SGN Marker cosOH81

SGN-M10939

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40900)
Chromosome
10
Position
33.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36592
Forward primer (5'-3')
TGTCATGGGAATAGGAAGTGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACCATAAGGCCTTCCTTCAA
Digested band sizes (using MspI)
Solanum pennellii TA56
450
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  
Genomic location of cosOH81  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10939 marker 10939
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)