SGN Marker TG74

SGN-M108

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAGTCCATGCTTGAAAAGCAGTGGAATCTTTCTGCTGAAGAGACATTGACTGCTTCTACACAACGCAAAAAGAATTGTAAGAAGATGCAT
ATTGCTTGCTCAGGGACGTCTGCTAGGCGGAGGAGAATGGATTCTCGACAAAGAGTTCTTGCTCAAAAAAGTTCAGCTACACCTATAAGT
GCAACCAAGCCACTGAGGTCAATACTTGGTCCAGATCTACTTCAAAATCGTTTAAAAGGTTACGTTAAGGGTATAGTAAGTGAAGAGCTG
CTCACACACACTGAAGTGCTTCAACTATCCAAAAAGATTAAAGTTGGTCTTCATGTGGAAGAGCAAAAATCAAGGTAACTAACTTCACAA
GCCTAATCCACCTTCACCTCTCCTCTGCTCTCAAGTGTAAACCAGAGATTTAGTAACTGATCATATCCCCACTTCCAACACTAACAGAAT
TCAGTA
Reverse sequence
GAAAAGAGGAAACAAAAAGATAAAATAAATAAAGAAACGAGATCATGAAACAATGGTAAAAAGATTATACGAGGCCTCAAGGACCTTAGA
CTCTTGGGTTCAAATCCCTAATAGAAGGAGAGTTTCATACAGTTACAGTTCGCCTTTATGTGAGTAATAAACATAAATGGCCAGACTTGT
ACCAGTTAATTCCTTTTTATTAGTATTGTACATCTCCACCCAGATATGAGTAACATTTGATTCCATTTTGTCACAATTTTTTGAAAATTG
AATCTAAATTTCTACTAGCCAATACCATAAATATCAACTCAAATATCAAATAGATTGTCAATGTTTACTTTTTGAGATGCAAAGTGGTGC
TTGAATTATTTGGTAAAATTCAGAATAAAGTTGTCAACCCCTACATTATGTGAACGTTCGGAGTTCAGACTTCAGACTTACACTATGGAG
AGTTGTTCCGGGCAGACCGTTTAAAGAGGGAAACACTTCCCTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1550913.2e-0532 (7.0% of RFLP seq)+
SGN-U1550913.5e-1170 (15.4% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53381)
Chromosome
3
Position
55.48 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40127)
Chromosome
3
Position
74.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8124)
Chromosome
3
Position
89.16 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8122)
Chromosome
3
Position
58.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8125)
Chromosome
3
Position
21.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Other PCR data 
PCR data   Exp. ID 35635
Forward primer (5'-3')
CATGCTTGAAAAGCAGTGGA
Digested band sizes (using HpaII)
Solanum lycopersicum LA925: 1900
Solanum pennellii LA716: 2300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GATTATACGAGGCCTCAAGGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2300
Solanum pennellii LA716: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 44
Forward primer (5'-3')
Unknown
Digested band sizes (using HpaII)
Solanum pennellii LA716: 2300
Solanum lycopersicum LA925: 1900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2300
Solanum lycopersicum LA925: 2300
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG74 was used as an overgo probe on plate 14 [well A1]

Plausible BAC Matches:   P259E03,   P324B15,   P307L07

 Overgo Sequences

A sequence
ACAAGCCTAATCCACCTTCACCTC
B sequence
ACTTGAGAGCAGAGGAGAGGTGAA
AB sequence
ACAAGCCTAATCCACCTTCACCTCTCCTCT
Marker sequence
AAGTCCATGCTTGAAAAGCAGTGGAATCTTTCTGCTGAAGAGACATTGAC
TGCTTCTACACAACGCAAAAAGAATTGTAAGAAGATGCATATTGCTTGCT
CAGGGACGTCTGCTAGGCGGAGGAGAATGGATTCTCGACAAAGAGTTCTT
GCTCAAAAAAGTTCAGCTACACCTATAAGTGCAACCAAGCCACTGAGGTC
AATACTTGGTCCAGATCTACTTCAAAATCGTTTAAAAGGTTACGTTAAGG
GTATAGTAAGTGAAGAGCTGCTCACACACACTGAAGTGCTTCAACTATCC
AAAAAGATTAAAGTTGGTCTTCATGTGGAAGAGCAAAAATCAAGGTAACT
AACTTCACAAGCCTAATCCACCTTCACCTCTCCTCTGCTCTCAAGTGTAA
ACCAGAGATTTAGTAACTGATCATATCCCCACTTCCAACACTAACAGAAT
TCAGTA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG74  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D108 marker 108
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)