SGN Marker SSR350

SGN-M1023

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 52
Repeat motif: AT   Repeat number: 13
Repeat motif:    Repeat number:
Forward primer: GGAATAACCTCTAACTGCGGG
Reverse primer: CGATGCCTTCATTTGGACTT
Predicted size: 267
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42995)
Chromosome
6
Position
55.80 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43995
Forward primer (5'-3')
GGAATAACCTCTAACTGCGGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CGATGCCTTCATTTGGACTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39236)
Chromosome
6
Position
101.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14121
Forward primer (5'-3')
GGAATAACCTCTAACTGCGGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGATGCCTTCATTTGGACTT
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 146+267
Solanum lycopersicum LA925: 149+267+269
Approximate temperature
55°C
  
PCR data   Exp. ID 85
Forward primer (5'-3')
GGAATAACCTCTAACTGCGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CGATGCCTTCATTTGGACTT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 256+267
Solanum lycopersicum LA925: 267+267
Approximate temperature
55°C
  
Genomic location of SSR350  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1023 marker 1023
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)