SGN Marker CBF

SGN-M10927

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40726)
Chromosome
3
Position
29.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36561
Forward primer (5'-3')
AAAATGCATCAAATGTCACG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GAAGAAATTTGGGGGAAAAA
Digested band sizes (using DraI)
Solanum lycopersicum TA209
350
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  
Genomic location of CBF  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10927 marker 10927
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)