Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

SGN Marker LeOH301

SGN-M10928

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43696)
Chromosome
12
Position
64.90 cM
Confidence
uncalculated
Protocol
INDEL


Sun1642 x LA1589

PCR data   Exp. ID 44988
Forward primer (5'-3')
TGCTGTTTTGTTTGGCTCAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTCATATCTTTGATGGCATGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
CTTAGCATCTTTACCTGTGATCCATCAACT
  
3' flanking region
GATATTATGTTTTAATTAGGAGTTCCAAGAT
  
   Indel
GATATTATGATCCATCAACT

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43096)
Chromosome
12
Position
65.80 cM
Confidence
uncalculated
Protocol
INDEL


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44867
Forward primer (5'-3')
TGCTGTTTTGTTTGGCTCAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTCATATCTTTGATGGCATGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
CTTAGCATCTTTACCTGTGATCCATCAACT
  
3' flanking region
GATATTATGTTTTAATTAGGAGTTCCAAGAT
  
   Indel
GATATTATGATCCATCAACT

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40756)
Chromosome
12
Position
68.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of LeOH301  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10928 marker 10928
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)