Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker SSR450

SGN-M1123

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: AAT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: AATGAAGAACCATTCCGCAC
Reverse primer: ACATGAGCCCAATGAACCTC
Predicted size: 265
Derivations 
This marker was derived from EST read SGN-E11770
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 52841)
Chromosome
4
Position
37.34 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43809)
Chromosome
4
Position
55.60 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44821
Forward primer (5'-3')
AATGAAGAACCATTCCGCAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACATGAGCCCAATGAACCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43269)
Chromosome
4
Position
53.20 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44635
Forward primer (5'-3')
AATGAAGAACCATTCCGCAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACATGAGCCCAATGAACCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40800)
Chromosome
4
Position
48.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39248)
Chromosome
4
Position
54.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 60
Forward primer (5'-3')
AATGAAGAACCATTCCGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATGAGCCCAATGAACCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 265+265
Solanum pennellii LA716: 255+265
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR450 was used as an overgo probe on plate 9 [well F5]

Plausible BAC Matches:   P290H03

 Non-Plausible BAC matches

P290I04,   P304N17,   P290P12

 Overgo Sequences

A sequence
ACGCTGCAATCTACTGACATTCCC
B sequence
AGCCAGAGAGTAGAGTGGGAATGT
AB sequence
ACGCTGCAATCTACTGACATTCCCACTCTA
Marker sequence
GCCATGGATGACGCTATGCACTGCTTTTTTTTTTTTTTTTTTTATAGCTA
TAAAAGTGAACTTCATTACATTACAATGACCTTATGATGGTAAATGAAGA
ACCATTCCGCACGTACATATATATTACGTACCAACACCACTCCTCTAGTT
TTATAATATTACAAAATATAACAAAAAAAGGTGACGATACAATAATAATA
ATAATAATAATGATAATATATAGTTTAAAACAGCACACTCAAAATGAAGC
AAGACACAAATAAATGATAAAATGTTGAAACGTTGAGGAGAATTAATTAA
TTAATTAGGTCCTAGAGTCCAAAGCCATAATGGTGCTGAGGTTCATTGGG
CTCATGTACTGGGAAGAACCAGTCAATATCTGCTGAACAATGATCCTATT
TGCCCTTTCAGATGGATGGAATGGATCCCAAAATGCATATATGTCCCTGT
TTGGACACAAGTTTGATAATGGTGTACATAGCCCTATTCCATTGTACGGT
CCTTGTCCACAACATGCTATTTTTGATGTCACAAATCCATAAGCTTGAGG
ATTAGATACAAAATCCATGTTCATAGTATATGTGTTAGCAGCAATAAATA
CATTAGCACCCAATTGTGATATGAGATCAGCCCCACATTGAGTCAATTGA
GGGGTTGATAAAGCAGCTGCACGCTGCAATCTACTGACATTCCCACTCTA
CTCTCTGGCTATTTGCTGACACAACTATTGCAGACTTGACTATACCTCTT
CTCCAATATACACTNTGATATTTCTGCTAAGATAGAAACACTATCGTGGG
AATTGTGCTGCAGAAGACCATATGTTACAGCCTTCCCAAGGGGAGAAGCT
GTCCCTGCGTGTGCATACCCTCCCCTGATTAGCCACGTCCCTATATAAAG
GCGGTAGCACCCAGAGGNCCNNNNNCCCCCATCCTCCTCCGTGGGGTGGG
GAGAG
Genomic location of SSR450  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1123 marker 1123
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)