SGN Marker TG303

SGN-M112

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG303 image not available
Forward sequence
CTCTACTGTGATTTCTCTGGACAACATTCTTCATATTCCTAATGAGTATTTGTCATCAGTAGTAACATTACTTAAATATGAACTAGACTT
TGTTACTATTACATTGGAAAAATTCTTTATCCTGATTCATTGGGTAGTGTATGCTCATTGGGCCAGAGAACTACCCTTGTTATTAATAAC
TTTTTGATAGGTTAAGATTGTATGGTTCATAGTTGTAGATCAAATCATTCTTCCAGCGATTTGTGATTACAGCATAAAAGGACTTTGTTA
GTGCAATGACAGGGGAGAAATCAGTTTCAAACGAATATATGCTAATCTTAGAATGAATTCTATGCATGCTAGATATTGCCATTTGGCTTT
CAACTTTTATCTGTATTATCCTAGTCCCAAGGACCTTATTTGGCACTTTTGGATTACTGTGATGAGGCTGAATAATTGTTTTCTCATGCC
ACAGTTTGGTA
Reverse sequence
ACAGAGAGGGAAAGAAGTTTGAAACGAGCTAATAATTATGGATTACGTAAAGGGTTGTTCTTGTGCTTTTCTCTCATTTTCTTTGATGAT
GTAATAGAACAGTCGTCACTGGTGAGGTGAACAGTAGGAGGATCAGCTTATAGCTTCTCATCAGAAAAGCATGAGCTTTCTGAAACATTT
ATTGCAGCTTCATTTTGTAAGCAAATCAATGTCAAAATCATTTTCCAAAATTAAAATGTGAACATCATATATTAGAAATTGGAAAGCATT
ATCCTGCCTCCCTATTGTGTGCTGTGTCTGAACTAATTCCAAGATTCCGCACCCTTACGGGGCAAGAACACTGAGAAGAAAAGGTCAATA
CCTGATAAAATAGTTGGCAACATGTTGACTCACTTGGATTGCATCCTCGGTATGTGGAATCTGTGATGAACCCCACTCGAAAACATTTTT
CTGCAATTACCATGACGAAGTAATGCAGTTAAATTTCAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1486853.6e-4591 (18.6% of RFLP seq)-
SGN-U1623813.6e-4591 (18.6% of RFLP seq)-
SGN-U148684452 (92.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53537)
Chromosome
10
Position
3.29 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53262)
Chromosome
10
Position
38.23 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42437)
Chromosome
4
Position
34.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39988)
Chromosome
10
Position
11.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8145)
Chromosome
4
Position
13.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8144)
Chromosome
10
Position
12.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8149)
Chromosome
10
Position
1.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Other PCR data 
PCR data   Exp. ID 35630
Forward primer (5'-3')
CGTAAAGGGTTGTTCTTGTGC
Digested band sizes (using AluI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 280
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTTCGAGTGGGGTTCAT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 124
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 280
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG303 was used as an overgo probe on plate 5 [well F8]

Plausible BAC Matches:   P271H20,   P181J06,   P238O17,   P236O14,   P211C19,   P015N06,   P135C12,   P155M08,   P222H10,   P183L16,   P101H06,   P280N23,   P302B09

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCTGATTCATTGGGTAGTGTATGC
B sequence
TTCTCTGGCCCAATGAGCATACAC
AB sequence
CCTGATTCATTGGGTAGTGTATGCTCATTG
Marker sequence
CTCTACTGTGATTTCTCTGGACAACATTCTTCATATTCCTAATGAGTATT
TGTCATCAGTAGTAACATTACTTAAATATGAACTAGACTTTGTTACTATT
ACATTGGAAAAATTCTTTATCCTGATTCATTGGGTAGTGTATGCTCATTG
GGCCAGAGAACTACCCTTGTTATTAATAACTTTTTGATAGGTTAAGATTG
TATGGTTCATAGTTGTAGATCAAATCATTCTTCCAGCGATTTGTGATTAC
AGCATAAAAGGACTTTGTTAGTGCAATGACAGGGGAGAAATCAGTTTCAA
ACGAATATATGCTAATCTTAGAATGAATTCTATGCATGCTAGATATTGCC
ATTTGGCTTTCAACTTTTATCTGTATTATCCTAGTCCCAAGGACCTTATT
TGGCACTTTTGGATTACTGTGATGAGGCTGAATAATTGTTTTCTCATGCC
ACAGTTTGGTA
Genomic location of TG303  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D112 marker 112
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)