SGN Marker Hba181H07SP6

SGN-M10949

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41599)
Chromosome
4
Position
4.20 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43567
Forward primer (5'-3')
ACAAATAAATGCATTATGTGTCCTTGTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AAACAAATTCCAATTTGAACAACAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hba181H07SP6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10949 marker 10949
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)