SGN Marker SSR345

SGN-M1018

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 50
Repeat motif: TCC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: AAGCCAAGCTCGAACCTGTA
Reverse primer: ATCCATGCTGTCGCTTTCAT
Predicted size: 179
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53499)
Chromosome
12
Position
42.22 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39233)
Chromosome
12
Position
72.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14155
Forward primer (5'-3')
AAGCCAAGCTCGAACCTGTA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATCCATGCTGTCGCTTTCAT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 178+179
Solanum pimpinellifolium LA1589: 179+184
Approximate temperature
60°C
  
Genomic location of SSR345  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1018 marker 1018
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)