SGN Marker SSR383

SGN-M1056

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: AT   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: ATTGTACAAAGACCCGTGGC
Reverse primer: GTTGCACACTGGATCAATGC
Predicted size: 188
Derivations 
This marker was derived from EST read SGN-E5287
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39241)
Chromosome
9
Position
57.30 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 117
Forward primer (5'-3')
ATTGTACAAAGACCCGTGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GTTGCACACTGGATCAATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 188+188
Solanum lycopersicum LA925: 188+230
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR383 was used as an overgo probe on plate 16 [well F5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAAGGTAAGCCTGGGTGCTATGAG
B sequence
GCATTCTGTAGTAGCCCTCATAGC
AB sequence
TAAGGTAAGCCTGGGTGCTATGAGGGCTAC
Marker sequence
TGTTAATCCCTTGAGACNCCCACCCTTGTTGTTTTTTTTTTTTTTTTTTT
CAATACAATATACTCTTATATCTCTGATTATAGTAAGTATTTACATGTCA
TAAAAAGTAAAAAAAAAATCTGCATCTCATTGATTTCATTTGCTTGATCT
CCCCACACTGATGCATTGTACAAAGACCCGTGGCGTTTTTTTTTCTTGCT
ATAAGCTTCTTTTCTTGAGGTAGGTACCAGCGGAGACGAATCATATATAT
ATATATATATATATGGCCCGATCCAAAAGTGATGGGTTCCACTTGGTTTC
AGTCCTAAATCCGCCTCCACGTACCAACATAAGCATTGATCCAGTGTGCA
ACTCCGTGTTGCACCATAATTACAATGGAAAAACCGACTGAATCCAATTC
ATCAAGAAGATGTTTGTCAGTTTTAACAAACAAAACAAGCATTTGAGACT
CGAACTCGATTCATCACGCTATCTTAAAGAGACTTCCATCTCGTGCCTTA
TACAGCGATGATAAGGTAAGCCTGGGTGCTATGAGGGCTACTACAGAATG
CGGCTGGATCTGCGTCACTAACAGTTGTTATTGACTCACGCACCCTACGC
CTTGGTAATGGGCAGTTCACCTTTGAAGGCGTGTTGGCAACACCTCCTGC
CCAATGGGCTTGATCCTTGACCTTCCGCCTGTCTGCACCGTCTGTAGGTT
CTACTTTCCGAGAACATGTTTGTTACGGCCTTCTTTTTTGGGCTCTTTAT
TTGCACTTCTCA
Genomic location of SSR383  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1056 marker 1056
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)