Cloning Vector – PUC18-SW

Sequence8,139 bases 
>PUC18-SW
GCGGCCGCAAGGGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATG
CGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGG
GCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAAC
GACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGGATCCCACGTGGGATCCTCTAGAGTCGACCTGCAGGCAT
GCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA
CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGT
CGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCTTGCGGCCGCCCGGGCCGTCGACCAATTCTCATGTTTGACAGCTTAT
CATCGAATTTCTGCCATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAAGGGCACCAATAACTGCCTTAAAAAAATTACGCCC
CGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGC
ATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAA
ACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAAT
ATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACA
CTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAA
CTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAA
AATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAAC
TCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCA
GGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAAGCTCATGGAGCGGCGT
AACCGTCGCACAGGAAGGACAGAGAAAGCGCGGATCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTTGCCGCCGCTGCTGC
TGACGGTGTGACGTTCTCTGTTCCGGTCACACCACATACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGCTGAAAGTTCTGC
AAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAAGTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCAGTTTGCGATG
CCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCTGAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATATGCTGTTTT
TGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGCGAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATTAATCTC
AGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGATGCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAGAAAT
CTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATGGACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTACAG
CCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGGTTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA
GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTTGTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGG
ACGTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGGGCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAA
ATCGGCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGCCTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGAC
TACTGACAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGATGAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCA
GAAAATCCAGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTTTTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTT
AACCAGGGCTGCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCTCGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGG
AACAGCACTTATATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCACTTATCCACGGGGATATTTTTATAATTATTTTTTTT
ATAGTTTTTAGATCTTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAAGGTGTTGTGACAAATTGCCCTTTCAGTGTGACAA
ATCACCCTCAAATGACAGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAGAAGAAGCTGTTTTTTCACAAAGTTATCCCTGC
TTATTGACTCTTTTTTATTTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGGCGGAAACAGCGGTTATCAATCACAAGAAAC
GTAAAAATAGCCCGCGAATCGTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCAAAAACGTATGCTGTATCTGTTCGTTGAC
CAGATCAGAAAATCTGATGGCACCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCTGAAATATTCGGATTGACCTCTGCGGA
AGCCAGTAAGGATATACGGCAGGCATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGGATGCCGGCGATGAAAAAGGCTATG
AATCTTTTCCTTGGTTTATCAAACGTGCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCTCATTCCCTTCTTTATCGGGTTA
CAGAACCGGTTTACGCAGTTTCGGCTTAGTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCCCTGTGTCAGTATCGTAAGCC
GGATGGCTCAGGCATCGTCTCTCTGAAAATCGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGCCTGACTTCCGCCGCCGCT
TCCTGCAGGTCTGTGTTAATGAGATCAACAGCAGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGACGACTCATATCGTATTT
TCCTTCCGCGATATCACTTCCATGACGACAGGATAGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTTCTGACCTACTGAGG
GTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTGCATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATTTGAGGGCAGTTT
GTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTGACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCACAGTTTATTAC
TCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTTTTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGACAGAACAGT
TCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTACACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCTTCTTAT
CTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTTTTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTTAATA
AAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCATGGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTATC
GCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACCCGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA
GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGGAAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAA
TTAATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGTATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTAC
AAAACCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGTGTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAAT
GTATCACGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTTTCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGC
CCACTTGCTGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGAAACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCC
ACCGATCCACACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTCATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCAC
GATTAATGTCGTATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACTACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTG
ATCTGCTCAAGAACGTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATACAGCAATAGTAATGGCTCTCAGTCCCCGTGGATG
GAGGAGCAAATTCGGGATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAAGTTGGTAAAGGTCAGATCCGGATGAGAACTGT
TTTTGAACAGGCCATTGATCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAACCTGTCTGCAATGAAATTTTCGATCGTCTGA
TTAAACCACGCTGGGAGATTAGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAACCGGTTGAAGATACTTCGTTATCGACAC
CAGCTGCCCCGATGGTGGATTCGTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGCCTGTATGTGGTCGGGATGTGAAGTTT
ACTCTTGAAGTGCTCCGGGGTGATAGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGAGCTGCTTACTGAGGACGCACTGGA
TGATCTCATCCCTTCTTTTCTACTGACTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAAATTGCCGATGGGAGTCGCCGTC
GTAAAGCTGCTGCACTTACCGAAAGTGATTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTATCCAGATTGGGTAACGATTAT
CGCCCAACAAGTGCTTATGAACGTGGTCAGCGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCTGGCTGATGCGGAAAATAT
TTCACGTAAGATTATTACCCGCTGTATCAACACCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAACTATCTGCCCGGTCAG
GTGATGCACTTCAAAAAGCCTTTACAGATAAAGAGGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTGGGGTGATATTTGAA
GCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTTAAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGCTCCTGGAGCGAC
AGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGGACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTTAAGGAACTTG
AAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGTTTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTGGCCTGAAT
ATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGATAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGG
ACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGTCCCA
CTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCG
GTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA
GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGGACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTAC
GATTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGTAGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTG
CTGCTGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATACCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCC
GATGCAAGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACG
TTAAGTTGATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTGGTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATA
ATCATTATCACTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGG
CGTTTCCGTTCTTCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTC
TGTCGTTTCCTTTCTCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAATAACTTCGTATAGCATACATTATACGAAGTTATAT
TCGAT