SGN Marker BAC_119J05

SGN-M10001

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38042)
Chromosome
11
Position
89.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35563
Forward primer (5'-3')
AACTTACGGCACCTCAATTTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GTGCCCCCTATGCAAGTAATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 676
Approximate temperature
60°C
  
Genomic location of BAC_119J05  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10001 marker 10001
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)