Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG566

SGN-M10

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TATACTACATGACACCACCAAGTTGGTCCAACTGGATTTTGCCAGTATGGAGCTGCAACATCTGCTACAGTGACATCATCTTCCTCATCA
CTGAGATCAACAGGCTGAGAGGCCCAACCACTATCAATCTGCACTGTTTGAAGCAGCTCAGATATTCTAGACCAGCCTATTGGTATCCAG
TAATTACCAGGAGACGTTTCTCGGGAATGATAAGGATAGTCTTGATGATAACTTTGGCTATCTCCATTCTCGATGTCAACATACGCAGAT
TCTGTTGGATAATGAGGTTCTATGAAGTGATCCTTGTCAACATCTTGGGGTGAGAAATTACTTGCACCATATTTATATAATGGTGGTTTT
TTAGGGTCCCTGACAGCATAATGTTCAGTAGCTCTCGCGCCATTTGTCTTCCTTTGGCCACGGACAAATTCAAAGGCACAAAGCAGGCCA
TCTGTCCATAGCTCACTACCCAGCATGACATCTCTGGACAGTTGCTGTTTATGATTCTCTCGGTTCTTCGTACCATTGTTCATTTTTGCA
CTCTCATGAGTTACACTACTCATGCCACTTTCCCTTTT
Reverse sequence
CTGCTCTTGTCATCGCGAATGATACTTGGGAAAGATGGGAGCTTTTATAAGTACATTAGTAGTAGTTTTTATTGAAATGAAGTAGCAGAT
CTTGGTAGTACAGTCTCTGACATTCCTATCAGTGACATTAGTTCCAATGGATTTTAATGTATCGTTAGTCGGTATTGAAGTGGTAGGTAC
ATAAGTTGGTATGCAGTTTTTGTCTTTCCTATCAGCAGCATTAGTTCCTTTGGTTCTAGTATATTCCTTTAGTTTTTTTGACATAATTAT
ATAACCTCTTTTTTTTGCTCGAAACGACAACAACCCAAATTATATATTAAATGGTTTCATGAGATTATAGTACAGATCTGACCTGGTCTT
GGCAAAATGTTAACATTAGCGATCCTCAGATAATACCACTTCTCCGNGATTCTTTTTTTGTTGTCTTCCTTCATCTTGCAACTTCTTCGA
CAAACTTGGGTCCATCAATTGCTGATATTTCAAGAATGCTGGCTAAGTTGAATCAAGAAAAGGGAAAGTGGCATGAGTAGTGTAACTCAT
GAGAGTGCAAAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40090)
Chromosome
10
Position
16.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7724)
Chromosome
10
Position
16.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG566 was used as an overgo probe on plate 14 [well E2]

Plausible BAC Matches:   P204K01,   P155I21,   P100B06

 Overgo Sequences

A sequence
TTGGCCACGGACAAATTCAAAGGC
B sequence
AGATGGCCTGCTTTGTGCCTTTGA
AB sequence
TTGGCCACGGACAAATTCAAAGGCACAAAG
Marker sequence
TATACTACATGACACCACCAAGTTGGTCCAACTGGATTTTGCCAGTATGG
AGCTGCAACATCTGCTACAGTGACATCATCTTCCTCATCACTGAGATCAA
CAGGCTGAGAGGCCCAACCACTATCAATCTGCACTGTTTGAAGCAGCTCA
GATATTCTAGACCAGCCTATTGGTATCCAGTAATTACCAGGAGACGTTTC
TCGGGAATGATAAGGATAGTCTTGATGATAACTTTGGCTATCTCCATTCT
CGATGTCAACATACGCAGATTCTGTTGGATAATGAGGTTCTATGAAGTGA
TCCTTGTCAACATCTTGGGGTGAGAAATTACTTGCACCATATTTATATAA
TGGTGGTTTTTTAGGGTCCCTGACAGCATAATGTTCAGTAGCTCTCGCGC
CATTTGTCTTCCTTTGGCCACGGACAAATTCAAAGGCACAAAGCAGGCCA
TCTGTCCATAGCTCACTACCCAGCATGACATCTCTGGACAGTTGCTGTTT
ATGATTCTCTCGGTTCTTCGTACCATTGTTCATTTTTGCACTCTCATGAG
TTACACTACTCATGCCACTTTCCCTTTT
Genomic location of TG566  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10 marker 10
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)