SGN Marker Skdh-1

SGN-M10953

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41614)
Chromosome
1
Position
140.90 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43582
Forward primer (5'-3')
TTCTCACAACTATGAAAGCACACCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTTGCTATGGCTAACTGGCTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Skdh-1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10953 marker 10953
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)