SGN Marker 120K

SGN-M10925

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40724)
Chromosome
2
Position
45.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36559
Forward primer (5'-3')
CCGGAAAGCCACTAATTGTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TAAAAGGCCCAACACCAAAG
Digested band sizes (using HindIII)
Solanum lycopersicum TA209
320
Solanum pennellii TA56
600
Mg+2 concentration
1.5mM
   Enzymes
  
Genomic location of 120K  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10925 marker 10925
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)