAGAGATATGGTGAGACCCATCGCAATGGCTATAATAACTATGACTTTGAACAACTTCATCAT
TTTCGAATGTGATACTGATTGATGATATTAAATGGTATGATGATGAAAATCGATCTTGGTTTTCGTTATTGACTAGGAGGAGGAGGGGAGGAGAAGTGTT
CTTTTTTTTTTGGTTTTGTGAAATGATGTAAATGGGAGACATATATATATATATATATAGAAGGGTTTTATATTTTTTTAATAGAGTGGGAAAATGGAAG
AGTTGACTTTAGAAAGAAAGGGAGAAATGTGAAGAAGAAGCAAAAAATTAAATAGATTGACTTAATTATGAAAGAAATTAAATTAATCAATAATTACATA
TATTTGCTGTTTAATTAAATGGTGGAGTTATTGTGAAGAAAATATTTAAATATATTAATTAGAGTATGTTAATTTCAAGTAAAAACATAGTTATTTAGGC
ATTAATGTAGTCTTTAATTAGAAATCACCACTTCAATTAGCGTTGACTTGAGGTTTAATTTGCTTGAAATGTTTATAAAGTGGCAAAAAGAATATTACTC
GTTTACGTATATGATTGAGGAGTGAAGTTCACATTTTATTTTATTTTTGAACATTTAAAATTCTATGGGCACAAAAGTAAAGGAAAAGCCTTTGTTTCTT
GGCTATTGTATGAACCAAGAAAAGTATTTATTTGATTACAAAATATTTGACTTTTAGGACCTTTTTGAATATCAAAAATAAAATAAAATTAGAACATCTT
AGTAATCAAGGATTTGAAAAGAAACTAAAGCAAAATGCATGCATTTATTGAGTGTAGCTTCTAATATTTTGAGTTTTGACTCCAAAGTAATCTTTACACC
ATAATAACAAAAATTATGTCTGAATCAATTTGTTCGTATCTTAATTATGTCACAGTCGTGTACGTAATTACAGTTTTAATTTGGTGGCATGCCAAATGTA
GGGGTTACATATATTTGGAGTGAAGTTGAATTCTAAAAAAGTTCATTGAATTCGAACAATTGATGAACATGGGCAAGCCAAAAAAAATTGTTTTGGCCAT
GTTCTAGTTATAGTATGTCTTCTCCCAATTAATTAGGATATATTTATTTACGCACTTAACTTAAAGTTTGGATATTTAATTTTATGTTAACACAAACTTT
ACATCATATGTCATTTTCCATATAATGGAATAACCTTTTTTGGTTTATGGTCACACTCCTAAATTCGTGTCCTTAAGCATATCAAATATATAAAGTTTAT
GTAGAACTTAAAACTTATAATTTGAATATTGTAACACTTGATACATATTTGCAACATAATTGTATGTAGAAACAATCCTTTTATCTTGACTAGGTAAGAT
AAAGTTTGTATATACTGTATCGATCAGAAATTACATTGAATATGTTTTTTTTTTTCTGTTGCTAATCACTTGTCTATTTTTAAATTGGCACACTTGTTAA
GAAAATAACTAATGACATAATGAGTTTACCATTTTACTCTTATTAATTATAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTCACAAACTCACCCCTCTAAAAATATCTTTCCTCAAATTCCG
AAAACATCGGTAAACCATTAATTTCCATAATCACAAACCCTTATAATCCCTTAATCCAAAATTAACCTAAACAATTGCCATGAAAAAAATTTAAAAAATA
AAATCCATAATCATGGCAATGAACATGACAAATTGTTGTCCTCTTTTCTTCATAATTGTTTTAATAATATTTCTTTCTTCACCTCAATATTCAGATGCTG
CTGAACAACAAACAAGTTTCGTAAATAAAATGTTTCCCACAATTGAGGTAACATTAGCCAACGACAACAATTTCTCAATCTATTACATGTGCAGAGATTT
CGATACAATTAATGCCTTAACAAAGCTATCTCCAGGTGATAATTACAAATTTAACATCTCACAAATTGCTTTCCCTATGAGATGGTGTTATTTGTACATT
AATCCTCGTACCCATGGATTCTTTTGGGCTTATAATGTGAGATCCAAATGTACAAAATGTTTTTGGAGTGTTACAAATTTTCCTTATTTATATAAAGCGG
ATCGAGTTAGGTGGGAACGTGAGAAGCTTTTTGTTCCCGTTGGGTTCAATATCAATGATTATTTGATAAAGAATATTTGAGACCAGAGTCTATCAGAAGG
ATAGGGATAAGATCTGCGTCCCCGTTACGTTAAAAGCAAAACTATAGAGGGGAGAAAGGAGAGGGATATGAAAATGTTTGGAATTTAAGATTCCAAGGTT
TATGAAGAATTCTTTGATGTGAATTGAGAATTTGAAATTTGTAGACTATATTATGGTCATTTGTAAAGTGTCATTAAAATGAAATGATATTCATTTAACT
CCTTGAAGCTTATACATGTTCATGTTGTTAATTTGATATAACTAAATGTTTGTTACGCGTCAATTGTCTCTTAATGCTAAGAAGAGAAATACTATTGAAT
TTATTGGTTAAATAGACTTCCCGTCCTAATTGAACGTTATATAACAATACAAATGTTTAAGTCTCTATTATTGATTATACTTTTGAAAACTTTTTCAATA
TAGTTAATTATTAAATAAACTATCAAAATTGTTCTAAAAGTGTCTTGAAATAATTTCAAGACTTCACTTCATTGAATATAACAATTAAAGATTTTTTTTT
ACTTATATATTATTTCATAATAATTTTAATTACAAAAACCAACGATTTTTACTTTAGAAGACATTCAAATTTAAGATACTATATTTTTAGATTTAATTAT
TAGATAATCTAATTAGTTTCAACTTGAAATGTTTGATAAATTATCTCAAAAAATTGAAGACAATTTTAAAAAATCAATATAAGTGAACTAGACAAATTAA
AAAAATAAAAAAGTAGCTATAAATTTAATTGTGTATAATTAATTACAATTACATCAATAATAAAGTTTTTAAAGTATGTGAATAAATACTCCATTTGTTC
CCGTTTATATATCGTCCTTACTAAAAATAAATGGTCCTTGAATATTAGTTTCACGAATAAAATTGTGTCACATGTCCCTATTTAATCTTTCGTTATAGTG
AAGAACATATATGTCCTAATTTTTGAACGATAGAAGCACATATGTCCCAAAAGTGTGACAGATGATACGAGCATACCGTTTACAATAGTTTAGGTGTATG
TTTGTCCTTCTAATTTTCCCTTAGTTAATTAGTATATTCCTTAAGCTT