Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker Hba78A16T7

SGN-M10006

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39110)
Chromosome
11
Position
89.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35578
Forward primer (5'-3')
CCTCTCAGGAAGTCTGAGATTGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAAGGATATTCAACCAGCAGT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of Hba78A16T7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10006 marker 10006
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)