SGN Marker Idh-1

SGN-M10950

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41610)
Chromosome
1
Position
159.30 cM
Confidence
I(LOD2)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43578
Forward primer (5'-3')
CTTGATATGAACCTATTAAATAGCAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GCGAATAGACTACATCACATCAAGAAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Idh-1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10950 marker 10950
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)