SGN Marker SSR356

SGN-M1029

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: AT   Repeat number: 20
Repeat motif:    Repeat number:
Forward primer: ACCATCGAGGCTGCATAAAG
Reverse primer: AACCATCCACTGCCTCAATC
Predicted size: 259
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39237)
Chromosome
2
Position
44.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 26
Forward primer (5'-3')
ACCATCGAGGCTGCATAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACCATCCACTGCCTCAATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200+259
Solanum lycopersicum LA925: 259+259
Approximate temperature
55°C
  
Genomic location of SSR356  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1029 marker 1029
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)