SGN Marker SSR340

SGN-M1013

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 50
Repeat motif: GTTGA   Repeat number: 2
Repeat motif: GA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TTCTCTCTGTCGCCATTGTG
Reverse primer: AAATCAACGCCAATGGTAGG
Predicted size: 281
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39230)
Chromosome
9
Position
18.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31924
Forward primer (5'-3')
TTCTCTCTGTCGCCATTGTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAATCAACGCCAATGGTAGG
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Genomic location of SSR340  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1013 marker 1013
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)