SGN Marker U222561

SGN-M10014

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40222)
Chromosome
5
Position
66.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35644
Forward primer (5'-3')
ACCTAGCGAAGGCATTTGTG
Digested band sizes (using DpnII)
Solanum pennellii LA716: 175+50
Solanum lycopersicum LA925: 225
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GACAACAATCATGCCACCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 225
Solanum pennellii LA716: 225
Approximate temperature
55°C
  
Genomic location of U222561  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10014 marker 10014
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)