SGN Marker TG370

SGN-M104

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AGCAAATGCAGAAGAAAATCGAAGCTCTGTTTCTGCTCACCACATGTATGATAAAATGCCAAGCTCAAATTCCACTAACAAAAGTGTTCC
TGCTGCTGAAAGGAGTGACAGTATAGTTTTGGGTTTGCAGAATGCAGCAAATTTTTCTGGGGTTCGGAAGAGGAAACGAGGTGAGTATGT
TGCTGAAAAATGGGACCCGATTACGAAAAAACGGGTTTGTTTGGGTACATTCAACACTGCTGAAGAAGCTTCCGAGGCTTATTTAGCTAA
GCAATGCGAATTTTCTACTGCCCGCCACATGCTTGATGAAATGCCAAGCTCAAATTCGACTAACAAAACTGCTAATGCTGCTGCCGGTTC
CACTGATGCTGATCATGGGAAAAAGCCCCTTATTCAGGAGATATCTTTCAGTCACAAAAGCATGTTACTTGGAGCTGAATGGCATAACAT
GGGG
Reverse sequence
TACTAAAATCAACAGGCATATTGCTTTGCAACTTGGTCTCTTTTGATCTCTGAACGTCGAATTTCATATACTGATTAGCATGGAAAGTAA
CTTCAGCGGCTGATTCTGACTGAAATGCTTCACAATTTACAACTAATTTCTCTTTCCCAGCTTGCTTCTCCCCTGTACTAAAATCAACCG
GCATATTGCTTTGCAACTCGGCCTCTTTTGATCTCTGAACGCCGACTTTCATATACAGATTAGCATGGAAAGTTTCTCCAGCAACTGATT
CAGGCTGAAATCCTTCACAATTTACAGCTATTTTCTCTTTCCCAACTTGCTTCTCCCTTGCATTTAAATGAATTTTCTTACTACATTTCT
TCTTTGCCTTGACTATTTCCCGAAACTCTAGCTTCTTAGATTGATAAGCTAGGGAAGCCTCTTCATACGTGCCAAAAGTCCCCAACCAAA
TCTTTTTCTTACTAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1450082e-0638 (8.4% of RFLP seq)+
SGN-U1450092e-0638 (8.4% of RFLP seq)+
SGN-U1593687e-68129 (28.4% of RFLP seq)+
SGN-U1593684.8e-72136 (29.2% of RFLP seq)-
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132217)
Chromosome
11
Position
83.28 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53289)
Chromosome
4
Position
19.40 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42449)
Chromosome
11
Position
131.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40017)
Chromosome
4
Position
21.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8107)
Chromosome
11
Position
128.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8106)
Chromosome
4
Position
18.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG370 was used as an overgo probe on plate 7 [well E4]

Plausible BAC Matches:   P329H05,   P025K02,   P055I14

 Overgo Sequences

A sequence
AGAGGAAACGAGGTGAGTATGTTG
B sequence
GGGTCCCATTTTTCAGCAACATAC
AB sequence
AGAGGAAACGAGGTGAGTATGTTGCTGAAA
Marker sequence
AGCAAATGCAGAAGAAAATCGAAGCTCTGTTTCTGCTCACCACATGTATG
ATAAAATGCCAAGCTCAAATTCCACTAACAAAAGTGTTCCTGCTGCTGAA
AGGAGTGACAGTATAGTTTTGGGTTTGCAGAATGCAGCAAATTTTTCTGG
GGTTCGGAAGAGGAAACGAGGTGAGTATGTTGCTGAAAAATGGGACCCGA
TTACGAAAAAACGGGTTTGTTTGGGTACATTCAACACTGCTGAAGAAGCT
TCCGAGGCTTATTTAGCTAAGCAATGCGAATTTTCTACTGCCCGCCACAT
GCTTGATGAAATGCCAAGCTCAAATTCGACTAACAAAACTGCTAATGCTG
CTGCCGGTTCCACTGATGCTGATCATGGGAAAAAGCCCCTTATTCAGGAG
ATATCTTTCAGTCACAAAAGCATGTTACTTGGAGCTGAATGGCATAACAT
GGGG
Genomic location of TG370  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D104 marker 104
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)