Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker SSR327

SGN-M1000

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 55
Repeat motif: AAT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TCAGGATCAGGAGCAGGAGT
Reverse primer: TGGACTTGTTCCATGAACCC
Predicted size: 149
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43800)
Chromosome
8
Position
21.70 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44809
Forward primer (5'-3')
TCAGGATCAGGAGCAGGAGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGACTTGTTCCATGAACCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43260)
Chromosome
8
Position
22.30 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44623
Forward primer (5'-3')
TCAGGATCAGGAGCAGGAGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGACTTGTTCCATGAACCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42993)
Chromosome
8
Position
4.70 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43993
Forward primer (5'-3')
TCAGGATCAGGAGCAGGAGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGACTTGTTCCATGAACCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40795)
Chromosome
8
Position
20.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39224)
Chromosome
8
Position
22.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 100
Forward primer (5'-3')
TCAGGATCAGGAGCAGGAGT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGACTTGTTCCATGAACCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 180+195
Solanum lycopersicum LA925: 195+195
Approximate temperature
55°C
  
Genomic location of SSR327  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1000 marker 1000
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)