SGN Marker P55P11

SGN-M10929

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40757)
Chromosome
6
Position
12.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36562
Forward primer (5'-3')
TCCCAAACCCCAACTTAAAA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GGACGGTCTGTGAGTGGAAT
Digested band sizes (using DdeI)
Solanum pennellii TA56
400
Solanum lycopersicum TA209
300
Mg+2 concentration
1.5mM
   Enzymes
  
Genomic location of P55P11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10929 marker 10929
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)