Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG156

SGN-M101

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2520
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TATGAATTTGACCAAGCTGTAACTTATTTGGTTTAAGTTTTTACCTCTACAGAAGCAGTTTTATAGCACCTTTTTATATGCCCCAAATGG
GAGGGAAGAAAGGAAAGGATTATGGAGCTATATGACATAAATAGGATCTGGAATGGATAAATTATGGATAATACTGGGAGACTTTAACAA
TGTATTACACACTACAGATAGGCTTGGTTGACAAACGTCACTTTTGCATAAGTGTGTGACTTTCAAGAATGTCTTGACACATGTATGCTG
GAGGAATGGGAAGTAATGGAAATGCCTATACATGGAATGACAAAGGAACTACAAACGAAGTGTTCTCTAAAATTGATTGGTCTTTTATAA
ATGTATATGAGTAGATGAAATACGCGATTTCGAACAACTTTCATGAGTGAAGAGGTAAGTGATCATAGTCGAATACATGTTAGAAGGGTG
GAAGAGTGGCAAGACAAAGAGTA
Reverse sequence
CTTCCCCAGGTGGTTTACTTGTCCAAAAATCACAATCATCTTTCAAAAATACTTTGTTCACCCATTTTACCCACAAAATGTCTTTTTTCT
CCATTAGTAACCAAATATGTTTCCCAACAGATGCCATATTCCAGTGTATGCAGCTTTTTATACTTAAACCTCCTTGTTGTTATGGCCTAC
AAATAATTTCCCAAGCTACTAGAGAAGTTCTCTTCTTTCCTTGAGTGCCTCCCCACAAATACTCCCTACATTATCCATCTGTCTTTTTAA
CTACACTTAGGGGCAAAATAAATACAGCCCCCCAAAAATTATGAATGGAAAATAGGATAAGTAATAACCTGCGACTTCCCTGCATATGAT
AATGCCTATTTGATACTGATTCTTTCAGTGATCTTTTGGCCTAGCTGGTTGCACTCTAGTTTAGACCATTTATTTGGGACAATGGGAGTC
CTAGATATCTAATAGGAAACTCTCCTTCAACATAACTAGT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53517)
Chromosome
7
Position
39.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8092)
Chromosome
7
Position
21.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8093)
Chromosome
7
Position
49.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG156 was used as an overgo probe on plate 9 [well B10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P233N12,   P211E03,   P169N02,   P315K05

 Overgo Sequences

A sequence
GACACATGTATGCTGGAGGAATGG
B sequence
GCATTTCCATTACTTCCCATTCCT
AB sequence
GACACATGTATGCTGGAGGAATGGGAAGTA
Marker sequence
TATGAATTTGACCAAGCTGTAACTTATTTGGTTTAAGTTTTTACCTCTAC
AGAAGCAGTTTTATAGCACCTTTTTATATGCCCCAAATGGGAGGGAAGAA
AGGAAAGGATTATGGAGCTATATGACATAAATAGGATCTGGAATGGATAA
ATTATGGATAATACTGGGAGACTTTAACAATGTATTACACACTACAGATA
GGCTTGGTTGACAAACGTCACTTTTGCATAAGTGTGTGACTTTCAAGAAT
GTCTTGACACATGTATGCTGGAGGAATGGGAAGTAATGGAAATGCCTATA
CATGGAATGACAAAGGAACTACAAACGAAGTGTTCTCTAAAATTGATTGG
TCTTTTATAAATGTATATGAGTAGATGAAATACGCGATTTCGAACAACTT
TCATGAGTGAAGAGGTAAGTGATCATAGTCGAATACATGTTAGAAGGGTG
GAAGAGTGGCAAGACAAAGAGTA
Genomic location of TG156  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D101 marker 101
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)