SGN Marker TG441

SGN-M102

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGTATTGAATAATGTCAGCATAGGCTTTTCCAAGCCTGCTCTGAGGTAAACTCTCAGTTCTCTGATTGTCTCCTTGATCCTGAGGCAAAA
AGATGTCATACAACATTTTGTATCAGTTGGAGGGGGAAGAGGTCAGAGGAGAGGAAGAATGAACACACACAACTGAAGGCACAACAAAAT
GCCAACATACAATAGATGAAGTTGATGTGGTGACTCGTTGACCAAGTGGACTATCCGAAAACATGGTTTCACTTCTTGCATCATATTTTC
CTCTGCGAGAGCGTCCCCTCGTAATTATTGCTTTCAGCCCAGTAATCCAAACCTCAGCTTCATCCTTGTCTTTACAGATCTACACAGAAT
TATCATAACAGTTACTAGATTATTTTTTTAAGACTTGTAAATATCAAAATGTCATTTTTCCCGACCGGAAAGAGTACTTATTTTCATTGA
GAAGACAAA
Reverse sequence
TGGTATGGTACCACGACAAAGAAGAAAAACAGCTTGAACTGTGTCATGTATCAAGGATTATTCCTGGACAGAGAACTGTGAGTTTGAGTA
TTCCCACATCTTTCTTCCCTTATAAAGGAAATTTTTTCCCTCAAGTTCCATTTGAATGGAAGATTTGCAGGTTTTACTCTTTAAGAGAAG
GTGGATTAAATTTTCTGATCATTGATCAGCAAGAGTAATTTCTGCATCGAGTTCTTTGTTGTGCTCTATGACTGATTTGTAAAGACCATA
TATTATAGTTCACAAGGGCATTGCTATTCTTATGTCTGTCGAGTTTAGATCCTTTTTCTGTGTGGTTTATACTCCTCTTCCTCTTGTGCT
AGACCTTTATTTTCAAGTGGCTGACCAAAACAGTGGTAATTTTCTCCTCTTCAGGCAATATTCCAGCGGTATCCTCGACCTGAAAAGGAG
TATCAATCATTTTCTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53324)
Chromosome
5
Position
12.24 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50389)
Chromosome
5
Position
1.95 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48323)
Chromosome
5
Position
21.59 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43868)
Chromosome
5
Position
7.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43611)
Chromosome
5
Position
9.70 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43330)
Chromosome
5
Position
9.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40871)
Chromosome
5
Position
8.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40045)
Chromosome
5
Position
19.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8094)
Chromosome
5
Position
21.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8095)
Chromosome
5
Position
11.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8100)
Chromosome
5
Position
5.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8099)
Chromosome
5
Position
12.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 14112
Forward primer (5'-3')
TGGTATGGTACCACGACAAAG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 280
Solanum pimpinellifolium LA1589: 350
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTTTCAGGTCGAGGATACCG
Enzymes
  
Accessions and product sizes
Approximate temperature
53°C
  
Overgo hybridization and physical mapping 
TG441 was used as an overgo probe on plate 5 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGTCAGCATAGGCTTTTCCAAGC
B sequence
GTTTACCTCAGAGCAGGCTTGGAA
AB sequence
ATGTCAGCATAGGCTTTTCCAAGCCTGCTC
Marker sequence
TGTATTGAATAATGTCAGCATAGGCTTTTCCAAGCCTGCTCTGAGGTAAA
CTCTCAGTTCTCTGATTGTCTCCTTGATCCTGAGGCAAAAAGATGTCATA
CAACATTTTGTATCAGTTGGAGGGGGAAGAGGTCAGAGGAGAGGAAGAAT
GAACACACACAACTGAAGGCACAACAAAATGCCAACATACAATAGATGAA
GTTGATGTGGTGACTCGTTGACCAAGTGGACTATCCGAAAACATGGTTTC
ACTTCTTGCATCATATTTTCCTCTGCGAGAGCGTCCCCTCGTAATTATTG
CTTTCAGCCCAGTAATCCAAACCTCAGCTTCATCCTTGTCTTTACAGATC
TACACAGAATTATCATAACAGTTACTAGATTATTTTTTTAAGACTTGTAA
ATATCAAAATGTCATTTTTCCCGACCGGAAAGAGTACTTATTTTCATTGA
GAAGACAAA
Genomic location of TG441  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D102 marker 102
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)