SGN Marker MboI77E18SP6

SGN-M10951

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41611)
Chromosome
4
Position
31.30 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43579
Forward primer (5'-3')
AACCCAACCTTTATGGGGAAGAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTAGAAGATGTGTATTGCCCATGATA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of MboI77E18SP6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10951 marker 10951
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)