SGN Marker MboI49G16SP6

SGN-M10007

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39121)
Chromosome
2
Position
75.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35581
Forward primer (5'-3')
GCTTTCACCTTTTGCAAGGA
Digested band sizes (using CfoI)
Solanum pennellii LA716: 510
Solanum lycopersicum LA925: 253+257
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTGCTAGCTCTTGTTTGGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 510
Solanum lycopersicum LA925: 510
Approximate temperature
55°C
  
Genomic location of MboI49G16SP6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10007 marker 10007
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)