SGN Marker TG77

SGN-M1

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTCTTATTTCGCTGTTGGTTCTTGCTTTGCACAGAGGATCACGCAACATCCGAAATCAGAATAGTTTAGTACTTTAATTTTTTTACAAGG
TAAATAAGTTTCTTAATAATGGTAAAATATTAGCTGTATACCAAAAGGCTAAATTGGTTAGTGAAAACATGAATGGTCAAACGGGCTCTT
TGTACAACAAGAACAACTAATTATGCTTGGTTATGAACTTCAATCGTGGTGCTTGTATGTCCTCGACTCCCCATCTACGTAAGCTTTAAG
TAGACAGGTTTTAGTCAACTTGCACTAAATAGAGAGTTGGCTCAACTTGATAGTTCTGCAAATTACATGTGTCCACTATCATAGTTGACT
GCTTAATTAACAGTTTTTTTGTTTCCAAGAATAAGTTTCGGCAATACTTGTAAAAATTTGTCTGTCAATCCTTCTTCTATTGTCTCCTAT
ACTTTCTCTGGATTTCCACAATTTCTGATACTTGGAGTCGGAATGACTTACTATACTTCTATATCTCGACTCGACTATTGTGTTTCTGAC
TTCTTCATTTTAATAGTTCTCGATTTCCTGATTACAGATCTCCCATCTGGCCTTTTCATTTGTTCTAAACTAGTATTATTGAACTTAAAT
GGTCAAAGTGACATGCTTCTGCGCTG
Reverse sequence
TGAAATGCATTGGGAGATTTGAAATGTTCCCCTATGGCACATCAAGGACAGCTCAAGTATCATTACATCTTACATTACAACTGAAGCACG
AATTAGCACACGTATGAGCAAACCCTAGAAGCAATGAAATTAACCTGCATTACCTTTTTAACGGCAAGGTCAAAATCGTCCAGGGTACCA
TACTCTCTCTCGAAGCGAATCCATGAATTGCATATGTCCTGAATGATTCTGTTTTTTAGAAGAAGGGGTATCATCTAATTCAAAATAAAT
AGCAACTTAGGCTGCAAAGAACAATCCAGTAAAAGATAAACATAACAGATAGATGTAAGGGATAGCACAAAAGCAGCCACATAAAGCACC
AAGGAGAATCAAGAACTAATCACTCTTGACACTTGTTCATTTGTAAAGCATGTTTTCACAATAAATAGCAAAATTGATGGTACTTAATTA
GTTGAGAGATATTTCTCCGGTACAAGGCGCAATGCCTATCCATTAGATTAGGCCAGCATGACAAAAACCATGCTTCAAAGCACAATTACA
GACTTGTGTACCTCAAATACACAGTACTGAATATTAAAAGTTTGTTTTCATGGCCCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1640991.6e-3579 (13.2% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53863)
Chromosome
1
Position
13.20 cM
Confidence
uncalculated
Protocol
RFLP

Hexanal_content_hxa1_1 Pentanal_content_pna1_1 Titratable_acidity_ta1_1 Elasticity_ela1_1
Tomato QTL map

Map: Pepper-AC99   
Map version
34 (location: 7704)
Chromosome
1
Position
30.16 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7703)
Chromosome
1
Position
100.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG77 was used as an overgo probe on plate 5 [well E9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCGCTGTTGGTTCTTGCTTTGCAC
B sequence
TGTTGCGTGATCCTCTGTGCAAAG
AB sequence
TCGCTGTTGGTTCTTGCTTTGCACAGAGGA
Marker sequence
TTCTTATTTCGCTGTTGGTTCTTGCTTTGCACAGAGGATCACGCAACATC
CGAAATCAGAATAGTTTAGTACTTTAATTTTTTTACAAGGTAAATAAGTT
TCTTAATAATGGTAAAATATTAGCTGTATACCAAAAGGCTAAATTGGTTA
GTGAAAACATGAATGGTCAAACGGGCTCTTTGTACAACAAGAACAACTAA
TTATGCTTGGTTATGAACTTCAATCGTGGTGCTTGTATGTCCTCGACTCC
CCATCTACGTAAGCTTTAAGTAGACAGGTTTTAGTCAACTTGCACTAAAT
AGAGAGTTGGCTCAACTTGATAGTTCTGCAAATTACATGTGTCCACTATC
ATAGTTGACTGCTTAATTAACAGTTTTTTTGTTTCCAAGAATAAGTTTCG
GCAATACTTGTAAAAATTTGTCTGTCAATCCTTCTTCTATTGTCTCCTAT
ACTTTCTCTGGATTTCCACAATTTCTGATACTTGGAGTCGGAATGACTTA
CTATACTTCTATATCTCGACTCGACTATTGTGTTTCTGACTTCTTCATTT
TAATAGTTCTCGATTTCCTGATTACAGATCTCCCATCTGGCCTTTTCATT
TGTTCTAAACTAGTATTATTGAACTTAAATGGTCAAAGTGACATGCTTCT
GCGCTG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG77  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1 marker 1
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)