SGN Marker E492334

SGN-M10948

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46790)
Chromosome
9
Position
74.60 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41579)
Chromosome
4
Position
0.00 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43547
Forward primer (5'-3')
GCTGGTTGTGGTTGTACGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTCACATATCAATAGATTCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of E492334  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10948 marker 10948
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)