SGN Marker TG590

SGN-M106

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG590 image not available
Forward sequence
CTAAACTATATATCAAAATAGTGAACTGGTTCAAACCAAACTTCAATTTTCTCAAGCTCTATGTTGATGGATTCTCCAAAGGAAATACTA
GTACAGCAGGAGGTGATGGAATACTCAGAGATCATATGGGCTACATGGTCATGTCATATCCTGAATTTTATGGGCAAAGTAGTAATAATT
ATGCAAAGGGGATAGCTATTTTATTGGGTATTCAATGGTGTCACTGAAATAACCTTAATCAAGTCATTGTAGAATCAGATTCTATGTTGA
CTATCCAGATGATCATGGAAGAAATACACATTTCTTGGCAAAAAACTTGAAGTCTCTTTTTTCTTCTTAAAAATACAGACGTAACATTTC
ACTCCATTTCTAAAGTACAAGGAGAATCAAACAGCAGCACGCCTTAACATGAACCAAAAAGAAACCCAAAACAAATGAATAAATGAAAAG
AGTGAGATCCATACAAACTAAAGCATCAACA
Reverse sequence
TGACTTATAGAAATTTTTTTATTTTATTTTGAAAATCGCTCCGGGTGGAGCGATTTGTTTAATTTTATTTTTTTAAAAAAGAAAAGACAA
ATTTAAGAAATCGCTGCTATTGCAGCGATTTCGCTTTTTCAAAAGTTACAAGTCGCTACATCGTGAGCGATTTTACCGTTTTGATTTAAA
AAAAAATTGATATGCCCTTTTGGAATTTGTGACAATTTTTTTTACCCTTTTAACTCCACACTTCTTTATTCTCTACCTACAGGATATATC
GATAGGCTACAGACAAAGTATTTTTAATGATTGTGACATAATTTGCATTATTTTGCTTAACTTAAAAGGCACAAGTAATAGAATTAAAAG
ATTTTGGACGTTTAATTAAGTATGAATTTTGTAGTTGGTTGTTCAACGTCAATTGAAAGGAATAATATTGGGTACCCCTAGCTTATAATT
TTTGCGAAGTTAGTTTAGTAAAAATATACGGAGCTGTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1553775.1e-38119 (24.7% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53904)
Chromosome
6
Position
14.20 cM
Confidence
uncalculated
Protocol
RFLP

3_Methylthio_propanal_content_mta6_1 2_Isobutylthiazole_content_ibt6_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53573)
Chromosome
6
Position
17.32 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50414)
Chromosome
6
Position
31.17 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48346)
Chromosome
6
Position
28.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43883)
Chromosome
6
Position
31.30 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43622)
Chromosome
6
Position
15.70 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43345)
Chromosome
6
Position
29.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40889)
Chromosome
6
Position
22.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40104)
Chromosome
6
Position
22.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8112)
Chromosome
6
Position
13.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8113)
Chromosome
6
Position
19.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8117)
Chromosome
6
Position
11.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG590 was used as an overgo probe on plate 2 [well B7]

Plausible BAC Matches:   P122I22

 Overgo Sequences

A sequence
TACAGCAGGAGGTGATGGAATACT
B sequence
GCCCATATGATCTCTGAGTATTCC
AB sequence
TACAGCAGGAGGTGATGGAATACTCAGAGA
Marker sequence
CTAAACTATATATCAAAATAGTGAACTGGTTCAAACCAAACTTCAATTTT
CTCAAGCTCTATGTTGATGGATTCTCCAAAGGAAATACTAGTACAGCAGG
AGGTGATGGAATACTCAGAGATCATATGGGCTACATGGTCATGTCATATC
CTGAATTTTATGGGCAAAGTAGTAATAATTATGCAAAGGGGATAGCTATT
TTATTGGGTATTCAATGGTGTCACTGAAATAACCTTAATCAAGTCATTGT
AGAATCAGATTCTATGTTGACTATCCAGATGATCATGGAAGAAATACACA
TTTCTTGGCAAAAAACTTGAAGTCTCTTTTTTCTTCTTAAAAATACAGAC
GTAACATTTCACTCCATTTCTAAAGTACAAGGAGAATCAAACAGCAGCAC
GCCTTAACATGAACCAAAAAGAAACCCAAAACAAATGAATAAATGAAAAG
AGTGAGATCCATACAAACTAAAGCATCAACA
Genomic location of TG590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D106 marker 106
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)