SGN Marker U217183

SGN-M10009

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42505)
Chromosome
4
Position
15.90 cM
Confidence
F(LOD3)
Protocol
PCR


Eggplant-COSII

PCR data   Exp. ID 43845
Forward primer (5'-3')
GCGAGTTGACACGAAATCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCATAAGACCCCAATCCAAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41639)
Chromosome
10
Position
60.60 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43595
Forward primer (5'-3')
ATGAGGCCTATTTTTGTCGGGAAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGTCGGTCTCTGGTTTCCACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40207)
Chromosome
10
Position
28.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Genomic location of U217183  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10009 marker 10009
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)