SGN Marker SSR448

SGN-M1121

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 60 High: 53
Repeat motif: CT   Repeat number: 14
Repeat motif:    Repeat number:
Forward primer: GAATGACCATCAGTACGGC
Reverse primer: CTGTGCTCCTCTATGCCCTC
Predicted size: 163
Derivations 
This marker was derived from EST read SGN-E11841
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39246)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32033
Forward primer (5'-3')
GAATGACCATCAGTACGGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTGTGCTCCTCTATGCCCTC
Enzymes
  
Accessions and product sizes
Approximate temperature
53°C
  
Overgo hybridization and physical mapping 
SSR448 was used as an overgo probe on plate 10 [well D6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAGAAGAAAACGAGGGCATAGAG
B sequence
GTTTCTCTCTGTGCTCCTCTATGC
AB sequence
GGAGAAGAAAACGAGGGCATAGAGGAGCAC
Marker sequence
GAATGACCATCAGTACGGCCTCTCTCTCTCTCTCTCTCTCTCTCTCTGTG
TATCTCTCTCACTCACTCGCGGTGACTCACTCGCACGCGCGCGCTAAAAA
GCGAGGACAGGAGCGCGGGCTAAAAAAAAGGGGAGAAGAAAACGAGGGCA
TAGAGGAGCACAGAGAGAAACACCAACACACTCACAAAAAGACACAGAAA
AAGAGCCGGAAAAAGAAAGAGAAAAGCCGGAGGAGACTAAAAAAGGAACT
CCCAGGCAGGGAAAAAAGCTTGCGCACAAGAAGCGCACCCAATCGCAAGC
GATGGTATACAGACCAACACCCAAACAAGGAAACCGACCAACTAACGAAA
CCCCGAAAAGAAGCCAAGACCCATTGGAACGGCGAAAGAACAACGCGGGC
CGGGCAGACTTACAAACACGAAAATGGGCATGAAACCGGGGAAAGGAACC
TGTAAGAACCACATGAGGACCAATGAAAAAGACCCAAAACGGCGCCCACA
AGGTCATGAGCGATACCTCCACCATGATGCAAAGAAGGGAAGGCCCCCTG
AAAAAAGAAAACTGAACAAAACACAAACAGGCATTACCCACAAGGGGGGA
AAAAAAGGGACCCCCCCTTCGGGGCAAGGGAATACGAACCGACAAAAACC
AAGATCCCACAGGGGAAAGAAAAATGCAAAACCCAAACAAAGACGGTAAA
AAAACCGATTAAGTCTGAAGAAAAGTGGGCTAAAGAAGCCCCCCCCACCG
AAAGGAACCACCCCACGAAAATGCCCTAAAAGCACAATAAAAAACGACTG
GATCAGAACATGCAAAGGAAAAGACAAAACACGGAATGTAGTAGGGTGGT
ATGAAAAACAAAATGACTTTCCTNCTTCGNCTGTGGACACCAACAAATAA
CAAAAGAAG
Genomic location of SSR448  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1121 marker 1121
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)