SGN Marker U218000

SGN-M10011

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40211)
Chromosome
6
Position
5.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35641
Forward primer (5'-3')
CGTAAGAGCAAGTAGAACAGGAAAG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 600+1200
Solanum pennellii LA716: 800+1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAACTGCACTAAAGTGTCTTCAATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Solanum pennellii LA716: 2000
Approximate temperature
53°C
  
Genomic location of U218000  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10011 marker 10011
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)