SGN Marker TG302

SGN-M111

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG302 image not available
Forward sequence
ATGGTTGCATTACTCAGTCATTGCACTCTCCGGGTGGCTATTACATTTTTGAAAGGAGTAATTATTTCCCGCAAGAGAAGCACTTCCCTT
ATGTATAGAAATCAGTGACGTAAAATTTATAATCAACATAAAACTCTAAAGTTTGGTTCTGGTGAAGTAACTGGAGTTAAATAATCCTAC
TAACACTCATATCAGAGGGTTGGCTCCAAACAAATTTCTCGGTCATGAAAAACACCCATATAAGAGAAAGAATAGACATCCTTATTTTTG
GGGAAGGATTTTGGTTCCTATCAGTGAAATTTGGAATCATAGTTATAAGATGAAAAAAATGAGTGGAAAATTACTTATTAAAAAAGAAAA
CAGGGGTGATACCAGCTTAGATGGATCGATTTAAGTGCTATAAGATGTAGAAGTATTTGCAAGGTGAAAGGACTCTCCCGCGAATTTATT
AAAATAAATTTACATTTATTGGTCACAA
Reverse sequence
AAAGAAGCAAGAACCATTTTAATTAGGAAAGCATCTAGCTGAAATTAGCGGCCAGAGGCACCACCTCTTGCAAGAAAAGATACTATAACC
CTAGCTAGAAAAAGTGCAAATTTTTATGTAAACAGCATTGTCCAACAAAAATAAAGGAAGACTAAAAACAACATAAATCTAACTTGTTTG
TCAGAACTAGATATCTCAAATAAATGAAAGTTTGTCTTATTTCTACTAATTATCATCTGGCAACTGGCATTTCTATCCTAGTTGAATAAC
CTGCAAGTTTATGAGCAAATCTGATTGTTATCTTTTTATTTCTTTTTGGTGTAAATTGAATGAGTAAATGATTAGGAACTCCAATTACAG
TTCTTAGAAGCTTTTGCATATGCTAGTCTTGGGACTCCTCCTTTTCTTTCCTTTTTTCTGTTCTCTTTTGGATGTAATGACAGCACTTTC
TTAGTGCTAATTTTGACATCAATAATATTAACCCTTCATAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1563872.2e-0650 (10.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53536)
Chromosome
8
Position
39.96 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53261)
Chromosome
8
Position
87.24 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43855)
Chromosome
8
Position
43.30 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43597)
Chromosome
8
Position
18.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43316)
Chromosome
8
Position
38.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40856)
Chromosome
8
Position
44.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39987)
Chromosome
8
Position
37.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8139)
Chromosome
8
Position
36.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8143)
Chromosome
8
Position
47.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 14009
Forward primer (5'-3')
CTCTCCGGGTGGCTATTACA
Digested band sizes (using AluI)
Solanum pennellii LA716: 150+600
Solanum lycopersicum LA925: 150+250+350
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCTTGGGACTCCTCCTTTTCT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 14009
Forward primer (5'-3')
CTCTCCGGGTGGCTATTACA
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 150+250+350
Solanum pennellii LA716: 150+600
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCTTGGGACTCCTCCTTTTCT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 14130
Forward primer (5'-3')
CTCTCCGGGTGGCTATTACA
Digested band sizes (using AluI)
Solanum pimpinellifolium LA1589: 150+600
Solanum lycopersicum LA925: 150+400
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCTTGGGACTCCTCCTTTTCT
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 101
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 150+250+350
Solanum pennellii LA716: 150+600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG302 was used as an overgo probe on plate 12 [well B8]

Plausible BAC Matches:   P050L21

 Overgo Sequences

A sequence
GGTTGCATTACTCAGTCATTGCAC
B sequence
AATAGCCACCCGGAGAGTGCAATG
AB sequence
GGTTGCATTACTCAGTCATTGCACTCTCCG
Marker sequence
ATGGTTGCATTACTCAGTCATTGCACTCTCCGGGTGGCTATTACATTTTT
GAAAGGAGTAATTATTTCCCGCAAGAGAAGCACTTCCCTTATGTATAGAA
ATCAGTGACGTAAAATTTATAATCAACATAAAACTCTAAAGTTTGGTTCT
GGTGAAGTAACTGGAGTTAAATAATCCTACTAACACTCATATCAGAGGGT
TGGCTCCAAACAAATTTCTCGGTCATGAAAAACACCCATATAAGAGAAAG
AATAGACATCCTTATTTTTGGGGAAGGATTTTGGTTCCTATCAGTGAAAT
TTGGAATCATAGTTATAAGATGAAAAAAATGAGTGGAAAATTACTTATTA
AAAAAGAAAACAGGGGTGATACCAGCTTAGATGGATCGATTTAAGTGCTA
TAAGATGTAGAAGTATTTGCAAGGTGAAAGGACTCTCCCGCGAATTTATT
AAAATAAATTTACATTTATTGGTCACAA
Genomic location of TG302  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D111 marker 111
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)