SGN Marker TG70

SGN-M107

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTGTTTGCTCATGCTGCCTCTTTTAATTCAGTTAATTTAGTGATTTCGTTGTTTTTGGTCTCTGAATACATAAACCATGGCATTTCTTT
TTAAAAAATGGAAATCTTTCATGAGCTGCTAAATGTCATTGTTCATTTATTCAGGTAGGTTGTTAAGAACCCATTTGTTTTCTTTATATG
GTTAAAGGGCATACTCCTCTAGTTCTCTTGATGCTTGGTTATATGGGATTTATGATGAATTTCTGGCTGGCTTGCATTTATGCTTGTTGT
AGGTTTGTTGACTTCCTTGAATTTCATATTATCTTTTTGCCATGCATGATGAACTCTCTTCACTCAAACTAAAGATGTTGTTATTTCTGG
GGTGTGATTGAACATTGAACTTGATCTTTTCACCATTTGAGAACACAACATTTGCATTAATGAGCAAATAAGAAATTGGATCTAACTGAT
TATGGAAGCTGTTGAAGTACATCAAAACATACTTGTCCGAGGTT
Reverse sequence
CTAGAGGATCCCGGGCGAGCTCGAATTCTTTGCCAACTTTGCTTGGGTAAGCCTGTCCAAGATGGCTGGTTCCAGGGGGATGGGATCAAG
ACAACGTTCAGCAGCAGCAACAATCACCTGTTCAGCAAGAAACATTATCTGTCACATTTGGCTAGATAATAAGGTTTGAAGCATTCAACT
TTCAGTATGTGCAGTGATGATCAACTTAACCATTTCTAATACAAAATCAAATCTATTCGGATGAGGGAGAAAAGAGGTGGGGAAGAGTTT
AGGGAGGAAACAACTGATCGATAACAACTAAACATAGATGATAAAGAACCTTTCAGGACTGTTTGAAGTGGCCATTAAGAAGAAAATACA
GGAAAGCGCCCATTAAAAGAGTAATTGTTAAGTATAATAGCTGTGGAGATTCTGTCATTACCTCATCAAGCAAAAAATCAACAGCTGCTT
CATCTTCAGCCGTATCTTTAAGAGTGGTCTTAAGAAAGTGAATGTCCAACTGAATTTGTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1491916.8e-1995 (18.6% of RFLP seq)-
SGN-U1491911.7e-1992 (18.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53584)
Chromosome
1
Position
37.81 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53378)
Chromosome
1
Position
51.42 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Pepper-AC99   
Map version
34 (location: 8119)
Chromosome
8
Position
47.23 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8118)
Chromosome
1
Position
31.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8121)
Chromosome
1
Position
18.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8120)
Chromosome
1
Position
58.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG70 was used as an overgo probe on plate 15 [well C1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGTTAAAGGGCATACTCCTCTAG
B sequence
CCAAGCATCAAGAGAACTAGAGGA
AB sequence
TGGTTAAAGGGCATACTCCTCTAGTTCTCT
Marker sequence
CTTGTTTGCTCATGCTGCCTCTTTTAATTCAGTTAATTTAGTGATTTCGT
TGTTTTTGGTCTCTGAATACATAAACCATGGCATTTCTTTTTAAAAAATG
GAAATCTTTCATGAGCTGCTAAATGTCATTGTTCATTTATTCAGGTAGGT
TGTTAAGAACCCATTTGTTTTCTTTATATGGTTAAAGGGCATACTCCTCT
AGTTCTCTTGATGCTTGGTTATATGGGATTTATGATGAATTTCTGGCTGG
CTTGCATTTATGCTTGTTGTAGGTTTGTTGACTTCCTTGAATTTCATATT
ATCTTTTTGCCATGCATGATGAACTCTCTTCACTCAAACTAAAGATGTTG
TTATTTCTGGGGTGTGATTGAACATTGAACTTGATCTTTTCACCATTTGA
GAACACAACATTTGCATTAATGAGCAAATAAGAAATTGGATCTAACTGAT
TATGGAAGCTGTTGAAGTACATCAAAACATACTTGTCCGAGGTT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG70  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D107 marker 107
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)