SGN Marker SSR360

SGN-M1033

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40 High: 50
Repeat motif: TA   Repeat number: 17
Repeat motif:    Repeat number:
Forward primer: ATCAGCCCTTCCACTGATTG
Reverse primer: TAAGCAACCACCAATGTTCA
Predicted size: 219
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39238)
Chromosome
10
Position
39.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31803
Forward primer (5'-3')
ATCAGCCCTTCCACTGATTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TAAGCAACCACCAATGTTCA
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Genomic location of SSR360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1033 marker 1033
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)