SGN Marker TG154

SGN-M100

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTACCAGTGAGATTGAGGTATTTTATTGTGGTTTGTGGGTAAGACTATTTGAATAAATGCAACTTAGTTGCATAAACCTTATTCATAAAC
CAAAAACCTCAAGAAATTGTGAAAAGAACAAATAAGAGTCACACAGTACCTTCAAACCATCTTTGTTCCCCTTCAGAACAACATCAAGAT
AGCGGTCCAAAATTTCTTTCTCAAGGCTGTCAATGTTTAAAAAGAAGGGAAAATAGCTGTTATTAAAGGAAACAAGAATATGATGAGTGT
GGTCATGAGGTGGGTAAGAAAGAGTTTCGTTCCTTATATTCCCACAGTAAACCAAAAGAAATGTTAACTGCAAAAGTAAAGTTCAAAGGA
ATAAATCACAAAGAGATGAAAGTCCTTCTTGATGACAGCTCACGGATATTCTTAACAGAAATTCTTCATGCATTAAAGTGTATACCTAAA
TTTCCTAATATAGC
Reverse sequence
CTACCAGTGAGATTGAGGTATTTTATTGTGGTTTGTGGGTAAGACTATTTGAATAAATGCAACTTAGTTGCATAAACCTTATTCATAAAC
CAAAAACCTCAAGAAATTGTGAAAAGAACAAATAAGAGTCACACAGTACCTTCAAACCATCTTTGTTCCCCTTCAGAACAACATCAAGAT
AGCGGTCCAAAATTTCTTTCTCAAGGCTGTCAATGTTTAAAAAGAAGGGAAAATAGCTGTTATTAAAGGAAACAAGAATATGATGAGTGT
GGTCATGAGGTGGGTAAGAAAGAGTTTCGTTCCTTATATTCCCACAGTAAACCAAAAGAAATGTTAACTGCAAAAGTAAAGTTCAAAGGA
ATAAATCACAAAGAGATGAAAGTCCTTCTTGATGACAGCTCACGGATATTCTTAACAGAAATTCTTCATGCATTAAAGTGTATACCTAAA
TTTCCTAATATAGCACATTTCTAAAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1478761.8e-3168 (14.7% of RFLP seq)+
SGN-U1478761.9e-3168 (14.3% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53186)
Chromosome
11
Position
15.87 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53185)
Chromosome
2
Position
91.45 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50347)
Chromosome
2
Position
1.69 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48282)
Chromosome
2
Position
158.36 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43837)
Chromosome
2
Position
54.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43586)
Chromosome
2
Position
93.40 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43297)
Chromosome
2
Position
105.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40837)
Chromosome
2
Position
107.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39914)
Chromosome
2
Position
143.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8087)
Chromosome
2
Position
122.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8091)
Chromosome
2
Position
98.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG154 was used as an overgo probe on plate 16 [well E11]

Plausible BAC Matches:   P293L01,   P118P10,   P231G23

 Overgo Sequences

A sequence
TGAGTGTGGTCATGAGGTGGGTAA
B sequence
GGAACGAAACTCTTTCTTACCCAC
AB sequence
TGAGTGTGGTCATGAGGTGGGTAAGAAAGA
Marker sequence
CTACCAGTGAGATTGAGGTATTTTATTGTGGTTTGTGGGTAAGACTATTT
GAATAAATGCAACTTAGTTGCATAAACCTTATTCATAAACCAAAAACCTC
AAGAAATTGTGAAAAGAACAAATAAGAGTCACACAGTACCTTCAAACCAT
CTTTGTTCCCCTTCAGAACAACATCAAGATAGCGGTCCAAAATTTCTTTC
TCAAGGCTGTCAATGTTTAAAAAGAAGGGAAAATAGCTGTTATTAAAGGA
AACAAGAATATGATGAGTGTGGTCATGAGGTGGGTAAGAAAGAGTTTCGT
TCCTTATATTCCCACAGTAAACCAAAAGAAATGTTAACTGCAAAAGTAAA
GTTCAAAGGAATAAATCACAAAGAGATGAAAGTCCTTCTTGATGACAGCT
CACGGATATTCTTAACAGAAATTCTTCATGCATTAAAGTGTATACCTAAA
TTTCCTAATATAGC
Genomic location of TG154  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D100 marker 100
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)